Proteínas de micronema 1 e 4 de Toxoplasma gondii reconhecem N

Transcrição

UNIVERSIDADE DE SÃO PAULO
FACULDADE DE MEDICINA DE RIBEIRÃO PRETO
PROGRAMA DE PÓS-GRADUAÇÃO EM IMUNOLOGIA BÁSICA E APLICADA
Aline Sardinha da Silva
Proteínas de micronema 1 e 4 de Toxoplasma gondii
reconhecem N-glicanas de TLRs: a interação
desencadeia a resposta inicial de defesa contra o
parasito
Ribeirão Preto
2016
ALINE SARDINHA DA SILVA
Proteínas de micronema 1 e 4 de Toxoplasma gondii
reconhecem N-glicanas de TLRs: a interação
desencadeia a resposta inicial de defesa contra o
parasito
Tese apresentada ao programa de Pós-Graduação em
Imunologia Básica e Aplicada da Faculdade de Medicina
de Ribeirão Preto da Universidade de São Paulo, como
requisito para a obtenção do título de Doutora em
Ciências – área de concentração: Imunologia Básica e
Aplicada.
Orientadora: Profª. Dra. Maria Cristina Roque Barreira
Ribeirão Preto
2016
AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE
TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA
FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE.
Catalogação da Publicação
Serviço de Documentação
Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo
FICHA CATALOGRÁFICA
Sardinha-Silva, Aline
Proteínas de micronema 1 e 4 de Toxoplasma gondii reconhecem N-glicanas de
TLRs: a interação desencadeia a resposta inicial de defesa contra o parasito
Ribeirão Preto, 2016.
141p. : il.; 30cm.
Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto/USP –
Área de concentração: Imunologia Básica e Aplicada
FOLHA DE
APROVAÇÃO
1.Toxoplasma gondii. 2. Proteínas
de micronema.
3. Receptores do tipo toll. 4.
Imunidade inata. 5. Reconhecimento de carboidrato.
Aline Sardinha da Silva
Proteínas de micronema 1 e 4 de Toxoplasma gondii reconhecem N-glicanas de TLRs: a
interação desencadeia a resposta inicial de defesa contra o parasito
Tese de doutorado apresentada à Faculdade de Medicina de
Ribeirão Preto da Universidade de São Paulo para obtenção
do título de doutora em Ciências – Área de concentração:
Imunologia Básica e Aplicada.
Aprovada em: _____/_____/_____
Banca Examinadora
Prof. Dr. ______________________________________ Instituição: ___________________
Julgamento: _____________________ Assinatura: _________________________________
Trabalho realizado nos Laboratórios:
- Imunoquímica e Glicobiologia do Departamento de Biologia Celular e Molecular da
Faculdade de Medicina de Ribeirão Preto – Universidade de São Paulo. Ribeirão Preto, SP.
- Immunobiology Section, Laboratory of Parasitic Diseases, National Institure of Allergy and
Infectious Diseases – National Institutes of Health. Bethesda, MD, USA.
- Molecular Parasitology Section, Laboratory of Parasitic Diseases, National Institure of
Allergy and Infectious Diseases – National Institutes of Health. Bethesda, MD, USA.
Apoio Financeiro: CAPES, CNPq e FAPESP
AGRADECIMENTOS
Aos meus queridos pais, Adilson e Valdete, que independente das minhas escolhas
dedicaram esforços e apoiaram integralmente meus objetivos pessoais e profissionais para
que eu obtivesse sucesso. Obrigada por todo carinho. Agradeço ainda minhas queridas irmãs
Miriam e Daniela, e minha querida Avó Angelina, pelo apoio e por se fazerem sempre
presentes.
À querida Professora Dra. Maria Cristina Roque Barreira, minha mãezinha científica,
pela confiança depositada em meu trabalho e por garantir sempre as melhores condições para
o desenvolvimento desta pesquisa. Agradeço ainda pelas lições de responsabilidade,
ensinamentos, dedicação, por todo apoio e pelo carinho com que sempre me atendeu.
Obrigada pela agradável convivência e por contribuir intensamente para a minha formação
acadêmica durante esses seis anos! Sentirei saudade da doce glycofamily!
À Dra. Camila Figueiredo Pinzan (Camilinha), por sempre me ajudar com os
experimentos, pelo seu tempo disponibilizado, seu apoio e sua dedicação. Suas sugestões e
nossas discussões foram essenciais para a realização desse trabalho.
À Dra. Dominique Soldati-Favre e ao Dr. Damien Jacot pela gentil doação dos
parasitos simples nocaute, e pela geração dos parasitos duplo-nocautes, essenciais para o
desenvolvimento deste trabalho.
À querida Dra. Dragana Jankovic (Dragana) e ao Dr. Alan Sher pela importante
colaboração com os experimentos de infecção in vitro em células TLR11/TLR12 DKO, pela
oportunidade de estágio, pelos ensinamentos e por toda ajuda e apoio profissional.
Ao colaborador e futuro supervisor Dr. Michael Grigg (Mike) e ao Dr. Asis Khan pela
oportunidade de estágio, pelo acolhimento e pela agradável convivência no laboratório.
Obrigada pelos inúmeros ensinamentos sobre Biologia Molecular em tão pouco tempo, e por
contribuírem para o enriquecimento da minha formação.
Às queridas Iza, Aninha e Wendy, do laboratório do Prof. Dr. Célio Lopes Silva, pelo
pronto auxílio com as constantes dosagens de LPS.
Às queridas irmãs Patrícia (Pati) e Érica (Eriquinha) pela agradável convivência, pela
dedicação ao trabalho técnico, com as questões burocráticas e com tantas outras. Obrigada
por estarem sempre dispostas a me ajudar.
À querida Sandra (Darling) pelo apoio técnico e organização, que facilitam a
funcionalidade do laboratório.
Aos bioteristas Sr. Domingos, Júlio, Dener, Rinaldo e Cristina pela boa disposição em
fornecer e ajudar na manutenção dos animais.
À Ana Cristine, que sempre esteve disposta a ouvir minhas dúvidas e solucionar meus
problemas. Obrigada pela preocupação comigo com respeito às datas, assuntos burocráticos e
documentos, pelas agradáveis conversas e momentos de descontração.
A todos os colegas de pós-graduação dos programas de Imunologia Básica e Aplicada
e Biologia Celular e Molecular e Bioagentes Patogênicos pela agradável convivência.
À querida amiga Dra. Katiuchia Uzzun Sales (Katiu) pelo incentivo profissional,
pessoal e pelas inúmeras discussões sobre Biologia Molecular.
Ao meu noivo Diego, e em breve marido, por estar ao meu lado durante esses cinco
anos, acompanhando e participando de importantes conquistas alcançadas e de outras que
estão por vir. Obrigada pelo apoio emocional, pessoal e profissional, e por se fazer presente
diariamente, mesmo tão longe. Te admiro muito, pessoal e profissionalmente!
Aos meus queridos amigos Fausto Bruno (Faustinho) e Thiago (TT), obrigada pela
paciência, pela amizade, pela agradável convivência, pelos inúmeros momentos de
descontração e auxílios com dúvidas e experimentos. Obrigada por fazerem parte da minha
jornada e tornarem meus dias mais agradáveis!
Aos queridos glycofriends Marcel, Mateus (Peteca), Rafael, Aline Oliveira, Flávia,
Lívia, Fabrício e Relber. Obrigada pela convivência, pelas discussões, pela ajuda com
dúvidas e experimentos.
Aos meus familiares, que apesar da distância sempre se fizeram presentes me
apoiando e torcendo por mim.
A todos que contribuíram direta ou indiretamente para a minha formação e para a
realização desse trabalho, muito obrigada.
À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) pelo
apoio financeiro concedido no início da realização desse trabalho.
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pelo
apoio financeiro concedido durante a realização desse trabalho.
À Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP) pelo apoio
financeiro concedido durante os quase quatro anos de realização desse trabalho (processo
número 2012/12950-0). Gostaria, ainda, de agradecer à FAPESP pelas duas oportunidades de
estágio no exterior (NIAID/NIH), que possibilitaram o aperfeiçoamento desse trabalho.
“Feliz aquele que transfere o que sabe e aprende o que ensina.”
Cora Coralina
Resumo | viii
Resumo
Resumo | ix
SARDINHA-SILVA, A. Proteínas de micronema 1 e 4 de Toxoplasma gondii reconhecem
N-glicanas de TLRs: a interação desencadeia a resposta inicial de defesa contra o
parasito. 2016. 141p. Tese (doutorado) – Faculdade de Medicina de Ribeirão Preto,
Universidade de São Paulo, Ribeirão Preto, 2016.
Toxoplasma gondii infecta as células do hospedeiro de maneira ativa, a partir de um
processo que envolve necessariamente a liberação de lectinas, denominadas proteínas de
micronema (MIC), provenientes de organelas intracelulares. TgMIC1, TgMIC4 e TgMIC6
formam um complexo na superfície de T. gondii, que permite a adesão do parasito à célula
hospedeira, via reconhecimento de carboidratos, uma vez que TgMIC1 liga-se à ácido siálico
terminal e TgMIC4 à galactose terminal. Nosso objetivo foi avaliar a interação proteínacarboidrato entre TgMIC1/TgMIC4 e N-glicanas de TLRs extracelulares, bem como o papel
dessas proteínas de micronema durante a infecção por T. gondii. Observamos que TgMIC1 e
TgMIC4 induzem a produção de citocinas pró-inflamatórias, especialmente IL-12, por células
dendríticas e macrófagos provenientes de camundongos C57BL/6. A secreção dessas
citocinas foi induzida em níveis similares aos desencadeados por agonistas de TLRs,
enquanto que, quando utilizamos macrófagos nocauteados para MyD88, TRIF, TLR2, TLR4
ou ambos os receptores (duplo nocaute TLR2/TLR4), as proteínas de micronema 1 e 4
induziram produção de níveis menores de IL-12, comparado à células do tipo selvagem (wild
type; WT). Fato similar não foi observado quando estimulamos macrófagos DKO
TLR11/TLR12. Além disso, verificamos que essa ativação foi dependente do reconhecimento
de carboidrato, uma vez que duas mutações pontuais no domínio de reconhecimento de
carboidrato (CRD) de TgMIC1, e uma mutação pontual no CRD de TgMIC4, prejudicaram a
capacidade dessas lectinas em induzir a produção de IL-12 por células dendríticas e
macrófagos WT. Verificamos que durante as primeiras horas de infecção com T. gondii, a
ausência, concomitante, de TLR2 e TLR4 resultou em menor produção de IL-12 por células
dendríticas, enquanto que a falta de TLR11/TLR12 não afetou a secreção dessa citocina.
Ademais, a infecção de macrófagos e células dendríticas selvagens com parasitos
nocauteados para TgMIC1 ou ambas as proteínas (duplo nocaute TgMIC1/TgMIC4) resultou
em prejuízo na ativação celular mesmo após 48 horas, já que houve menor produção de IL-12
do que a determinada pela infecção com parasitos WT. Finalmente, durante a infecção in
vivo, TgMIC1 mostrou-se importante para a indução da produção de IL-12 sistêmica, nas
Resumo | x
primeiras 6 horas de infecção. Uma vez que a diminuição da produção de IL-12 foi observada
na fase inicial de infecção, concluímos que TgMIC1 e TgMIC4 desencadeiam a resposta
imune inicial a T. gondii, a partir do reconhecimento das N-glicanas de TLR2 e TLR4. Em
conjunto, os resultados indicam que as interações estabelecidas por proteínas de micronema
de T. gondii com receptores do tipo Toll resultam em ativação da célula hospedeira e exercem
um papel relevante na infecção pelo parasito.
Palavras-chave: Toxoplasma gondii, proteínas de micronema, receptores do tipo toll,
imunidade inata, reconhecimento de carboidrato.
Abstract | xi
Abstract
Abstract | xii
SARDINHA-SILVA, A. Toxoplasma gondii microneme proteins 1 and 4 recognize TLRs
N-glycans: the interaction triggers the initial immune response to the protozoan. 2016.
141p. Tese (doutorado) – Faculdade de Medicina de Ribeirão Preto, Universidade de São
Paulo, Ribeirão Preto, 2016.
Toxoplasma gondii infects host cells through an active process, which requires the
release of lectins, named microneme proteins (MIC) from intracellular organelles. TgMIC1,
TgMIC4 and TgMIC6 form a complex on
T. gondii surface that allows the parasite’s
adhesion in the host cell, via carbohydrate recognition since TgMIC1 binds to terminal sialic
acid and TgMIC4 binds to terminal galactose. Our aim was to evaluate the proteincarbohydrate interaction between TgMIC1/TgMIC4 with N-glycans of extracellular TLRs,
and the role of these proteins during T. gondii initial infection. We observed that TgMIC1
and TgMIC4 induce proinflammatory cytokine production, especially IL-12, by dendritic
cells and macrophages from C57BL/6 mice. The secretion of these cytokines was induced in
similar levels to those triggered by TLRs agonists, whereas when we used MyD88, TRIF,
TLR2, TLR4 or double knockout (DKO TLR2/TLR4) macrophages, the microneme proteins
1 and 4 induced production of lower levels of IL-12 compared to those of wild type cells. We
did not observe difference when we stimulated DKO TLR11/TLR12 macrophages.
Furthermore, we found that this activation was dependent on carbohydrate recognition, since
two pontual mutations on the carbohydrate recognition domain (CRD) of TgMIC1, and one
mutation on TgMIC4 CRD impaired the ability of these lectins to induce IL-12 production by
wild type dendritic cells and macrophages. We found that during the first hours of T. gondii
infection, the concomitant absence of TLR2 and TLR4 resulted in lower IL-12 production by
dendritic cells, whereas the lack of TLR11 and TLR12 did not affect the secretion of this
cytokine. Moreover, infection of wild type dendritic cells and macrophages with TgMIC1 or
double knockout parasites (DKO TgMIC1/TgMIC4) resulted in impaired cellular activation
even after 48 hours, since IL-12 production was lower compared with wild type parasites
infection. Finally, during in vivo infection TgMIC1 proved to be important for inducing
systemic IL-12 in the first 6 hours of infection. Once we observed decreased IL-12 levels
during the initial phase of the infection, we concluded that TgMIC1 and TgMIC4 trigger the
initial immune response to T. gondii, based on TLR2 and TLR4 N-glycans recognition.
Abstract | xiii
Together, these results indicate that interactions established between microneme proteins and
TLRs result in the host cell activation, and play a key role on the parasite infection.
Keywords: Toxoplasma gondii, microneme proteins, toll-like receptors, innate immunity,
carbohydrate recognition.
Lista de abreviaturas | xiv
Lista de Abreviaturas
Lista de abreviaturas | xv
ArtinM: lectina de semente de jaca (Artocarpus integrifolia). Ligante de manose
B6: C57BL/6
BCA: Bicinchoninic acid assay
BMDM: “Bone marrow derived macrophages” – Macrófagos derivados de medula óssea
CRD: Carbohidrato
DAPI: “4’ 6-diamino-2 phenyilindol”
DKO: Geneticamente deficiente para os receptores tipo toll 2 e 4
DNA: Ácido desoxirribonucleico
DO: Densidade óptica
EGF: Fator de crescimento semelhante ao epidermal
GAL: “Galactose adherence lectin” – lectina de aderência à galactose
GM-CSF: “Granulocyte macrophage colony stimulating factor” – fator estimulador de
crescimento de colônias de granulócitos e monócitos (macrófagos e células dendríticas)
GPI: “Glycophosphatidylinositol” - glicofosfatidilinositol
HEK293: “Human Embryonic Kidney 293 cells” – células embrionárias de rim humano 293
IFN-γ: Interferon gama
IL-10: Interleucina 10
IL-12p40: Subunidade p40 da Interleucina 12
IL-1β: Interleucina 1 beta
IPTG: “Isopropyl-β-D-thiogalactoside”
kDa: Quilodálton
LCCM: “L-cell conditioned media”
LPS: Lipopolissacarídeo
MAR: Repeticão adesiva de micronema
MAR1: Repeticão adesiva 1
MAR2: Repeticão adesiva 2
MCP-1: “Monocyte chemotractant protein 1” – proteína quimioatraente de monócitos 1
Lista de abreviaturas | xvi
M-CSF: “Monocyte colony stimulating factor” – fator estimulador de crescimento de
colônias de monócitos
MIC: Proteínas de micronema
mRNA: Ácido ribonucleico RNA mensageiro
MyD88: “Myeloid differentiation primary response gene 88”
NK: Células “natural killer”
NKκB: “Nuclear factor kappa-light-chain-enhancer of activated B cells”
NO: Óxido nítrico
NT: Amino terminal
PAMP: “Pathogen associated molecular patterns” – padrões moleculares associados a
patógenos
PBS: “phosphate buffered saline” – solução salina de fosfato tamponada
PBS-T: salina de fosfato tamponada com 0,05% de tween 20
PCR: “Polymerase chain reaction” – reação em cadeia da polimerase
PGN: Proteoglicano
PHA-L: “Phytohaemagglutinin-L”. Ligante de galactose, N-acetil glucosamina e manose
PNA: “Peanut agglutinin”. Ligante de galactose
PRR: “Pattern recognition receptor” – receptor de reconhecimento de padrões
RNA: àcido ribonucleico
RPM: Rotações por minuto
rTgMIC1: Proteína de micronema de Toxoplasma gondii 1 recombnante
rTgMIC4: Proteína de micronema de Toxoplasma gondii 4 recombnante
SBA: “Soybean agglutinin”. Ligante de N-acetilgalactosamina
SBF: Soro bovino fetal
SDS: “Sodium dodecyl sulfate” – dodecil sulfato de sódio
SDS-PAGE: “Sodium dodecyl sulfate polyacrylamide gel electrophoresis” – gel de
eletroforese de dodecil sulfato de sódio
SP-A: Proteína surfactante A
STAg: Antígeno solúvel de Toxoplasma gondii
T. gondii: Toxoplasma gondii
TgMIC1: Proteína de micronema de Toxoplasma gondii 1
TgMIC1/4: Proteína de micronema de Toxoplasma gondii 1 e 4
Lista de abreviaturas | xvii
Th1: T “helper” 1
TLR: “Toll like receptor” – receptor do tipo toll
TLR11: Receptor do tipo toll 11
TLR11-/-: Geneticamente deficiente para o receptor do tipo toll 11
TLR11-/-/TLR12-/-: Geneticamente deficiente para os receptores do tipo toll 11 e 12
TLR2-/-/TLR4-/-: Geneticamente deficiente para os receptores do tipo toll 2 e 4
TMB: Tetrametil benzidina
TNF-α: Fator de necrose tumoral alfa
Tregs: Células T reguladoras
WGA: “wheat germ agglutinin”. Ligante de N-acetil glucosamina / ácido siálico
WT: “Wild type” – tipo selvagem
18
SUMÁRIO
Resumo .................................................................................................................. viii
Abstract ................................................................................................................... xi
Lista de Abreviaturas ............................................................................................ xiv
Introdução .............................................................................................................. 20
1. Aspectos gerais .................................................................................................... 21
2. Atividade lectínica do complexo TgMIC1/MIC4 ..................................................... 24
3. Imunidade ao parasito........................................................................................... 25
4. Alguns aspectos sobre a ativação da resposta imune por receptores do tipo Toll 26
Objetivos ................................................................................................................ 29
Objetivo Geral ........................................................................................................... 30
Objetivos Específicos ................................................................................................ 30
Material e Métodos ................................................................................................ 31
1. Declaração de ética e experimentação animal ..................................................... 32
2. Camundongos....................................................................................................... 32
3. Manutenção in vitro da cepa RH de Toxoplasma gondii ....................................... 32
4. Transformação das cepas DH5α e BL21 Codon Plus RIPL de E. coli .................. 32
5. Expressão de TgMIC1 e TgMIC4 recombinantes ................................................. 33
6. Purificação de TgMIC1 e TgMIC4 recombinantes ................................................ 34
7. Refolding de TgMIC1 e TgMIC4 recombinantes ................................................... 34
8. Ensaio de atividade e inibição de TgMIC1 e TgMIC4 ........................................... 35
9. Obtenção e cultura de macrófagos e células dendríticas derivados de medula
óssea (BMDMs e BMDCs) ........................................................................................ 35
10. Avaliação da produção de citocinas por células dendríticas e macrófagos após o
estímulo com as TgMICs .......................................................................................... 36
11. Transfecção de células HEK293T e avaliação da produção de IL-8 após o
estímulo com as TgMICs .......................................................................................... 36
12. Pull-down ............................................................................................................ 36
13. Infecção in vitro de células dendríticas e macrófagos derivados da medula óssea
.................................................................................................................................. 37
14. Infecção in vivo de camundongos wt com Toxoplasma gondii............................ 37
15. Clonagem de TgMIC1 e TgMIC4 em SagCatSagTub-GFP e pLUC-GFP ........... 38
19
16. Transfecção de Toxoplasma gondii .................................................................... 39
17. Análise da expressão de antígenos de superfície de T. gondii por citometria de
fluxo .......................................................................................................................... 39
18. Análise estatística ............................................................................................... 40
Resultados .............................................................................................................. 41
1. Expressão e purificação de TgMIC1 e TgMIC4 .................................................... 42
2. Atividade lectínica de TgMIC1 e TgMIC4 .............................................................. 43
3. TgMIC1 e TgMIC4 induzem ativação de células da imunidade inata ................... 44
4. A ativação de células da imunidade inata por TgMIC1 e TgMIC4 é dependente de
receptores do tipo toll 2 e 4 ....................................................................................... 45
5. A ativação de células da imunidade inata por TgMIC1 e TgMIC4 via TLRs é
dependente do reconhecimento de carboidratos ...................................................... 50
6. A produção inicial de IL-12 durante a infecção por T. gondii é dependente de TLR2
e TLR4, mas não de TLR11 e TLR12. ...................................................................... 51
7. TgMIC1 parece ser a responsável pela indução inicial de IL-12 durante a infecção
in vitro por T. gondii .................................................................................................. 52
8. TgMIC1 parece contribuir para a indução inicial de IL-12 sistêmica durante a
infecção in vivo com T. gondii ................................................................................... 54
9. Geração de parasitos transgênicos para expressão de TgMIC1 e TgMIC4 mutadas
.................................................................................................................................. 56
Discussão................................................................................................................ 61
Conclusões ............................................................................................................. 70
Referências Bibliográficas ..................................................................................... 72
Anexo I ................................................................................................................... 79
Anexo II ............................................................................................................... 110
Anexo III .............................................................................................................. 129
Introdução | 20
Introdução
Introdução | 21
1. Aspectos gerais
A toxoplasmose é causada pelo protozoário Toxoplasma gondii, membro coccídeo do
filo Apicomplexa, altamente prevalente pelo mundo, capaz de infectar cronicamente uma
variedade de hospedeiros vertebrados, especialmente aves, mamíferos marinhos e terrestres.
Infecta aproximadamente um terço da população humana mundial (Dubey, 2009). Apesar do
grande número de indivíduos infectados, a prevalência do parasito pode variar entre 10% a 80%,
dependendo da localidade e dos status econômico, cultural e de saúde da população (Tenter et
al., 2000; Montoya e Rosso 2005; Wasmuth et al., 2012; Macêdo et al., 2013). Em regiões
endêmicas, com destaque para o Brasil, cerca de 50 a 80% da população já foi exposta à
infecção por T. gondii ao menos uma vez, sendo que casos de múltiplas exposições a diferentes
cepas são comuns (Jensen et al., 2015). As manifestações clínicas da toxoplasmose em
indivíduos saudáveis podem variar ser assintomáticas ou causar apenas sintomas semelhantes
aos de uma gripe. Entretanto, acometimento
grave pode ocorrer em
indivíduos
imunocomprometidos, especialmente naqueles afetados pela síndrome da imunodeficiência
adquirida (AIDS), e em fetos em desenvolvimento; nessas populações a toxoplasmose pode ser
fatal (Jung et al., 2004). A toxoplasmose congênita pode levar à cegueira por coriorretinite e
cursar com linfadenite, encefalite, retardo mental e até mesmo levar a morte (Suzuki et al., 1989;
Luft e Remington, 1992; Jung et al., 2004).
A variedade de hospedeiros infectados, bem como a diversidade de células invadidas, faz
com que haja grande interesse na identificação dos ligantes e receptores envolvidos no processo
de adesão e invasão por T. gondii. Sugere-se que o parasito se valha de um ou mais tipos de
receptores comuns a diferentes células hospedeiras ou de múltiplos receptores potencialmente
presentes nessas células (Blumenschein et al., 2007).
As espécies incluídas no filo Apicomplexa fazem uso de um modo particular para entrar
na célula hospedeira. Movimentam-se vigorosamente contra a célula, forçando a sua entrada na
membrana celular. A invasão por T. gondii ocorre em três etapas distintas: (1) adesão, que se
inicia pelo contato do taquizoíta com a membrana da célula do hospedeiro; (2) reconhecimento,
que se inicia com um movimento denominado gliding, que é seguido de disposição
perpendicular da região do conóide em relação à membrana celular do hospedeiro; (3)
penetração, que culmina com a formação do vacúolo parasitóforo, já no interior da célula
hospedeira (Dobrowolski e Sibley, 1997).
A passagem de uma etapa a outra é rápida e finamente regulada. Ela requer liberação
sequencial de proteínas de várias organelas do parasito - micronemas, roptrias e grânulos densos
– que são fundamentais para o processo de adesão e invasão do mesmo (figura 1) (Carruthers e
Introdução | 22
Sibley, 1997). Micronemas são organelas secretoras em forma de hastes, localizadas na parte
anterior do parasito; liberam proteínas essenciais para a adesão e o movimento de gliding,
utilizados para invadir a célula hospedeira (Ajioka et al., 2001; Kucera et al., 2010). As roptrias,
8 a 10 organelas em forma de clava, estão entre a extremidade anterior e o núcleo, apresentam
um estreitamento na parte que fica no interior do conóide. Essas proteínas são importantes na
invasão; compõem a membrana do vacúolo parasitóforo, além de serem encontradas no
citoplasma da célula hospedeira, atuando como quinases que regulam a cascata de sinalização
intracelular de macrófagos (Ajioka et al., 2001; Denkers et al., 2011). Por fim, os grânulos
densos são estruturas esféricas, dispersas no taquizoíta, que liberam proteínas logo após a
formação do vacúolo parasitóforo; atuam modificando o ambiente local e permitindo a
sobrevivência e replicação do parasito dentro da célula hospedeira. (Dubey et al., 1998; Ajioka
et al., 2001).
Figura 1. Região Apical de Toxoplasma gondii. O conóide (B) define a extremidade apical (A) e está
envolvido na penetração da célula do hospedeiro. As micronemas (C) liberam proteínas essenciais para a
adesão do parasita à célula e o movimento de gliding. As proteínas de roptria (D) são liberadas no
momento da invasão. Os grânulos densos (E) liberam proteínas após a formação do vacúolo parasitóforo
(Figura adaptada de Ajioka et al., 2001).
As proteínas de micronemas são as primeiras liberadas pelo taquizoíta no processo de
invasão (Carruthers et al., 1997); estabelecem uma conexão direta com o sistema actina-miosina
do citoesqueleto do parasito (Jewett e Sibley, 2003) e, dessa maneira, viabilizam sua motilidade
(Soldati e Meissner, 2004).
A primeira proteína de micronema a ser identificada em T. gondii foi TgMIC1, que
participa da adesão celular (Fourmaux et al., 1996). TgMIC1 é uma proteína de 49 KDa, solúvel,
multifuncional, capaz de se ligar a receptores das células do hospedeiro. Na superfície do
parasito, apresenta-se complexada com outras duas proteínas de micronema, TgMIC4 e TgMIC6
(Brencht et al., 2001, Reiss et al., 2001); o subcomplexo TgMIC1/MIC4 corresponde à estrutura
que irá interagir com a célula hospedeira (figura 2). TgMIC1 é essencial para o transporte de
Introdução | 23
TgMIC4 e de TgMIC6 através das primeiras vias secretórias (Retículo Endoplasmático e
Aparelho de Golgi), o que torna possível a liberação do complexo na superfície do parasito
(Reiss et al., 2001; Saouros et al., 2005). O complexo macromolecular é formado pela
associação da região β-finger de TgMIC1 ao segundo domínio apple de TgMIC4, podendo
existir formas homotriméricas de TgMIC1, ou formas hetero-hexaméricas, decorrentes da
associação de TgMIC1 e TgMIC4 (figura 3) (Marchant, et al., 2012). TgMIC1 associa-se ainda
a TgMIC6, através de sua porção C-terminal (Friedrich et al., 2010).
TgMIC4 interage com células hospedeiras; é uma proteína solúvel, adesiva, de 60 KDa,
apresenta 6 domínios apple (A) conservados, expostos extracelularmente (figura 2) (Brencht et
al., 2001). Marchant e colaboradores (2012) verificaram que o quinto domínio apple de TgMIC4
é essencial para a interação com glicanos, mais especificamente com aqueles que têm galactose
como resíduo em posição terminal (figura 2).
Figura 2. Interação do subcomplexo TgMIC1/MIC4 com a célula hospedeira. (A) A formação do
subcomplexo TgMIC1/MIC4 decorre da interação do segundo domínio apple de TgMIC4 (A2) com o
primeiro domínio de repetição adesiva de TgMIC1 (MAR1). TgMIC4 interage com a célula hospedeira
através de seu quinto domínio apple (A5), reconhecendo β-galactosídeos (I). TgMIC1 interage com a
célula hospedeira através de seus domínios de repetição adesiva (MAR1 e 2), reconhecendo gicanas
sialiladas (II). (B) Forma trimérica de TgMIC1 (região superior), com a presença da região β-finger que
interage com domínio apple 2 de TgMIC4. Associação entre TgMIC1 e TgMIC4 resulta na formação do
hetero-hexâmero (região inferior). Regiões de interação com ácido siálico (amarelo) e galactose (azul)
estão representadas. (Figura adaptada de Marchant, et al., 2012).
TgMIC6, uma proteína transmembrana de 34 KDa, através de seu domínio EGF (similar
ao fator de crescimento epidermal) liga-se ao domínio galectina-like de TgMIC1. TgMIC6 não
está diretamente envolvida na adesão à célula hospedeira (Reiss et al., 2001, Marchant et al.,
2012).
Estudos com parasitos geneticamente deficientes de cada uma das três proteínas
revelaram que TgMIC1 proporciona maior força de adesão à célula hospedeira do que TgMIC4.
Introdução | 24
TgMIC1 é capaz de manter a adesividade do parasito mesmo na ausência de expressão das
proteínas TgMIC4 e TgMIC6. Atribui-se à TgMIC6 um papel essencialmente estrutural, de
suporte às duas proteínas adesivas (Saouros et al., 2005).
2. Atividade lectínica do complexo TgMIC1/MIC4
Os primeiros indícios da propriedade de reconhecimento de açúcar do sub complexo
TgMIC1/MIC4 foram proporcionados pela utilização de uma fração denominada Lac+, obtida
do antígeno solúvel total de T. gondii (STAg) por afinidade à coluna de lactose-agarose.
Constatou-se que essa fração é constituída de TgMIC1 e TgMIC4 dotada de propriedade
hemaglutinante, seletivamente inibida por lactose, D-galactose e fetuína. Tal propriedade
lectínica foi atribuída a TgMIC1, constituindo-se na primeira descrição de uma proteína ligante
de carboidrato de T. gondii, propriedade exercida pelo reconhecimento de β-galactosídeos
(Lourenço et al., 2001).
O estudo estrutural detalhado da molécula de TgMIC1 (Blumenschein et al., 2007)
revelou, na porção N-terminal da proteína (TgMIC1-NT), domínios ligantes de ácido siálico,
denominados domínios repetidos de adesão (MAR). Os resíduos de treonina nas posições 126 a
220 de TgMIC1 constituem os aminoácidos responsáveis pela interação com ácido siálico; a
região corresponde, portanto, ao sítio de ligação à célula hospedeira (Saouros et al., 2005;
Blumenschein et. al, 2007; Hager e Carruthers 2008).
Ácido siálico é frequentemente encontrado nas extremidades das glicanas associadas à
glicoproteínas e gangliosídeos, exercendo papel de grande relevância nos processos de adesão
célula-célula (Tolia e Enemark, 2005). Glicoproteínas e glicolipídeos contêm uma variedade
grande de sialo-oligossacarídeos, reconhecidos por lectinas ligantes de ácido siálico.
Oligossacarídeos que possuem dois ou mais ácidos siálicos terminais são melhor reconhecidos.
A região MAR de TgMIC1-NT contém dois sítios ligantes de ácido siálico, MAR1 e MAR2.
Nesses sítios há resíduos conservados e localizados em posições estruturais idênticas, capazes de
estabelecer pontes com oligossacarídeos sialilados. Tais domínios ligam-se com alta afinidade e
especificidade a glicanas sialiladas de células de mamíferos (Blumenschein et al., 2007),
permitindo inferir que essa região contribua para a adesão de T. gondii à célula hospedeira.
Como mencionado, está demonstrado que o subcomplexo TgMIC1/MIC4, exposto na
superfície de T.gondii, interaja com a célula hospedeira. Embora TgMIC4 interaja mais
fracamente com a superfície da célula hospedeira, essa interação se soma à adesão mais forte
Introdução | 25
proporcionada por TgMIC1 (Saouros et al., 2005). Quanto ao reconhecimento de βgalactosídeos por TgMIC4, um estudo liderado por S. Matthews e realizado com a nossa
colaboração, identificou o quinto domínio apple de TgMIC4 como responsável por
reconhecimento de resíduos de galactose (Marchant et al., 2012) (figura 2). As formas
recombinantes de TgMIC1 e de TgMIC4, obtidas por nosso grupo, permitiram investigar, com
maior rigor, a atividade lectínica de cada uma dessas proteínas.
3. Imunidade ao parasito
A resposta imune do hospedeiro à infecção por T. gondii é complexa e envolve
mecanismos celulares e humorais, sendo que a imunidade inata proporciona mecanismos
cruciais no estabelecimento da relação parasito-hospedeiro, atuantes mesmo na montagem da
resposta adaptativa (Neves et al., 2003).
Neutrófilos, e posteriormente macrófagos, migram para o sítio de infecção, onde
secretam uma grande quantidade de citocinas e quimiocinas (Gazzinelli et al., 1996a; Denkers et
al., 2004). Juntamente com outras células, como as dendríticas, cumprem um papel fagocitário
importante. O estímulo por T. gondii desencadeia a produção por neutrófilos de interleucina-12
(IL-12) e do fator de necrose tumoral-alfa (TNF-α) (Scharton-Kersten et al., 1996; Bliss et al.,
1999). A produção de IL-12 é essencial para o desenvolvimento de uma resposta adaptativa Th1,
protetora contra a infecção. Além de neutrófilos, macrófagos ativados e células dendríticas
secretam altas concentrações de IL-12 em resposta ao parasito (Gazzinelli et al., 1993; Reiss et
al., 2001; Fischer et al., 2000). IL-12, por sua vez, estimula macrófagos a sintetizarem mais IL12, por um processo de feedback positivo. IL-12, associada à TNF-α, induz células natural killer
(NK) a produzirem interferon-γ (Hunter et al., 1994). A grande quantidade IFN- liberada no
microambiente estimula macrófagos a produzirem NO (óxido nítrico) e metabólitos reativos de
oxigênio, capacitando-os a promover a de morte intracelular do protozoário (Scharton-Kersten et
al., 1996). Portanto, IL-12, TNF-α e IFN-γ são citocinas críticas na resistência ao T. gondii
(Suzuki et al.,1998; Gazzinelli et al., 1993; Scharton-Kersten et al., 1996).
A produção dessas citocinas, entretanto, deve ser rigorosamente controlada para se evitar
a ocorrência de patologias inflamatórias. A citocina IL-10 é fundamental nesse controle, durante
a infecção por T.gondii. Sabe-se que camundongos knockout para IL-10 sucumbem à infecção
com cinética notavelmente similar aos animais deficientes de IL-12 e IFN-γ, o que demonstra a
sua importância (Gazzinelli et al., 1996b). A morte dos animais desprovidos de IL-10 está
Introdução | 26
associada a baixo número de parasitas e elevados níveis de IL-12, TNF-α e IFN-γ, gerando
intensa inflamação aguda (Gazzinelli et al., 1996b; Suzuki et al., 2000). Acreditava-se que IL-10
era produzida somente por macrófagos, mas hoje se sabe que células Th1 são uma importante
fonte dessa citocina durante infecção por Toxoplasma (Jankovic et al., 2007). Além das células
Th1, as T reguladoras (Tregs) são importantes fontes de IL-10, o que garante a manutenção da
homeostasia da resposta imunológica. Estudos mostraram que células Tregs residuais possuem
uma capacidade alta de suprimir a imunidade na infecção aguda por T. gondii, supressão essa
que resulta do aumento do número de Tregs e da alta produção de IL-10. Essa resposta ocasiona
uma diminuição da proliferação de células T CD4+ ou CD8+, através de um mecanismo
dependente de IL-2 (Tenorio et al., 2011). Por outro lado, a depleção de células Tregs na
infecção por T.gondii em camundongos resistentes gerou aumento na produção de citocinas próinflamatórias e maior carga parasitária (Morampudi et al., 2011).
Curiosamente, dados apresentados neste estudo demonstram que o estímulo in vitro de
células dendríticas e macrófagos derivados de medula óssea de camundongos wild-type (WT)
com TgMIC1 e TgMIC4 recombinantes leva a uma alta produção de IL-12, TNF-α e IL-6. Tal
fato é coerente com demonstrações prévias de que STAg (extrato solúvel de taquizoíta) induz
acentuada produção de IL-12 por células dendríticas (Aliberti et al., 2000; revisto por Aliberti,
Jankovic e Sher 2004) e, o subcomplexo TgMIC1/MIC4 (Lac+) induz a produção de IL-12 e
óxido nítrico por células aderentes provenientes do baço (Lourenço et al., 2001). Dessa forma
sugere-se que, dentre as proteínas contidas no STAg, TgMIC1/MIC4 sejam, pelo menos em
parte, responsáveis pela indução de produção de IL-12 por células dendríticas e macrófagos.
Observações preliminares mostraram que lactose, na concentração de 0,05M, inibe a produção
de IL-12 induzida por Lac+, sugerindo que domínios de reconhecimento de carboidrato de
TgMIC1/MIC4 estejam envolvidos na atividade em foco.
4. Alguns aspectos sobre a ativação da resposta imune por receptores do tipo Toll
Células dendríticas (DCs) e macrófagos são células do sistema imune inato que
proporcionam uma primeira linha de defesa contra diversos microrganismos. Exercem ainda
papel central na apresentação de antígenos a linfócitos T e têm influência sobre a diferenciação
de células Th0 em Th1 ou Th2, durante infecções microbianas (revisto por Gorelik e
Frischmeyer-Guerrerio, 2015). As células da imunidade inata discriminam o que é próprio do
hospedeiro do que é derivado de patógenos, através de PRR (Pattern Recognition Receptors),
Introdução | 27
que reconhecem PAMPs (Pathogen-Associated Molecular Pattern). Os receptores do tipo Toll
(TLR – Toll-like receptors), que são os mais conhecidos PRRs, cumprem papel fundamental no
reconhecimento de PAMPs. Mais de dez tipos de TLRs foram identificados em mamíferos,
dotados de capacidade de reconhecer diferentes grupos de ligantes (Takeda e Akira, 2003;
revisto por Ulevitch, 2004 e Ashour, 2015).
Uma vez estimulados por ligantes microbianos (PAMPs), os TLRs ativam fatores de
transdução gênica, NFκB e IRF3, no caso da via de TLR4, além das vias de proteínas quinases
ativadoras de mitose (MAPK), como ERK1/2, JNK e p38, presentes em fagócitos (Denkers et
al., 2004; Kawai e Akira, 2010). A sinalização intracelular disparada por esses receptores é
complexa, mas, de maneira geral, envolve o recrutamento de uma molécula adaptadora comum,
MyD88, ou ainda MyD88 e TRIF, no caso de TLR4, localizadas no citosol da célula, além da
ativação de outras moléculas, como TRAM, TIRAP/MAL, IRK4, Rip1 e TRAF (Kawai e Akira,
2010). A ativação de moléculas adaptadoras e, posteriormente, de fatores de transcrição
culminam na produção de citocinas pro-inflamatórias, como por exemplo, a IL-12 (O’Neill,
2006; Kawai e Akira, 2010). O principal alvo da ação da IL-12 são os linfócitos T (Th0) que,
por sua vez, proliferam e diferenciam-se em Th1. Estas células são produtoras de citocinas,
especialmente de IFN-γ, citocina crucial para a imunidade adaptativa contra patógenos
intracelulares (revisto por Trinchieri, Pflanz e Kastelein 2003).
Estudos de Weber e colaboradores, 2004, revelaram que TLR2 e TLR4 são glicosilados e
que a glicosilação é necessária para o desempenho de sua função receptora. A importância
funcional das glicanas de TLRs pode ser avaliada por seu alto grau de conservação entre as
espécies. Dentre as quatro glicanas associadas a TLR2, somente uma delas é conservada entre
mamíferos e aves, sendo requerida para a expressão do receptor na membrana celular. As outras
três glicanas exibem grande variabilidade dependente da maturação do TLR2 (Weber et al.,
2004).
Na literatura há diversos relatos de lectinas que se ligam a TLRs (Pluddemann et al.,
2006; Gay e Gangloff, 2007), como GAL (galactose-adherence lectin) de Entamoeba histolytica
(Campbell et al., 2000), SP-A (proteína surfactante A) (Murakami et al., 2002; Yamada et al.,
2006). A lectina GAL está envolvida na aderência de E. histolytica a células do hospedeiro ela
induz um aumento da expressão de TLR2 mRNA em macrófagos (Kammanadiminti et al.,
2004), atua na ativação dessas células, e induz a produção de IL-12 (Campbell et al., 2000). Já a
lectina SP-A, principal constituinte da mistura de lipídeos e proteínas presentes nos alvéolos
Introdução | 28
pulmonares, atua na regulação da resposta imune inata pulmonar (Wright, 2005); SP-A interage
com o ectodomínio de TLR2, o que faz com que sua presença reduza a ligação de TLR2 a
peptideoglicana (PGN) de bactérias gram-positivas. Com isso, há também redução da atividade
NF-kB induzida por PGN, (Murakami et al., 2002). Além disso, diversas lectinas de plantas têm
sido descritas por interagirem com TLRs, atuando como agonistas não convencionais para esses
receptores. É o caso das proteínas PNA (peanut agglutinin) ligante de galactose, SBA (soybean
agglutinin) ligante de N-acetilgalactosamina e PHA-L (phytohaemagglutinin-L) ligante de
galactose, N-acetilglicosamina e manose, capazes de ativar TLR4; ConA (concanavalina A)
ligante de manose, que induz ativação celular via TLR2/6; ArtinM (lectina de semente de jaca)
ligante de manose, que interage com TLR2 e ativa células da imunidade inata; e, finalmente,
WGA (wheat germ agglutinin) ligante de N-acetilglicosamina e ácido siálico, capaz de ativar
todos os TLRs, exceto TLR3 e TLR4 (Unitt e Hornigold 2011; Souza et al., 2013).
A presença de glicanos associados aos tolls extracelulares, como TLR2 e TRL4, motivou
a hipótese, investigada por nós, de que eles correspondam a alvos de reconhecimento por
domínios de reconhecimento de carboidratos (CRD) de proteínas de micronema de T.gondii.
Estudos prévios do nosso grupo demonstraram que TgMIC1 e TgMIC4 induzem ativação e
secreção de IL-8 por células HEK transfectadas com TLR2/1, TLR2/6 e TLR4, em níveis
similares aos observados para os controles positivos (Lopes, 2012; Mendonça, 2014). Além
disso, verificamos que as lectinas TgMIC1 e TgMIC4 estabelecem interações com as N-glicanas
de TLR2, uma vez que células HEK transfectadas com TLR2 contendo mutações deletérias em
um ou mais sítios de N-glicosilação apresentaram prejuízo na ativação induzida pelas MICs
(Mendonça, 2014). A interação TLR-TgMIC e o papel de TgMIC1 e TgMIC4 durante a
infecção pelo parasito foram alvos de estudo desse trabalho, que pretende contribuir para
projetar uma visão mais ampla sobre mecanismos que caracterizam a virulência de T. gondii e
sua relação com a regulação do sistema imune do hospedeiro.
Objetivos | 29
Objetivos
Objetivos | 30
Objetivo Geral
Avaliar se a ativação de células da imunidade inata desencadeada por TgMIC1 e
TgMIC4 é dependente do reconhecimento de carboidrato de N-glicanas dos receptores do tipo
toll, bem como o papel dessas proteínas durante a infecção inicial por T. gondii.
Objetivos Específicos
1. Verificar se TgMIC1 e TgMIC4 são capazes de ativar células dendríticas e macrófagos, e se
essa fenômeno está associado a ativação de MyD88, TRIF, TLR2, TLR4, TLR11 e/ou TLR12.
2. Investigar a influência do reconhecimento de carboidratos pelas TgMICs na ativação de
células dendríticas e macrófagos.
3. Avaliar o papel de TgMIC1 e TgMIC4 durante a infecção in vitro por Toxoplasma gondii, na
ausência de expressão de MyD88, TLR2, TLR4, TLR11, TLR12 e/ou TgMICs.
4. Gerar parasitos transgênicos expressores das formas mutadas de TgMIC1 (T126A/T220A) e
TgMIC4 (K469M), e avaliar se a secreção inicial de IL-12 por células dendríticas e macrófagos,
durante a infecção in vitro por T. gondii, é dependente do reconhecimento de carboidrato das Nglicanas de TLRs.
Material e Métodos | 31
Material e Métodos
1. Declaração de ética e experimentação animal
Todos os experimentos foram desenvolvidos de acordo com os princípios éticos na
pesquisa com animais, adotados pela Sociedade Brasileira para o Laboratório de Ciência Animal
e aprovado pelo Comitê de Ética em Experimentação e Pesquisa Animal (CETEA) da Faculdade
de Medicina de Ribeirão Preto, da Universidade de São Paulo (protocolo número 065/2012).
Foram feitos todos os esforços para minimizar o sofrimento dos animais e o número de
camundongos utilizados em cada experimento.
2. Camundongos
Foram utilizados camundongos fêmeas, isogênicos, C57BL/6 (WT), MyD88-/-, TRIF-/-,
TLR2-/- e TLR4-/-, background C57BL/6, de 8 a 12 semanas, provenientes do biotério de criação
de camundongos transgênicos da Faculdade de Medicina de Ribeirão Preto, USP, e
camundongos DKO TLR2-/-/TLR4-/- (gerados para esse trabalho), background C57BL/6, de 8 a
12 semanas, provenientes do biotério do departamento de Biologia Celular e Molecular e
Bioagentes Patogênicos da FMRP-USP. Além disso, camundongos DKO TLR11-/-/TLR12-/foram criados e cedidos pelo laboratório do Dr. Alan Sher, NIAID-NIH, Bethesda, MD, USA.
3. Manutenção in vitro da cepa RH de Toxoplasma gondii
Parasitos wild type parental e nocautes para as proteínas de micronema alvos desse
estudo, WT, TgMIC1-/-, TgMIC4-/- e DKO TgMIC1-/-/MIC4-/- foram gerados e gentilmente
doados pela colaboradora Profa. Dra. Dominique Soldati-Favre, da Universidade de Genebra,
Suíça. As linhagens foram mantidos por meio de passagens em células HFF (Human Foreskin
Fibroblast), utilizando meio de cultura DMEM (Dulbecco’s Modified Eagle Medium) (Gibco,
Thermo Fisher Scientific Inc, Rockville, MD, USA) acrescido com 0,25 mM de gentamicina
(Gibco), 1000 U/ml de penicilina e streptomicina (Gibco) e 5-10% de soro fetal bovino (Gibco),
a 37°C com 5% CO2.
4. Transformação das cepas DH5α e BL21 Codon Plus RIPL de E. coli
Os vetores pET28a (NdeI e BamHI) (GenScript) e SagCatSag-Tub-GFP (BglII/BstZ17I
e AvrII) clonados com a sequência codificadora de TgMIC1 e TgMIC4 wt e mutadas e o vetor
SagCatSag-Tub-GFP foram utilizados para a transformação térmica de cepas de E. coli (DH5α e
Codon Plus RIPL). Para isso, células competentes (50 ul) mais 150 ng dos plasmídeos contento
os genes das TgMICs foram adicionados em microtubos, mantidos em gelo durante 50 minutos.
Em seguida, as células foram submetidas ao choque térmico (42ºC por 50 segundos), e
imediatamente foram adicionados 700 ul de meio líquido LB (Himedia). Para a recuperação das
células transformadas, os microtubos foram mantidos sob agitação (240 rpm) a 37ºC durante 1
hora. Posteriormente, as bactérias foram estriadas em placas de Petri com meio sólido LB-Ágar
(Himedia), contendo kanamicina (100 ug/mL) ou ampicilina (100 ug/ml), e deixadas em estufa
por uma noite a 37°C, para o crescimento das colônias. Após essa etapa, as colônias positivas
foram cultivadas em meio LB líquido contendo kanamicina ou ampicilina (100 ug/ml) para a
extração de DNA por MiniPrep Kit (QIAprep® Spin Miniprep Kit, Qiagen, Hilden, Alemanha)
ou experssão e purificação das proteínas recombinantes.
5. Expressão de TgMIC1 e TgMIC4 recombinantes
Uma colônia das bactérias transformadas (cepa RIPL) foi cultivada em 5 ml de meio
líquido LB (Himedia) sob agitação (240 rpm) a 37ºC por uma noite, na presença de ampicilina
(100 ug/ml). No dia seguinte, o inóculo de 5 ml foi adicionado a 500 ml de meio LB (100 ug/ml
ampicilina), mantido a 37ºC, 240 rpm até atingir densidade óptica (D.O.) entre 0,6 a 0,8.
Posteriomente, foi adicionado 0,1 mM de IPTG (Isopropyl-β-D-thiogalactoside) (Sigma, St.
Louis, MO, USA), para indução da expressão das proteínas recombinantes, e a cultura
bacteriana permaneceu a 37ºC, a 200 rpm, durante 4 horas. Após a indução, as bactérias foram
centrifugadas (4000 rpm, 15 minutos) e o pelete foi congelado em freezer -80ºC. Alíquotas
foram coletadas da cultura antes e após indução para verificar se houve a expressão de TgMIC1
e TgMIC4. Essas amostras (1 ml cada) foram centrifugadas a 8000 RPM por 5 minutos a
temperatura ambiente e o pelete foi ressuspendido em 50 μL de tampão de amostra (0,25 M tris
HCl ph 6,8, 12,5% SDS, 50% glicerol e 0,05% azul bromofenol), fervido por 10 minutos
(100°C) para quebra total das pontes de hidrogênio. Em seguida, as amostras foram
centrifugadas a 13000 RPM por 10 minutos, e estocadas a -20°C até o momento da análise por
SDS-page em gel de poliacrilamida 10%. Após a eletroforese, o gel de poliacrilamida foi corado
com comassie blue 0,1% (45% metanol, 10% ácido acético) durante 1 hora, e, em seguida,
descorado com solução descorante (50% metanol, 12% ácido acético).
6. Purificação de TgMIC1 e TgMIC4 recombinantes
As proteínas TgMIC1 e TgMIC4 encontradas na fração insolúvel foram purificadas e
submetidas ao refolding pelo método de diálise. O pelete bacteriano foi ressuspendido em
tampão de lavagem (20 mM Tris, 500 mM NaCl, 0,2% Triton X-100 e 0,1 mM PMSF, pH 8,3),
seguido de sonicação em banho de gelo (4 pulsos de 40 segundos cada), e centrifugado a 4000
rpm por 15 minutos. Esse procedimento foi repetido duas a três vezes. Posteriormente, os corpos
de inclusão foram ressuspendidos em tampão de solubilização (20 mM Tris, 500 mM NaCl e 8
mM Ureia, pH 8,3) e a solução foi incubada em agitação por uma noite à temperatura ambiente.
Após completa solubilização dos corpos de inclusão, a amostra foi novamente centrifugada
(4000 rpm, 40 minutos) para a remoção de qualquer material insolúvel, e então foi submetida a
cromatografia de afinidade em coluna de níquel (GE Healthcare, Little Chalfont, Reino Unido)
para a purificação das proteínas recombinates contendo His-Tag.
7. Refolding de TgMIC1 e TgMIC4 recombinantes
Após cromatografia de afinidade em coluna de níquel, as proteínas recombinantes
purificadas diluídas em tampão de refolding (20 mM Tris, 500 mM NaCl e 8 mM Ureia, pH 8,3)
foram adicionadas em cassetes de diálise (Thermo Fisher Scientific Inc, Rockville, MD, USA) e
dialisadas contra o tampão de refolding contendo concentrações decrescentes de uréia (6; 5; 4; 2;
1; 0,5 e 0 M). Após a remoção de toda a uréia, as amostras foram submetidas a cromatografia de
afinidade em coluna com polimixina B imobilizada (Sigma, St. Louis, MO, USA), segundo
instruções do fabricante, para eliminar possível contaminação com lipopolissacarídeo (LPS). A
concentração proteica foi determinada (dosagem com BCA - Bicinchoninic Acid Solution Sigma) e as amostras armazenadas a –20o C até o momento do uso. Todos os lotes purificados
passaram por dosagem de LPS (Limulus Amebocyte Lysate – LAL, QCL-1000, Lonza, Basileia,
Suíça) e apresentaram pouca ou nenhuma contaminação resquicial com lipopolissacarídeo (1 a 3
unidades de endotoxina por micrograma de proteína). Antes da realização de cada experimento,
as proteínas recombinantes foram incubadas durante 30 minutos (temperatura ambiente) com 10
ug/ml de sulfato de polimixina B (Sigma, St. Louis, MO, USA) para excluir possível
contaminação com LPS, mesmo após a putificação em coluna.
8. Ensaio de atividade e inibição de TgMIC1 e TgMIC4
O ensaio foi realizado em placa de 96 poços, seguindo o protoloco para ELISA. A
microplaca foi revestida com glicoproteínas contento ou não ácido siálico terminal, como fetuína
e asialofetuína, respectivamente, prefazendo a quantidade de 1 ug de glicoproteína por poço,
diluída em 50 ul de tampão carbonato. Posteriormente, a placa foi mantida por uma noite a 4ºC.
Em seguida, após lavagem com PBS, foram adicionadas as proteínas de micronema 1 e 4 (wt e
mutadas) pré-incubadas ou não com seus açucares especíicos (α(2-3) sialyllactose para TgMIC1
e lacto-N-biose para TgMIC4. A incubação permaneceu por 2 horas a temperatura ambiente.
Após lavagem com PBS, o ensaio foi revelado com soro de camundongo infectado com T.
gondii (1:50) e a leitura foi realizada a 450 nm em leitor de microplacas (Power Wavex- BIOTEK).
9. Obtenção e cultura de macrófagos e células dendríticas derivados de medula óssea
(BMDMs e BMDCs)
Células totais da medula óssea foram retiradas dos fêmures de camundongos WT,
MyD88-/-, TRIF-/-, TLR2-/-, TLR4-/-, DKO TLR2-/-/TLR4-/- e DKO TLR11-/-/TLR12-/- e
cultivadas em placas de Petri do tipo optilux (não tratadas) com dimensões de 100 x 20 mm
(Corning), na presença de 10 ml de meio RPMI 1640 (Gibco, Thermo Fisher Scientific Inc,
Rockville, MD, USA) suplementado com 20% de soro fetal bovino inativado (Gibco), 1% de
penicilina e estreptomicina (1000 U/ml), 2 mM de glutamina, 25 mM HEPES pH 7,2 e 30% do
sobrenadante de cultura de células L929 (LCCM - L-Cell Conditioned Media) como uma fonte
de M-CSF (Macrophage Colony-Stimulating Factor), para a diferenciação em macrófagos.
Concomitantemente, células totais da medula óssea de camundongos WT, TLR2-/-, TLR4-/-,
DKO TLR2-/-/TLR4-/- e DKO TLR11-/-/TLR12-/- foram cultivadas na presença de 10 ml de meio
RPMI 1640 (Gibco, Thermo Fisher Scientific Inc, Rockville, MD, USA) suplementado com
20% de soro fetal bovino inativado (Gibco), 1% de penicilina e estreptomicina (1000 U/ml), 2
mM de glutamina, 25 mM HEPES pH 7,2 e 15% do sobrenadante de células CHO-GM-CSF,
como fonte de GM-CSF para a diferenciação de células dendríticas, de acordo com Goldszmid e
colaboradores (2003). No quarto dia para macrófagos ou no terceiro dia para células dendríticas,
foi efetuado um reforço e 10 ml foram acrescentados nas placas de cultura. No sétimo dia de
cultivo, os macrófagos foram removidos por choque térmico e lavagem das monocamadas com
PBS gelado, e as células dendríticas foram coletadas a partir do sobrenadante da cultura.
10. Avaliação da produção de citocinas por células dendríticas e macrófagos após o
estímulo com as TgMICs
5x105 BMDCs ou BMDMs foram plaqueados em placa de 24 poços utilizando meio
RPMI-1640, com 10% de soro fetal bovino (Gibco). As células foram estimuladas com TgMIC1
(5 µg/ml) e TgMIC4 (5 µg/ml) ou somente meio (controle negativo). Para os controles positivos
as células dendríticas e os macrófagos foram incubados com LPS ultrapuro (500 ng/ml)
(Invivogen, San Diego, CA, USA) ou Pam3CSK4 (1 µg/ml) (Invivogen, San Diego, CA, USA)
e incubados por 48 horas em estufa a 37ºC com 5% CO2. Os sobrenadantes das culturas foram
coletados e estocados a -20ºC para a dosagem de IL-12p40, TNF-α, IL-6 e IL-10 por ELISA
(Enzyme-Linked Immunosorbent Assay) de acordo com as instruções do fabricante (BD
Biosciences, Franklin Lakes, NJ, USA). A leitura foi realizada a 450 nm em leitor de
microplacas (Power Wavex- BIO-TEK).
11. Transfecção de células HEK293T e avaliação da produção de IL-8 após o estímulo com
as TgMICs
Os plasmídeos para expressão de TLR2 foram construídos e gentilmente cedidos pelo
Professor Dr. Nicolas J. Gay da Universidade de Cambridge, Londres, Inglaterra e descritos por
WEBER et al., 2004. Células HEK293T foram cultivadas em placas de 96 poços (3,5 x 104
células/poço) em meio DMEM (Gibco), suplementado com 10% de soro fetal bovino (Gibco), e
transfectadas com 60 ng de TLR2 wild type (A6), acrescidas de 70ng de vetor vazio pcDNA3.1,
60 ng de NF-kB e 5 ng de Renilla utilizando Lipofectamina 2000 (Invitrogen) conforme
instruções do fabricante. Após esse período, o sobrenadante foi removido e os estímulos
adicionados: 100 ng de FSL-1 (EMC Microcolletions), utilizado como controle positivo, e 5 ug
de TgMIC1 ou TgMIC4. Após 24 horas o sobrenadante foi coletado e a produção de IL-8 foi
mensurada por ELISA.
12. Pull-down
Como fonte enriquecida de TLR2 e TLR4, foi utilizado o lisado de células HRK293
transfectadas separadamente com esses receptores fusionados a FLAG-Tag. Para isso, foi
adicionado tampão de lise não desnaturante (20mM Tris pH 8.0, 137mM NaCl, 2mM EDTA)
suplementado com inibidor de protease (Roche, Basileia, Suíça). Após 30 minutos de incubação
em gelo, o lisado foi submetido a centrifugação (16000 x g, 4oC por 5 minutos). O conteúdo
proteico no sobrenadante foi quantificado pelo método de BCA, aliquotado e estocado a -80oC.
Para o ensaio de pull-down, 100 ug do lisado de células HEK293 transfectadas com FlagTLR2 ou Flag-TLR4 foi incubado por 16 horas a 4ºC com 10 ug de TgMIC1 ou TgMIC4. Em
seguida, como as proteínas de micronema possuem tag de histidina (His-Tag), as amostras
foram purificadas com resina de níquel (GE Healthcare, Little Chalfont, Reio Unido), após
incubação de 30 minutos a temperatura ambiente e centrifugação do material ligado ao níquel
(16000 x g, 4ºC, 5 minutos). As amostras foram dissolvidas em tampão de amostra, fervidas
durante 5 minutos (100ºC) e submetidas a análise por western blot. Primeiramente, a membrana
foi revelada com anticorpo anti-Flag (1:1000) (Sigma, St. Louis, MO, USA) para a análise da
presença de TLR2 e TLR4. A mesma membrana foi submetida à sondagem secundária e foi
revelada com anticorpo anti-His (1:3000) (Sigma, St. Louis, MO, USA) para a detecção de
TgMIC1 e TgMIC4.
13. Infecção in vitro de células dendríticas e macrófagos derivados da medula óssea
Para a infecção in vitro foram utilizados parasitos da cepa RH (taquizoítos) WT parental,
TgMIC1-/-, TgMIC4-/- ou DKO TgMIC1-/-/MIC4-/- recuperados de garrafas de cultura T25 em
células HFF (descrito no item 8). As garrafas foram lavadas com o próprio meio RPMI 1640
para a completa remoção dos parasitos. Em seguida, o material coletado foi centrifugado a 50 g
durante 5 minutos, para a remoção dos debris celulares. O pelete foi descartado, e o
sobrenadante contendo os parasitos foi centrifugado a 1000 g durante 10 minutos, seguido de
contagem. Em placa de 24 poços contendo 5x105 células/poço, provenientes de camundongos
WT, MyD88-/-, DKO TLR2-/-/TLR4-/- ou DKO TLR11-/-/TLR12-/- (meio RPMI 1640, 5% soro
fetal bovino), foram adicionados três parasitos para cada célula (multiplicidade de infecção,
MOI 3), e em seguida a placa foi centrifugada por três minutos a 200 g para sincronizar o
contato entre as células e os parasitos. Após 6, 12, 24 e 48 horas de incubação o sobrenadante foi
coletado para a dosagem de IL-12p40 por ELISA, como descrito no item 10.
14. Infecção in vivo de camundongos wt com Toxoplasma gondii
Camundongos C57BL/6 de 8 a 12 semanas de idade foram infectados com as linhagens
WT e nocautes da cepa RH de T. gondii. A via de infecção utilizada foi a intraperitoneal, e para
o ensaio de cinética os animais foram infectados com 1x105, 1x106 e 1x107 parasitos WT. Após
1, 2, 3, 6 e 18 horas de infecção, o sangue dos camundongos foi coletado do plexo retro-orbital
para a dosagem de IL-12p40 presente no soro. Para o ensaio com as diferentes linhagens da cepa
RH (WT e nocautes), os camundongos foram infectados com 1x106 parasitos (i.p.), e as
amostras de sangue foram coletadas 1, 2 e 6 horas após a infecção. O tempo zero é representado
pela dosagem de IL-12 do soro dos animais não infectados.
15. Clonagem de TgMIC1 e TgMIC4 em SagCatSagTub-GFP e pLUC-GFP
Para a amplificação de TgMIC1 e TgMIC4, o RNA da cepa RH de T. gondii foi isolado
de 1x108 taquizoítas, a partir da purificação com kit RNeasy Mini (Qiagen, Hilden, Alemanha),
e a amostra foi mantida em -80ºC. Posteriormente, 500 ng a 1 ug do RNA total foi usado para a
conversão em cDNA (SuperScript II, Thermo Fisher Scientific, Rockville, MD, USA). A
amplificação de TgMIC1 e TgMIC4 a partir do cDNA (100 a 400 ng) foi realizada com o uso da
enzima high-fidelity Herculase II (Agilent Technologies, Santa Clara, CA, USA). Os primers
utilizados para TgMIC1 foram: forward 5’ GGGGAGATCTATGGGCCAGGCGCTGTTTCTC
3’ (com sítio para a enzima de restrição BglII), reverse para o vetor SagCatSag-Tub-GFP 5’
GGGGCCTAGGAGCAGAGACGGCCGTAGGAC 3’ (com sítio para a enzima de restrição
AvrII)
e
reverse
para
o
vetor
pLUC-GFP
5’
GGGGCCTGCAGGTCAAGCAGAGACGGCCGTAG 3’ (com sítio para a enzima de restrição
SbfI). Para TgMIC4: forward 5’ GGGGGTATACATGAGAGCGTCGCTCCCGGT 3’ (com
sítio para a enzima de restrição BstZ17I) e reverse para o vetor SagCatSag-Tub-GFP 5’
GGGGCCTAGGTTCTGTGTCTTTCGCTTCAA 3’ (com sítio para a enzima de restrição
AvrII). Após a amplificação dos genes de interesse, o produto de PCR foi purificado (PCR
Purification Kit, Qiagen), e 1 ug de cada amostra de DNA (TgMIC1, TgMIC4 e vetor de
interesse) foram submetidos a digestão durante 3 horas a 37ºC, com as respectivas enzimas de
restrição (New England Biolabs, UK). Em seguida, as amostras foram analisadas em gel de
agarose 1%, e as bandas de interesse foram extraídas por meio de kit (Gel Extraction Kit,
Qiagen). As amostras de DNA foram quantificadas em nanodrop, seguidas da etapa de ligação
do inserto de interesse ao vetor. Para isso, o DNA de TgMIC1 ou TgMIC4 foi incubado o DNA
do vetor (3:1) durante 10 minutos a temperatura ambiente (Quick Ligation™, New England
Biolabs, UK), e estocado a -20ºC. Em seguida, o material ligado foi utilizado para a
transformação de bactérias competentes, como descrito no item 2. Para o teste das colônias
positivas por amplificação de TgMIC1 e TgMIC4, utilizamos Taq DNAPolymerase (Thermo
Fisher Scientific, Rockville, MD, USA). Por último, três colônias foram selecionadas, cultivadas
e submetidas a purificação de plasmídeos por miniprep (QIAprep® Spin Miniprep Kit, Qiagen,
Hilden, Alemanha) para sequenciamento e transfecção da cepa RH de T. gondii.
16. Transfecção de Toxoplasma gondii
Após a lise total da monocamada de células HFF, os parasitos foram coletados das
garrafas T25, filtrados (poros de 3 μm) para a retirada dos debris celulares, centrifugados a 800 x
g por 10 minutos, seguidos de lavagem com cytomix (10 nM KPO4, 120 mM KCl, 0.15 mM
CaCl2, 5 mM MgCl2, 25 mM Hepes e 2 mM EDTA, pH 7,6) e contagem em câmara de
neubauer. Para cada transfecção, foram utilizados 3,5 x107 contidos em 300 ul de cytomix e 30
a 50 ug dos plasmídeos contendo TgMIC1 ou TgMIC4 (diluídos em 100 ul de cytomix),
previamente aquecidos a 65ºC por 10 a 20 minutos para eliminar qualquer contaminante
bacteriano. Posteriormente, o DNA e os parasitos foram adicionados em cubeta BTX descartável
(4 mm), seguidos de eletroporação em eletroporador celular BTX (BTX ECM630) nas seguintes
condições: 2 pulsos de voltagem 1400 e resistência 25. Finalmente, após a transfecção, os
parasitos foram adicionados em garrafas T25 contendo monocamada de células HFF e mantidos
por 24 horas, antes da adição do antibiótico para seleção dos taquizoítas transformados (20 uM
de cloramphenicol).
17. Análise da expressão de antígenos de superfície de T. gondii por citometria de fluxo
A expressão de TgMIC1 na superfície de parasitos transfectados foi avaliada por
citometria de fluxo. Para isso, 5x106 parasitos foram fixados durante 10 minutos (temperatura
ambiente – T.A.) com cytofix/cytoperm (BD Biosciences, Franklin Lakes, NJ, USA), seguidos
de incubação com BD Perm/Wash Buffer (150 ul) durante 20 minutos (T.A.). Após
centrifugação (800 x g), os parasitos foram incubados durante 30 minutos (T.A.) com anticorpo
primário anti-MIC1 (1:100) (mAb T10 1F7, gentilmente cedido pelo Dr. Vern Carruthers), ou o
isotipo controle (1:100), diluídos em tampão BD Perm/Wash (BD Biosciences, Franklin Lakes,
NJ, USA). Posteriormente, os taquizoítos passaram por 2-3 lavagens com o tampão, seguidos de
incubação de 30 minutos (T.A.) com anticorpo secundário anti- IgG de camundongo conjugado
a APC (1:200) (BD Biosciences, Franklin Lakes, NJ, USA). Após 2-3 lavagens, os parasitos
foram ressuspendidos em tampão BD Perm/Wash, adquiridos com auxílio de citômetro de fluxo
LSRII (BD Biosciences, Franklin Lakes, NJ, USA) e a expressão de TgMIC1 foi analisada com
auxílio do software FlowJo (FlowJo, LLC, Data Analysis Software, Ashland, OR, USA).
18. Análise estatística
Para análise estatística foi utilizado o programa Prisma 6.0 (Graph Pad Software). Todas
as variáveis foram testadas a distribuição normal e a variância homogênea. O teste aplicado foi o
One-way ANOVA com pós-teste de Bonferroni. Os resultados foram expressos em média e ±
EPM (erro padrão da média), com as diferenças observadas sendo consideradas significativas
quando p<0,05 (*).
Resultados | 41
Resultados
Resultados | 42
1. Expressão e purificação de TgMIC1 e TgMIC4
Para produzir as proteínas recombinantes, alvos deste estudo, o gene wild type de
TgMIC1 e TgMIC4, proveniente da cepa RH, foi clonado em vetor para expressão em bactéria
(pET28), nos sítios NedI e BamHI, com a presença de tag de histidina (His-Tag) na porção Nterminal. Paralelamente, visando entender o papel do domínio lectínico das TgMICs na indução
da ativação celular, TgMIC1 e TgMIC4 sofreram mutações pontuais em seus domínios de
reconhecimento de carboidrato e foram então clonadas no vetor pET28, com a presença de tag
de histidina (figura 1A). Para induzir a perda da capacidade em reconhecer carboidratos,
TgMIC1 sofreu duas mutações em seu CRD, sendo essa, a troca de duas treoninas (posições 126
e 220) por duas alaninas (Blumenschein et. al, 2007; Hager & Carruthers 2008); e TgMIC4
sofreu apenas uma mutação em seu CRD, onde a lisina da posição 469 foi alterada por uma
metionina (Marchant et. al, 2012). Todas as sequências (wt e mut) passaram por otimização de
códons para expressão em Escherichia coli.
Amostras de E. coli transformadas foram cultivadas em meio líquido, e induzidas a
expressarem TgMIC1 e TgMIC4. Como observado anteriormente (Pinzan, 2010), as proteínas
recombinantes foram avaliadas por SDS-PAGE e detectadas no sedimento, contidas em corpos
de inclusão (figura 1B). O sedimento foi solubilizado com alta concentração de uréia (8M) e as
proteínas nele contidas foram submetidas a processo de refolding, pelo método da diálise, que
proporcionou, em ambos os casos, preparações homogêneas de TgMIC1 e TgMIC4 (figura 1C).
Eventual contaminação das preparações com lipopolissacarídeo bacteriano (LPS) foi eliminada
por adsorção à polimixina B imobilizada. Cada preparação foi submetida à análise do conteúdo
de lipopolissacarídeo pelo método colorimétrico Limulus Amebocyte Lysate (LAL). Em todos os
casos, concentrações inferiores a 3 UE/ug (unidade de endotoxina por micrograma de proteína)
foram detectadas. Com o objetivo de remover quantidades residuais de LPS, antes de cada
experimento, as amostras de TgMIC1 e TgMIC4 foram incubadas com sulfato de polimixina B
por 30 minutos.
Resultados | 43
B
C
Figura 1. Expressão e purificação de TgMIC1 e TgMIC4. A) Bactérias E.coli BL21 Codon Plus RIPL
foram transformadas com o vetor pET28a contendo o gene das TgMICs wt ou mutadas, foram cultivadas
em meio líquido seletivo (100 ug/ml de ampicilina). B) A expressão de TgMIC1 e TgMIC4 foi induzida
com 0,5mM de IPTG por 4 horas a 37°C, e amostras da cultura antes e depois da indução foram
submetidas as condições desnaturantes, analisada em gel de poliacrilamida (SDS-PAGE 10%). Coloração
realizada por azul de comassie 0,1%. Em C, TgMIC1 e TgMIC4 após cromatografia por afinidade a
níquel e refolding pelo método da diálise B.I. (before induction): amostra não induzida, coletada antes da
adição de IPTG; A.I. (after induction): amostra após 4 horas de indução com IPTG.
2. Atividade lectínica de TgMIC1 e TgMIC4
Uma vez que as proteínas de micronema 1 e 4 possuem atividade lectínica, testamos essa
atividade a partir da capacidade de ligação de TgMIC1 (wt e mut) a fetuína, e de TgMIC4 (wt e
mut) a asialofetuína. Para isso, as glicoproteínas alvo (fetuína e asialofetuína) revestiram poços
de microplacas, seguindo-se incubação com TgMIC1, ∆-TgMIC1 (T126A/T220A), TgMIC4 e
∆-TgMIC4 (K469M). O ensaio foi revelado com soro de camundongos infectados com T.
gondii. Adicionalmente, para melhor explorar a propriedade de reconhecimento de açúcar de
TgMIC1 e TgMIC4, ensaiamos o efeito inibitório exercido pelos oligossacarídeos específicos
em sua ligação às glicoproteínas alvo. Na figura 2, podemos observar que TgMIC1 (barra preta)
e TgMIC4 (barra branca) foram capazes de interagir com fetuína e asialofetuína,
respectivamente. Em contraste, ∆-TgMIC1 (T126A/T220A) e ∆-TgMIC4 (K469M) não
Resultados | 44
interagiram com as glicoproteínas alvo, indicando que as mutações foram eficientes ao fazer
com que o CRD deixasse de se ligar a açúcares específicos. Além disso, verificamos que a préincubação com α(2-3) Sialil-lactose inibiu a ligação de TgMIC1 à fetuína (barra preta), enquanto
que a pré-incubação com lacto-N-biose inibiu a ligação de TgMIC4 à asialofetuína (barra
branca). Esses resultados indicam que a mutação no CRD impediu a ligação das lectinas às
glicoproteínas alvo, assim como os açúcares específicos, que foram reconhecidos pelos CRDs
das TgMICs e passaram a ocupar fisicamente esse sítio de interação. Esse fato resultou no
impedindo da ligação das lectinas a fetuína e a asialofetuína, respectivamente.
Figura 2. Atividade lectínica de TgMIC1 e TgMIC4. A atividade lectínica de TgMIC1 e TgMIC4 foi
avaliada por interação com glicoproteínas contendo ácido siálico e galacotse terminais. Os poços foram
revestidos com fetuína ou asialofetuína, seguidos de incubação por duas horas (TA) com TgMIC1 (préincubada com PBS ou sialylactose) e TgMIC4 (pré-incubada com PBS ou lacto-N-biose),
respectivamente. Após incubação, o ensaio foi revelado com soro de camundongo infectado com T.
gondii. Resultados expressos em densidade óptica 450nm, média ± SD e são representativos de dois
experimentos. *p<0,05 (One-way ANOVA e pós-teste de Bonferroni).
3. TgMIC1 e TgMIC4 induzem ativação de células da imunidade inata
Nosso grupo demonstrou anteriormente que o subcomplexo
nativo
Lac+
(TgMIC1/TgMIC4) estimula células esplênicas aderentes a produzirem altas concentrações de
interleucina 12 (IL-12) (Lourenço et al., 2001). Com o objetivo de averiguar se as proteínas
equivalentes recombinantes são capazes de ativar células da imunidade inata, avaliamos a
produção das citocinas IL-12 (subunidade p40), TNF-α, IL-6 e IL-10 induzida em células
Resultados | 45
dendríticas e macrófagos derivados da medula óssea de camundongos WT (background
C57BL/6). Na figura 3, podemos observar que tanto células dendríticas (figuras 3A, B, C e D),
quanto macrófagos (figuras 3E, F, G e H) são capazes de produzir níveis significativos de IL12p40 (figuras 3A e 3E), TNF-α (figuras 3B e F), IL-6 (figuras 3C e G) e IL-10 (figuras 3D e
H), após o estímulo TgMIC1 e TgMIC4 recombinantes. Adicionalmente, ambas as proteínas de
micronema mostraram-se similarmente capazes de estimular a produção de citocinas por essas
células, com exceção de IL-10 por BMDMs. Neste caso os níveis de IL-10 foram maiores após o
estímulo com TgMIC1, quando comparado ao estímulo com TgMIC4 (figura 3H). O controle
positivo, LPS proporcionou a resposta esperada na condição experimental adotada.
*
#
*
Figura 3. Produção de citocinas por células dendríticas e macrófagos estimulados com proteínas de
micronema. Células dendríticas (BMDCs) (A, B, C e D) e macrófagos (BMDMs) (E, F, G e H)
derivados a partir da melula óssea de camundongos C57BL/6, foram estimulados com TgMIC1 (5 ug/ml)
e TgMIC4 (5 ug/ml) por 48 horas. LPS (500 ng/ml) foi utilizado como controle positivo. Os níveis de IL12p40, TNF-α, IL-6 e IL-10 foram mensurados por ELISA. Resultados expressos em média ± SD e são
representativos de três experimentos. *p<0,05 (One-way ANOVA e pós-teste de Bonferroni).
4. A ativação de células da imunidade inata por TgMIC1 e TgMIC4 é dependente de
receptores do tipo toll 2 e 4
Como demonstrado na figura anterior, as lectinas TgMIC1 e TgMIC4 são capazes de
estimular células dendríticas e macrófagos a produzirem níveis significativos de citocinas
associadas a resposta imune pró e anti-inflamatória. Uma vez que as proteínas de micronema de
Resultados | 46
T. gondii reconhecem ácido siálico (TgMIC1) e β-galactose (TgMIC4) de glicanas presentes na
superfície da célula hospedeira e os receptores do tipo toll, diretamente associados a resposta
imune inata e indução de citocinas, são glicoproteínas N-glicosiladas, decidimos investigar aqui
se a sinalização via TLR está relacionada à ativação celular induzida pelas TgMICs. Para tanto,
utilizamos inicialmente macrófagos derivados de medula óssea de animais WT, MyD88-/- e
TRIF-/- (background C57BL/6), visando avaliar o efeito da ausência das moléculas adaptadoras
das vias de sinalização dos TLRs após o estímulo com as proteínas de micronema. Verificamos
que em macrófagos nocauteados para MyD88 (figura 4A), estimulados com TgMIC1 e
TgMIC4, a secreção de IL-12 foi 15 vezes menor do que a verificada em macrófagos WT. Na
ausência de TRIF (figura 4B) ocorreu uma produção 1,6 vezes menor de IL-12, em relação aos
macrófagos WT. Esses resultados indicam que MyD88 é a molécula adaptadora
majoritariamente envolvida na ativação celular induzida pelas proteínas de micronema, enquanto
que TRIF está apenas parcialmente implicado nessa ativação.
Uma vez que MyD88 e TRIF relacionam-se à indução de IL-12 pelas TgMICs,
avaliamos se os receptores do tipo toll 2, 4, 11 e 12 estariam envolvidos nesse fenômeno. TLR11
e TLR12 foram descritos anteriormente como reconhecendo profilina, uma proteína
citoplasmática de T. gondii, interação essa que induz secreção de IL-12 por células dendríticas
(Yarovinsk et al., 2005; Yarovinsky and Sher, 2006; Plattner et al., 2008; Koblansky et al.,
2013). Para esse ensaio, macrófagos derivados da medula óssea de camundongos WT, TLR2-/-,
TLR4-/-, DKO (TLR2-/-/TLR4-/-) e DKO (TLR11-/-/TLR12-/-) foram estimulados com TgMIC1
ou TgMIC4 e os níveis de IL-12 foram determinados por ELISA. Na figura 4, observamos que a
ausência de TLR2 (figura 4C) ou de TLR4 (figura 4D) resulta em prejuízo da ativação celular
induzida por TgMIC1 e TgMIC4. Notamos ainda que, a queda determinada pela falta de TLR4
foi mais acentuada, do que a determinada pela falta de TLR2; ressalta-se, entretanto que os
macrófagos ainda foram capazes de secretar níveis significativos de IL-12. Finalmente,
macrófagos duplamente nocauteados (figura 4E), ou seja, sem a expressão concomitante de
TLR2 e TLR4, não produzem IL-12 após o estímulo com as proteínas de micronema, quando
comparados à resposta dos macrófagos WT. Esses resultados confirmam que a expressão de
ambos, TLR2 e TLR4, é necessária para que a ativação de macrófagos seja induzida por
TgMIC1 e TgMIC4. A produção residual de IL-12 verificada em células TLR2-/- pode resultar
da ativação de TLR4 (figuras 4C e D), e vice-versa, ou seja, a produção residual por
macrófagos TLR4-/- pode ser resultado da ativação de TLR2 (figura 4C). A constatação de que
Resultados | 47
macrófagos de camundongos DKO estimulados com proteínas de micronema não produzem IL12 sugere que a ativação celular desencadeada por TgMIC1 ou TgMIC4 não exige a
participação de outros receptores de imunidade inata, além de TLR2 e TLR4. Em contraste, a
ausência de TLR11 e TLR12 não prejudicou a ativação celular induzida pelas TgMICs, pois
nesse caso os níveis de IL-12 detectados foram semelhantes aos produzidos pelos macrófagos
WT (figura 4F); esse fato indica que esses receptores não participam da ativação desencadeada
por TgMIC1 ou TgMIC4. Os estímulos controles, LPS para TLR4 e Pam3CSK4 (P3C) para
TLR2 proporcionaram as respostas esperadas nas condições experimentais adotadas.
Figura 4. Produção de IL-12 por macrófagos estimulados com TgMIC1 e TgMIC4 na ausência de
sinalização via toll. Macrófagos derivados a partir da medula óssea (BMDMs) de camundongos
C57BL/6 WT, MyD88-/-, TRIF-/-, TLR2-/-, TLR4-/-, DKO (TLR2-/-/TLR4-/-) e DKO (TLR11-/-/TLR12-/-)
foram estimulados com TgMIC1 (5 ug/ml) e TgMIC4 (5 ug/ml) por 48 horas. LPS (500 ng/ml) e
Pam3CSK4 (P3C) (1 ug/ml) foram utilizados como controles positivos. Os níveis de IL-12p40 foram
mensurados por ELISA. Resultados expressos em média ± SD e são representativos de três experimentos.
*p<0,05 (One-way ANOVA e pós-teste de Bonferroni).
Resultados | 48
Com o objetivo de comprovar a interação de TgMIC1 e TgMIC4 com TLR2 e TLR4,
realizamos o ensaio de pull-down. Para tanto, o lisado celular de HEK293T enriquecido com
Flag-TLR2 ou Flag-TLR4 foi incubado com as proteínas de micronema wt e mutadas, HisTgMIC1 (wt), His-TgMIC1 (mut), His-TgMIC4 (wt) e His-TgMIC4 (mut). Seguiu-se
purificação em resina de níquel, e análise da presença de TLR2 e TLR4 por western blot, com o
uso de anticorpos α-Flag. A mesma membrana foi submetida à sondagem secundária, e foi
revelada com anticorpo α-His, para a detecção das TgMICs. Na figura 5, podemos observar que
tanto TgMIC1, quanto TgMIC4 (wt e mutadas), são capazes de interagir com TLR2, como
demonstrado nas linhas 1 e 3, colunas 5 e 6 (TLR2+wt-TgMIC e TLR2+mut-TgMIC). O fato
das proteínas mutadas em seus CRDs ainda interagirem com TLR2. Sugere que, além da
interação proteína-carboidrato (N-glicana de TLR-lectina), também ocorra interação proteínaproteína (TLR-TgMIC). Em contraste, esse experimento não indicou a interação de TgMIC1 e
TgMIC4 com TLR4 (linhas 1 e 3, colunas 7 e 8), já que a banda correspondente não foi
detectada após a incubação e revelação da membrana com anticorpo α-Flag. Como o input de
TLR4 não resultou em detecção de banda (linhas 1 e 3, coluna 2), acreditamos que a transfecção
das células HEK tenha gerado expressão muito baixa de TLR4, impossibilitando sua detecção
por western blot. Esse ensaio não é definitivo, e repetições estão sendo providenciadas. Até o
momento, podemos concluir que TgMIC1 e TgMIC4 interagem fisicamente com receptor do
tipo toll 2.
Figura 5. Interação de TgMIC1 e TgMIC4 com TLR2 e TLR4. Células HEK293 expressando
transientemente Flag-TLR2 ou Flag-TLR4 foram lisadas e incubadas com His-TgMIC1 (wt ou mutada)
e His-TgMIC4 (wt ou mutada). His-TgMIC1 e His-TgMIC4 foram submetidas a técnica de pull-down
por afinidade a resina de níquel. As amostras foram fervidas (100ºC, 5 minutos) e aplicadas em gel de
poliacrilamida, seguidas de transferência para membrana de nitrocelulose. Para detectar a presença de
TLR2 e TLR4, a membrana foi incubada com anticorpo α-Flag. Posteriormente, a membrana foi
submetida à sondagem secundária por incubação com α-His para confirmar a presença de TgMIC1 e
TgMIC4 (wt e mutada).
Resultados | 49
Como é sabido, a ativação de TLRs, que culmina na produção de mediadores
inflamatórios, associa-se a diferentes vias/moléculas que participam da sinalização intracelular
desses receptores. Podemos destacar MyD88 e TRIF, localizadas upstream na cascata de
sinalização intracelular, e as MAP-quinases (ERK1/2, JNK e p38) juntamente com NF-kB,
situadas downstream na via. Uma vez que TgMIC1 e TgMIC4 induzem ativação de células
dendríticas e macrófagos de maneira dependente de TLR2 e TLR4, avaliamos qual (is) molécula
(s) da cascata de sinalização downstream seria crucial na indução de IL-12 desencadeada pelas
TgMICs. Para isso, macrófagos derivados da medula óssea de camundongos WT foram
previamente incubados com os inibidores farmacológicos para as moléculas ERK1/2, JNK, p38
e NF-kB. Posteriormente, essas células foram estimuladas com TgMIC1 e TgMIC4 e os níveis
de IL-12 foram determinados. Constatamos que as MAP-quinases ERK1/2 não se associam à
ativação celular induzida pelas TgMICs (figura 6A), pois mesmo após a inibição dessas
moléculas, a produção de IL-12 pelos macrófagos foi mantida em níveis similares aos
verificados em células que não sofreram nenhum tipo de inibição. Em contraste, a inibição de
JNK (figura 6B), p38 (figura 6C) e NF-kB (figura 6D) resultou em prejuízo da ativação celular
induzida por TgMIC1 e TgMIC4. Observamos que na ausência de resposta de JNK e p38 há
uma produção residual de IL-12, enquanto que a ausência isolada de NF-kB resultou na inibição
completa da ativação celular. Esses resultados indicam que a secreção de citocinas por
macrófagos estimulados com TgMIC1 e TgMIC4 depende, majoritariamente, da ativação
intracelular de NF-kB, bem como de sua translocação para o núcleo.
Resultados | 50
Figura 6. Efeito da inibição da sinalização intracelular associada a TLR sob a produção de IL-12
por macrófagos estimulados TgMIC1 e TgMIC4. Macrófagos derivados a partir da medula óssea
(BMDMs) de camundongos C57BL/6, foram incubados por 3 horas a 37ºC com os inibidores
farmacológicos para as MAP-quinases (A) ERK (PD98059) (20 μM), (B) JNK (SP600125) (20 μM) e
(C) p38 (SB202190) (20 μM), e para (D) NF-kB (caffeic acid) (15 ug/ml). Em seguida, as células foram
estimuladas com TgMIC1 (5 ug/ml) e TgMIC4 (5 ug/ml) por 48 horas. LPS (500 ng/ml) foi utilizado
como controle positivo. Os níveis de IL-12p40 foram mensurados por ELISA. Resultados expressos em
média ± SD e são representativos de dois experimentos. *p<0,05 (One-way ANOVA e pós-teste de
Bonferroni).
5. A ativação de células da imunidade inata por TgMIC1 e TgMIC4 via TLRs é
dependente do reconhecimento de carboidratos
Dado que o domínio de reconhecimento de carboidrato (CRD) de TgMIC1 e TgMIC4
pode estar envolvido no reconhecimento de N-glicanas de TLR2 e TLR4, desencadeando a
ativação de células dendríticas e macrófagos por nós verificada, passamos a avaliar se mutações
pontuais no CRD das TgMICs seriam capazes de prejudicar essa ativação celular. Desse modo,
estimulamos células dendríticas e macrófagos derivados da medula óssea de camundongos WT
(C57BL/6) com TgMIC1 (wt), Δ-TgMIC1 (T126A/T220A), TgMIC4 (wt) e Δ-TgMIC4
(K469M). A figura 7 mostra que as mutações pontuais resultaram em prejuízo da ativação de
células dendríticas (figura 7A), macrófagos (figura 7B) e células HEK293T transfectadas com
TLR2 (figura 7C), como indica a comparação dos níveis de citocinas induzidos pelas lectinas
mutadas e lectinas nativas. Ocorreu uma diferença entre as respostas de células dendríticas e de
macrófagos: os níveis de IL-12 secretados pelas DCs estimuladas com as lectinas mutadas foi
1,6 menor quando comparado aos níveis induzidos pelas lectinas wt (figura 7A), enquanto que
Resultados | 51
em macrófagos (figura 7B), TgMIC1 wt induziu uma produção de citocina 4,5 vezes maior do
que a determinada pela proteína mutada; a diferença entre a resposta ao estímulo de macrófagos
com TgMIC4 wt e mutada foi de 2,9 vezes. O mesmo perfil foi verificado quando células
HEK293T foram estimuladas com as lectinas wt e mutadas (figura 7C). A produção de IL-8 foi
1,9 vezes menor quando o estímulo por Δ-TgMIC1 foi comparado ao estímulo por TgMIC1
(wt), e 2,8 vezes menor entre Δ-TgMIC4 e TgMIC4 (wt).
Esses resultados indicam que o reconhecimento de N-glicanas de TLR por TgMIC1 e
TgMIC4 contribui para a ativação celular por nós neste estudo. Contudo, a utilização de
mutações pontuais nos CRDs de TgMIC1 e TgMIC4 não bloqueou a produção de citocinas pelas
células ensaiadas. Mutações mais extensas podem ser necessárias. Mas, o mais provável é que
interação proteína-proteína possa ocorrer entre o TLR e a lectina, como sugere o resultado do
western blot (figura 5).
Figura 7. Efeito da falta de reconhecimento de carboidrato por TgMIC1 e TgMIC4 sob a ativação
celular. Células dendríticas (A) e macrófagos (B) derivados a partir da medula óssea de camundongos
C57BL/6, e células HEK293 transfectadas com TLR2 (C) foram estimulados com TgMIC1 (wt), ΔTgMIC1, TgMIC4 (wt) e Δ-TgMIC4 (5 ug/ml) por 48 horas. LPS (500 ng/ml) e FSL-1 (100 ng/ml)
foram utilizados como controles positivos. Os níveis de IL-12p40 e IL-8 foram mensurados por ELISA.
Resultados expressos em média ± SD e são representativos de dois experimentos. *p<0,05 (One-way
ANOVA e pós-teste de Bonferroni).
6. A produção inicial de IL-12 durante a infecção por T. gondii é dependente de TLR2 e
TLR4, mas não de TLR11 e TLR12.
Uma vez que células dendríticas e macrófagos murinos produzem IL-12 em resposta ao
estímulo com as proteínas de micronema 1 e 4, de maneira dependente de MyD88, em
decorrência do reconhecimento de TLR2 e TLR4, passamos a investigar se a ausência dessas
moléculas afetaria a resposta de células dendríticas (BMDCs) à infecção com T. gondii WT.
Resultados | 52
Para tanto, células dendríticas derivadas da medula óssea de camundongos WT, MyD88-/-, DKO
(TLR2-/-/TLR4-/-) e DKO (TLR11-/-/TLR12-/-) foram infectadas com o taquizoítas WT da cepa
RH (tipo I) de T. gondii (MOI 3). LPS (500 ug/ml) e STAg (antígeno solúvel de Toxoplasma
gondii) (10 ug/ml) foram utilizados como controles positivos. Em seguida, avaliamos a
produção de IL-12 após 6, 12, 24 e 48 horas de infecção (figura 8). Confirmando o que já é
sabido, verificamos que a secreção de IL-12 resultante da infecção por T. gondii é dependente de
MyD88, pois na ausência dessa molécula houve prejuízo da ativação celular induzida tanto pelo
parasito como pelos controles positivos (LPS e STAg) (figura 8A). Observamos ainda, que
TLR2 e TLR4 são crucias para a indução de IL-12 nas primeiras 12 horas de infecção, uma vez
que a ausência concomitante desses receptores prejudicou, significativamente, a secreção dessa
citocina por células dendríticas infectadas com T. gondii, quando comparada à obtida com DCs
WT (figura 8B). Após 24 e 48 horas de infecção, a produção de IL-12 pelas DCs DKO é
restaurada, igualando-se aos níveis secretados pelas células WT. Esse fenômeno pode ser devido
a outros componentes do parasito que são comprovadamente capazes de induzir a secreção de
IL-12.
Figura 8. Produção de IL-12 por células dendríticas infectadas com T. gondii. Células dendríticas
derivadas a partir da medula óssea de camundongos WT, (A) MyD88-/-, (B) DKO (TLR2-/-/TLR4-/-) e (C)
DKO (TLR11-/-/TLR12-/-) foram infectadas com T. gondii WT da cepa RH (MOI 3). LPS (500 ng/ml) e
STAg (10 ug/ml) foram utilizados como controles positivos. Após 6, 12, 24 e 48 horas de infecção, os
sobrenadantes das culturas tiveram determinados os níveis de IL-12p40 por ELISA. Resultados expressos
em média ± SD e são representativos de três experimentos. *p<0,05 (One-way ANOVA e pós-teste de
Bonferroni). ns: não significativo.
7. TgMIC1 parece ser a responsável pela indução inicial de IL-12 durante a infecção in
vitro por T. gondii
Como observado por nós neste trabalho, as proteínas de micronema 1 e 4 recombinantes
induzem a ativação de células dendríticas e macrófagos, culminando na secreção de elevados
Resultados | 53
níveis citocinas inflamatórias, especialmente de IL-12. Baseado nisso, propusémo-nos a avaliar
a relevância biológica de TgMIC1 e TgMIC4, bem como o papel dessas lectinas na secreção de
IL-12 por células dendríticas e macrófagos infectados por T. gondii. Para tanto, BMDCs
(figuras 9A, B e C) e BMDMs (figuras 9D, E e F) foram infectados com parasitos WT,
TgMIC1-/-, TgMIC4-/- e DKO TgMIC1-/-/MIC4-/- (MOI 3), e os níveis de IL-12 foram
determinados após 6, 12, 24 e 48 horas de infecção. Uma vez que parasitos nocauteados para
TgMIC1 induzem níveis significativamente menores de IL-12 em todos os tempos ensaiados
(figura 9A), concluímos que essa proteína é crucial para a indução da secreção de IL-12 por
células dendríticas e macrófagos durante a infecção por T. gondii. Notamos que, após apenas 6
horas de infecção das células dendríticas com o parasito WT, a produção de IL-12 foi acentuada
(2000 pg/ml), atingindo níveis próximos a 6000 pg/ml com 48 horas (figuras 9A, B e C).
Diferentemente das células dendríticas, os macrófagos respondem à infecção mais tardiamente,
somente após 24 horas; porém, assim como foi observado para células dendríticas, a ausência de
TgMIC1 prejudicou a ativação de macrófagos, resultando em menor produção de IL-12 por
essas células após 24 e 48 horas de infecção (figura 9D).
Enquanto a ausência de TgMIC1 prejudica a ativação de células dendríticas e
macrófagos, a falta de TgMIC4 parece não afetar a produção de IL-12 por essas células, visto
que essa citocina é produzida em níveis similares por células dendríticas e macrófagos
infectados com o parasito wt ou TgMIC4-/-, em todos os tempos ensaiados (figuras 9B e 9E). O
fato de TgMIC4 não parecer importante durante a infecção in vitro por T. gondii pode estar
relacionado à presença de TgMIC1, que continua sendo secretada no parasito TgMIC4-/-. Isso se
explica pelo fato de TgMIC1 ser expressa isoladamente, em forma de homotrímero, além de
associada a TgMIC4, formando um complexo heterohexâmero, (3 moléculas de TgMIC1 para 3
moléculas de TgMIC4), enquanto que TgMIC4 só pode ser secretada pelo parasito quando está
associada à TgMIC1 (Reiss et al., 2001; Marchant et al., 2012). Portanto, parasitos TgMIC1-/não secretam TgMIC1 nem TgMIC4 (apesar de expressarem essa última proteína), ao passo que
parasitos TgMIC4-/- continuam secretando TgMIC1, mesmo na ausência da expressão de
TgMIC4 (Reiss et al. 2001; Marchant et al., 2012). Como esperado, as células dendríticas e os
macrófagos infectados com parasitos duplo nocautes (DKO TgMIC1-/-/MIC4-/-) produziram
menos IL-12 em todos os tempos analisados, quando comparados com as células infectadas com
T. gondii wt (figuras 9C e 9F).
Resultados | 54
Os resultados mencionados acima corroboram com nossos achados de que as proteínas
de micronema 1 e 4 recombinantes induzem ativação de células dendríticas e macrófagos a
secretarem citocinas inflamatórias, via reconhecimento de TLR2 e TLR4. Constatamos ainda,
que TgMIC1 possue papel crucial na indução inicial de IL-12 por células dendríticas e
macrófagos, durante a infecção in vitro.
Figura 9. Produção de IL-12 por células dendríticas e macrófagos infectados com T. gondii. Células
dendríticas (A, B e C) e macrófagos (D, E e F) derivados a partir da medula óssea de camundongos WT
foram infectados com T. gondii WT, TgMIC1-/-, TgMIC4-/- e DKO (TgMIC1-/-/MIC4-/-) da cepa RH
(MOI 3). LPS (500 ng/ml) e STAg (10 ug/ml) foram utilizados como controles positivos. Após 6, 12, 24
e 48 horas de infecção, os sobrenadantes das culturas tiveram determinados os níveis de IL-12p40 por
ELISA. Resultados expressos em média ± SD e são representativos de três experimentos. *p<0,05 (Oneway ANOVA e pós-teste de Bonferroni). ns: não significativo.
8. TgMIC1 parece contribuir para a indução inicial de IL-12 sistêmica durante a infecção
in vivo com T. gondii
Uma vez que TgMIC1 desempenha papel importante na indução inicial de IL-12 por
células dendríticas e macrófagos durante a infecção in vitro por T. gondii, avaliamos se essa
proteína também seria importante para indução da produção de IL-12 sistêmica, durante a
infecção in vivo pelo protozoário. Para isso, camundongos WT (C57BL/6), de 8 a 12 semanas de
idade, foram infectados (i.p.) com quantidades crescentes de parasitos (1x105, 1x106 e 1x107),
para que definíssemos a melhor dose e o menor tempo necessário para que IL-12 fosse detectada
Resultados | 55
no soro dos animais (figura 10A). As amostras de sangue foram coletadas 1, 2, 3, 6 e 18 horas
após a infecção. A injeção de STAg (10 ug/animal) foi utilizada como controle positivo e o
sangue coletado antes da infecção foi utilizado como controle negativo (time zero). Os níveis
séricos de IL-12, determinados por ELISA, mostraram que já na primeira hora de infecção era
possível detectar IL-12 nos grupos inoculados com 1x106 e 1x107 parasitos (figura 10A). Os
níveis da citocina permaneceram elevados até 6 horas após a infecção, sofrendo queda drástica
após 18 horas. Sendo assim, definimos os tempos a serem ensaiados (zero, 1, 2 e 6 horas p.i.) e o
inóculo de 1x106 parasitos por animal.
Assim, infectamos camundongos WT (C57BL/6), de 8 a 12 semanas de idade, com o
inóculo de 1x106 parasitos por animal e coletamos amostras de sangue após 1, 2 e 6 horas de
infecção. Na figura 10B podemos observar que após 1 hora de infecção os níveis de IL-12
detectados foram iguais aos dos camundongos não infectados (time zero), pois, infelizmente, o
nível basal de IL-12 desses animais estava elevado antes da infecção. O mesmo foi observado
para o tempo de 2 horas, quando os animais infectados com TgMIC1-/- ou DKO TgMIC1-//MIC4-/- secretaram níveis de IL-12 semelhantes aos do grupo infectado com o parasito wt;
apenas o grupo infectado com o parasito TgMIC4-/- apresentou maior produção de IL-12
sistêmica, quando comparado ao grupo infectado com T. gondii WT; porém, o alto desvio
padrão pode ter interferido nesse resultado (figura 10B). Por último, verificamos que a ausência
de TgMIC1 prejudicou parcialmente on níveis sistêmicos de IL-12, após 6 horas de infecção,
como indicado pela comparação aos níveis de IL-12 detectados no grupo infectado com o
parasito WT (figura 10B). Em contraste, os grupos infectados com taquizoítas TgMIC4-/- e
DKO TgMIC1-/-/MIC4-/- responderam de maneira similar ao grupo WT. Esse resultado indica
que TgMIC1 pode colaborar para que ocorra o aumento inicial de IL-12 sistêmica, produzida
durante a infecção in vivo por T. gondii.
Resultados | 56
Figura 10. Produção de IL-12 sistêmica por camundongos infectados com T. gondii. (A)
Camundongos WT (C57BL/6), de 8 a 12 semanas de idade, (N=3) foram infectados (i.p.) com T. gondii
WT com as doses de 1x105, 1x106 e 1x107 taquizoítas/animal. Um grupo inoculado com PBS (N=3) e
animais não infectados foram utilizados como controle negativo (time zero). Após 1, 2, 3, 6 e 18 horas de
infecção o sangue foi coletado, e o soro foi separado por centrifugação para determinação dos níveis de
IL-12p40 por ELISA. (B) Camundongos WT (C57BL/6), de 8 a 12 semanas de idade, foram infectados
com T. gondii WT, TgMIC1-/-, TgMIC4-/- ou DKO TgMIC1-/-/MIC4-/- (1x106 taquizoítas por animal).
Amostras de sangue de animais não infectados foram utilizados como controle negativo (time zero).
Após 1 (N=4), 2 (N=4) e 6 (N=3) horas de infecção o sangue foi coletado, e o soro foi separado por
centrifugação para determinação dos níveis de IL-12p40 por ELISA. Resultados expressos em média ±
SD e são representativos de dois experimentos. *p<0,05 (One-way ANOVA e pós-teste de Bonferroni).
ns: não significativo.
9. Geração de parasitos transgênicos para expressão de TgMIC1 e TgMIC4 mutadas
Visto que a ativação de células dendríticas e macrófagos (in vitro) por TgMIC1 e
TgMIC4 depende, principalmente, do reconhecimento de resíduos de ácido siálico e galactose
das N-glicanas de TLR2 e TLR4, iniciamos a geração de parasitos transgênicos expressores de
TgMIC1 e TgMIC4 carreando mutações pontuais em seus CRDs. Essa etapa do estudo tem por
objetivo avaliar se o fenômeno por nós demonstrado utilizando as MICs purificadas, também
acontece durante a infecção pelo parasito expressando essas proteínas mutadas. Para tanto, as
sequências codificadoras de TgMIC1 e TgMIC4 foram amplificadas a partir do cDNA de T.
gondii (cepa RH), utilizando primers contendo os sítios para as enzimas BglII e AvrII (TgMIC1)
ou BstZ17I e AvrII (TgMIC4) nas extremidades, a fim de possibilitar a clonagem do gene no
vetor SagCatSag_TubFNRGFP (figura 11A). Optamos por expressar as MICs fusionadas à
GFP, pois a partir do uso do microscópio de fluorescência, essa ferramenta possibilita o
acompanhamento dos parasitos transfectados com os plasmídeos. Para isso, excluímos o stop
códon das sequências de TgMIC1 e TgMIC4, permitindo a expressão dessas proteínas de forma
conjunta à proteína fluorescente. Após a amplificação de TgMIC1 (figura 11B) e de TgMIC4
(figura 11B), estes e o vetor SagCatSag_TubFNRGFP (figuras 11C e D) foram submetidos à
digestão com as enzimas de restrição indicadas. Na figura 11D, podemos observar a presença de
Resultados | 57
duas bandas de, aproximadamente, 8.560 e 469 pares de base, indicando a eficácia na digestão
do vetor contendo GFP. As bandas correspondentes aos fragmentos TgMIC1, TgMIC4 e vetor
(fragmento maior) foram extraídas do gel de agarose e o DNA foi purificado (figura 11C e D).
Figura 11. Amplificação dos genes de TgMIC1 e TgMIC4 e digestão do DNA. Os transcritos gênicos
de TgMIC1 (1371pb) e TgMIC4 (1743pb), contendo os sítios específicos para as enzimas de restrição
BglII ou BstZ17I, e AvrII, foram amplificados do cDNA da cepa RH de T. gondii (A), seguidos de
digestão (B). Paralelamente, digerimos o vetor SagCatSag_TubFNRGFP (C) com as mesmas enzimas, e
o material foi analisado em gel de agarose 1% (D). O marcador utilizado foi GeneRulerTM 1kb DNA
Ladder.
Em seguida, o material extraído e purificado do gel, após digestão, foi quantificado e
submetido a reação de ligação com enzima T4 DNA ligase (quick ligation kit, NEB). A
proporção utilizada foi calculada com base na quantidade de DNA do vetor e o tamanho do
inserto, como mostra a fórmula abaixo. Para 50 ng de DNA proveniente do vetor, utilizamos 23
ng do DNA de TgMIC1 e 29 ng de TgMIC4. Após a reação de ligação, os produtos foram
usados para transformação de bactéria competente (E. coli DH5α), que foram selecionadas em
meio seletivo com carbenicilina (100 μg/ml). Posteriormente, selecionamos 13 clones para
TgMIC1 e 20 clones para TgMIC4, que foram expandidos em meio sólido e submetidos a PCR
de colônia utilizando primers específicos para TgMIC1 ou TgMIC4. Na figura 12B, podemos
Resultados | 58
observar que os clones número 1, 2, 3, 4, 6, 8, 10, 11, 12 e 13 são positivos para a TgMIC1,
indicando que o gene foi clonado no vetor. Para TgMIC4, verificamos que as colônias 3, 4, 5, 7,
9, 13, 14, 15, 16, 18, 19 e 20 são positivas e apresentam o gene inserido no vetor (figura 12C).
Em seguida, três clones foram selecionados, expandidos em meio líquido, e os plasmídeos foram
purificados e sequenciados para verificação das sequências de TgMIC1 e TgMIC4, e para
análise das corretas inserções no vetor.
Figura 12. Clonagem dos genes de TgMIC1 e TgMIC4 em vetor para transfecção de T. gondii.
Após a digestão com as enzimas de restrição, os genes de TgMIC1 ou TgMIC4 foram incorporados no
vetor com auxílio de enzima de ligação (A). Em seguida, os produtos da ligação foram inseridos em
bactérias competentes, que foram inoculadas em meio seletivo LB sólido, contendo 100 μg/ml de
carbenicilina. Posteriormente, selecionamos 13 colônias para TgMIC1 (B) e 20 para TgMIC4 (C), e a
presença do gene de interesse foi detectada por PCR. Os produtos foram analisados em gel de agarose
1%. O marcador utilizado foi GeneRulerTM 1kb DNA Ladder.
Em seguida, cepas de T. gondii nocauteadas para TgMIC1 ou TgMIC4 foram
transfectadas com os plasmídeos contendo o gene WT de TgMIC1 ou TgMIC4,
respectivamente, para avaliarmos a eficiência do constructo antes de realizarmos as mutações
pontuais por PCR. Após 24 horas, a expressão de GFP não foi detectada por microscópio de
fluorescência. Para detectar se houve problema na expressão e secreção de TgMIC para a
superfície do parasito, os taquizoítas foram mantidos durante sete dias em meio seletivo
(cloranfenicol 20 μM), e tiveram a expressão de TgMIC1 e GFP avaliada por citometria de
fluxo. Para tanto, taquizoítas transfectados foram incubados com anticorpo primário α-TgMIC1
ou α-GFP, seguidos de incubação com anticorpo secundário α-mouse-APC. Não foi possível
Resultados | 59
avaliar a expressão de TgMIC4 devido a ausência de anticorpo para essa proteína. As amostras
foram adquiridas em citômetro de fluxo e analisadas. Na figura 13B, podemos observar a
detecção da expressão de TgMIC1 em parasitos WT, mas não em parasitos TgMIC1-/-, que
foram utilizados como controles positivo e negativo, respectivamente. Não detectamos
expressão de TgMIC1 em parasitos nocauteados que foram transfectados com o plasmídeo
contendo o gene para essa proteína (figura 13C), assim como não foi detectada a expressão nos
parasitos transfectados com o plasmídeo vazio. Além disso, a expressão de GPF foi observada
tanto nos parasitos transformados com o plasmídeo contendo TgMIC1, quanto o plasmídeo
vazio (figura 13C). Controles para a marcação estão representados (figura 13A). Em paralelo,
verificamos a expressão de TgMIC1 por PCR e constatamos a presença do gene codificador da
proteína, indicando o sucesso da transfecção (figura 13D). TgMIC1 amplificada a partir do
cDNA de T. gondii, parasitos WT, TgMIC1-/-, TgMIC4-/- e DKO foram utilizados como
controles. Esses resultados não indicam problemas na transfecção, porém demonstram que a
proteína TgMIC1 não conseguiu ser secretada e expressa na superfície do parasito. Sugerimos
que o dobramento da TgMIC+GFP não foi realizado com sucesso, impedindo esse fato. O
mesmo pode ter ocorrido para parasitos transfectados com TgMIC4, uma vez que não
detectamos a expressão de GFP fluorescente, por microscopia de fluorescência. A ausência de
sucesso nessa construção nos obrigou a construir e utilizar outro vetor (pLUC-GFP) para as
clonagens com os genes de TgMIC1 e TgMIC4 WT, para em seguida realizarmos as mutações
pontuais por PCR. Até o momento de entrega deste trabalho, os experimentos estão em
andamento e serão finalizados em breve.
Resultados | 60
A
B
D
C
Figura 13. Expressão de TgMIC1 após a transfecção. Após a transfecção de parasitos TgMIC1-/- com
o plasmídeo contendo a sequência de TgMIC1 fusionada à GFP ou com o plasmídeo vazio, avaliamos a
expressão de ambas as proteínas por citometria de fluxo. Depois de três passagens em meio seletivo
(clorafenicol 20 μM), os parasitos foram incubados com anticorpo primário α-TgMIC1 (1:100) ou α-GFP
(1:100), seguidos de incubação com anticorpo secundário α- IgG de camundongo (1:200), marcado com
fluorocromo APC (C). Parasitos WT e TgMIC1-/- foram utilizados como controles para expressão de
TgMIC1 (B). Controles: parasitos não marcados, isotipo controle e somente anticorpo secundário estão
representados (A). As amostras foram adquiridas em citômetro de fluxo e analisadas no software FlowJo.
Adicionalmente, a expressão de TgMIC1 foi analisada por PCR a partir do DNA genômico dos parasitos
WT, TgMIC1-/-, TgMIC4-/-, DKO, TgMIC1-/- + plasmídeo TgMIC1 e TgMIC1-/- + plasmídeo vazio (D).
O material foi analisado em gel de agarose 1%, e o marcador utilizado foi GeneRuler TM 1kb DNA
Ladder. Resultados são representativos de dois experimentos.
Objetivos | 61
Discussão
Discussão | 62
Neste estudo, investigamos a ativação de células da imunidade inata desencadeada a
partir de interações estabelecidas por proteínas de micronema 1 e 4 de Toxoplasma gondii com
receptores do tipo toll 2 e 4. Tais interações resultam em importante produção de IL-12 que,
associada à liberação de IFN-γ, é responsável pelo clearance do protozoário e o desenvolvmento
de resposta protetora para o hospedeiro. Demonstramos ainda que a secreção de IL-12 depende
do reconhecimento de glicanas N-ligadas aos ectodomínios dos TLRs extracelulares alvejados.
Diversos microorganismos patogênicos sintetizam proteínas ligantes de carboidratos, e
através delas, tiram proveito dos glicoconjugados da superfície de células do hospedeiro para
aderir a elas e colonizar tecidos. No caso da infecção por T. gondii, as interações iniciais com a
célula hospedeira dependem criticamente de componentes de superfície e de proteínas
secretadas, dentre elas lectinas, que medeiam eventos como adesão e invasão (Jung et al., 2004;
Macêdo et al., 2013). Essas interações podem promover eventos de transdução de sinal e
ativação celular, capazes de interferir na colonização e na infecção, já que induzem a resposta
imunitária do hospedeiro (Mineo et al., 1993; Pinzan, 2010; Macêdo et al., 2013).
As proteínas de micronema, algumas delas alvos deste trabalho, são expressas na
superfície do parasito e também secretadas na forma solúvel. Muitas dessas proteínas formam
complexos, como o derivado da associação de TgMIC1, TgMIC4 e TgMIC6 (TgMIC1/4/6).
Estudos prévios demonstraram a natureza lectínica do subcomplexo nativo TgMIC1/4,
originalmente identificado por sua capacidade de lgação à lactose imobilizada, na ocasião
atribuída à TgMIC1 (Lourenço et al., 2001). Entretanto, um estudo detalhado da estrutura
atômica dessa proteína revelou que ela se liga ao ácido siálico, e não à lactose (Friedrich et al.,
2010). Esses dados favoreceram a ideia de que TgMIC4, e não TgMIC1, fosse responsável pela
ligação do subcomplexo à lactose. Mais tarde, a especificidade de TgMIC4 por galactose foi
demonstrada num amplo estudo liderado por S. Mathews e que contou com a colaboração do
nosso grupo (Marchant et al., 2012). Nesse trabalho, demonstramos que as proteínas de
micronema 1 e 4 recombinantes reproduzem suas atividades de ligação ao ácido siálico e à
galactose, respectivamente, como anteriormente indicado pela interação com as glicoproteínas
fetuína e asialofetuína (figura 2). Esse fenômeno é atribuído a resíduos de aminoácidos
específicos presentes no domínio de reconhecimento de carboidrato (CRD) de TgMIC1 e
TgMIC4. Para TgMIC1, dois resíduos de treonina, nas posições 126 e 220, são críticos para o
reconhecimento de ácido siálico (Blumenschein et al., 2007; revisto por Hager & Carruthers,
2008), enquanto que para TgMIC4, apenas a lisina na posição 469 é crítica para o
Discussão | 63
reconhecimento de β-galactose na superfície da célula hospedeira (Marchant et al., 2012).
Quando substituímos esses resíduos por aminoácido de características distintas, as proteínas de
micronema 1 e 4 perderam sua capacidade de ligação a glicanas, de modo semelhante àquelas
que tiveram seu CRD bloqueado fisicamente pelo oligossacarídeo específico (figura 2). Esses
resultados indicaram que as mutações pontuais prejudicaram a atividade lectínica dessas MICs.
O subcomplexo nativo TgMIC1/4, conforme demonstrado por Lourenço e colaboradores
(2001), estimula células esplênicas murinas a secretarem IL-12 , em níveis similares aos
induzidos pelo antígeno solúvel de T. gondii, STAg. Além disso, nosso grupo constatou que
células HEK tranfectadas com plasmídeos para TLR2/1, TLR2/6 e TLR4 são ativadas em
resposta ao estímulo com TgMIC1 e TgMIC4 recombinantes, conforme demontrado pelo
aumento da produção de IL-8 (Lopes, 2012; Mendonça, 2014). Esse fato indicou uma possível
interação das proteínas de micronema com os receptores do tipo toll expressos na superfície
celular, que foi mais detalhadamente investigada neste trabalho. Ele foi desenhado para
investigar se as lectinas TgMIC1 e TgMIC4 de T. gondii interagem com as N-glicanas presentes
nos receptores do tipo toll 2 e 4, causando a ativação de células dendríticas e macrófagos. Aqui,
demonstramos que TgMIC1 e TgMIC4 ativam células dendríticas e macrófagos a produzirem
níveis elevados de diversas citocinas – IL-12, TNF-α, IL-6 e IL-10 (figura 3) – de modo
semelhante ao que é promovido por agonistas de TLR2 e TLR4. Confirmamos que essa ativação
depende, principalmente, da sinalização intreacelular mediada pela molécula adaptadora
MyD88, enquanto que a sinalização via TRIF está apenas parcialmente envolvida nessa
resposta. Esses dados corroboram com os achados de que a ausência, simples ou concomitante,
de TLR2 e TLR4, mas não de TLR11 e TLR12, está associada ao prejuízo na secreção de IL-12
induzida pelas proteínas de micronema 1 e 4 (figura 4), que ativam de maneira indireta e
majoritária a transcrição de NF-kB (figura 6). Constatamos, por fim, que esse fenômeno
observado resulta do reconhecimento de resíduos de ácido siálico por TgMIC1 e galactose por
TgMIC4, pois a ativação celular é afetada quando o estímulo foi procedido com as proteínas
mutadas em seus CRDs (figura 7). Esses achados corroboram com trabalhos do nosso grupo que
mostram que as proteínas de micronema interagem com N-glicanas de TLR2, induzindo a
ativação de células HEK transfectadas (Lopes, 2012; Mendonça 2014). Além disso, ensaios de
glycoarray demonstraram que TgMIC1 liga-se com alta afinidade a resíduos de α2-3
sialilactosaminas enquanto TgMIC4 liga-se a resíduos β1-3 ou β1-4 galactosaminas (Lopes,
2012). Estudos mais recentes do nosso grupo, utilizando glicomutantes de TLR2, confirmaram
Discussão | 64
que a ativação desse receptor por proteínas de micronema 1 e 4 depende do reconhecimento de
N-glicanas desse receptor. Foi demonstrado que TgMIC1 interage especificamente com a
segunda, a terceira e a quarta glicanas de TLR2, enquanto que TgMIC4 reconhece apenas a
terceira glicana (Mendonça, 2014). Esses resultados indicam que as glicanas de TLR2 que são
importantes para a ativação celular desencadeada por MICs têm na sua constituição os
glicoalvos específicos para o reconhecimento pelas respectivas MICs.
Lectinas de patógenos e plantas tem sido descritas por também possuírem a propriedade
de reconhecer resíduos de açúcar na estrutura de TLRs e de induzirem produção de IL-12 por
células da imunidade inata. Paracoccina, uma lectina do fungo Paracoccidioides brasiliensis,
induz produção de citocinas por macrófagos de maneira dependente de TLR2 e TLR4, por
interagir com resíduos de N-acetilglicosamina presentes na quarta N-glicana do receptor
(Alegre-Maller, 2014). Além disso, GAL (galactose-adherence lectin) de Entamoeba histolytica
(Campbell et al., 2000) ativa TLR2 e induz a produção de IL-12 (Campbell et al., 2000). A
lectina SP-A, caracteristicamente presente nos alvéolos pulmonares, interage com o ectodomínio
de TLR2 (Murakami et al., 2002). Sobre as lectinas oriundas de plantas, essa seletividade por
glicanas exibidas por um ou outro TLR já foi demonstrada anteriormente e revelou padrões de
reconhecimento bastante variáveis, como ilustram os seguintes exemplos: (a) ArtinM, ligante de
manose, foi caracterizada por ativar TLR2; (b) PHA-L, ligante de galactose, manose e Nacetilglicosamina, estimulou TLR4; (c) SBA e PNA, ligantes de N-acetilgalactosamina e
galactose, respectivamente, também ativaram apenas TLR4; (d) ConA, ligante de manose e
glucose, ativou apenas heterodímeros constituídos de TLR2 e TLR6; (e) AIL, ligante de
galactose de galactose e N-acetilgalactosamina, revelou-se incapaz de ativar qualquer dos TLRs
ensaiados; (f) WGA, ligante de N-acetilglucosamina/ácido siálico, foi a lectina mais promíscua,
ativando todos os TLRs com exceção dos 3 e 4. Da mesma maneira, lectinas de patógenos e de
mamíferos mostraram seletividade de ligação a TLRs (revisto por Unitt & Hornigold, 2011 e
Souza et al., 2013).
A especificidade de TgMIC1 e TgMIC4 por TLR2 e TLR4, bem como a de outras
lectinas citadas, pode estar associada à posição do resíduo de açúcar específico, presente na
estrutura da N-glicana do receptor, uma vez que TgMIC1 reconhece ácido siálico α2-3 ligado à
resíduos de galactose, e TgMIC4 reconhece β1-3 e β1-4 galactosaminas. Como as estruturas das
N-glicanas de TLR2 e TLR4 não são conhecidas, nós sugerimos que elas possuam esses
Discussão | 65
resíduos, que são especificamente reconhecidos pelas proteínas de micronema, desencadeando
assim a resposta imune inata.
Por outro lado, existem proteínas do parasito que induzem a produção de citocinas próinflamatórias, resposta esta que é independente do reconhecimento de carboidrato. É o caso da
profilina (TgPRF), proteína essencial para a motilidade do parasito (gliding) dependente da
polimerização de actina. A profilina é liberada antes da invasão, e pode ser reconhecida por
TLR11 e TLR12, desencadeando produção de IL-12 por células dendríticas e macrófagos
(Yarovinsky et al., 2005; Plattner et al., 2008; Kucera et al., 2010; Koblansky et al., 2012). Além
disso, outros componentes do parasito induzem produção de citocinas pró-inflamatórias
(especialmente IL-12) de maneira independente dos receptores do tipo toll. Por exemplo, a
proteína de grânulo denso 7 (GRA7), secretada pelo parasito após a formação do vacúolo
parasitóforo, interage diretamente com TRAF6 e induz a ativação de NF-kB de modo
dependente de MyD88, levando à produção de IL-12, TNF-α e IL-6 por macrófagos; essa
demonstração foi feita através do estímulo de macrófagos derivados da medula óssea com a
forma recombinante de GRA7 (Yang et al., 2016). De forma semelhante, GRA15, outra proteína
de grânulo denso, ativa diretamente a subunidade p65 de NF-kB no núcleo, induzindo sua
transcrição e a consequente secreção de IL-12, de maneira dependente de TRAF6 e IKK-β e
independente de MyD88 (Rosowski et al., 2011). Atribui-se a GRA15 grande parte da
responsabilidade por diferenças nos níveis de IL-12 produzidos por distintas cepas de T. gondii.
Parasitos avirulentos do tipo II, quando nocauteados para GRA15 replicam-se mais rapidamente
do que parasitos WT da mesma cepa, fato que é atribuído aos níveis reduzidos de IL-12 e IFN-γ
verificados em camundongos BALB/c (Rosowski et al., 2011). Assim como TgMIC1 e
TgMIC4, os componentes TgPRF, GRA7 e GRA15 de T. gondii contribuem para a imunidade
protetora do hospedeiro através da indução de citocinas pró-inflamatórias, que ocorre de maneira
dependente dos receptores do tipo toll no caso da profilina, e independente, no caso de GRA7 e
GRA15.
No entanto, T. gondii dispõe de mecanismos capazes de balancear esse quadro
inflamatório gerado diretamente pela ação de TgMIC1, TgMIC4, TgPRF, GRA7 e GRA15 e de
subverter a resposta imune gerada pelo hospedeiro, favorecendo assim a sobrevivência e a
replicação do parasito e o estabelecimento da infecção. Para isso, o parasito lança mão de
proteínas de roptrias (ROPs), introduzidas na célula hospedeira durante a formação do vacúolo
parasitóforo, como é o caso de ROP5, ROP16, ROP17 e ROP18 (Boothroyd e Dubremetz, 2008;
Discussão | 66
revisto por Boothroyd, 2013). A maioria das ROPs possui homologia com proteínas quinases:
ROP5 é uma pseudoquinase (pois apresenta o domínio catalítico inativo); ROP16 uma tirosinoquinase, ROP17 e ROP18 são serina/treonina-quinases (revisto por Boothroyd, 2013). Essas
proteínas têm como alvo principal moléculas do hospedeiro associadas aos mecanismos de
controle intracelular de patógenos, as IRGs (immuno-regulated GTPases), que destroem a
membrana do vacúolo parasitóforo, impedindo a sobrevivência e replicação do parasito (revisto
por Boothroyd, 2013; Jensen et al., 2015). ROP5 liga-se a moléculas de IRG, impedindo assim
sua oligomerização (Fleckenstein et al., 2012; Niedelman et al., 2012); em seguida ROP5 forma
um complexo com as quinases ROP17 e ROP18, evitando o recrutamento de IRGs para a
membrana do vacúolo parasitóforo contendo T. gondii e prevenindo a eliminação do parasito
pelos macrófagos ativados por IFN-γ (revisto por Boothroyd, 2013; Etheridge et al., 2014).
Além disso, ROP18 é capaz de invadir o núcleo da célula hospedeira e promover diretamente a
degradação da subunidade p65 de NF-kB, impedindo assim a produção de IL-12, TNF-α e IL-6
por macrófagos infectados (Du et al., 2014). ROP5 e ROP18 também estão relacionadas à
virulência de cepas atípicas originadas da América do Sul, especialmente associadas à infecção
secundária pelo protozoário (Jensen et al., 2015). Tal qual ROP5, ROP17 e ROP18, a proteína
ROP16 subverte a resposta imune inflamatória gerada pelo hospedeiro. Por ser uma proteína
tirosino-quinase, ROP16 fosforila diretamente STAT3 e STAT6, ativa essas moléculas e induz
perfil regulador, inibindo a produção de citocinas e o controle do crescimento dependente da
expressão de arginase-1, um aminoácido essencial para replicação e virulência de T. gondii (Ong
et al., 2010; Butcher et al., 2011).
Os resultados que obtivemos nos ensaios in vitro com as proteínas de micronema 1 e 4
purificadas reforçaram nossa hipótese de que elas estejam associadas à indução da resposta
imune inata contra T. gondii de maneira dependente de TLR2 e TLR4 durante a infecção. Esses
resultados demonstram que a IL-12 produzida por células dendríticas derivadas da medula óssea,
durante as primeiras 24 horas de infecção por T. gondii (WT), depende da ativação de TLR2 e
TLR4, mas não de TLR11 e TLR12. Demonstramos ainda que esse evento é dependente da
ativação da molécula adaptadora MyD88 (figura 8). Nossos achados são coerentes com estudos
prévios que ressaltam a importância da molécula MyD88 na resistência da infecção por T.
gondii, pois essa via regula a produção de IL-12 por células dendríticas induzida pelo parasito
(Scanga et al., 2002). Debierre-Grockiego e colaboradores (2007) observaram ainda, que
moléculas de glicofosfatidilinositol (GPIs), core de glicanas neutras e radicais lipídicos de
Discussão | 67
T.gondii ativam TLR2 e TLR4, induzem a ativação de MyD88 e NF-kB, culminando em baixa,
mas consistente, produção de IL-12 e IFN-γ por células esplênicas. Ademais, essa interação
induziu níveis elevados de TNF-α por células da imunidade inata estimuladas, produção que não
está envolvida com o desenvolvimento de linfócitos Th1 em camundongos infectados com T.
gondii (Debierre-Grockiego et al., 2007). Entretanto, não houve diferença entre os níveis de IL12 produzidos por células dendríticas selvagens e duplamente nocauteadas para TLR11 e
TLR12, o que contrasta com que relatam ser a profilina reconhecida por esses receptores, e que
a ausência dos mesmos durante a infecção leva a prejuízo significativo na secreção de IL-12.
Esse fato pode estar relacionado à diferença da origem das células utilizadas, uma vez que
nossos ensaios foram realizados em células dendríticas derivadas da medula óssea, enquanto que
Plattner e colaboradores (2008) e Koblansky e colaboradores (2013) utilizaram células
dendríticas CD11c+ provenientes de baço. Células dendríticas da medul óssea e do baço
apresentam expressão distinta de TLRs, juntificando-se assim o fato de que em nossos ensaios a
produção de IL-12 induzida pelo agonista de TLR4 (LPS) chegou a 30 nanogramas por mililitro,
enquanto que em resposta ao estímulo com STAg a secreção dessa citocina não ultrapassou 3
ng/ml. No caso das células dendríticas esplênicas, ocorre o inverso, a produção de IL-12
estimulada por LPS atige níveis entre 2,5 a 3 ng/ml, enquanto STAg induz 10 nanogramas de
IL-12 por mililitro (Plattner et al., 2008; Koblansky et al., 2013). Essas observações indicam que
a expressão de TLR4 é maior em células dendríticas derivadas da medula óssea do que nas
provenientes de baço, enquanto que a expressão de TLR11 e TLR12 é baixa; o oposto é sugerido
para as DCs esplênicas, que expressam menores níveis de TLR4 e maiores de TLR11 e TLR12.
Esses dados corroboram com o que foi demonstrado para TLR7, onde diferentes subtipos de
células dendríticas respondem de maneira diferente ao estímulo com seu agonista,
imidazoquinolina, sendo o subtipo CD8α+ irresponsivo devido à falta de expressão de TLR7
(Edwards et al., 2003).
Por fim, nossas observações sugerem que, especialmente, TgMIC1 contribui para a
secreção de IL-12 por macrófagos e células dendríticas durante as primeiras 48 horas de
infecção pelo protozoário, sendo que durante as primeiras 12 horas os níveis de IL-12 parecem
depender exclusivamente do estímulo por TgMIC1, uma vez que não foi detectada produção
dessa citocina por DCs infectadas com parasitos TgMIC1-/- (figura 9). O mesmo perfil de
ativação foi gerado pelos taquizoítas duplo nocaute (TgMIC1-/-/MIC4-/-). Apesar de não
detectarmos a participação efetiva de TgMIC4 na ativação das células da imunidade inata
Discussão | 68
infectadas, acreditamos que essa lectina participe da indução de IL-12 durante a infecção por T.
gondii, uma vez que observamos esse fenômeno nos ensaios in vitro com a proteína purificada.
O fato de não demonstrarmos aqui o papel de TgMIC4 durante a infecção por T. gondii pode
estar relacionado a não secreção dessa proteína no parasito TgMIC1-/-. Essa ideia é
fundamentada em estudos prévios que comprovam que TgMIC4 e TgMIC6 dependem da
expressão de TgMIC1 para serem transportadas através da via secretória, bem como para as
organelas micronemas, e consequentemente, para a superfície celular do protozoário (Reiss et
al., 2001; Marchant et al., 2012). Parasitos TgMIC1-/- ou TgMIC6-/- deixam de secretar
TgMIC4/MIC6 ou TgMIC1/MIC4 na superfície celular, respectivamente. Em ambos os casos, a
ausência de um ou de outro gene não impede a adesão e a invasão dos taquizoítos em células
HFF, uma vez comparados ao parasito WT parental (Reiss et al., 2001). Nesse caso, as proteínas
TgMIC4 e TgMIC6 ou TgMIC1 e TgMIC4 ficam retidas nos compartimentos intracelulares na
região perinuclear, como o retículo endoplasmático e o complexo de Golgi, e a reposição da
expressão de TgMIC1 em parasitos nocauteados para essa proteína restaura o transporte de
TgMIC4 e TgMIC6 (Reiss et al., 2001). Mais recentemente, Marchant e colaboradores (2012)
propuseram um modelo para a expressão e secreção de TgMIC1 e TgMIC4, no qual TgMIC1 é
secretada na forma de homotrímero e TgMIC1/TgMIC4 na forma de heterohexâmero. Esses
dados indicam que o parasito TgMIC1-/- não secreta TgMIC4, mas o parasito TgMIC4-/- secreta
TgMIC1. No que tange às nossas observações, ao analisarmos a infecção de células dendríticas e
macrófagos por parasitos TgMIC4-/-, observamos a produção de IL-12 inicial sendo estimulada
por TgMIC1, o que compensa a ausência de TgMIC4. Já na infecção com parasitos TgMIC1-/ocorre o mesmo perfil verificado com parasitos DKO, pois ambos não secretam TgMIC1 e nem
TgMIC4. Uma vez que demonstramos que essa ativação é dependente do reconhecimento de
carboidrato, iniciamos a geração de parasitos transgênicos, no sentido de restituir a expressão e
secreção das proteínas de micronema 1 e 4, em parasitos simples nocaute, carreando as
mutações pontuais em seus CRDs (TgMIC1 – T126A/T220A; TgMIC4 – K469M). Essa
estratégia foi pensada no sentido de tentar observar se TgMIC4 realmente participa da indução
de IL-12 durante o início da infecção por T. gondii, bem como confirmar se nossos achados com
as proteínas purificadas reproduzem o que acontece durante a infecção inicial pelo parasito.
Nossos achados sobre o papel de TgMIC1 e TgMIC4 durante o início da infecção por T.
gondii demonstram, pela primeira vez, a importância do reconhecimento de carboidratos do
hospedeiro por proteínas do parasito na indução de uma resposta imune protetora. Em conjunto,
Discussão | 69
nossos resultados contribuem para o entendimento das estratégias de sobrevivência e o sucesso
no estabelecimento do parasito em diferentes organismos, uma vez que T. gondii possui
mecanismos complexos de orquestrar o curso da infecção.
Conclusões | 70
Conclusões
Conclusões | 71
Os resultados apresentados neste estudo nos levam a concluir que:
1. TgMIC1 e TgMIC4 induzem células dendríticas e macrófagos a produzirem IL-12, TNF-α,
IL-6 e IL-10 via ativação de MyD88 e de receptores do tipo toll 2 e 4.
2. A ativação de células da imunidade inata associa-se ao reconhecimento de resíduos de ácido
siálico e de galactose supostamente presentes nas N-glicanas de TLR2 e TLR4.
3. A produção de IL-12 durante as primeiras 24 horas de infecção in vitro por Toxoplasma
gondii depende de TLR2 e TLR4.
4. TgMIC1 é indispensável para a ativação de células dendríticas e macrófagos durante o
período inicial de infecção pelo parasito.
Referências Bibliográficas | 72
Referências Bibliográficas
Ajioka, J.W., Fitzpatrick J.M., Reitter C.P. Toxoplasma gondii genomics: shedding light on pathogenesis
and chemotherapy. Expert Reviews in Molecular Medicine, p.1-19, 2001.
Alegre-Maller, A.C.P. Paracoccina recombinante reproduz as propriedades biológicas da lectina
nativa e induz imunidade protetora contra a infecção por Paracoccidioides brasiliensis. Tese
(Doutorado em Biologia Celular e Molecular). Faculdade de Medicina, Universidade de São Paulo,
Ribeirão Preto, 2014. 161p.
Aliberti J., Reis e Sousa C., Schito M., Hieny S., Wells T., Huffnagle G.B., Sher A. CCR5 provides a
signal for microbial induced production of IL-12 by CD8 alpha+ dendritic cells. Nature Immunology, v.
1, n. 1, p. 83-87, 2000.
Aliberti J., Jankovic D., Sher A. Turning on and off: regulation of dendritic cell function in Toxoplasma
gondii infection. Immunological Reviews, v. 201, p. 26-34, 2004.
Ashour D.S. Toll-like receptor signaling in parasite infections. Expert Review of Clinical Immunology,
v. 11, n. 6, p. 771-780, 2015.
Bliss, S. K., A. J. Marshall, et al. Human polymorphonuclear leukocytes produce IL-12, TNF-alpha, and
the chemokines macrophage-inflammatory protein-1 alpha and -1 beta in response to Toxoplasma gondii
antigens. Journal of Immunology, v. 162, n. 12, p.7369-75, 1999.
Blumenschein, T. M., Friedrich N., et al. Atomic resolution insight into host cell recognition by
Toxoplasma gondii. The EMBO Journal, v. 26, n.11, p.2808-20, 2007.
Boothroyd J.C., Dubremetz J.F. Kiss and spit: the dual roles of Toxoplasma rhoptries. Nature Reviews
Microbiology, v. 6, p. 79-88, 2008.
Boothroyd J.C. Have it your way: how polymorphic, injected kinases and pseudokinases enable
Toxoplasma to subvert host defenses. Plos Pathogens, v. 9, n. 6, e1003296, 2013.
Brencht, S.; Carruthres,V.B., Fergunson,D.J.P et al. The Toxoplasma micronemal protein MIC4 is an
adhesin composed of six conserved apple domains. Jounal of Biological Chemistry, v. 276, p. 41194127, 2001.
Butcher B.A., Fox B.A., Rommereim L.M. et al. Toxoplasma gondii rhoptry kinase ROP16 activates
STAT3 and STAT6 resulting in cytokine inhibition and arginase-1-dependent growth control. Plos
Pathogens, v. 7, n. 9, e1002236, 2011.
Campbell, D., B. J. Mann, et al. A subunit vaccine candidate region of the Entamoeba histolytica
galactose-adherence lectin promotes interleukin-12 gene transcription and protein production in human
macrophages. European Journal of Immunology, v. 30, n. 2, p.423-30, 2000.
Carruthers, V. B. e L. D. Sibley. Sequential protein secretion from three distinct organelles of
Toxoplasma gondii accompanies invasion of human fibroblasts. European Journal of Cell Biology, v.
73, n. 2, p.114-23, 1997.
Carruthres, V.B.; Giddings, O.K.; Sibley, L.D. Secretion of micronemal proteins is associated with
Toxoplasma invasion of host cells. Cellular Microbiology, v. 1, p. 225-235, 1999.
Debierre-Grockiego, F., M. A. Campos, et al. Activation of TLR2 and TLR4 by
glycosylphosphatidylinositols derived from Toxoplasma gondii. Journal of Immunology, v. 179, n. 2,
p.1129-37, 2007.
Debierre-Grockiego F., Niehus S., Coddeville B. et al. Binding of Toxoplasma gondii
glycosylphosphatidylinositols to galectin-3 is required for their recognition by macrophages. Journal of
Biological Chemistry, v. 43, n. 285, p. 32744-50, 2010.
Denkers, E. Y.; Butcher B. A.; et al. Neutrophils, dendritic cells and Toxoplasma. International Journal
for Parasitology, v. 34, n. 3, p.411-21, 2004.
Denkers, E. Y. Toll-like receptor initiated host defense against Toxoplasma gondii. Journal of
Biomedicine & Biotechnology, v. 2010, 737125, p. 1-7, 2010.
Denkers E.Y., Bzik D.J., Fox B.A., Butcher B.A. An inside job: hacking into Janus kinase/signal
transducer and activator of transcription signaling cascades by the intracellular protozoan Toxoplasma
gondii. Infection and Immunity, v. 80, n. 2, p. 476-482, 2011.
Dobrowolski, J. e L. D. Sibley. The role of the cytoskeleton in host cell invasion by Toxoplasma gondii.
Behring Institute Mitteilungen, n. 99, p.90-96, 1997.
Du J., An R., Chen L., Shen Y., Chen Y., Cheng L., Jiang Z., et al. Toxoplasma gondii virulence factor
ROP18 inhibits the host NF-kB pathway by promoting p65 degradation. Journal of Biological
Chemistry, v. 289, n. 18, p. 12578-12592, 2014.
Dubey, J. P., R. M. Weigel, et al. Sources and reservoirs of Toxoplasma gondii infection on 47 swine
farms in Illinois. The Journal of Parasitology, v. 81, n. 5, p.723-729, 1998.
Dubey JP. Toxoplasmosis of animals and humans. 2nd ed. Boca Raton, FL, USA: CRC Press. 336p.,
2009.
Edwards A.D., Diebold S.S., Slack E.M., Tomizawa H., Hemmi H., Kaisho T., Akira S., Reis e Sousa C.
Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8 alpha+ DC
correlates with unresponsiveness to imidazoquinolines. European Journal of Immunology, v. 33, n. 4,
p. 827-833, 2003.
Etheridge R.D., Alaganan A., Tang K., Lou H.J., Turk B.E., Sibley D. The Toxoplasma pseudokinase
ROP5 forms complexes with ROP18 and ROP17 kinases that synergize to control acute virulence in
mice. Cell Host & Microbe, v. 15, p. 537-550, 2014.
Fischer, H. G., U. Bonifas, et al. Phenotype and functions of brain dendritic cells emerging during
chronic infection of mice with Toxoplasma gondii. Journal of Immunology, v. 164, n. 9, p. 4826-4834,
2000.
Fleckenstein M.C., Reese M.L., Könen-Waisman S., Boothroyd J.C., Howard J.C., et al. A Toxoplasma
gondii pseudokinase inhibits host IRG resistance proteins. Plos Biology, v. 10, n. 7, e1001358, 2012.
Fourmaux, M. N., A. Achbarou, et al. The MIC1 microneme protein of Toxoplasma gondii contains a
duplicated receptor-like domain and binds to host cell surface. Molecula and Biochemical Parasitology,
v. 83, n. 2, p. 201-210, 1996.
Friedrich N., Santos J.M., Liu Y. et al. Members of a novel protein family containing microneme
adhesive repeat domains act as sialic acid-binding lectins during host cell invasion
by apicomplexan parasites. Journal of Biological Chemistry, v. 3, p.2064-76, 2010.
Gay, N. J. e M. Gangloff. Structure and function of Toll receptors and their ligands. Annual Review of
Biochemistry, v. 76, p. 141-165, 2007.
Gazzinelli, R. T., S. Hieny, et al. Interleukin 12 is required for the T-lymphocyte-independent induction
of interferon gamma by an intracellular parasite and induces resistance in T-cell-deficient hosts.
Proceedings of the National Academy of Sciences USA, v. 90, n. 13, p.6115-9, 1993.
Gazzinelli, R. T., D. Amichay, et al. Role of macrophage-derived cytokines in the induction and
regulation of cell-mediated immunity to Toxoplasma gondii. Current Topics in Microbiology and
Immunology, v. 219, p. 127-139, 1996a.
Gazzinelli, R. T., M. Wysocka, et al. In the absence of endogenous IL-10, mice acutely infected with
Toxoplasma gondii succumb to a lethal immune response dependent on CD4+ T cells and accompanied
by overproduction of IL-12, IFN-gamma and TNF-alpha. Journal of Immunology, v. 157, n. 2, p.798805, 1996b.
Gorelik M., Frischmeyer-Guerrerio P.A. Innate and adaptative dendritic cell responses to
immunotherapy. Current Opinion in Allergy and Clinical Immunology, v. 15, n. 6, p. 575-580, 2015.
Hager K.M., Carruthers V.B. MARveling at parasite invasion. Trends in Parasitology, v. 24, n. 2, p. 5154, 2008.
Hunter, C. A., C. S. Subauste, et al. Production of gamma interferon by natural killer cells from
Toxoplasma gondii-infected SCID mice: regulation by interleukin-10, interleukin-12, and tumor necrosis
factor alpha. Infection and Immunology, v. 62, n. 7, p. 2818-24, 1994.
Jankovic, D., M. C. Kullberg, et al. Conventional T-bet(+)Foxp3(-) Th1 cells are the major source of
host-protective regulatory IL-10 during intracellular protozoan infection. Journal of Experimental
Medicine, v. 204, n. 2, p.273-283, 2007.
Jensen K.D., Camejo A., Melo M.B., Cordeiro C., Julien L., Grotenbreg G.M., et al. Toxoplasma gondii
superinfection and virulence during secondary infection correlate with the exact ROP5/ROP18 allelic
combination. mBio, v. 6, n. 2: e02280, 2015.
Jewett, T.J. e Sibley, L.D. Aldolase forms a bridge between cell surface adhesins and the actin
cytoskeleton in apicomplexan parasites. Mol Cell, v.11, n.4, Apr, p.885-94. 2003.
Jung C., Lee C.Y., Grigg M.E. The SRS superfamily of Toxoplasma surface proteins. International
Journal for Parasitology, v. 34, n. 3, p. 285-96, 2004.
Kammanadiminti, S. J., B. J. Mann, et al. Regulation of Toll-like receptor-2 expression by the Gal-lectin
of Entamoeba histolytica. FASEB Journal, v. 18, n.1, p.155-7, 2004.
KAWAI T., AKIRA S.The role of pattern-recognition receptors in innate immunity: update on Toll-like
receptors. Nature Immunology, v. 11, n. 5, p. 373-384, 2010.
Koblansky A.A., Jankovic D., Oh H., Hieny S., Sungnak W., Mathur R., et al. Rognition of profiling by
Toll-like receptor 12 is critical for host resistance to Toxoplasma gondii. Immunity, v. 38, n. 1, p. 119130, 2012.
Kucera K., Koblansky A.A., Saunders L.P. et al. Structure-based analysis of Toxoplasma gondii profilin:
a parasite-specific motif is required for recognition by Toll-like receptor 11. Journal of Molecular
Biology, v. 403, n. 4, p.616-629, 2010.
Lopes, C.D. Dissecção molecular da interação de proteínas 1 e 4 de micronema de Toxoplasma
gondii com glicanas de TLRs (Toll-like Receptors). Tese (Doutorado em Biologia Celular e Molecula)
– Faculdade de Medicina, Universidade de São Paulo, Ribeirão Preto, 2012.
Lourenço, E. V., S. R. Pereira, et al. Toxoplasma gondii micronemal protein MIC1 is a lactose-binding
lectin. Glycobiology, v. 11, n. 7, p.541-547, 2001.
Luft B.J., Remington J.S. Toxoplasmic encephalitis in AIDS. Clinical infectious diseases : an official
publication of the Infectious Diseases Society of America, v. 15, n. 2, p. 211-22, 1992.
Macêdo A.G., Cunha J.P., Cardoso T.H., Silva M.V., Santiago F.M., Silva J.S., et al. SAG2A protein
from Toxoplasma gondii interacts with both innate and adaptive immune compartments of infected hosts.
Parasites & vectors, v. 6, n. 163, p. 1-12, 2013.
Marchant, J., Cowper, B., Liu, Y., Lai L., Pinzan C.F., et al. Galactose recognition by the apicomplexan
parasite Toxoplasma gondii. Journal of Biological Chemistry, v. 287, n. 20, p. 16720-33, 2012.
Mendonça F.C. Interação de proteínas de micronema de Toxoplasma gondii com N-glicanas de
TLR2. Dissertação (Mestrado em Biologia Celular e Molecular). Faculdade de Medicina, Universidade
de São Paulo, Ribeirão Preto, 2014. 95p.
Mineo J.R., McLeod R., Mack D., Smith J., Khan I.A., Ely K.H. Kasper L.H. Antibodies to Toxoplasma
gondii major surface protein (SAG-1, P30) inhibit infection of host cells and are produced in murine
intestine after peroral infection. Journal of Immunology, v. 150, p. 3951-3964, 1993.
Montoya JG, Rosso F. Diagnosis and management of toxoplasmosis. Clinics in Perinatology, v. 32, n. 3,
p. 705-726, 2005.
Morampudi V., De Craeye S., Le Moine A. et al. Partial depletion of CD4(+)CD25(+)Foxp3(+) T
regulatory cells significantly increases morbidity during acute phase Toxoplasma gondii infection in
resistant BALB/c mice. Microbes and Infection, v. 13, n. 4, p. 394-404, 2011.
Mun, H. S., F. Aosai, et al. TLR2 as an essential molecule for protective immunity against Toxoplasma
gondii infection. International Immunology, v. 15, n. 9, p.1081-7, 2003.
Murakami, S., D. Iwaki, et al. Surfactant protein A inhibits peptidoglycan-induced tumor necrosis factoralpha secretion in U937 cells and alveolar macrophages by direct interaction with toll-like receptor 2.
Journal of Biological Chemistry, v. 277, n. 9, p. 6830-7, 2002.
Neves, D.P.; Melo, A.L.; Linardi, O.G. Toxoplasma gondii. In: Parasitologia humana, 10ª ed. São
Paulo: Atheneu, cap. 18, p. 147-156, 2003.
Niedelman W., Gold D.A., Rosowski E.E., Sprokholt J.K., Lim D., et al. The rhoptry proteins ROP18
and ROP5 mediate Toxoplasma gondii evasion of the murine, but not the human, interferon-gamma
response. Plos Pathogens, v. 8, n. 6, e1002784, 2012.
O’Neill L.A. How Toll-like receptors signal: what we know and what we don’t know. Current Opinion
in Immunology, v. 18, n. 1, p. 3-9, 2006.
Ong Y.C., Reese M.L., Boothroyd J.C. Toxoplasma rhoptry protein 16 (ROP16) subverts host function
by direct tyrosine phosphorylation of STAT6. Journal of Biological Chemistry, v. 285, p. 28731-28740,
2010.
Pinzan, C.F. Proteínas de micronemas de Toxoplasma gondii: avaliação estrutural e das atividades
biológica e vacinal. 149p. Tese (Doutorado em Imunologia Básica e Aplicada) – Faculdade de Medicina,
Universidade de São Paulo, Ribeirão Preto, 2010.
Plattner F., Yarovinsky F., Romero S., Didry D., Carlier M.F., Sher A., Soldati-Favre D. Toxoplasma
profiling is essential for host cell invasion and TLR11-dependent induction of an interleukin-12 response.
Cell Host & Microbe, v. 3, n. 2, p. 77-87, 2008.
Pluddemann, A., S. Mukhopadhyay, et al. The interaction of macrophage receptors with bacterial ligands.
Expert Reviews in Molecular Medicine, v. 8, n. 28, p. 1-25, 2006.
Reiss M., Viebig N., et al. Identification and characterization of an escorter for two secretory adhesins in
Toxoplasma gondii. The Journal of Cell Biology, v. 152, n. 3, p. 563-78, 2001.
Rosowski E.E, Lu D., Julien L., Rodda L., Gaiser R.A., Jensen K.D.C., Saeij J.P.J. Strain-specific
activation of the NF-kB pathway by GRA15, a novel Toxoplasma gondii dense granule protein. Journal
of Experimental Medicine, v. 208, n.1, p. 195-212, 2011.
Saouros S., Edwards-Jones B., et al. A novel galectin-like domain from Toxoplasma gondii micronemal
protein 1 assists the folding, assembly, and transport of a cell adhesion complex. Journal of Biological
Chemistry, v. 280, n. 46, p.38583-91, 2005.
Scanga, C. A., J. Aliberti, et al. Cutting edge: MyD88 is required for resistance to Toxoplasma gondii
infection and regulates parasite-induced IL-12 production by dendritic cells. Journal of Immunology, v.
168, n. 12, p.5997-6001, 2002.
Scharton-Kersten, T. M., T. A. Wynn, et al. In the absence of endogenous IFN-gamma, mice develop
unimpaired IL-12 responses to Toxoplasma gondii while failing to control acute infection. Journal of
Immunology, v. 157, n. 9, p. 4045-54, 1996.
Soldati, D. e M. Meissner. Toxoplasma as a novel system for motility. Current Opinion in Cell Biology,
v. 16, n. 1, p. 32-40, 2004.
Souza M.A., Carvalho F.C., Ruas L.P., Ricci-Azevedo R., Roque-Barreira M.C. The immunomodulatory
effect of plant lectins: a review with emphasis on ArtinM properties. Glycoconjugate Journal, v. 30, n.
7, p. 641-657, 2013.
Suzuki, Y., M. A. Orellana, et al. Interferon-gamma: the major mediator of resistance against
Toxoplasma gondii. Science, v. 240, n. 4851, p. 516-8, 1988.
Suzuki Y., Conley F.K., Remington J.S. Differences in virulence and development of encephalitis during
chronic infection vary with the strain of Toxoplasma gondii. The Journal of infectious diseases, v. 159,
n. 4, p. 790-4, 1989.
Suzuki, Y., A. Sher, et al. IL-10 is required for prevention of necrosis in the small intestine and mortality
in both genetically resistant BALB/c and susceptible C57BL/6 mice following peroral infection with
Toxoplasma gondii. Journal of Immunology, v. 164, n. 10, p. 5375-82, 2000.
Takeda, K. e S. Akira. Toll receptors and pathogen resistance. Cellular Microbiology, v. 5, n. 3, p.14353, 2003.
Tenorio E.P., Fernández J., Castellanos C. et al. CD4+ Foxp3+ regulatory T cells
mediate Toxoplasma gondii-induced T-cell suppression through an IL-2-related mechanism but
independently of IL-10. European Journal of Immunology, v. 41, n. 12, p. 3529-41, 2011.
Tenter, A. M., Heckeroth A. R, Weiss L.M. Toxoplasma gondii: from animals to humans. International
Journal for Parasitology, v. 30, n. 12-13, p. 1217-58, 2000.
Tolia, N. H., E. J. Enemark, et al. Structural basis for the EBA-175 erythrocyte invasion pathway of the
malaria parasite Plasmodium falciparum. Cell, v.122, n. 2, p. 183-93, 2005.
Trinchieri G., Pflanz S., Kastelein R.A. The IL-12 family of heterodimeric cytokines: new players in the
regulation of T cell responses. Immunity, v. 19, n. 5, p. 641-644, 2003.
Ulevitch R.J. Therapeutics targeting the innate immune system. Nature Reviews Immunology, v. 4, p.
512-520, 2004.
Unitt J., Hornigold D. Plant lectins are novel Toll-like receptors agonists. Biochemical Pharmacology,
v. 81, p. 1324-1328, 2011.
Wasmuth J.D., Pszenny V., Haile S., Jansen E.M., Gast A.T., Sher A., et al. Integrated bioinformatic and
targeted deletion analyses of the SRS gene superfamily identify SRS29C as a negative regulator of
Toxoplasma virulence. mBio. V. 3, n. 6, e00321-12, 2013.
Weber, A. N., M. A. Morse, et al. Four N-linked glycosylation sites in human toll-like receptor 2
cooperate to direct efficient biosynthesis and secretion. Journal of Biological Chemistry, v.279, n. 33,
p.34589-94, 2004.
Wright, J. R. Immunoregulatory functions of surfactant proteins. Nature Reviews Immunology, v. 5, n.
1, p. 58-68, 2005.
Yamada, C., H. Sano, et al. Surfactant protein A directly interacts with TLR4 and MD-2 and regulates
inflammatory cellular response. Importance of supratrimeric oligomerization. Journal Biological
Chemistry, v. 281, n. 31, p.21771-80, 2006.
Yang C.S., Yuk J.M., Lee Y.H., Jo E.K. Toxoplasma gondii GRA7-induced TRAF6 activation
contributes to host protective immunity. Infection and Immunity, v. 84, n. 1, p. 339-350, 2016.
Yarovinsky, F., D. Zhang, et al. TLR11 activation of dendritic cells by a protozoan profilin-like protein.
Science, v. 308, n. 5728, p.1626-9, 2005.
Anexo I | 79
Anexo I
Manuscrito em preparação | 80
1
Toxoplasma gondii microneme proteins 1 and 4 recognize N-glycans of TLR2
2
and TLR4: the interaction triggers the initial immune response to the
3
protozoan
4
5
Aline Sardinha-Silva1, Carla Duque Lopes 1,2, Flávia Costa Mendonça-Natividade1, Camila
6
Figueiredo Pinzan1, Diego L. Costa3, Damien Jacot4, André L. V. Zorzetto-Fernandes1, Alan B.
7
Carneiro2,3, Lilian L. Nohara2, Nicholas Gay5, Alan Sher3, Dominique Soldati-Favre4, Dragana
8
Jankovic3, Igor C. Almeida2, Maria Cristina Roque Barreira1
9
10
11
12
13
14
15
16
17
18
19
20
1
Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de
Medicina de Ribeirão Preto, Universidade de São Paulo, 14040130 , Ribeirão Preto, SP, Brasil
2
Border Biomedical Research Center (BBRC), Department of Biological Sciences, University
of Texas at El Paso (UTEP), 500W. University Ave. El Paso, TX 79968-0519, USA
3
Immunobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and
Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
4
Department of Microbiology and Molecular Medicine, CMU, University of Geneva, 1 rue
Michel-Servet, 1211 Geneva 4, Switzerland
5
Department of Biochemistry, Cambridge University, 80 Tennis Court Road Cambridge CB2
1GA, United Kingdom
21
22
Key words – Toxoplasma gondii, microneme proteins, Toll-like receptors, TLR2, TLR4,
23
carbohydrate recognition
24
25
Corresponding author. Dr Maria Cristina Roque Barreira, Tel: +55-16-3602-3066, E-mail:
26
[email protected]
27
28
29
30
31
32
33
ABSTRACT
34
Toxoplasma gondii infects host cells through an active process, which requires the
35
release of lectins, named microneme proteins (MIC) from intracellular organelles. TgMIC1,
36
TgMIC4 and TgMIC6 form a complex on T. gondii surface that allows the parasite’s adhesion
37
in the host cell, via carbohydrate recognition since TgMIC1 binds to terminal sialic acid and
38
TgMIC4 binds to terminal galactose. Our aim was to evaluate the protein-carbohydrate
39
interaction between TgMIC1/TgMIC4 with N-glycans of extracellular TLRs, and the role of
40
these proteins during T. gondii initial infection. We observed that TgMIC1 and TgMIC4 induce
41
proinflammatory cytokine production, especially IL-12, by dendritic cells and macrophages
42
from C57BL/6 mice. The secretion of these cytokines was induced in similar levels to those
43
triggered by TLRs agonists, whereas when we used MyD88, TRIF, TLR2, TLR4 or double
44
knockout (DKO TLR2/TLR4) macrophages, the microneme proteins 1 and 4 induced production
45
of lower levels of IL-12 compared to those of wild type cells. We did not observe difference
46
when we stimulated DKO TLR11/TLR12 macrophages. Furthermore, we found that this
47
activation was dependent on carbohydrate recognition, since two pontual mutations on the
48
carbohydrate recognition domain (CRD) of TgMIC1, and one mutation on TgMIC4 CRD
49
impaired the ability of these lectins to induce IL-12 production by wild type dendritic cells and
50
macrophages. We found that during the first hours of T. gondii infection, the concomitant
51
absence of TLR2 and TLR4 resulted in lower IL-12 production by dendritic cells, whereas the
52
lack of TLR11 and TLR12 did not affect the secretion of this cytokine. Moreover, infection of
53
wild type dendritic cells and macrophages with TgMIC1 or double knockout parasites (DKO
54
TgMIC1/TgMIC4) resulted in impaired cellular activation even after 48 hours, since IL-12
55
production was lower compared with wild type parasites infection. Finally, during in vivo
56
infection TgMIC1 proved to be important for inducing systemic IL-12 in the first 6 hours of
57
infection. Once we observed decreased IL-12 levels during the initial phase of the infection, we
58
concluded that TgMIC1 and TgMIC4 trigger the initial immune response to T. gondii, based on
59
TLR2 and TLR4 N-glycans recognition. Together, these results indicate that interactions
60
established between microneme proteins and TLRs result in the host cell activation, and play a
61
key role on the parasite infection.
62
63
64
65
66
AUTHOR SUMMARY
67
One of the first steps of the T. gondii invasion is the discharge of microneme proteins
68
(MICs) which adhere the parasite onto the host cell surface. MICs are released by T. gondii in a
69
complex formed mainly by TgMIC1, TgMIC4, and TgMIC6. TgMIC1 and TgMIC4 recognize
70
sugars expressed by host cell. TgMIC1 binds to sialic acid, whereas TgMIC4 recognizes glycans
71
terminated in galactose. Besides, TgMIC1/4/6 complex elicits an immune response against the
72
parasite, through unknown mechanisms. Here, we found that TgMIC1 and TgMIC4 act as
73
agonists of Toll-like receptors (TLR) 2 and 4; they bind to both heterodimers of TLR2: TLR2/1
74
and TLR2/6, with the involvement of accessory proteins, CD14 and CD36. A more detailed
75
study on the interaction established with TLR2 showed that TgMICs bind to the sugar moieties
76
of this receptor; more precisely, TgMIC1 binds to the second, third and fourth sugar chains of
77
TLR2, whereas TgMIC4 binds only to the third sugar chain. We also verified that both
78
microneme proteins stimulated phagocytes to produce proinflammatory cytokines, in a manner
79
that depends on the TLR2 or TLR4 expression on the cells surface. Then we supposed that
80
TgMIC1 and TgMIC4 could be responsible by the known IL-12 production that follows the
81
infection of phagocytes with T. gondii. Indeed, when we infected phagocytes with parasites that
82
were TgMIC1- or TgMIC4-genetically deficient the IL-12 production was significantly inhibited
83
in the early phase of infection. Taken together our results reveal a novel role of TgMIC1 and
84
TgMIC4: they bind to TLRs, activate phagocytes and trigger innate immunity response. These
85
events are relevant in the initial phases of T. gondii infection.
86
87
INTRODUCTION
88
Toxoplasma gondii belongs to the phylum Apicomplexa, which includes important
89
pathogens of humans and animals. The invasion of host cells by parasites of this phylum is an
90
active process that relies on the actomyosin system (glideosome) and the sequential secretion of
91
proteins from two specialized apical organelles - microneme and rhoptries [1]. T. gondii
92
discharges microneme proteins (TgMICs) onto the surface of the host cell [2, 3] that interact
93
tightly with membrane receptors from host cell and initiate the invasion cell [2]. Among the
94
secreted MICs, T. gondii microneme protein 1 (TgMIC1), TgMIC4, and TgMIC6 form a
95
complex that exerts a critical role in the invasion of host cells [4, 5], contributing to the
96
virulence of the parasite [6, 7]. Immunization with the subcomplex Lac+, consisting of TgMIC1
97
and TgMIC4, protects against infection by T. gondii [8]. However, the way that TgMICs interact
98
and activate a protective immune response remains unclear.
99
The innate immunity is conserved among vertebrates and has among its components the
100
pattern recognition receptors (PRRs), which recognize pathogen-associated molecular patterns
101
(PAMPs), and related signal transducers. Toll-like receptors (TLRs) are the best characterized
102
PRRs [9, 10] and they signal using a pathway that depends on the adaptor protein MyD88. The
103
susceptibility of MyD88-knockout mice to infection by T. gondii suggested that TLRs
104
participate in recognition of the parasite [11, 12]. Nonetheless, little is known about T. gondii
105
ligands for TLRs. It was demonstrated that a profilin-like component of the parasite (TgPRF) is
106
recognized by murine TLR11 [13] and TLR12 [14, 15], and human TLR5, a member
107
evolutionarily
108
Glycosylphosphatidylinositol (GPI) anchors derived from T. gondii were shown to activate
109
TLR2 and TLR4 [17]. In addition, parasite RNA and DNA are ligands for TLR7 and TLR9,
110
respectively [15]. TLR2 has attracted particular interest because it recognizes several distinct
111
lipid ligands and forms active heterodimers with TLR1 and TLR6 [18]. The accessory protein
112
CD14, a GPI-anchored protein, and the class B scavenger receptor CD36 enhance TLR2
113
signaling [19, 20, 21]. A direct interaction of the components of T. gondii with TLR2
114
heterodimers or accessory protein has not yet been reported.
closer
of
the
TLR
gene
family
to
mouse
TLR11
[16].
115
Several studies have shown that efficient invasion by T. gondii depends on carbohydrate
116
recognition [22, 23, 24]. Interestingly both TgMIC1 and TgMIC4 have lectin domains [25, 4, 7,
117
29] and the binding of TgMIC1 to sialylated oligosaccharides is biologically relevant because
118
the presence of soluble sialic acid reduces the efficiency of T. gondii invasion by 90% [7, 26].
119
There is evidence that TLR1, TLR2, TLR6, and TLR4 are glycoproteins. The expression
120
and function of receptors require glycosylation of the mature TLR2 and TLR4 proteins [27, 28].
121
All the nine N-glycosylation sites of the TLR4 molecule are highly conserved among species,
122
suggesting that N-glycans are biologically important to this receptor. Although only one of four
123
glycosylation sites are conserved in TLR2, the heterodimers comprising TLR1 and TLR6
124
conserve two of six and five of nine glycosylation sites, respectively [27].
125
Here, we used recombinant forms of the microneme proteins TgMIC1 and TgMIC4 to
126
demonstrate their ability to activate TLR2 and TLR4. We focused on investigating the activation
127
of TLR2, to verify whether its heterodimeric forms TLR2/1 and TLR2/6 amplify the cellular
128
response to TgMIC1 and TgMIC4. We found that TLR2 is critical for the binding of TgMICs
129
and among the four N-glycans of TLR2, we identified that the N-glycans occupying the second,
130
third and fourth of glycosylation sites are the most probable targets for TgMIC1 recognition,
131
whereas TgMIC4 recognizes only the third N-glycan of TLR2. Furthermore, we showed that
132
TgMICs account for the early IL-12 production by macrophages infected with T. gondii. Our
133
results reveal a new role of T. gondii microneme proteins: they are ligands for TLRs, their
134
binding is dependent on carbohydrate recognition and they are important to induce early innate
135
immune activation.
136
137
RESULTS
138
Recombinant TgMIC1 and TgMIC4 features are consistent with those of the
139
subcomplex Lac+ of the parasite.
140
Because native TgMIC1 and TgMIC4 have lectin properties, we investigated whether the
141
recombinant proteins used here reproduced the sugar binding specificity of the native proteins
142
complex, which corresponds to the Lac+ fraction purified from the soluble antigens of T. gondii.
143
The glycoarray analysis showed that (i) the subcomplex Lac+ (consisting of native TgMIC1 and
144
TgMIC4) bound to glycans with terminal α(2-3)-sialyl and β(1-4) or β(1-3)-galactose; (ii)
145
TgMIC1 bound exclusively to the α(2-3)-sialyl residue linked to β-galactosides; and (iii)
146
TgMIC4 interacted with a diverse range of oligosaccharides with terminal β(1-4) or β(1-3)-
147
galactose (Figure 1A). Therefore, the combined specificities of the individual recombinant
148
proteins correspond to the double sugar specificity of Lac+. In conclusion, the glycoarray
149
analysis revealed that sugar recognition properties of recombinant TgMIC1 and TgMIC4 are
150
consistent with those of the subcomplex Lac+ of the parasite.
151
On the basis of the selectivity of sugar recognition by TgMIC1 and TgMIC4 reported by
152
us and others [7, 25, 26], we wondered whether three commercially available oligosaccharides
153
(lacto-N-biose, β(1-3)-galactosyl-N-acetylgalactosamine, and α(2-3) sialyllactose) could inhibit
154
the binding of microneme proteins to the glycoproteins, fetuin and asialofetuin (Figure 1B).
155
156
TgMIC1 and TgMIC4 trigger the activation of dendritic cells and macrophages
157
Because we have previously demonstrated that the subcomplex Lac+ isolated from the
158
soluble antigens of T. gondii stimulated murine spleen cells to produce proinflammatory
159
cytokines [8], we sought to determine whether the recombinant proteins TgMIC1 and TgMIC4
160
could retain this activity and exert similar effect on bone marrow-derived dendritic cells
161
(BMDCs) and bone marrow-derived macrophages (BMDMs). BMDCs (Figures 2A-D) and
162
BMDMs (Figures 2E-H) produced IL-12 (Figure 3A and 3E), TNF-α (Figures 3B and F), IL-6
163
(Figures 3C and G) and IL-10 (Figures 3D and 3H) in response to stimulation with TgMIC1 or
164
TgMIC4. The measured levels were similar to those recorded for known agonists of TLRs, such
165
as Pam3CSK4 (P3C) and LPS. We concluded that recombinant TgMIC1 and TgMIC4 exert
166
proinflammatory activity consistent with that of the subcomplex Lac+ of the parasite.
167
The activation of dendritic cells and macrophages by TgMIC1 and TgMIC4 depends on
168
interaction with TLR2 and TLR4, and not on TLR11 or TLR12
169
To investigate the potential mechanisms through which the microneme proteins induce
170
innate immune cells to produce cytokines, we evaluated whether TgMIC1 or TgMIC4 could
171
interact with TLRs expressed on cells surface. We used wild type or TLRs knockout BMDMs,
172
and HEK293A cells transfected with pairs of TLRs (TLR2/1 or TLR2/6) or with TLR4, as well
173
as with the co-receptors CD14, CD36 and MD2. We detected cell activation by measuring the
174
concentration of IL-12 or IL-8 in the cells supernatant, which revealed that both TgMIC1 and
175
TgMIC4 are able to induce macrophage (Figures 3A-F) and HEK cells (Figures 3G-I) activation
176
in a dependent manner of TLR2 and TLR4, but not TLR11 and TLR12. The activation levels
177
determined by the optimum concentrations of microneme proteins (around 200 nM for TgMIC1
178
and 160 nM for TgMIC4) were similar to those obtained with the positive controls, i.e., the
179
agonists P3C (TLR2/1), FSL (TLR2/6), and LPS (TLR4), and were significantly different from
180
the result provided by the negative control (medium).
181
To confirm in a more natural system the primary role played by TLR2 and TLR4 in the
182
cell activation triggered by microneme proteins, which was verified in transfected HEK293T
183
cells, we compared the IL-12 production by BMDMs from wild-type mice in response to
184
TgMIC1 or TgMIC4 with the responses of BMDMs from mice that were knocked out of TLR2,
185
TLR4, TLR2 and TLR4 (DKO), and MyD88. We detected lower, but still significant, levels of
186
IL-12 production by BMDMs from MyD88KO (Figure 3A), TRIFKO (Figure 3B), TLR2KO
187
(Figure 3C) and TLR4KO (Figure 3D) mice. In contrast, BMDMs from DKO mice did not
188
produce IL-12 in response to TgMIC1 or TgMIC4 (Figure 3E). These results confirm that TLR2
189
and TLR4 are both relevant for the macrophage activation induced by TgMIC1 and TgMIC4.
190
The cytokine residual production verified in macrophages from TLR2KO or MyD88KO may
191
result from the activation of TLR4 (Figure 3A and 3C), and vice-versa, i.e. the residual IL-12
192
levels produced by macrophages from TLR4KO mice may result from TLR2 activation. The
193
finding that microneme proteins-stimulated macrophages from DKO mice did not produce IL-12
194
suggests that cell activation triggered by TgMIC1 or TgMIC4 does not require the participation
195
of other innate immunity receptors beyond TLR2 and TLR4.
196
Nonetheless, once TLR11 and TLR12 were previously reported as accounting for the IL-
197
12 production by macrophages infected with T. gondii or stimulated with the parasite component
198
profilin, the involvement of both receptors in the response to TgMIC1 or TgMIC4 was
199
investigated. Similar levels of IL-12 were produced by BMDMs from wild-type and double-
200
knocked out mice for TLR11 and TLR12 (Figure 3F), indicating that cell activation triggered by
201
TgMIC1 or TgMIC4 does not depend on these receptors.
202
203
Recognition of TLR2 and TLR4 N-glycans accounts for the TgMIC1- or TgMIC4-
204
triggered cell activation
205
Since TgMIC1 and TgMIC4 have carbohydrate recognition domains (CRD) 4, 7, 28, 29
206
and TLR2 and TLR4 are a glycoproteins with four and eight N-glycans linked to its ectodomain,
207
respectively 27 , we hypothesized that these structures interact to trigger cell activation. We
208
tested this hypothesis using wild type BMDCs and BMDMs, or HEK293T cells transfected with
209
TLR2 mutants for N-glycosylation sites and we checked the production of IL-8 as readout for
210
TLR2 activation. The obtained results are shown in Figure 4. We confirmed that cells
211
transfected with the fully N-glycosylated ectodomain of TLR2 (WT) responded to both stimuli,
212
TgMIC1 or TgMIC4. In addition, cells lacking only the first N-glycan (mutant ∆-1) also
213
responded to all assayed stimuli. In contrast, cells expressing unglycosylated TLR2 (mutant ∆-
214
1,2,3,4) were not responsive to any of the assayed stimuli, which include the control agonist
215
FSL-1. This finding is consistent with the previous report that this mutant is not secreted by
216
HEK293T cells and justifies their exclusion of the further analysis performed herein. Under
217
stimulus of TgMIC1, the IL-8 secretion was significantly reduced in cells transfected with five
218
different TLR2 mutants, lacking the second, third and fourth N-glycans. Under TgMIC4
219
stimulus, the IL-8 production was significantly reduced in cells transfected with the mutants
220
lacking the third N-glycan. Taken together, our results indicate that TLR2 N-glycans are
221
essential targets for the microneme proteins. Among TLR2 N-glycans, the second, the third and
222
the fourth are probably targeted by the TgMIC1 CRD, while the third is likely targeted by
223
TgMIC4 CRD.
224
225
TgMIC1 and TgMIC4 contribute to the early IL-12 production that follows T. gondii-
226
infection of dendritic cells and macrophages
227
Since macrophages are induced to produce IL-12 in both conditions, T. gondii infection
228
and stimulation with TgMICs, we investigated whether infected BMDMs with T. gondii lacking
229
TgMIC1 or TgMIC4 had the IL-12 secretion affected. By comparing the time-course infection
230
of BMDMs by integral parasites or parasites lacking TgMIC1, TgMIC4 or both (double
231
knockout), in terms of IL-12 levels detected in the cells supernatants, we found that the absence
232
of the either microneme proteins diminished the initial production of IL-12 (at 6, 12 and 24
233
hours p.i.) by the macrophages (Figure 6). In later time points of infection, (at 24 and 48 hours),
234
the cytokine production by BMDMs was similar among cells expressing or not microneme
235
proteins, maybe it is due to other T. gondii components, such as profilin (TgPRF), which was
236
reported to induce IL-12 secretion via TLR11 and TLR12 activation [11, 13,14]. Taken together,
237
our results suggest that TgMICs are important in the early stimulation of macrophages to
238
produce IL-12, a cytokine that is essential to drive the immune response toward a protective
239
axis.
240
241
DISCUSSION
242
We found that the T. gondii micronemal proteins TgMIC1 and TgMIC4 activate TLR2
243
and trigger innate immunity responses. We also determined that TgMIC1 and TgMIC4 interact
244
with TLR4, but we did not investigate this interaction extensively. Our findings amplify the
245
spectrum of roles exerted by micronemal proteins during infection by T. gondii, which already
246
includes parasite motility, formation of the moving cell junction, and attachment to and invasion
247
of the host cell.
248
TgMIC1/4/6, the most often studied microneme complex, favors the invasion process
249
and increases the virulence of the parasite by attaching the CRD of TgMIC1 to sialic acid on the
250
surface of the host cells [32]. In addition, TgMIC1 recruits TgMIC4, which also plays an
251
adhesive function during invasion [4, 5], since it interacts with a variety of galactose-terminating
252
oligosaccharides [29]. Here, we confirmed these sugar recognition properties of TgMIC1 and
253
TgMIC4 constitute a novel functional feature concerning the ability of both TgMIC1 and
254
TgMIC4 to activate TLR2 and trigger strong innate responses against the parasite.
255
Previous studies have led us to infer that microneme proteins are relevant when searching
256
a way to elicit immunity against T. gondii. Our group has shown that mice immunized with
257
Lac+ fraction, a protein complex consisting of TgMIC1 and TgMIC4 that was affinity-isolated
258
from the parasite protects against T. gondii during the acute phase of infection [8]. More
259
recently, we have verified that the recombinant forms of TgMIC1 and/or TgMIC4 also confer
260
protection against experimental toxoplasmosis (unpublished data). Other authors have attributed
261
similar protective effects to TgMIC6 and TgMIC8 [33, 34]. However, the mechanisms that
262
trigger protection remain poorly understood. The present study supports the idea that activation
263
of TLRs, which subsequently triggers innate immune responses, may contribute to the protection
264
conferred by immunization with micronemal proteins. This supposition is coherent with the fact
265
that the cellular immunity developed in response to parasites, including T. gondii, depends on
266
their initial encounter with antigen-presenting cells (APCs) [11, 35]. Here we have shown that
267
TgMIC1 and TgMIC4 stimulate macrophages and dendritic cells to produce pro-inflammatory
268
cytokines, especially IL-12. This production is critical during infection by T. gondii, because IL-
269
12 induces T and NK cells to release IFN-γ, which plays a pivotal role in host protection [11].
270
Few molecules isolated from T. gondii can interact with APC receptors to activate the innate
271
immunity [13, 14, 15, 17]. Although, in mice model, single knockout of TLR2 [37] or TLR4 did
272
not showed the same susceptibility seen in MyD88 knockout mice [12], the direct interaction of
273
TgMIC1 and TgMIC4 with key host-cell receptors, such as TLR2 and TLR4, and the consequent
274
induction of Th1 immunity may favor significantly the defense mechanisms of other hosts
275
against T. gondii, like humans.
276
Although some TLRs can be stimulated by T. gondii components, neither isolated TLR
277
absence has provides the susceptibility phenotype found in MyD88 knockout mice [11, 12, 13,
278
14, 15, 17, 37, 38]. In very early steps of our study we verified that the TgMIC1- and TgMIC4-
279
stimulated production of pro-inflammatory cytokines strongly depends on MyD88, a fact that
280
has motivated us to investigate the microneme proteins interactions with individual TLRs.
281
Very few components of T. gondii interact with TLRs. Glycosylphosphatidylinositol
282
(GPI)- anchored proteins, which abounds in the tachyzoite plasma membranes of T. gondii as
283
well as in other parasites such as Trypanosoma cruzi and Plasmodium falciparum, are agonists
284
of TLR2 and TLR4 [11, 14, 15, 17, 39, 40]. In addition, T. gondii profilin-like protein (TgPRF),
285
a regulator of actin polymerization, binds to TLR11 [13] and TLR12 [14, 15], probably working
286
as heterodimers [15]. Because humans lack functional tlr11 and tlr12 genes, the production of
287
high levels of pro-inflammatory cytokines during the first steps of infection by T. gondii,
288
suggests that other receptors and ligands can trigger such production. One possibility is the
289
activation of nucleic acid-sensing Toll-like receptors, as proposed by Andrade et al (2013). We
290
postulate that the interaction of TgMIC1 and TgMIC4 with TLR2 and TLR4 provides an
291
important mechanism that induces the generation of IL-12 during infection by T. gondii. Akin
292
to cells from MyD88-knockout mice, macrophages from TLR2- knockout mice produce lower
293
levels of pro-inflammatory cytokines in response to stimulus with TgMIC1 or TgMIC4. This
294
indicates that TgMIC1 and TgMIC4, which are early secreted by T. gondii during the invasion
295
process, induce pro-inflammatory cytokines by innate immune cells through a mechanism that
296
depends, at least in part, on the activation of TLR2 and TLR4.
297
TLR2, which was our main focus, acts as a heterodimer; which can result from
298
interaction with either TLR1 or TLR6 [18, 41]. Preferably, microbial ligands bind to only one
299
form of TLR2 heterodimer [42, 43]. Unpredictably, we demonstrated that TgMIC1 and
300
TgMIC4, in nanomolar concentrations, can stimulate both TLR2/1 and TLR2/6 heterodimers;
301
we also found that TgMIC1 and TgMIC4 stimulate TLR4. It is worth pointing out that our
302
TLR4-activation assays with recombinant TgMIC1 or TgMIC4 were done in the presence of the
303
LPS inactivator, polymyxin B, to avoid any misinterpretation due to potential contamination
304
with E. coli LPS. The unusual activation of TLR4 by TgMIC1 and TgMIC4 may create an
305
efficient cooperation among different TLRs during infection by T. gondii, which would enhance
306
the immune host response.
307
As well established for TLR4 [44, 45], the TLR2 complex formed on the surface of the
308
cell includes the accessory proteins CD14 [46, 47] and CD36 [30, 21]. The approximation of
309
CD14 and CD36 to TLR2 depends on the presence of ligands. The CD14 ligand concentrates
310
into microdomains with TLR4 and TLR2 [48, 49, 50, 51] and allows the recruitment of ligands
311
to the proximity of TLR and the transference of the ligand cargo to the receptors [46]. We found
312
that CD14 is also important, albeit not essential, for the activation of TLR2/1 or TLR2/6 in
313
response to stimulus with TgMIC1 or TgMIC4. On the other hand, CD36 appears to be
314
specifically involved in TLR2/6- but not in TLR2/1-mediated responses. These results are
315
consistent with previous studies using bacterial TLR2 agonists, that found that diacylated
316
lipoproteins like LTA and FSL-1 require the presence of CD14 and CD36 to activate the innate
317
immunity response, whereas the triacylated lipopeptide, P3C, requires the presence of CD14,
318
TLR2, and TLR1, but not of CD36 [17, 21].
319
The interaction of TLRs with specific ligands induces the initiation of signaling
320
pathways, which in turn activate the transcription factor NFκB and recruit MAP kinases such as
321
p38, c-Jun N-terminal kinases (JNK), and ERK1/2, which eventually activate the transcription
322
factor AP-1 [52]. The activation of transcription factors promotes several physiological changes,
323
including the production of pro-inflammatory cytokines. Contrary to our expectations, in the
324
absence of both accessory proteins CD14 and CD36, TLR2/1-transfected HEK293A cells
325
respond distinctly to stimulus with either TgMIC1 or TgMIC4, as attested by examining the six
326
fold higher activation of NF B and decreased production of IL-8. This divergence can be due to
327
distinct abilities of each member of the TLR complex to stimulate more than one signaling
328
pathway. The specific contribution of each component of the TLR2 complex (or other TLRs) to
329
the final activation of several signaling pathways is unknown. Nonetheless, the relevance of the
330
component to signaling can be inferred from previous reports. The presence of CD14 can alter
331
the TLR4- mediated signaling pathway [31]. CD36 participates in cellular events that trigger the
332
recruitment of kinases from the MAPK family [30, 53]. JNK activation contributes exclusively
333
to the expression of TLR1. Hence, the participation of certain members of the TLR complex
334
may drive the involvement of different signaling pathways, consequently optimizing the
335
activation of TLR. The complex signaling mechanisms that account for the activation of TLR
336
deserves further investigation.
337
In its infection strategy, T. gondii uses carbohydrate-binding proteins to facilitate host
338
cell invasion [6, 7, 26]. TgMIC1 and TgMIC4 bind to sialic acid and galactose, respectively [25,
339
4, 7, 26]. We showed that α2-3 sialyllactosamine and β-1-4 or β-1-3-galactose inhibit the
340
binding of TgMIC1 and TgMIC4 to the surface of the macrophage by almost 50%. The
341
molecular structure of TgMIC1 contains two adhesion sites, denominated MAR (micronemal
342
adhesive repeat region), which are responsible for binding to sialic acid-terminated glycans [7].
343
The activation of TLR2 triggered by TgMIC1 depends on glycosylation of the receptor, more
344
specifically, glycosylation of the second N-glycosylation site of TLR2, which is probably
345
targeted by the MAR region of TgMIC1. Although the exact structure of the glycans of TLR2
346
has not been determined yet, we can predict that the second N-glycan contains sialylated
347
residues. The crystal structure of the TLR1/2 ectodomain bound to the triacylated peptide,
348
PAM3CSK4, revealed the molecular mechanism by which this interaction activates signaling
349
[55]. Two acyl chains of the ligand insert into the hydrophobic core of the TLR2 ectodomain
350
horseshoe-shaped solenoid and the third chain binds to a hydrophobic groove on the surface of
351
TLR1. This promotes the formation of an extensive area of protein-protein interaction between
352
the ectodomains of TLR1 and -2, estabilizing the characteristic M-shaped heterodimer. The
353
proteins used in this structural analysis were produced in insect cells, so they do not have native
354
N-glycans. Nevertheless, a residual N-deoxy-glucose residue is present in the structure, at
355
glycosylation site 2. This chain is not close to the dimerization interface and projects out of the
356
solenoid structure. Binding of TgMIC1 to this glycan could stabilize the protein dimerization
357
interface in the absence of the lipid ligand, activating the receptor heterodimer.
358
In contrast to TgMIC1, the TgMIC4-stimulated activation of TLR2 does not depend on
359
the recognition of the receptor N-glycans. This feature of TgMIC4 also contrasts with its
360
adhesive function, associated with its galactose-binding property [29]. Failure in the
361
carbohydrate-recognition domain of the recombinant TgMIC4 used here could account for the
362
unexpected observation. However, the glycoarray analysis clearly demonstrated that the
363
recombinant TgMIC4 recognizes N-glycans that coincide with a set of carbohydrates that bind
364
the native complex protein Lac+. This shows that the recombinant protein is functionally closed
365
to TgMIC4 secreted by the parasite. Marchand et al. (2012) described similar carbohydrate
366
specificity for TgMIC4.
367
The Gal/GalNAc lectin of the surface of the protozoan Entamoeba histolytica can
368
activate TLRs, making a upregulation of TLR2 expression in murine macrophages, activation of
369
NFκB and generation of pro-inflammatory cytokines, such as TNF-α and IL-12 [56]. The
370
antibodies specific to the cysteine-rich region of this lectin encompass its CRD [57] and inhibit
371
the expression of TLR2- mRNA stimulated by the Gal/GalNAc lectin, an indirect evidence that
372
the lectin property of Gal/GalNAc determines its pro-inflammatory effect [56]. The recombinant
373
CRD of the amoebic Gal/GalNAc lectin activates TLR2 and TLR4 of human colonic cells,
374
reinforcing this assumption [58]. The functional analogies between the micronemal proteins of
375
T. gondii and the Gal/GalNAc lectin of E. histolytica suggest that activation of innate immunity
376
by protozoan carbohydrate-binding proteins may be more universally shared than previously
377
supposed.
378
Here, we have demonstrated that when TgMIC1 and TgMIC4 act as TLR2- and TLR4-
379
ligands, they acquire functions that can coincide with those exerted by microbial agonists,
380
named PAMPs [21, 17, 46, 47]. Besides activating the pro-inflammatory signaling, recognition
381
of PAMPs by TLRs may also uptake the whole microbe [59]. Even if the nature of the receptor
382
interacting with TgMIC1 is still unknown, the importance of this microneme protein for
383
invasion by T. gondii is clear [60, 7, 26]. On the basis of our results, we speculate that
384
TgMIC1/4 interacts with TLRs to enhance the penetration of T. gondii as well as efficient
385
endocytosis/phagocytosis mechanisms of the parasite. The internalization of TLR-TgMIC1/4
386
makes the plasma membrane permissive, allowing T. gondii to enter the host cell. The conserved
387
structure of TLR2 from mammals to birds [27] makes TLR2 an efficient facilitator of parasite
388
entry into cells of a wide range of species and partially explains the promiscuity of cell invasion
389
by T. gondii.
390
In summary, our data evidence a new function of TgMIC1 and TgMIC4: their ability to
391
activate the host innate immunity via interaction with key host-cell receptors, especially TLR2.
392
TgMIC1 interacts with TLR2 via a mechanism that depends on carbohydrate recognition. The
393
interactions established by either TgMIC1 or TgMIC4 trigger the production of pro-
394
inflammatory cytokines, which can culminate in the protective immunity against infection by T.
395
gondii upon administration of TgMIC1 or TgMIC4 to mice. Indeed, binding of adequate ligands
396
to TLR induces innate immunity and mediates the antimicrobial adaptive response [61].
397
We have made progress toward understanding the way through which T. gondii interacts
398
with host defense. Despite the intense investigations in the field, we are only starting to answer
399
fundamental questions on this subject. It is clear that during infection by T. gondii the parasite
400
uses complex strategies to modulate the host immune response and facilitate its own survival,
401
whereas host cells elaborate diverse mechanisms to eliminate the pathogen. By reporting this
402
new role of micronemal proteins in innate immunity, we reinforce the well-established idea that
403
host-parasite relationship is based on interplays between defense mechanisms of the host and
404
survival strategies of the parasite. The understanding of this relationship is crucial to implement
405
new vaccines and drugs to prevent and treat this protozoan disease. Our results may contribute
406
to the design of a vaccine and/or immunotherapy against toxoplasmosis, besides open
407
perspectives on the mechanisms through which infection by T. gondii operates.
408
409
MATERIAL and METHODS
410
Reagents
411
Synthetic triacylated protein P3C (Pam3CSK4) (used as agonist for TLR2/1), the
412
ultrapure LPS for E. coli K12 (used as agonist for TLR4), and synthetic diacylated protein
413
derived from Mycoplasma salivarium (FSL-1) (used as agonist for TLR2/6) were obtained from
414
InvivoGen (San Diego, CA). The TLR2/6 agonist (Malp-2), isolated from Mycoplasma
415
fermentans, was purchased from Enzo Life Sciences (Exeter, UK). Polymyxin B sulfate was
416
purchase from Sigma (St. Louis, MO).
417
418
Animals
419
C57BL/6 WT, TLR2-/-, CH3/HEPAS, CHe/HeJ and MyD88-/- mice were acquired from
420
the animal house of the Campus of Ribeirão Preto, University of São Paulo, Ribeirão Preto, São
421
Paulo, Brazil and housed in the Animal Facility of the Molecular and Cellular Biology
422
Department of the Faculty of Medicine of Ribeirão Preto, University of São Paulo, under
423
optimized hygienic conditions. All experiments were conducted in accordance with the ethical
424
guidelines of the Animal Studies Ethics Committee. The experimental mice were used at 7–10
425
wk of age and matched for sex and age (within 2 wk) within experiments.
426
427
Lac+ fraction
428
Lac+ fraction was obtained as previously reported 25 . Briefly, STAg was loaded in a
429
lactose column (Sigma- Aldrich) equilibrated with PBS containing 0.5M NaCl. The material
430
adsorbed to the resin and eluted with 0.1M lactose, in equilibrium buffer, was denoted Lac+ and
431
confirmed to contain TgMIC1 and TgMIC4, as previously reported.
432
433
434
Production of recombinant micronemal proteins
Genes mic1 and mic4 were amplified by PCR from a cDNA library of tachyzoites of
435
ME49-PDS prepared in
ZAP II (Stratagene, La Jolla, CA). This library was kindly provided
436
by Dr. Ian Manger, Department of Microbiology and Immunology, Stanford University School
437
of Medicine, Stanford, CA). cDNAs of mic1gene was amplified by using the primers: A-MIC1
438
5´GGGGACAAGTTTGTACAAAAAAGCAGGCT
439
TCGAAGGAGATAGAACCATGTCGCATTCTCATTCGCCGGCA-3´
440
GGGGACCACTTT
441
GTACAAGAAAGCTGGGTTCAAGCAGAGACGGCCGTAGGACT-3´ whereas to mic4 gene
442
A-MIC4
443
5´GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGATCAC
444
GCCTGCAGGTGATGAC-3´
445
GGGGACCCTTTGTACAAGAAAGCTGGGTTCATTCTGTTGTCTTTCGC
446
TTCAAG- 3´. cDNA were cloned into the vector pDONRTM201 and subcloned into the vector
447
pDESTTM17 (Gateway Tecnhology, Invitrogen) by site specific-recombinant reactions. Vector
448
was transformed into electrocompetent E. coli Rosetta (DE3) and protein expression induced
449
with 1 mM isopropyl b-D-thiogalactopyranoside (IPTG) (Invitrogen). The proteins were
450
solubilized from the inclusion bodies in solution containing 8 M urea, 500 mM NaCl and 20 mM
451
Tris and refolded in Tris-buffer (100mM NaCl and 20mM Tris-HCl, pH 8.0). After refolding,
452
the hexahistidine-thioredoxin-MIC1 or MIC4 fusion protein was purified using nickel-
453
nitrolotriacetic acid HISBind resin (Sigma). The proteins were treated in polymyxin column
454
(Sigma, St.Louis, MO), concentrated and stored at -20 °C in Tris buffer.
and
and
K-MIC4
K-MIC1
5´-
5´-
455
456
Sugar competition binding assay
457
Raw 264.7 cells were provided by Dr. Dario Simões Zamboni and cultivated in RPMI
458
1640 supplemented with 10% heat-inactivated FCS, 100 μg mL-1 penicillin, 100 μg mL-1
459
streptomycin, and 1% of an antibiotic-antimycotic solution. For the binding assay, TgMIC1 and
460
TgMIC4 (1 mg mL-1) conjugated to FITC were incubated with various concentrations of lacto-
461
N-biose, β1-3Gal-N-acetyl galactosaminyl-β1-4Gal-β1-4Glc, α2-3 sialyllactose (V-lab, Dextra,
462
LA, USA) for 1 h, at 37 °C. Raw 264.7 cells were covered with the solution contain 50 µg of
463
microneme protein and sugar for 45 min, at 37°C. The reaction was washed twice and fixed with
464
3.5% formaldehyde. Flow cytometry was conducted on CytoSoftBlue Software – Guava
465
EasyCity – (Guava Tecnologies, Millipore).
466
467
TLR complex constructs and cell expression
468
The mouse CD14, MD-2, and HA epitope-tagged Toll-like receptor (TLR) constructs,
469
the β-actin Renilla luciferase construct, and the reporter ELAM-1-firefly luciferase construct
470
were kindly provided by Dr. Richard Darveau (University of Washington, Seattle, WA). The
471
mouse CD36 construct was kindly provided by Dr. Kathryn J. Moore (Harvard Medical School,
472
Boston, MA). Mouse CD14 was cloned into the expression vector pcDNA3.1/Zeo (Invitrogen)
473
[60] and mouse MD-2 cloned into the pEFBOS vector [63, 64]. Mouse TLR1, TLR4, and TLR6
474
were cloned into a modified pDisplay vector (Invitrogen) that provides a signal peptide and an
475
amino-terminal HA tag. In the modified pDisplay vector, the myc epitope tag and the PDGFR
476
transmembrane domain were deleted [65]. Mouse TLR2 was cloned into the modified pDisplay
477
vector (Invitrogen), in which the neomycin resistance cassette was replaced with a Zeocin™
478
resistance cassette (Life Technologies) [62]. For the ELAM-1-firefly luciferase construct, the E-
479
selectin promoter containing a NFκB binding site was cloned upstream of the firefly luciferase
480
reporter gene in the pGL2-basic plasmid (Promega) [66]. For the β-actin Renila luciferase
481
construct, the β-actin promoter was cloned upstream of the Renilla luciferase gene in the pRL
482
null plasmid (Promega) [67]. Mouse CD36 was cloned into pcDNA3.1/hygro (Invitrogen) [68].
483
484
Human TLR2 Mutant plasmids
485
The human TLR2 mutant plasmids were provided by Dr. Nicholas Gay. The constructs
486
were generated as shown in [27]. HEK293 cells were plated at 3.5 × 105 cells per mL in 96-
487
well plates (3.5 × 104 cells per well) on the day before transfection. The cells were transfected
488
using Lipofectamine (Invitrogen) with 60 ng of a NFκB reporter plasmid (NFκBLuc) and 0.5 ng
489
Renilla luciferase plasmid, together with 60 ng of each gene of single and multiple glycosylation
490
mutants and TLR2WT genes [27]. Twenty-four hours after transfection, cells were stimulated
491
overnight with Malp-2 (Enzo Life Science) and the luciferase activity was measured using a
492
Dual-Luciferase reporter assay system (Promega) according to the manufacturer’s instructions
493
or analyzed by IL-8 ELISA assay.
494
495
Peritoneal macrophages
496
Peritoneal macrophages were obtained from mice peritoneal cavity elicited with 3%
497
thioglicollate. The peritoneal fluid was removed from TLR2-/-, MyD88-/-, and WT mice in 5 mL
498
phosphate buffered saline solution (PBS). Cells were plated in a 24-well plate for 30 min. The
499
non-adherent cells were removed by vigorous washing with PBS. Adherent macrophages were
500
analyzed by flow cytometry using antibody F4/80 stained with PE (Bioscience), providing more
501
than 80% positive cells. The cells (1 × 106 cells) were plated in RPMI 1640 supplemented with
502
10% heat-inactivated FCS, 100 μg mL-1 penicillin, 100 μg mL-1 streptomycin, and 1% of an
503
antibiotic-antimycotic solution (Gibco®). The peritoneal macrophages were stimulated or not
504
during indicated periods. The supernatant was analyzed by ELISA.
505
506
Generation of Bone Marrow-derived Dendritic Cells (BMDCs) and macrophages
507
(BMDMs)
508
BMDCs were obtained as previously described by [69] with some modifications. Briefly,
509
femurs and tibias were flushed with RPMI medium, to release the bone marrow cells. The latter
510
cells were cultured in 10-mm2 culture plate in RPMI 1640 medium supplemented with 10%
511
heat-inactivated FCS, 100 μg mL-1 penicillin, 100 μg mL-1 streptomycin, 5 × 10-5 M β-
512
mercaptoethanol, 30 ng mL-1 murine granulocyte-macrophage colony-stimuling factor (GM-
513
CSF), and 10 ng mL-1 murine recombinant IL-4 (Prepotech, Rocky Hill NJ, USA). On days 3
514
and 6, supernatants were gently removed and replaced with the same volume of supplemented
515
medium. On days 7-8, non-adherent cells were removed and analyzed by flow cytometry for DC
516
phenotyping. Over 80% of the cells presented showed high expression of CD11c. The BMDCs
517
were stimulated or not, and the supernatant was analyzed by ELISA.
518
519
Toxoplasma gondii infection
520
Infection of bone marrow-derived macrophages with Toxoplasma gondii for the in vitro
521
infection: it was used tachyzoite forms of WT, TgMIC1ko and TgMIC4ko parasites, all of
522
which were from the RH strain, recovered from VERO cell cultures. Petri dishes were washed
523
with RPMI medium for the complete removal of parasites. Next, the collected material was
524
centrifuged for 5 min at 50 x g to remove cell debris. The resulting pellet was discarded and the
525
supernatant containing the parasites was then centrifuged for 10 min at 1000 x g, and re-
526
suspended in RPMI medium for counting and concentration adjustments. Bone marrow-derived
527
macrophages were dispensed in 24 wells plates at 5x105 cells/well (in RPMI medium
528
supplemented with 5% FCS), and cells were infected with 3 parasites/cell (MOI 3:1). The plate
529
was then centrifuged for 3 min at 200 x g to synchronize the contact between cells and parasites,
530
and incubated at 37° Celsius in 5% CO2 atmosphere. The supernatants were collected at 6, 12,
531
24 and 48 h after infection for quantification of IL-12p40.
532
533
Glycan array
534
The carbohydrate-binding profile of micronemal proteins was determined by the Core H,
535
Consortium for Functional Glycomics (Emory University), using a printed glycan microarray as
536
comment in [70]. Briefly, TgMIC1-Fc, TgMIC4-Fc, and Lac+-Fc in binding buffer (1% BSA,
537
150mM NaCl, 2mM CaCl2, 2mM MgCl2,, 0.05% (w/v) Tween 20 and 20mM Tris-HCl (pH 7.4)
538
were applied onto covalently printed glycan array and incubated for 1 h at room temperature,
539
followed by incubation with Alexa Fluor 488-conjugated. Slides were scanned, and the average
540
signal intensity was calculated. The common features of glycans with stronger binding are
541
depicted in Figure 1A. The average signal intensity detected for all the glycans was calculated
542
and set as the baseline.
543
544
Cytokines assays
545
The concentration of human IL-8 and mouse IL-12, IL-6, and TNF-α in the supernatant
546
of the cultures were measured by a sandwich ELISA assay using paired cytokine specific
547
monoclonal antibodies, following the manufacturer’s instructions (OptEIA set; PharMingen).
548
549
Statistical Analysis
550
Statistical significance of the obtained results was calculated using One-way ANOVA
551
analysis followed by bonferroni post-tests. P < 0.05 values were considered significant. In vitro
552
experiments were performed in triplicate at each experiment, from cell preparations obtained at
553
least three times, to confirm the obtained results. Data were analyzed using the GraphPad Prism
554
software (GraphPad, La Jolla, CA).
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
ACKNOWLEDGEMENTS
571
This work was supported by grants from Fundação de Amparo à Pesquisa do Estado de
572
São Paulo (FAPESP) (2013/04088-0, 2012/12950-0 and 2008/52130-7) and National Institutes
573
Health (NIH) (grants 8G12MD007592, 2G12RR008124-16A1, and 2G12RR008124-16A1S1).
574
We thank Julio A. Siqueira and Domingos Soares de Souza Filho for expert animal care; and
575
and Dr. Richard Darveau (University of Washington) and Dr. Kathryn J. Moore (Harvard
576
Medical School) for TLR and CD36 constructs, respectively; and Dr David Smith and Dr
577
Richard Cummings at Core H, Consortium for Functional Glycomics (Emory University) for the
578
glycan array screenings, We also thank Lani P. Alcazar, Sandra Thomaz, and Patricia
579
Vendruscolo for excellent technical assistance. We are grateful to the Biomolecule Analysis
580
Core Facility (BACF) at the University of Texas at El Paso (UTEP) for the access to the
581
instrumentation used in this study. The BACF is supported by the Research Centers in Minority
582
Institutions
583
2G12RR008124-16A1S1, to the Border Biomedical Research Center (BBRC) at UTEP, from
584
the National Institutes on Minority Health and Health Disparities (NIMHD), a component of the
585
NIH.
(RCMI)
program,
grants
8G12MD007592,
2G12RR008124-16A1,
and
586
587
AUTHOR CONTRIBUTIONS
588
Conceived and designed the experiments: ASS, CDL, FCMN, CFP and MCRB. Performed the
589
experiments: ASS, CDL, FCMN, CFP, DLC, ALVZF and DJ. Analyzed the data: ASS and
590
MCRB. Contributed reagents/materials/analysis tools: NG, ICA, DJ, DSF, AS, DJ and MCRB.
591
Wrote the paper: ASS, CDL and MCRB.
592
593
594
595
596
597
598
599
600
601
602
603
604
REFERENCES
605
1. Carruthers VB, Sibley LD (1997) Sequential protein secretion from three distinct o
606
organelles of Toxoplasma gondi accompanies invasion of human fibroblasts. Eur J Cell Biol
607
73:114-123.
608
609
610
611
2. Carruthers V B, Giddings OK, Sibley LD (1999) Secretion of micronemal proteins is
associated with Toxoplasma invasion of host cells. Cell Microb 1: 225-235.
3. Lovett JL, Sibley LD (2003) Intracellular calcium stores in Toxoplasma gondii govern
invasion of host cells. J Cell Sci 116: 3009-3016.
612
4. Brench S, Carruthers VB, Fergunson DJ, Gliddings OK, Wang G et al. (2001) The
613
Toxoplasma micronemal protein MIC4 is an adhesion composed of six conserved apple
614
domains. J Biol Chem 276: 4119-4127.
615
616
617
618
619
620
5. Reiss M, Viebig N, Brench S, Fourmaux MN, Soete M, et al. (2001) J Cell Sci 152: 563578.
6. Cerede O, Dubremetz JF, Soete M, Deslee D, Vial H, et al. (2005) Synergistic role of
micronemal proteins in Toxoplasma gondii virulence. J. Exp Med 201:453-463.
7. Blumenchein TM, Friedrich N, Childs RA, Saourus S, Carpenter EP, et al. (2007) Atomic
resolution insight into host cell recognition by Toxoplasma gondii. EMBO J 26: 2808-2820.
621
8. Lourenço EV, Bernardes EV, Silva NM, Mineo JR, Panunto-Castelo A, et al. (2006)
622
Immunization with MIC1 and MIC4 induces protective immunity agaisnt Toxoplasma
623
gondii. Microb Infect 8: 1244-1251.
624
9. Blasius AL, Beutler B. (2010) Intracellular toll-like receptors. Immunity 32: 305-315.
625
10. Takeda K, Kaisho T, Akira S. (2003) Toll-like receptors. Annu Rev Immunol 21: 335-376.
626
11. Yarovinsk F, Sher, A. (2006) Toll-like receptor recognition Toxoplasma gondii. Int J
627
Parasitol 36: 255-259.
628
12. Scanga CA, Aliberti J, Jankovic D, Tilloy F, Bennouna S, et al. (2002) Cutting edge: MyD88
629
is required for resistance to Toxoplasma gondii infection and regulates parasite-induced IL-
630
12 production by dendritic cells. J Immunol 168: 5997-6001.
631
632
13. Yarovinsky F, Zhang D, Andersen JF, Bannernberg GL, Serhan CN, et al. (2005) TLR11
activation dendritic cells by a protozoan profilin-like protein. Science 308: 1626-1629.
633
14. Koblansky AA, Jankovic D, Oh H, Hieny S, Sungnak W, et al. (2013) Recognition of
634
profiling by Toll-like receptor is critical for host resistance to Toxoplasma gondii. Immunity
635
38:119-130.
636
15. Andrade WA, Souza MC, Ramos-Martinez E, Napgal K, Dutra MS, Melo MB, et al. (2013)
637
Combinated action of nucleic acid-sensing Toll-like receptors and TLR11/12 heterodimers
638
imparts resistance to Toxoplasma gondii in mice. Cell Host Microbe 13: 42-53.
639
16. Gonzalez RMS, Shehata H, O’Connell MJ, Yang Y, Moreno-Fernandez ME, et al. (2014)
640
Toxoplasma gondii-direved profilin triggers human toll-like receptor 5-dependent cytokine
641
production. Journal of Innate Immune (volume 6, página?).
642
17. Debierre-Grockiego F, Campos MA, Azzouz N, Schmidt J, Bieker U, et al. (2007)
643
Activation of TLR2 and TLR4 by glycosylphosphatidylinositol derived from Toxoplasma
644
gondii. J Immunol 179: 1129-1137.
645
18. Ozinsky A, Underhill DM, Fontenot JD, Hajjar AM, Smith KD, et al. (2000) The repertoire
646
for pattern recognition of pathogens by the innate immune system is defined by cooperation
647
between Toll-like receptors. Proc Natl Acad Sci US 97: 13766- 13771.
648
19. Nilsen NJ, Deininger S, Nonstad U, Skjeldal F, Husebye H, et al. (2008) Cellular trafficking
649
of lipoteichoic acid and Toll-like receptor 2 in relation to signaling: role of CD14 and CD36.
650
J Leuk Biol 84: 280- 291.
651
652
20. Kirschning CJ, Schumann RR. (2002) TLR2: cellular sensor for microbial and endogenous
molecular patterns. Curr Top Microbiol Immunol 2002 270:121- 144.
653
21. Triantafilou M, Gamper FG, Haston RM, Mouratis MA, Morath S, et al (2006) Membrane
654
Sorting of toll-like receptor (TLR)-2/6 and TLR2/1 heterodimers at cell surface determines
655
heterotypic associations with CD36 and intracellular targeting. J Biol Chem 281: 31002-
656
31011.
657
658
22. Carruthers VB, Häkansson S, Giddings OK, Sibley LD. (2000) Toxoplasma gondii uses
sulfated proteoglycans for substrate and host cell attachment. Infect Immun 68: 4005-4011.
659
23. Monteiro VG, Soares CP, de Souza W. (1998) Host cell surface sialic acid are involved on
660
the process of penetration of Toxoplasma gondii into mammalian cells. FEMS Microbiol
661
Lett 164: 323-327.
662
24. Ortega-Barria E, Boothroyd JC. (1999) A Toxoplasma lectin-like activity specific for
663
sulfated polysaccharides is involved in host cell infection. J Biol Ch23em 274: 1267-1276.
664
25. Lourenço EV, Pereira SR, Faça VM, Coelho-Castro AA, Mineo M, et al. (2001) Toxoplasma
665
gondii micronemal protein MIC1 is a lactose-binding lectin. Glycobiology 11: 541-547.
666
26. Friedrich N, Santos JM, Liu Y, Palma AS, Leon E, et al. (2010) Members of a novel protein
667
family containing microneme adhesive repeat domains act as sialic acid-binding lectins
668
during host cell invasion by apicomplexa parasites. J Biol Chem 285: 2064- 2076.
669
27. Weber AN, Morse MA, Gay NJ. (2004) Four N-linked glycosylation sites in human toll-like
670
receptor 2 cooperate to direct efficient biosynthesis and secretion. J Biol Chem 279: 34589-
671
34594.
672
673
674
675
676
677
678
679
28. Correia JS, Ulevitch RJ. (2002) MD-2 and TLR4 N-linked glycosylations are important for a
functional lipopolysaccharide receptor. J Biol Chem 277: 1845-1854.
29. Marchant J, Cowper B, Liu Y, Lai L., Pinzan C, et al. (2012) Galactose recognition by the
apicomplexan parasite Toxoplasma gondii. J Biol Chem 287: 16720-16733.
30. Hoebe K, Georgel P, Rutschmann S, Du X, Mudd S, et al. (2005) CD36 is a sensor of
diacylglycerides. Nature 433:52 3-527.
31. Jiang Z, Georgel P, Du X, Shamel L, Sovath S, et al. (2005) CD14 is required for MyD88idependent LPS signaling. Nat Immunol 6: 565-570.
680
32. Garnett JA, Liu Y, Leon E, Alman SA, Friedrich N, et al. (2009) Detailed insights from
681
microarray and crystallographic studies into carbohydrate recognition by microneme protein
682
1 (MIC1) of Toxoplasma gondii. Protein Sci 18: 1935-1947.
683
33. Peng GH, Yuan ZG, Zhou DH, He XH, Liu MM, et al. (2009). Toxoplasma gondii
684
microneme protein 6 (MIC6) is a potential vaccine candidate against toxoplasmosis in mice.
685
Vaccine 27: 6570-6574.
686
34. Liu MM, Yuan ZG, Peng GH, Zhou DH, He XH, et al. (2010) Toxoplasma gondii
687
microneme protein 8 (MIC8) is a potential vaccine candidate against toxoplasmosis.
688
Parasitol Res 106: 1079- 1084.
689
690
691
692
35. Scharton-Kersten T, Denkers EY, Gazzinelli R, Sher A. (1995) Role of IL12 in induction of
cell-mediated immunity to Toxoplasma gondii. Res Immunol 146: 539–545.
36. Kawai T, Akira S. (2010) The role of pattern-recognition receptors in innate immunity: udate
on Toll-like receptors. Nat Immunol 11: 373-384.
693
37. Mun HS, Aosai F, Norose K, Chen M, Piao LX, et al. (2003) TLR2 as an essential molecule
694
for protective immunity against Toxoplasma gondii infection. Int Immunol 15: 1081-1087.
695
38. Gopal R, Birdsell D, Monroy FP. (2008) Regulation of toll-like receptors in intestinal
696
epithelial cells by stress and Toxoplasma gondii infection. Parasite Immunol 30: 563-576.
697
39. Campos RM, Almeida IC, Takeuchi O, Akira S, Valente EP, et al. (2001) Activation of Toll-
698
like receptor-2 by glycosylphosphatidylinositol anchors from a protozoan parasite. J
699
Immunol 167: 416-423.
700
40. Krishnegowda G, Hajjar AM, Zhu J, Douglass EJ, Uematsu S, et al. (2005). Induction of
701
proinflammatory responses in macrophages by the glycosylphosphatidylinositols of
702
Plasmodium falciparum: cell signaling receptors, glycosylphosphatidylinositol (GPI)
703
structural requirement, and regulation of GPI activity. J Biol Chem 280: 8606- 8616.
704
41. Farhat K, Riekenberg S, Heine H, Debarry J, Lang R, et al. (2008) Heterodimerization of
705
TLR2 with TLR1 or TLR6 expands the ligand spectrum but does not lead to differential
706
signaling. J Leuk Biol 83: 692- 701.
707
42. Oosting M, Ter Hofstede H, Sturm P, Adema GJ, Kullberg BJ, et al. (2011). TLR1/TLR2
708
heterodimers play an important role in the recognition of Borrelia spirochetes. PloS One. 6:
709
e25998
710
43. Chang S, Dolganiuc A, Szabo G. (2007) Toll-like receptors 1 and 6 are involved in TLR2-
711
mediated macrophage activation by hepatitis C virus core and NS3 proteins. J Leukoc Biol
712
82: 479- 487.
713
44. Schromm AB, Brandenburg K, Rietschel ET, Flad HD, Carroll SF, et al. (1996)
714
Lipopolysaccharide-binding
protein
mediates
CD14-independent
715
lipopolysaccharide into phospholipid membranes. FEBS Lett 399: 267-271.
intercalation
716
45. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. (1990) CD14, a receptor for
717
complexes of lipopolysaccharide (LPS) and LPS binding protein. Science 249: 1431-1433.
718
46. Muta T, Takeshige K. (2001) Essential roles of CD14 and lipopolysaccharide-binding
719
protein for activation of toll-like receptor (TLR)2 as well as TLR4 Reconstitution of TLR2-
720
and TLR4-activation by distinguishable ligands in LPS preparations. Eur J Biochem 268:
721
4580- 4589.
722
47. Nakata T, Yasuda M, Fujita M, Kataoka H, Kiura K, et al. (2006) CD14 directly binds to
723
triacylated lipopeptides and facilitates recognition of the lipopeptides by the receptor
724
complex of Toll-like receptors 2 and 1 without binding to the complex. Cell Microbiol
725
8:1899-1909.
726
727
48. Kirkland TN, Finley F, Leturcq D, Moriarty A, Lee JD, et al. (1993). Analysis of
lipopolyssacharide binding by CD14. J Biol Chem 268: 24818-24823.
728
49. Hailman E, Lichenstein HS, Wurfel MM, Miller DS, Johnson DA, et al. (1994)
729
Lipopolysaccharide (LPS)-binding protein accelerates the binding of LPS to CD14. J Exp
730
Med 179: 269-277.
731
732
50. Dziarski R, Tapping RI, Tobias PS. (1998) Binding of bacterial peptidoglycan to CD14. J
Biol Chem 273: 8680-8690.
733
51. Manukyan M, Triantafilou K, Triantafilou M, Mackie A, Nilsen N, et al. (2005) Binding of
734
lipopeptide to CD14 induces physical proximity of CD14, TLR2 and TLR1. Eur J Immunol
735
35: 911- 921.
736
737
738
739
52. Kumar H, Kawai T, Akira S. (2009) Toll-like receptors and innate immunity. Biochem
Biophys Res Commun 388: 621-625.
53. Silverstein RL, Febbraio M. (2009) CD36, a scavenger receptor involved in immunity,
metabolism, angiogenesis, and behavior. Sci Signal 2: re3.
740
54. Izadi H, Motameni AT, Bates TC, Oliveira ER, Villar-Suarez V, et al. (2007). c-Jun N-
741
terminal kinase 1 is required for Toll-like receptor 1 gene expression in macrophages. Infect
742
Immun 75: 5027-5034.
743
744
745
746
55. Jin MS, Kim SE, Heo JY, Lee ME, Kim HM, et al. (2007) Crystal Structure of TLR1-TLR2
heterodimer induces by binding of a triacylated lipopeptide. Cell 130: 1071-1082.
56. Kammanadiminti SJ, Mann BJ, Dutil L, Chadee K. (2004) Regulation of Toll-like receptor-2
expression by Gal-lectin of Entamoeba histolytica. FASEB J 18: 155-157.
747
57. Dodson JM, Lenkowki PW Jr, Eubanks AC, Jacson TF, Napodano J, et al. (1999) Infection
748
and immunity mediated by the carbohydrate recognition domain of the Entamoeba
749
histolytica Gal/GalNAc lectin. J Infect Dis 179: 460-466.
750
58. Galván-Moroyoqui JM, Del Carmen Domínguez-Robles M, Meza I. (2011) Pathogenic
751
bacteria prime the induction of Toll-like receptor signalling in human colonic cells by
752
the Gal/GalNAc lectin carbohydrate recognition domain of Entamoeba histolytica. Int J
753
Parasitol 41:1101-1112.
754
59. Khan
S, Bijker
MS, Weterings
JJ, Tanke
HJ, Adema
GJ,
et
al.
(2007)
755
Distinct uptake mechanisms but similar intracellular processing of two different toll-like
756
receptor ligand-peptide conjugates in dendritic cells. J Biol Chem 282: 21145-21159.
757
758
60. Carruthers VB, Tomley FM. (2008) Receptor-ligand interaction and invasion: Microneme
proteins apicomplexan. Subcell Biochem 47: 33-45.
759
61. Takeda K, Akira S. (2005) Toll-like receptors in innate immunity. Int Immunol 17: 1-14.
760
62. Underhill DM, Ozinsky A, Hajjar AM, Stevens A, Wilson CB, et al. (1999) The Toll-like
761
receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens.
762
Nature 401: 811- 815.
763
63. Akashi S, Shimazu R, Ogata H, Nagai Y, Takeda K, et al. (2000). Cutting edge: cell surface
764
expression and lipopolysaccharide signaling via the toll-like receptor 4-MD-2 complex on
765
mouse peritoneal macrophages. J Immunol 164: 3471-3475.
766
767
64. Mizushima S, Nagata S. (1990). pEF-BOS, a powerful mammalian expression vector.
Nucleic Acids Res 18: 5322.
768
65. Hajjar AM, O'Mahony DS, Ozinsky A, Underhill DM, Aderem A, et al. (2001) Cutting
769
edge: functional interactions between toll-like receptor (TLR) 2 and TLR1 or TLR6 in
770
response to phenol-soluble modulin. J Immunol 166: 15-19.
771
66. Schindler U, Baichwal VR. (1994) Three NF-kappa B binding sites in the human E-selectin
772
gene required for maximal tumor necrosis factor alpha-induced expression. Mol Cell Biol
773
14: 5820-5831.
774
67. Sweetser MT, Hoey T, Sun YL, Weaver WM, Price GA, et al. (1998). The roles of nuclear
775
factor of activated T cells and ying-yang 1 in activation-induced expression of the interferon-
776
gamma promoter in T cells. J Biol Chem 273: 34775-34783.
777
68. Stuart LM, Deng J, Silver JM, Takahashi K, Tseng AA. (2005) Response to Staphylococcus
778
aureus requires CD36-mediated phagocytosis triggered by the COOH-terminal cytoplasmic
779
domain. J Cell Biol 170: 477-485.
780
69. Lutz MB, Kukutsch N, Ogilvie AL, Rössner S, Koch F, et al. (1999) An advanced culture
781
method for generating large quantities of highly pure dendritic cells from mouse bone
782
marrow. J Immunol Methods 223: 77- 92.
783
70. Von Gunten S, Smith DF, Cummings RD, Riedel S, Miescher S, et al. (2009) Intravenous
784
immunoglobulin contains a broad repertoire of anticarbohydrate antibodies that is not
785
restricted to the IgG2 subclass. J Allergy Clin Immunol 123: 1268- 1276.
786
787
788
789
790
791
792
793
794
795
796
LEGENDS FOR FIGURES
797
Figure 1. Lectin activity of TgMIC1 and TgMIC4. (A) Glycoarray of TgMIC1/MIC4 native
798
subcomplex from parasite (Lac+), and recombinant forms of TgMIC1 and TgMIC4. 320
799
oligosaccharide probes were analyzed by reading their fluorescence intensities, and the 20 best
800
recognized glycans are shown above. (B) The activity and inhibition assay were performed in
801
microplates coated with glycoproteins with or without sialic acid, fetuin or asialofetuin,
802
respectively. After coating, TgMIC1 and TgMIC4 wild type (wt) or mutated (mut), pre
803
incubated with PBS or their specific sugars were added to the wells. Later, bound proteins were
804
detected through the addition of serum from T. gondii infected mice. *P < 0.05 by one-way
805
ANOVA. Gal: galactose; GalNAc: N-acetylgalactosamine; Glc: glucose; GlcNAc: N-
806
acetylglucosamine; Man: mannose; Fuc: fucose; Neu5Ac: N-acetylneuraminic acid; wt: wild
807
type protein; mut: protein with mutation in the carbohydrate recognition domain (CRD); ns: not
808
significative.
809
810
Figure 2. Microneme proteins stimulate pro-inflammatory citokyne production by
811
dendritic cells and macrophages. Bone marrow-derived dendritic cells (BMDCs) (A-D) and
812
bone marrow-derived macrophages (BMDMs) (E-H) from C57BL/6 mice, were stimulated with
813
TgMIC1 (5ug/ml) and TgMIC4 (5ug/ml) by 48 hours. LPS (500 ng/ml) was used as positive
814
control. The levels of IL-12p40, TNF-α and IL-6 were mensured by ELISA. *p<0.05 by one-
815
way ANOVA.
816
817
Figure 3. The IL-12 production induced by TgMICs is dependent on binding to toll-like
818
receptors 2 and 4. (A-F) BMDMs from WT, TLR2-/-, TLR4-/-, double knockout TLR2-/-/TLR4-/-
819
and DKO TLR11-/-/TLR12-/- mice (C57BL/6 background) were stimulated with TgMIC1 or
820
TgMIC4 (5ug/ml) by 48 hours. Pam3CSK4 (P3C) (1ug/ml) and LPS (1ug/ml) were used as
821
positive controls. IL-12p40 levels were mensured by ELISA. (G-I) Transfected HEK293T cells
822
expressing TLR2/1, TLR2/6 or TLR4 were stimulated with TgMIC1 (5ug/ml) or TgMIC4
823
(5ug/ml) for 24 hours. TLRs agonists were used as positive controls. IL-8 levels were mensured
824
by ELISA. (J) The interaction between TgMICs and TLRs was evaluated by western blot.
825
HEK293T cells transiently expressing Flag-TLR2 and Flag-TLR4 were lysed and incubated
826
with His-TgMIC1 (wt) or His-TgMIC4 (wt). His-TgMICs were subjected to Ni-affinity resin
827
pull down and analyzed for TLR2 and TLR4 binding by protein blotting with antibodies specific
828
for Flag and then His. *p<0.05 by one-way ANOVA.
829
830
Figure 4. The cellular activation induced by TgMICs via TLRs depends on carbohydrate
831
recognition. (A) BMDMs and (B) BMDCs from C57BL/6 mice, and (C) Transfected HEK293T
832
cells expressing fully glycosylated TLR2 were stimulated with TgMIC1 (wt) and TgMIC4 (wt)
833
or mutated forms, TgMIC1 (T126A/T220A) and TgMIC4 (K469M) by 48 hours. LPS (500
834
ng/ml) and FSL-1 (100 ng/ml) were used as positive controls. IL-12p40 and IL-8 levels were
835
mensured by ELISA. (D) HEK293T cells expressing fully glycosylated TLR2 (with 4 N-
836
glycans, WT) or glycosylation mutants of TLR2 (∆-1; ∆-4; ∆-1,2; ∆-3,4; ∆-2,4; ∆-1,2,3; ∆-
837
1,2,3,4) were stimulated with TgMIC1 or TgMIC4. FSL-1 was used as positive control. IL-8
838
levels were mensured by ELISA. Statistical analysis compared fully glycosylated TLR2 (WT)
839
and TLR2 mutants for the N-glycosylation sites for the same stimuli. *p<0.05 by one-way
840
ANOVA.
841
842
Figure 5. Initial production of IL-12 by dendritic cells during T. gondii infection depends
843
on TLR2 and TLR4. BMDCs from WT, MyD88-/-, DKO TLR2-/-/TLR4-/- and DKO TLR11-/-
844
/TLR12-/- (C57BL/6 background) were infected with wt T. gondii (RH strain, MOI 3). LPS (500
845
ng/ml) and STAg (10 ug/ml) (soluble T. gondii antigen) were used as positive controls. Cell
846
culture supernatants were collected after 6, 12, 24 and 48 hours and IL-12p40 production was
847
analyzed by ELISA. *P < 0.05 by one-way ANOVA.
848
849
Figure 6. TgMIC1 is important to induce the initial production of IL-12 during in vitro
850
infection with T. gondii. BMDCs (A-C) and BMDMs (D-F) from C57BL/6 mice were infected
851
with WT, TgMIC1-/-, TgMIC4-/- or DKO (TgMIC1-/-/TgMIC4-/-) T. gondii (RH strain, MOI 3:1).
852
LPS (500 ng/ml) and STAg (10 ug/ml) (soluble T. gondii antigen) were used as positive
853
controls. Cell culture supernatants were collected after 6, 12, 24 and 48 hours and IL-12
854
production was analyzed by ELISA. *P < 0.05 by one-way ANOVA.
855
856
857
858
859
860
861
862
FIGURES
863
864
865
Figure 1. Lectin activity of TgMIC1 and TgMIC4.
866
867
868
869
870
871
Figure 2. Microneme proteins stimulate pro-inflammatory citokyne production by
872
dendritic cells and macrophages.
873
874
875
876
877
Figure 3. The IL-12 production induced by TgMICs is dependent on binding to toll-like
878
receptors 2 and 4.
879
880
881
882
Figure 4. The cellular activation induced by TgMICs via TLRs depends on carbohydrate
883
recognition.
884
885
886
887
888
Figure 5. Initial production of IL-12 by dendritic cells during T. gondii infection depends
889
on TLR2 and TLR4.
890
891
892
893
894
895
Figure 6. TgMIC1 is important to induce the initial production of IL-12 during in vitro
896
infection with T. gondii.
897
898
899
900
901
902
Anexo II | 110
Anexo II
RESEARCH ARTICLE
Vaccination with Recombinant Microneme
Proteins Confers Protection against
Experimental Toxoplasmosis in Mice
Camila Figueiredo Pinzan1, Aline Sardinha-Silva1, Fausto Almeida1, Livia Lai2, Carla
Duque Lopes1, Elaine Vicente Lourenço3, Ademilson Panunto-Castelo4,
Stephen Matthews2, Maria Cristina Roque-Barreira1*
1 Department of Cell and Molecular Biology, Ribeirão Preto Medical School, University of São Paulo,
Ribeirão Preto, São Paulo, Brazil, 2 Division of Molecular Biosciences, Imperial College London, South
Kensington Campus, London, SW7 2AZ, United Kingdom, 3 Department of Medicine, Division of
Rheumatology, University of California Los Angeles, Los Angeles, California, 90095–1670, United States of
America, 4 Department of Biology, School of Philosophy, Sciences and Literature of Ribeirão Preto,
University of Sao Paulo, Ribeirão Preto, São Paulo, Brazil
* [email protected]
OPEN ACCESS
Citation: Pinzan CF, Sardinha-Silva A, Almeida F, Lai
L, Lopes CD, Lourenço EV, et al. (2015) Vaccination
with Recombinant Microneme Proteins Confers
Protection against Experimental Toxoplasmosis in
Mice. PLoS ONE 10(11): e0143087. doi:10.1371/
journal.pone.0143087
Editor: Takafumi Tsuboi, Ehime University, JAPAN
Received: June 17, 2015
Accepted: October 4, 2015
Published: November 17, 2015
Copyright: © 2015 Pinzan et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.
Data Availability Statement: All relevant data are
within the paper.
Funding: This work was funded by Fundação de
Amparo à Pesquisa do Estado de São Paulo FAPESP (grant number: 05/50460-1) (www.fapesp.
br), by Conselho Nacional de Desenvolvimento
Científico e Tecnológico (grant number: 154963/
2006-2). The funders had no role in study design,
data collection and analysis, decision to publish, or
preparation of the manuscript.
Abstract
Toxoplasmosis, a zoonotic disease caused by Toxoplasma gondii, is an important public
health problem and veterinary concern. Although there is no vaccine for human toxoplasmosis, many attempts have been made to develop one. Promising vaccine candidates utilize proteins, or their genes, from microneme organelle of T. gondii that are involved in the
initial stages of host cell invasion by the parasite. In the present study, we used different
recombinant microneme proteins (TgMIC1, TgMIC4, or TgMIC6) or combinations of these
proteins (TgMIC1-4 and TgMIC1-4-6) to evaluate the immune response and protection
against experimental toxoplasmosis in C57BL/6 mice. Vaccination with recombinant
TgMIC1, TgMIC4, or TgMIC6 alone conferred partial protection, as demonstrated by
reduced brain cyst burden and mortality rates after challenge. Immunization with TgMIC1-4
or TgMIC1-4-6 vaccines provided the most effective protection, since 70% and 80% of
mice, respectively, survived to the acute phase of infection. In addition, these vaccinated
mice, in comparison to non-vaccinated ones, showed reduced parasite burden by 59% and
68%, respectively. The protective effect was related to the cellular and humoral immune
responses induced by vaccination and included the release of Th1 cytokines IFN-γ and IL12, antigen-stimulated spleen cell proliferation, and production of antigen-specific serum
antibodies. Our results demonstrate that microneme proteins are potential vaccines against
T. gondii, since their inoculation prevents or decreases the deleterious effects of the
infection.
Competing Interests: The authors have declared
that no competing interests exist.
PLOS ONE | DOI:10.1371/journal.pone.0143087 November 17, 2015
1 / 18
Microneme Proteins Confers Protection against Toxoplasmosis
Introduction
T. gondii is an obligate intracellular protozoan parasite that infects warm-blooded animals and
causes toxoplasmosis. This wide host range makes T. gondii one of the most successful protozoan parasites. In pregnant women, the infection can lead to miscarriage, neonatal malformations, ocular complications, and severe cognitive impairment in the fetus [1, 2]. Furthermore,
the infection can be fatal for immunocompromised patients such as those with AIDS [3, 4],
organ transplant recipients [5, 6], or those with neoplastic disease [7]. In addition, toxoplasmosis can cause substantial economic losses to the farming industry [8, 9]. The most important
interventions for toxoplasmosis rely on chemotherapeutic agents. However, the agents in use
are inadequate, expensive, and often toxic [10, 11]. Until now, there is no commercial vaccine
for use in humans, whereas a vaccine developed for veterinary use showed limited efficacy [12–
14]. Therefore, the development of an effective vaccine or immunotherapy against human
toxoplasmosis would be particularly valuable for preventing both primary fetal infection and
reactivation in immunocompromised individuals. In addition, vaccination might reduce economic losses by preventing abortions in farm animals. Attenuated and inactivated parasites,
genetically engineered antigens, and DNA vaccines are among potential vaccines for toxoplasmosis and have been tested for their immunological effects in animal models. Because of poor
efficiency or biosafety concerns, only few vaccines have been licensed for use [15]. The characterization of molecules that play a role in the pathogenesis of T. gondii infection may constitute
an important step in vaccine development.
Most of the studies performed on antigens involved in imparting protective immunity
against T. gondii were focused on molecules that belong to 3 major protein families: surface
antigens (SAGs), dense granule excreted-secreted antigens (GRAs), and rhoptry antigens
(ROPs). However, the microneme proteins are particularly promising as vaccine antigens
because they are responsible for host-cell recognition, binding, secretion of rhoptry organelles,
and cell penetration of all apicomplexans [16–19]. Among the micronemes (MICs), T. gondii
microneme protein 1 (TgMIC1), TgMIC4, and TgMIC6 form a complex that exerts a very
important role in host cell invasion [18]. We have previously reported that a lactose-affinity
fraction (Lac+) purified from the soluble tachyzoite antigen of the T. gondii RH strain is constituted of TgMIC1 and TgMIC4, and that vaccination of C57BL/6 mice with Lac+ induces protective immunity against T. gondii [20, 21]. Such protection was demonstrated by increased
survival rate and reduced tissue parasitism, as well as a Th1-specific immune response [20].
Yet the production of Lac+ from tachyzoites is an arduous task that involves several purification procedures and provides low protein yields, making unfeasible its use in vaccine development. Therefore, in the present work, we have generated recombinant TgMIC1, TgMIC4, and
TgMIC6 proteins, which were evaluated individually or in several combinations for their ability
to induce protective immunity in mice against infection by T. gondii.
Materials and Methods
2.1. Animal ethics statement
All the experiments were developed in accordance to ethical principles in animal research
adopted by Brazilian Society for Laboratory Animal Science and approved by the Ethics Committee on Animal Experiments, Ethical Committee of Ethics in Animal Research (CETEA) of
the College of Medicine of Ribeirão Preto of the University of São Paulo (protocol number,
065/2012). All efforts were made to minimize animal suffering and the numbers of mice
required for each experiment.
2 / 18
2.2. Mice and parasites
Female C57BL/6 (H-2b) mice aged 6–7 weeks were purchased from the animal house of the
Campus of Ribeirão Preto, University of São Paulo. All mice were bred and maintained in
small groups inside isolator cages with light/dark cycle of 12 hours, besides food and water ad
libitum were provided, in the animal housing facility of School of Medicine of Ribeirão Preto,
University of São Paulo. Cysts of the ME49 strain, which has low virulence for mice, were
obtained from the brain of orally infected C57BL/6 mice, and maintained by monthly passage
of 20 cysts per animal.
2.3 Preparation of soluble T. gondii antigens (STAg)
The tachyzoites of the RH strain obtained from the peritoneal exudate of infected mice were
washed three times with phosphate-buffered saline (PBS, 10 mM sodium phosphate containing
0.15 M NaCl, pH 7.2) by centrifugation at 1,000 × g and suspended in PBS containing 0.8M
phenyl methyl sulfonyl fluoride (Sigma Chemicals, St. Louis, USA). This parasite suspension
was then sonicated (Vibra-cell; Sonics & Materials Inc., Danbury, USA) and centrifuged at
15,000 × g for 15 min, at 4°C. Supernatant was used as antigen source (STAg).
2.4. Isolation of lactose-binding proteins (Lac+)
Twenty milligrams of STAg was submitted to affinity chromatography on a 5-ml α-lactoseagarose column (Sigma Chemicals) previously equilibrated at 4°C with PBS containing 0.5 M
NaCl. After washing the column with equilibrating buffer, the adsorbed material (Lac+) was
eluted with 10 mL of 0.1M lactose in equilibrating buffer, concentrated, and dialyzed against
water in an ultradiafiltration system using 10,000-Da cutoff membrane (YM10 -Amicon1
Division; W.R. Grace & Co., Beverly, USA).
2.5. Construction of the expression plasmid
A cDNA library from ME49-PDS T. gondii tachyzoites was kindly provided by Dr. Ian Manger,
Department of Microbiology and Immunology, Stanford University School of Medicine (Stanford, CA, USA) and was used as the template for the initial PCR, to amplify the TgMIC1 and
TgMIC4 genes, using the following specific primers: TgMIC1 50 (TCGCATTCTCATTCGCCG
GCA)30 and 30 (TCAAGCAGAGACGGCCGTAGGACT)50 and for TgMIC4 50 (ATCACGCCTGC
AGGTGATGAC)30 and 30 (TCATTCTGTGTCTTTCGCTTCAAG)50 . These primers were
designed on the basis of published sequences (GenBank accession numbers: TgMIC1—
Z71786.1 and TgMIC4—AF143487.2). Two additional PCR steps have been performed for
introducing the recombination sites attB1 and attB2 at both 50 —(50 -GGGGACAAGTTTGTAC
AAAAAAGCAGGC-30 ) and 30 —end (50 -GGGGACC ACTTTGTACAAGAAAGCTGGG-30 ) of the
cDNA. The PCR products were cloned into a pDONR201 vector (Invitrogen, Carlsbad, CA) to
obtain the pENTR-TgMIC1 and pENTR-TgMIC4 constructs used to transform DH5α Escherichia coli competent cells. The DNA from several Kanr clones were sequenced. Inserts from
pENTR-TgMIC1 and pENTR-TgMIC4 were transferred into pDEST17 vectors (Invitrogen)
through a second recombination step and yielded pEXP17-TgMIC1 and pEXP17-TgMIC1.
Plasmids were used to transform DH5α E. coli cells to select the Ampr expression. Plasmids
extracted from DH5α E. coli were transformed in E. coli BL21-DE3 competent cells to produce
fusion proteins with N-terminal 6-histidine (6xHis) tag. The pET 21b plasmid containing fulllength TgMIC6 gene was kindly provided by Professor Stephen Matthews, Division of Molecular Biosciences, Imperial College London (UK).
3 / 18
2.6. Expression of TgMIC1, TgMIC4, and TgMIC6 proteins
E. coli BL21 (DE3) (Novagen) cells transformed with pDEST17-MIC1, pDEST17-MIC4, or
pET21b-MIC6 were grown on Luria-Bertani (LB) agar plates containing ampicillin (100 μg/
mL) and chloramphenicol (34 μg/mL). Individual colonies were grown in 5 mL LB medium
supplemented with ampicillin (100 μg/mL) at 37°C at 220 rpm. After 18 h, in 5 mL of LB
medium supplemented with antibiotics. An aliquot of each culture was used to inoculate separately to 500 mL of fresh LB medium containing antibiotics. Cells were grown for 2–2.5 h until
an optical density (OD600) of 0.4–0.6 was reached, when the expression was induced with the
addition of 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The culture was grown for
additional 4 h and harvested by centrifugation at 4,500 × g for 20 min at 4°C.
2.7. Isolation of inclusion bodies using centrifugation
Cell pellets were suspended in disruption buffer consisted of 50 mM Tris-HCL pH 7.5 containing, NaCL 100mM, EDTA 5mM, PMSF 0,1 mM, 4 μl DNase (20,000 U) and lysozyme 1mg
\mL. The cell pellets were stirred for 30 min at room temperature and disrupted by sonication
(Sonics and Materials, Vibra cell) for 2 min × 10 (pulse on, 1 s; pulse off, 1 s; temperature of
probe, 4°C; and amplitude, 80%). After ultra-sonication, the mixture was centrifuged at
15,200g for 15 min at 4°C. The pellet containing insoluble recombinant TgMICs proteins
(inclusion bodies) were washed three times with 50 mM Tris–HCl, 100 mM NaCl, PMSF 0,1
mM and 0.5% Triton X-100 (pH 8.0), and finally with the same buffer without Triton X-100.
2.8. Inclusion body solubilization and refolding by gradient dialysis
The pellets were suspended in buffer containing 8 M urea, 50 mM glycine and 100 mM Tris–
HCl, (pH 7.4) and solubilized overnight with stirring at room temperature, the solubilized
inclusion body was centrifuged at 15,200g for 40 min at 4°C, and the supernatant was collected.
Refolding was done with chaotropic agents’ concentration gradient dialysis using a previously
described method, with modifications [22]. The solutions of denatured proteins were dialyzed
against 2 L of freshly made 4, 2, 1, 0.5, and 0 M urea, respectively, with 100 mM Tris-HCl (pH
7.4). With each concentration, the protein was dialyzed 24 h at 4°C. After the urea removal the
samples were dialyzed against 5 mM Tris-HCl (pH 7.4) an ultradiafiltration system using
10,000-Da cutoff membrane (YM10 -Amicon1 Division; W.R. Grace & Co., Beverly, USA).
To remove endotoxin impurities, endotoxin-free columns (Bio_Rad, 0,5x10 cm) were
packed with 1ml polymyxine B suspended in pyrogen-free water. The microneme proteins
fractions were pumped over the columns with a flow rate of 1 ml/min and collected in sterile
pyrogen-free tubes. The endotoxin level was measured with a Chromogenic End-point Endotoxin Assay Kit (Chinese Horseshoe Crab Reagent Manufactory, Xiamen, China). Less than 0.1
EU/ml of endotoxin was detected in the final protein preparations.
2.9. Immunization
C57BL/6 mice were subcutaneously (s.c.) injected with TgMIC1 (10 μg), TgMIC4 (10μg),
TgMIC6 (10μg), TgMIC1-4 (5 μg of each protein), TgMIC1-4-6 (3.3μg of each protein), or Lac
+ (10 μg) emulsified in Freund’s complete adjuvant (Sigma Chemicals). Animals were boosted
at the same dose and regimen on day 15 and 30 after first injection, now emulsified in Freund’s
incomplete adjuvant (Sigma Chemicals). A control group was injected at the same regimen
with PBS emulsified in Freund’s adjuvant (vehicle). Fifteen days after the last injection, blood
and spleen samples were collected to assess serum IgG, in vitro T cell proliferation, and cytokine concentrations.
4 / 18
2.10. Determination of T. gondii-specific IgG and IgG subclass titers
Specific antibody responses were analyzed by enzyme-linked immunosorbent assay (ELISA).
For total IgG detection, the collected serum samples were diluted 1:25, 1:50, 1:100, 1:200, and
1:400. For isotype detection, the serum samples were diluted 1:100. The assays were performed
in microtiter plates (Nunc, Naperville, USA), which were coated with STAg (50 μL per well) at
a concentration of 10 μg/mL in 50 mM sodium carbonate buffer, pH 9.6, overnight, at 4°C. The
plates were then washed three times in PBS containing 0.05% Tween 20 (PBS-T) (pH 7.4).
Non-specific binding sites were blocked with PBS-T containing 1% bovine serum albumin
(BSA; blocking buffer), for 1 h, at 37°C. Serum samples (50 μl) were added to duplicate wells in
blocking buffer. Plates were then incubated at 37°C for 1 h, washed four times, and incubated
with horseradish-peroxidase-conjugated goat anti-mouse IgG, IgG1, or IgG2b (Santa Cruz Biotechnology), at 1:5000 dilution in blocking buffer, for 1 h, at 37°C. After washing with PBS-T,
reactions were developed with the TMB (3,30,5,50-tetramethylbenzidine) Substrate Kit,
according to the manufacturer’s instructions (Pierce Chemical Co., Rockford, USA). The reaction was stopped 15 min later by addition of 25μL of 1M sulfuric acid to each well. The absorbance was read at 450 nm by using a Microplate Scanning Spectrophotometer (PowerWavex;
Bio-Tek Instruments, Inc., Winooski, USA).
2.11. Cytokine level quantification
The spleens aseptically removed from mice, fifteen days after the last immunization procedure,
were gentle disrupted and passed through nylon mesh in RPMI medium. Single-cell suspensions were depleted of erythrocytes by hypotonic shock, and suspended in RPMI medium
(Sigma Chemicals) supplemented with 10% fetal calf serum, 10 mM HEPES, 2 mM L-glutamine, 1 mM sodium pyruvate, and 50μM β-mercaptoethanol. The cells were then seeded in
flat-bottom 24-well microtiter plates (Corning, USA) at density of 1 × 106 cells per well, in 1
mL of the culture medium alone or medium with STAg (10 μg/mL) in duplicate. Cells were
stimulated with concanavalin A (2 μg/mL) as positive control. The plates were incubated in
atmosphere containing 5% CO2 at 37°C. The optimal STAg concentration was previously
determined by a dose response assay. Cell-free supernatants were harvested and assayed for IL12p40 and IL-4 concentrations following a 24-h culture, IL-10 concentration, 72-h culture, and
IFN-γ concentration, 96-h culture. Cytokine production in supernatants was quantified using
an ELISA kit, according to the manufacturer’s instructions (OptEIA set; Pharmingen, San
Diego, CA).
2.12. Lymphoproliferation assay
Spleen cells, prepared as described previously, were suspended in RPMI medium (Sigma
Chemicals) supplemented with 10% fetal calf serum, 10 mM HEPES, 2 mM L-glutamine, 1 mM
sodium pyruvate, and 50μM β-mercaptoethanol. They were distributed in flat-bottom 96-well
microtiter plates (Corning) at a density of 5 × 105 cells per well, in 200 μL of culture medium
alone or medium with STAg (10 μg/mL) in triplicate. Cells were stimulated with concanavalin
A (2 μg/ml) as positive control. The plates were incubated for 3 days in atmosphere containing
5% CO2 at 37°C and pulsed with 1 μCi [3H]thymidine per well for an additional 18-h period.
The cells were next harvested onto glass fiber filters and incorporated radioactivity (counts per
minute [cpm]) was measured in a liquid scintillator. The results are expressed as mean counts
per minute (count) for three replicates.
5 / 18
2.13. Challenge and infection
One month after the last immunization procedure, the mice were orally infected with 80 cysts
of the ME49 strain and were monitored and recorded for 30 days to compute the survival rates.
During this period, the infected mice were closely monitored two times a day (at 8 am and 6
pm) for their clinical appearance. The mice were weighed daily and monitored for clinical
signs of infection–weight loss, ruffled fur, hunched posture, decrease in appetite, weakness/
inability to obtain feed or water, lethargy and morbidity. If obvious sufferings were observed,
the mice were immediately euthanized using CO2 in a custom flow metered chamber. At the
end of the experimental window, all the remaining mice were euthanized with CO2.
To evaluate the effect of immunization on tissue cyst burden, the brain of the mice infected
with 40 cysts was removed 1 month after the challenge and homogenized in 1 mL of PBS, by
passing it through a 25-×-8-gauge needle (Becton Dickinson, Curitiba, Brazil). Cysts were separated from the brain tissue by using a previously described method, with modifications [23].
Homogenates were centrifuged in 16% dextran gradient (industrial grade, average molecular
weight: 170,000; Sigma Chemicals) in PBS, at 3,000 × g for 15 min at 4°C. The mean number of
cysts per brain was determined by phase-contrast microscopy at 100× magnification and
counting five samples (8 mL each) of each pellet. The results are expressed as means ± SD for
each group.
Additionally, blood samples from groups of 4 infected mice were collected 30 days after T.
gondii challenge and the serum cytokine levels were analyzed by ELISA as described above.
Blood samples from these mice were collected after the injection with anesthetics Ketamine
(Syntec Brasil Ltda, SP, Brazil)/Xylazine (Schering-Plough Coopers, SP, Brazil), (10/0.5 mg per
100 g body weight) by i.p. route and then the mice were euthanized with CO2.
2.14 Statistical analysis
Statistical determinations of the difference between means of experimental groups were performed using one or two-way analysis of variance (ANOVA) followed by Bonferroni’s posttest using GraphPad Prism software (GraphPad Software, San Diego, CA, USA). Values were
considered significant when p <0.05. All experiments were performed at least three times.
Results
3.1. Expression and purification of TgMIC1, TgMIC4, and TgMIC6
recombinant proteins
Fig 1 shows the electrophoretic profile of samples harvested from recombinant clone cultures
before (lane 1) and after induction (lane 2) for the expression of TgMIC1 (panel A), TgMIC4
(panel B), and TgMIC6 (panel C). The T. gondii microneme proteins expressed in E. coli were
insoluble and contained inclusion bodies. They were diluted in refolding buffer containing 8M
urea, until concentrations as low as 100μg/ml were reached. Sequential dialysis removed the
denaturing agent and provided high yields of soluble proteins. SDS-PAGE of the purified
recombinant proteins showed a single band for each preparation, with molecular masses of
70-kDa for TgMIC1, 80-kDa for TgMIC4, and 30-kDa for TgMIC6 (Fig 1, lane 3 of Panels A,
B, and C). These masses are compatible with the predicted molecular mass for each protein
together with a polyhistidine-tag. The immunoreactivity of TgMIC1 and TgMIC4 preparations
with anti-Lac+ mouse serum was confirmed by western blot analysis; however, no reactivity
was observed with TgMIC6 preparation (Fig 1, panel E). The Lac+ fraction provided two
major protein bands with molecular masses of 53 and 68-kDa (Fig 1, panel D), both of which
were identified in the serum sample from anti-Lac+ mice (Fig 1, panel E). This recognition
6 / 18
Fig 1. SDS-PAGE and western blot analysis of native and recombinant microneme proteins. SDS-PAGE of recombinant proteins (panels A, B, and C,
Coomassie Blue stained) or native (panel D, silver-stained) proteins. Heterologous expression was noted in E. coli (DE3) and recombinant proteins were
detected in inclusion bodies. Lane 1: protein expression before induction. Lane 2: protein expression after induction. Lane 3: purified and refolded histidinetagged recombinant proteins, displayed apparent molecular masses of 70-kDa (TgMIC1, panel A), 80-kDa (TgMIC4, panel B), and 30-kDa (TgMIC6, panel
C). Panel E shows the electrophoretical profile of the Lac+ fraction, composed of the native proteins TgMIC1 (53-kDa) and TgMIC4 (68-kDa). Lane M:
Molecular mass markers. Reactivity of recombinant and native microneme proteins with anti-Lac+ mouse serum was examined by western blot (Panel E),
developed with peroxidase-conjugated goat anti-mouse IgG.
doi:10.1371/journal.pone.0143087.g001
indicates that the recombinant TgMIC1 (rTgMIC1) and TgMIC4 (rTgMIC4) had antigenic
similarities with the corresponding native proteins. The lack of rTgMIC6 recognition by antiLac+ serum was predictable, since this microneme protein is not a constituent of the Lac+ fraction purified from the parasite, as already demonstrated and now reinforced by the electrophoretic profile of Lac+ shown in Fig 1, panel D.
3.2. Humoral immunity elicited by vaccination with microneme proteins
To evaluate whether immunization protocol (Fig 2) with microneme proteins could elicit specific humoral responses, serum samples from immunized and control mice were collected fifteen days after the last booster, and specific IgG levels were analyzed by ELISA. High IgG titers
were detected in the sera of all immunized mice. Notably, the titers were higher in the sera
from the mice immunized with combinations of microneme proteins, i.e., TgMIC1-4,
TgMIC1-4-6, and Lac+ than in the sera from the mice immunized with individual proteins,
i.e., TgMIC1, TgMIC4, or TgMIC6 (Fig 3A). We also examined whether a skew toward Th1 or
Th2 immunity could be inferred from the levels of specific IgG1 and IgG2b subclasses detected
in the serum samples. Immunized mice in all groups presented higher serum levels of specific
IgG1 and IgG2b, in comparison to the sera of the non-immunized mice (Fig 3B). A significantly higher IgG2b value than IgG1 was observed in mice immunized with combinations of
recombinant microneme proteins (TgMIC1-4, TgMIC1-4-6) or with the native complex Lac+
(obtained from STAg and comprising TgMIC1-4), while no significant differences were
7 / 18
Fig 2. Experimental Protocol. (A) In the first experimental procedure mice were subcutaneously (s.c.)
vaccinated with microneme proteins emulsified in Freund’s complete adjuvant. Mice were boosted at the
same dose and regimen on day 15 and 30 after first injection, now emulsified in Freund’s incomplete
adjuvant. Fifteen days after the last injection, blood and spleen samples were collected to assess serum IgG,
in vitro T cell proliferation, and cytokine concentrations. (B) One month after the last immunization procedure,
the mice were orally infected with 80 cysts of the ME49 strain and the mortality was monitored daily for 1
month. To evaluate the tissue cyst burden, the brain of the mice infected with 40 cysts was removed 1 month
after the challenge and the mean number of cysts per brain was determined. Additionally, blood samples from
mice challenged with 40 cysts were collected 30 days after T. gondii challenge and the serum cytokine levels
were analyzed.
observed in the control group (PBS), suggesting that these microneme proteins elicited prominent Th1 immunity.
3.3 Cellular immunity elicited by vaccination with microneme proteins
We compared the proliferative response of the spleen cells from vaccinated and non-vaccinated
animals stimulated in vitro with STAg. Proliferation of the cells from immunized mice was significantly higher than that of the cells from non-immunized mice. Cell proliferation was at
least 2 times higher in the spleen cells from the mice immunized with TgMIC1-4-6 compared
to that observed in cells from other groups of immunized mice, which was comparable to cell
proliferation from any group of mice polyclonally stimulated with Con A (Fig 4A).
The cell-mediated immunity generated by the immunized mice was also evaluated by measuring the levels of cytokines (IL-12p40, IFN-γ, IL-4, and IL-10) released in the supernatant of
spleen cells cultured under STAg stimulation (Fig 4B, 4C and 4D). Spleen cells from all groups
of immunized mice displayed high IL-12 production, primarily those from mice immunized
with multicomponent preparations, because they produced twice as much IL-12 than the cells
from mice immunized with single-component microneme protein. Notably, STAg stimulation
generated IL-12 production by the spleen cells from non-immunized mice (PBS), in amounts
that were close to those released by cells from mice immunized with single-component preparations such as TgMIC1, TgMIC4, or TgMIC6. High concentrations of IFN-γwere predominantly produced by cells of all groups of immunized mice, especially by those immunized with
multicomponent preparations, such as TgMIC1-4, TgMIC1-4-6 and Lac+. High levels of IL-10
8 / 18
Fig 3. Specific humoral responses elicited by immunization of mice with microneme proteins. The reactivity of immunoglobulins anti-STAg was
determined by ELISA in serum samples collected from both immunized (TgMICs) and control (PBS) mice 15 days after the last antigen injection. Each point/
bar represents the average absorbance ± SD of the serum samples from 4 animals. (A) Absorbance provided by the reaction of serum IgG with STAg. (B)
Absorbance provided by the reaction of serum IgG1 and IgG2a (diluted 1:25) with STAg. The average absorbance ± SD generated by the reaction of serum
IgG1 or IgG2a from each group of immunized mice was significantly higher than the corresponding values provided by control mice, with the exception of the
TgMIC6-immunized group, whose results were not significantly different of those of the control group. Three independent experiments were performed, and
9 / 18
data from one representative experiment is shown. Asterisks represent statistical significant differences (*p < 0.05) between IgG2b and IgG1 for each group
of mice (Bonferroni’s t test).
were also produced by STAg-stimulated spleen cells from all groups of immunized mice. There
was no difference in the IL-10 production pattern displayed by cells from mice that were
immunized with single- or multi-component preparations. IL-4 was not detected in any culture
supernatant (data not shown). It is noteworthy that in cells from non-immunized mice, STAg
stimulated only IL-12 production.
3.4 Protection conferred by immunization with microneme proteins
Since our results indicate that immunization with microneme proteins elicits Th1 response,
which is the type required for the development of resistance to toxoplasmosis (reviewed in ref.
[24]), we investigated if the vaccination procedure could confer protection to T. gondii infection. The serum cytokine levels on day 30 post the challenge with T. gondii cysts were determined (Table 1).
Serum concentrations of IL-12 and IFN-γwere significantly higher in animals from groups
immunized with TgMIC1-4-6 and Lac+ (Table 1). IL-4 concentrations were significantly lower
in the serum of all groups of immunized mice compared to that of the non-immunized mice,
Fig 4. Specific cell-mediated immune responses elicited by immunization with microneme proteins. Spleen cells were harvested from immunized
(indicated as TgMICs) and control mice (PBS) on day 15 post the last antigen injection and cultured in the presence of medium only, STAg (10 μg/ml), or
Concanavalin A (2 μg/ml) for 72 h. (A) Proliferation of spleen cells was measured by [3H]-thymidine incorporation assay. Each bar represents the average of
four mice per group and is representative of three independent experiments. Statistical significance is denoted as *p < 0.05 compared to the control group.
(B–D) Cytokine concentration was measured by ELISA in the supernatant of spleen cell cultures. Panels show the IL-12 (B), IFNγ(C), and IL-10 (D)
concentrations. Each bar represents the mean ± SD of triplicate samples and the results are representative of three independent experiments. Statistical
significance is denoted as *p < 0.05 compared to PBS-inoculated mice; # p < 0.05 compared to non-stimulated cells of the same group.
10 / 18
Table 1. Serum cytokine levels of mice immunized with microneme proteins and infected with T. gondii. Cytokine levels in the serum of mice immunized on days 0, 15, and 30 with the indicated preparations of
TgMICs or with vehicle (PBS), and after one month (day 60), challenged with T. gondii infection, provoked by
gavage with 40 cysts of the ME49 strain. Cytokine levels were determined by ELISA in samples collected one
month after challenge (on day 90).
Groups
Cytokine (ng/ml)
IL-12
IFN-γ
IL-4
IL-10
PBS
1.8±0.41
0.53±0.17
2.0±0.1
0.7±0.15
TgMIC1
5.4±1.1
1.6±0.57
1.2±0.14 *
1.0±0.54
TgMIC4
4.9±0.81
1.4±0.29
1.2±0.04 *
1.4±0.18
TgMIC6
2.1±0.58
1.2±0.39
1.7±0.08
1.7±0.81
TgMIC1-4
6.3±1.2
2.2±0.9
1.0±0.1 *
2.0±0.15
TgMIC1-4-6
7.7±0.93 *
3.1±0.72 *
0.4±0.01 *
2.3±0.16*
Lac+
7.1±0.45 *
2.7±0.46 *
0.4±0.02 *
1.8±0.4
The results are expressed as the mean of five mice per group and are representative of three independent
experiments. Statistical significance is denoted as * p < 0.05 compared to the PBS control group.
doi:10.1371/journal.pone.0143087.t001
except in case of mice immunized with TgMIC6, which displayed IL-4 levels that were similar
to the control group. Only mice immunized with TgMIC1-4-6 had IL-10 levels that were significantly higher than those in control mice.
3.5. Protection of immunized mice against T. gondii challenge
We evaluated, by enumeration of brain cysts, the effect of immunization in mice undergoing
chronic toxoplasmosis. One month post the challenge, the mice immunized with TgMIC1,
TgMIC4, TgMIC6, TgMIC1-4, TgMIC1-4-6, and Lac+, compared with non-immunized mice,
showed reductions in brain cysts by 52%, 46.9%, 27.2%, 59%, 67.8%, and 73.4%, respectively (Fig
5A). The survival period (in days) of the mice challenged with T. gondii cysts is shown in Fig 5B.
Non-immunized control mice started dying 6 days after T. gondii infection, and they were all
dead by day 11 post infection. Effective and highly significant protection was demonstrated in
mice immunized with TgMIC1-4-6 or TgMIC1-4, since 80% and 70% of the mice, respectively,
survived to the acute phase of infection, which is compatible with the high protection reported to
be conferred by immunization with the LAC+ fraction (21). Furthermore, immunization with
individual components, namely, TgMIC1, TgMIC4, or TgMIC6, was associated with a survival
rate of 40–50%, indicating that these vaccines confer partial protection against T. gondii infection. Since our results achieved significant protection in mice immunized with microneme proteins, as indicated above, we investigated whether this vaccine candidate could work also to
different T. gondii strains. Alignment analysis demonstrated similarity approximately of 99%
between TgMIC1 amino acid sequences from ME49 strain when compared to other strains (Fig
6A). Similar results were also verified to TgMIC4 (Fig 6B) and TgMIC6 (Fig 6C).
Together, our results show that the vaccine formulation constituted by the combination of
three recombinant proteins (TgMIC1-4-6) induced the best immune response and subsequent
protection against T. gondii infection.
Discussion
In the current study, we investigated the protection conferred by immunization of C57BL/6
mice with several preparations of recombinant microneme proteins against T. gondii infection.
The assayed preparations, with the exception of TgMIC6, conferred protection against
11 / 18
Fig 5. Number of brain cysts and survival of mice immunized with microneme proteins and infected with T. gondii. Mice immunized on days 0, 15,
and 30 with the indicated preparations of TgMICs or with the vehicle (PBS) were challenged after one month (day 60) with T. gondii infection, provoked by
gavage with cysts of the ME49 strain. (A) Cyst numbers were counted from whole brain homogenates of mice, harvested one month after challenge with 40
cysts. The results are expressed as means ± SD for each group. Significance is denoted as *p < 0.05, compared to the PBS group. (B) Survival curves of
mice that were challenged with 80 cysts of the ME49 strain and observed daily for mortality. Data are representative of six experiments with similar results.
infection. The most effective protection was conferred by the combination of TgMIC1,
TgMIC4, and TgMIC6 (TgMIC1-4-6), as demonstrated by an increased survival rate and
reduced tissue parasitism, which was associated with the occurrence of a Th1-specific immune
response, the essential event in the control of toxoplasmosis.
12 / 18
Fig 6. Cladogram analysis of TgMIC1, TgMIC4, and TgMIC6 of the T. gondii isolates. Dendrograms grouping microneme proteins of T. gondii isolates
showing similarity of approximately 99% according to their sequences. (A) TgMIC1. (B) TgMIC4. (C) TgMIC6. Amino acids sequences were obtained from
available sequence database at NCBI, and the alignment was performed using MEGA 6.06 software.
The process of host cell invasion by T. gondii is complex and consists of several sequential
steps initiated by the release of proteins from secretory organelles called micronemes (MICs)
and rhoptries (ROPs) [25–27]. When released onto the parasite's surface, MICs can interact
with host cell receptors, which lead to the activation of the gliding motility machinery, and
finally culminate in host cell invasion [28–30]. Importantly, some MICs share adhesive
domains, which are disposed in various combinations and numbers [16, 31–34]. Microneme
protein 1 (TgMIC1), 4 (TgMIC4), and 6 (TgMIC6) form a complex on the surface of T. gondii
and enable parasite binding to host cells [35]. TgMIC1 and TgMIC4 are both carbohydratebinding proteins that interact with glycans containing terminal sialic acid and galactose
13 / 18
residues, respectively, on host cells [18, 36–38]. Studies based on gene disruption have attributed a very important role for the TgMIC1-4-6 complex in host cell invasion in tissue culture
and have established the contribution of the complex on parasite virulence in vivo [21, 39].
Although well known in terms of its structural features and adhesive properties, the role of
TgMIC1-4-6 complex in host immunity is yet to studied in detail.
We have previously reported that mice immunized with the native subcomplex Lac+, comprising TgMIC1 and TgMIC4 proteins, elicit a strong specific immune response that confers
protection against T. gondii infection [21]. In fact, due to the key biological role of micromeme
proteins, some of them, including TgMIC11 [40], TgMIC13 [41], TgMIC8 [42], and TgMIC3
[43] have been proposed as vaccines for the prevention of toxoplasmosis. Thus, our goals in
this work were to investigate the capacity of TgMIC1, TgMIC4, and TgMIC6 recombinant proteins of inducing protective immunity in mice against T. gondii infection.
To be efficient against toxoplasmosis, a vaccine should induce both cellular and humoral
immune responses. Since a natural infection is often resolved by Th1-biased immunity [44,
45], a good vaccine must also direct T-helper cells toward the development of Th1 rather than
Th2. Moreover, a humoral response is necessary because specific antibodies limit the multiplication of T. gondii by killing extracellular tachyzoites, either by activating the complement system or by opsonizing the parasites for phagocytosis and macrophage killing [46–51].
To evaluate whether prominent Th1 immunity was induced by the administration of microneme proteins, we first analyzed the isotype of serum-specific antibodies. All assayed preparations elicited both IgG1- and IgG2b-specific antibodies. The highest IgG2b/IgG1 ratio was
detected in mice immunized with combinations of recombinant microneme proteins
(TgMIC1-4, TgMIC1-4-6) or with the native complex Lac+ (isolated from STAg and comprising TgMIC1 and 4), suggesting that prominent Th1 immunity was elicited in these cases. This
idea was strongly reinforced by the fact that the same groups of immunized mice had their
spleen cells stimulated by STAg to proliferate and release Th1 cytokines, but not IL-4. Notably,
high levels of IFN-γ were produced by mice immunized with TgMIC1-4-6. This is an important finding, considering that this cytokine plays an important role in host resistance to toxoplasmosis in its acute phase, by restricting growth of T. gondii, and later, by preventing the
reactivation of parasites from dormant cysts [52–56]. The importance of IFN-γ in resistance to
toxoplasmosis was unequivocally demonstrated by the extreme susceptibility of IFN-γ-deficient mice to T. gondii infection [55].
Pro-inflammatory responses, although essential for resistance to T. gondii infection, may
lead to tissue injury if uncontrolled. The anti-inflammatory cytokine IL-10 acts by diminishing
the detrimental effects of an excessive cellular immune response elicited during the acute phase
of the infection [56–59]. Previous studies clearly demonstrated that IL-10-deficient mice rapidly succumb to infection by T. gondii, because of extensive necrosis of the liver, lungs, and
intestines, which was attributed to an uncontrolled Th1 response [52, 60]. Therefore, we believe
that the IL-10 production by spleen cells from immunized mice in our model was crucial for
attenuating the Th1 immunity induced by T. gondii infection following vaccination.
We verified that vaccination with microneme proteins could positively influence the outcome of T. gondii infection, thus accomplishing the major purpose of the present work. The
most successful vaccination procedure was the administration of the TgMIC1-4-6 preparation,
since vaccinated mice had the highest survival rate (80%) and the lowest parasite burden in the
brain. In addition, they displayed the most prominent Th1 immunity, which was equilibrated
by IL-10 production. These results indicate that vaccination with the microneme complex
TgMIC1-4-6 prevented host death in the acute phase of infection, conferring a protection that
is reflected in the chronic phase of the disease. These results are particularly relevant if we consider that they were obtained in C57BL/6 mice, which are highly susceptible to T. gondii
14 / 18
infection and a high mortality rate occurs during the acute phase of the infection even when
animals are challenged with a low number of encysted bradyzoites [61].
In summary, the use of the multicomponent vaccine, comprising TgMIC1, TgMIC4, and
TgMIC6, offers a promising strategy for conferring protection against toxoplasmosis. Evaluation in other animal host species, including those in which a vaccine may have veterinary utility, should aid in defining the applicability of this vaccine to prevent toxoplasmosis.
Acknowledgments
We would like to thank Sandra O. Thomaz and Patricia Vendruscolo for technical support.
Author Contributions
Conceived and designed the experiments: MCRB CFP. Performed the experiments: CFP ASS
CDL FA LL. Analyzed the data: MCRB ASS CFP APC EVL FA LL. Contributed reagents/materials/analysis tools: MCRB SM. Wrote the paper: MCRB CFP.
References
1.
Cook GC. Toxoplasma gondii infection: a potential danger to the unborn fetus and AIDS sufferer. The
Quarterly journal of medicine. 1990; 74(273):3–19. PMID: 2183258
2.
Dodds EM. Toxoplasmosis. Current opinion in ophthalmology. 2006; 17(6):557–61. PMID: 17065925
3.
Luft BJ, Remington JS. AIDS commentary. Toxoplasmic encephalitis. The Journal of infectious diseases. 1988; 157(1):1–6. PMID: 3121758
4.
Luft BJ, Remington JS. Toxoplasmic encephalitis in AIDS. Clinical infectious diseases: an official publication of the Infectious Diseases Society of America. 1992; 15(2):211–22.
5.
de Medeiros BC, de Medeiros CR, Werner B, Loddo G, Pasquini R, Bleggi-Torres LF. Disseminated
toxoplasmosis after bone marrow transplantation: report of 9 cases. Transplant infectious disease: an
official journal of the Transplantation Society. 2001; 3(1):24–8.
6.
Escuissato DL, de Aguiar RO, Gasparetto EL, Muller NL. Disseminated toxoplasmosis after bone marrow transplantation: high-resolution CT appearance. Journal of thoracic imaging. 2004; 19(3):207–9.
PMID: 15273620
7.
Israelski DM, Remington JS. Toxoplasmosis in patients with cancer. Clinical infectious diseases: an
official publication of the Infectious Diseases Society of America. 1993; 17 Suppl 2:S423–35.
8.
Dubey JP, Hill DE, Jones JL, Hightower AW, Kirkland E, Roberts JM, et al. Prevalence of viable Toxoplasma gondii in beef, chicken, and pork from retail meat stores in the United States: risk assessment
to consumers. The Journal of parasitology. 2005; 91(5):1082–93. PMID: 16419752
9.
Zou FC, Sun XT, Xie YJ, Li B, Zhao GH, Duan G, et al. Seroprevalence of Toxoplasma gondii in pigs in
southwestern China. Parasitology international. 2009; 58(3):306–7. doi: 10.1016/j.parint.2009.06.002
PMID: 19523533
10.
Maser P, Wittlin S, Rottmann M, Wenzler T, Kaiser M, Brun R. Antiparasitic agents: new drugs on the
horizon. Current opinion in pharmacology. 2012; 12(5):562–6. doi: 10.1016/j.coph.2012.05.001 PMID:
22652215
11.
Soeiro MN, Werbovetz K, Boykin DW, Wilson WD, Wang MZ, Hemphill A. Novel amidines and analogues as promising agents against intracellular parasites: a systematic review. Parasitology. 2013;
140(8):929–51. doi: 10.1017/S0031182013000292 PMID: 23561006
12.
Buxton D. Protozoan infections (Toxoplasma gondii, Neospora caninum and Sarcocystis spp.) in
sheep and goats: recent advances. Veterinary research. 1998; 29(3–4):289–310. PMID: 9689743
13.
Buxton D. Toxoplasmosis: the first commercial vaccine. Parasitology today. 1993; 9(9):335–7. PMID:
15463799
14.
Verma R, Khanna P. Development of Toxoplasma gondii vaccine: A global challenge. Human vaccines
& immunotherapeutics. 2013; 9(2):291–3.
15.
Innes EA, Vermeulen AN. Vaccination as a control strategy against the coccidial parasites Eimeria,
Toxoplasma and Neospora. Parasitology. 2006; 133 Suppl:S145–68. PMID: 17274844
16.
Soldati D, Dubremetz JF, Lebrun M. Microneme proteins: structural and functional requirements to promote adhesion and invasion by the apicomplexan parasite Toxoplasma gondii. International journal for
parasitology. 2001; 31(12):1293–302. PMID: 11566297
15 / 18
17.
Tomley FM, Soldati DS. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Trends in parasitology. 2001; 17(2):81–8. PMID: 11228014
18.
Marchant J, Cowper B, Liu Y, Lai L, Pinzan C, Marq JB, et al. Galactose recognition by the apicomplexan parasite Toxoplasma gondii. The Journal of biological chemistry. 2012; 287(20):16720–33. doi:
10.1074/jbc.M111.325928 PMID: 22399295
19.
Soldati-Favre D. Molecular dissection of host cell invasion by the apicomplexans: the glideosome. Parasite. 2008; 15(3):197–205. PMID: 18814681
20.
Lourenco EV, Pereira SR, Faca VM, Coelho-Castelo AA, Mineo JR, Roque-Barreira MC, et al. Toxoplasma gondii micronemal protein MIC1 is a lactose-binding lectin. Glycobiology. 2001; 11(7):541–7.
PMID: 11447133
21.
Lourenco EV, Bernardes ES, Silva NM, Mineo JR, Panunto-Castelo A, Roque-Barreira MC. Immunization with MIC1 and MIC4 induces protective immunity against Toxoplasma gondii. Microbes and infection / Institut Pasteur. 2006; 8(5):1244–51. PMID: 16616574
22.
Wang BL, Xu Y, Wu CQ, Xu YM, Wang HH. Cloning, expression, and refolding of a secretory protein
ESAT-6 of Mycobacterium tuberculosis. Protein expression and purification. 2005; 39(2):184–8. PMID:
15642469
23.
Freyre A. Separation of toxoplasma cysts from brain tissue and liberation of viable bradyzoites. The
Journal of parasitology. 1995; 81(6):1008–10. PMID: 8544039
24.
Aliberti J. Host persistence: exploitation of anti-inflammatory pathways by Toxoplasma gondii. Nature
reviews Immunology. 2005; 5(2):162–70. PMID: 15662369
25.
Carruthers VB, Sibley LD. Sequential protein secretion from three distinct organelles of Toxoplasma
gondii accompanies invasion of human fibroblasts. European journal of cell biology. 1997; 73(2):114–
23. PMID: 9208224
26.
Alexander DL, Mital J, Ward GE, Bradley P, Boothroyd JC. Identification of the moving junction complex
of Toxoplasma gondii: a collaboration between distinct secretory organelles. PLoS pathogens. 2005; 1
(2):e17. PMID: 16244709
27.
Carruthers V, Boothroyd JC. Pulling together: an integrated model of Toxoplasma cell invasion. Current
opinion in microbiology. 2007; 10(1):83–9. PMID: 16837236
28.
Huynh MH, Harper JM, Carruthers VB. Preparing for an invasion: charting the pathway of adhesion proteins to Toxoplasma micronemes. Parasitology research. 2006; 98(5):389–95. PMID: 16385407
29.
Besteiro S, Dubremetz JF, Lebrun M. The moving junction of apicomplexan parasites: a key structure
for invasion. Cellular microbiology. 2011; 13(6):797–805. doi: 10.1111/j.1462-5822.2011.01597.x
PMID: 21535344
30.
Santos JM, Soldati-Favre D. Invasion factors are coupled to key signalling events leading to the establishment of infection in apicomplexan parasites. Cellular microbiology. 2011; 13(6):787–96. doi: 10.
1111/j.1462-5822.2011.01585.x PMID: 21338465
31.
Carruthers VB, Tomley FM. Microneme proteins in apicomplexans. Sub-cellular biochemistry. 2008;
47:33–45. PMID: 18512339
32.
Friedrich N, Santos JM, Liu Y, Palma AS, Leon E, Saouros S, et al. Members of a novel protein family
containing microneme adhesive repeat domains act as sialic acid-binding lectins during host cell invasion by apicomplexan parasites. The Journal of biological chemistry. 2010; 285(3):2064–76. doi: 10.
1074/jbc.M109.060988 PMID: 19901027
33.
Garcia-Reguet N, Lebrun M, Fourmaux MN, Mercereau-Puijalon O, Mann T, Beckers CJ, et al. The
microneme protein MIC3 of Toxoplasma gondii is a secretory adhesin that binds to both the surface of
the host cells and the surface of the parasite. Cellular microbiology. 2000; 2(4):353–64. PMID:
11207591
34.
Kessler H, Herm-Gotz A, Hegge S, Rauch M, Soldati-Favre D, Frischknecht F, et al. Microneme protein
8—a new essential invasion factor in Toxoplasma gondii. Journal of cell science. 2008; 121(Pt 7):947–
56. doi: 10.1242/jcs.022350 PMID: 18319299
35.
Reiss M, Viebig N, Brecht S, Fourmaux MN, Soete M, Di Cristina M, et al. Identification and characterization of an escorter for two secretory adhesins in Toxoplasma gondii. The Journal of cell biology.
2001; 152(3):563–78. PMID: 11157983
36.
Blumenschein TMA, Friedrich N, Childs RA, Saouros S, Carpenter EP, Campanero-Rhodes MA, et al.
Atomic resolution insight into host cell recognition by Toxoplasma gondii. Embo J. 2007; 26(11):2808–
20. PMID: 17491595
37.
Garnett JA, Liu Y, Leon E, Allman SA, Friedrich N, Saouros S, et al. Detailed insights from microarray
and crystallographic studies into carbohydrate recognition by microneme protein 1 (MIC1) of Toxoplasma gondii. Protein Sci. 2009; 18(9):1935–47. doi: 10.1002/pro.204 PMID: 19593815
16 / 18
38.
Saouros S, Edwards-Jones B, Reiss M, Sawmynaden K, Cota E, Simpson P, et al. A novel galectin-like
domain from Toxoplasma gondii micronemal protein 1 assists the folding, assembly, and transport of a
cell adhesion complex. The Journal of biological chemistry. 2005; 280(46):38583–91. PMID: 16166092
39.
Cerede O, Dubremetz JF, Soete M, Deslee D, Vial H, Bout D, et al. Synergistic role of micronemal proteins in Toxoplasma gondii virulence. The Journal of experimental medicine. 2005; 201(3):453–63.
PMID: 15684324
40.
Tao Q, Fang R, Zhang W, Wang Y, Cheng J, Li Y, et al. Protective immunity induced by a DNA vaccineencoding Toxoplasma gondii microneme protein 11 against acute toxoplasmosis in BALB/c mice. Parasitology research. 2013; 112(8):2871–7. doi: 10.1007/s00436-013-3458-4 PMID: 23749087
41.
Yuan ZG, Ren D, Zhou DH, Zhang XX, Petersen E, Li XZ, et al. Evaluation of protective effect of pVAXTgMIC13 plasmid against acute and chronic Toxoplasma gondii infection in a murine model. Vaccine.
2013; 31(31):3135–9. doi: 10.1016/j.vaccine.2013.05.040 PMID: 23707448
42.
Liu MM, Yuan ZG, Peng GH, Zhou DH, He XH, Yan C, et al. Toxoplasma gondii microneme protein 8
(MIC8) is a potential vaccine candidate against toxoplasmosis. Parasitology research. 2010; 106
(5):1079–84. doi: 10.1007/s00436-010-1742-0 PMID: 20177910
43.
Fang R, Nie H, Wang Z, Tu P, Zhou D, Wang L, et al. Protective immune response in BALB/c mice
induced by a suicidal DNA vaccine of the MIC3 gene of Toxoplasma gondii. Veterinary parasitology.
2009; 164(2–4):134–40. doi: 10.1016/j.vetpar.2009.06.012 PMID: 19592172
44.
Denkers EY, Gazzinelli RT. Regulation and function of T-cell-mediated immunity during Toxoplasma
gondii infection. Clinical microbiology reviews. 1998; 11(4):569–88. PMID: 9767056
45.
Dupont CD, Christian DA, Hunter CA. Immune response and immunopathology during toxoplasmosis.
Semin Immunopathol. 2012; 34(6):793–813. doi: 10.1007/s00281-012-0339-3 PMID: 22955326
46.
Johnson LL, Sayles PC. Deficient humoral responses underlie susceptibility to Toxoplasma gondii in
CD4-deficient mice. Infection and immunity. 2002; 70(1):185–91. PMID: 11748181
47.
Kang H, Remington JS, Suzuki Y. Decreased resistance of B cell-deficient mice to infection with Toxoplasma gondii despite unimpaired expression of IFN-gamma, TNF-alpha, and inducible nitric oxide
synthase. Journal of immunology. 2000; 164(5):2629–34.
48.
Konishi E, Nakao M. Naturally occurring immunoglobulin M antibodies: enhancement of phagocytic
and microbicidal activities of human neutrophils against Toxoplasma gondii. Parasitology. 1992; 104
(Pt 3):427–32. PMID: 1641242
49.
Fuhrman SA, Joiner KA. Toxoplasma gondii: mechanism of resistance to complement-mediated killing.
Journal of immunology. 1989; 142(3):940–7.
50.
Schreiber RD, Feldman HA. Identification of the activator system for antibody to Toxoplasma as the
classical complement pathway. The Journal of infectious diseases. 1980; 141(3):366–9. PMID:
7365285
51.
Vercammen M, Scorza T, El Bouhdidi A, Van Beeck K, Carlier Y, Dubremetz JF, et al. Opsonization of
Toxoplasma gondii tachyzoites with nonspecific immunoglobulins promotes their phagocytosis by macrophages and inhibits their proliferation in nonphagocytic cells in tissue culture. Parasite Immunol.
1999; 21(11):555–63. PMID: 10583856
52.
Gazzinelli RT, Wysocka M, Hieny S, Scharton-Kersten T, Cheever A, Kuhn R, et al. In the absence of
endogenous IL-10, mice acutely infected with Toxoplasma gondii succumb to a lethal immune
response dependent on CD4+ T cells and accompanied by overproduction of IL-12, IFN-gamma and
TNF-alpha. Journal of immunology. 1996; 157(2):798–805.
53.
Sher A, Denkers EY, Gazzinelli RT. Induction and regulation of host cell-mediated immunity by Toxoplasma gondii. Ciba Foundation symposium. 1995; 195:95–104; discussion -9. PMID: 8724832
54.
Suzuki Y, Orellana MA, Schreiber RD, Remington JS. Interferon-gamma: the major mediator of resistance against Toxoplasma gondii. Science. 1988; 240(4851):516–8. PMID: 3128869
55.
Scharton-Kersten TM, Wynn TA, Denkers EY, Bala S, Grunvald E, Hieny S, et al. In the absence of
endogenous IFN-gamma, mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing
to control acute infection. Journal of immunology. 1996; 157(9):4045–54.
56.
Khan IA, Matsuura T, Kasper LH. IL-10 mediates immunosuppression following primary infection with
Toxoplasma gondii in mice. Parasite Immunol. 1995; 17(4):185–95. PMID: 7624159
57.
Neyer LE, Grunig G, Fort M, Remington JS, Rennick D, Hunter CA. Role of interleukin-10 in regulation
of T-cell-dependent and T-cell-independent mechanisms of resistance to Toxoplasma gondii. Infection
and immunity. 1997; 65(5):1675–82. PMID: 9125546
58.
Mosmann TR, Moore KW. The role of IL-10 in crossregulation of TH1 and TH2 responses. Immunology
today. 1991; 12(3):A49–53. PMID: 1648926
59.
Fiorentino DF, Zlotnik A, Mosmann TR, Howard M, O'Garra A. IL-10 inhibits cytokine production by activated macrophages. Journal of immunology. 1991; 147(11):3815–22.
17 / 18
60.
Suzuki Y, Sher A, Yap G, Park D, Neyer LE, Liesenfeld O, et al. IL-10 is required for prevention of
necrosis in the small intestine and mortality in both genetically resistant BALB/c and susceptible
C57BL/6 mice following peroral infection with Toxoplasma gondii. Journal of immunology. 2000; 164
(10):5375–82.
61.
McLeod R, Eisenhauer P, Mack D, Brown C, Filice G, Spitalny G. Immune responses associated with
early survival after peroral infection with Toxoplasma gondii. Journal of immunology. 1989; 142
(9):3247–55.
18 / 18
Anexo III | 129
Anexo III
RESEARCH ARTICLE
Toxoplasma gondii Chitinase Induces
Macrophage Activation
Fausto Almeida1, Aline Sardinha-Silva1, Thiago Aparecido da Silva1, André
Moreira Pessoni1, Camila Figueiredo Pinzan1, Ana Claudia Paiva Alegre-Maller1, Nerry
Tatiana Cecílio1, Nilmar Silvio Moretti2, André Ricardo Lima Damásio3, Wellington
Ramos Pedersoli4, José Roberto Mineo5, Roberto Nascimento Silva4, Maria
Cristina Roque-Barreira1*
1 Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de
Ribeirão Preto, Universidade de São Paulo, Av. Bandeirantes 3900, Ribeirão Preto, SP, 14049–900, Brasil,
2 Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de Sao Paulo, São
Paulo, SP, Brasil, 3 Departamento de Bioquímica e Biologia Tecidual, Instituto de Biologia, Universidade de
Campinas, Campinas, SP, Brasil, 4 Departamento de Bioquímica e Imunologia, Faculdade de Medicina de
Ribeirão Preto, Universidade de São Paulo, Av. Bandeirantes 3900, Ribeirão Preto, SP, 14040–900, Brasil,
5 Laboratorio de Imunoparasitologia, Departamento de Imunologia, Microbiologia e Parasitologia,
Universidade Federal de Uberlândia, Av. Pará, 1720, Uberlândia, MG, 38400 902, Brasil
* [email protected]
OPEN ACCESS
Citation: Almeida F, Sardinha-Silva A, da Silva TA,
Pessoni AM, Pinzan CF, Alegre-Maller ACP, et al.
(2015) Toxoplasma gondii Chitinase Induces
Macrophage Activation. PLoS ONE 10(12):
e0144507. doi:10.1371/journal.pone.0144507
Editor: Vijai Gupta, National University of Ireland—
Galway, IRELAND
Received: October 29, 2015
Accepted: November 19, 2015
Published: December 10, 2015
Copyright: © 2015 Almeida et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.
Abstract
Toxoplasma gondii is an obligate intracellular protozoan parasite found worldwide that is
able to chronically infect almost all vertebrate species, especially birds and mammalians.
Chitinases are essential to various biological processes, and some pathogens rely on chitinases for successful parasitization. Here, we purified and characterized a chitinase from T.
gondii. The enzyme, provisionally named Tg_chitinase, has a molecular mass of 13.7 kDa
and exhibits a Km of 0.34 mM and a Vmax of 2.64. The optimal environmental conditions for
enzymatic function were at pH 4.0 and 50°C. Tg_chitinase was immunolocalized in the cytoplasm of highly virulent T. gondii RH strain tachyzoites, mainly at the apical extremity.
Tg_chitinase induced macrophage activation as manifested by the production of high levels
of pro-inflammatory cytokines, a pathogenic hallmark of T. gondii infection. In conclusion, to
our knowledge, we describe for the first time a chitinase of T. gondii tachyzoites and provide
evidence that this enzyme might influence the pathogenesis of T. gondii infection.
Data Availability Statement: All relevant data are
within the paper.
Funding: This study was supported by the Fundação
de Amparo à Pesquisa do Estado de São Paulo
(Grant number 2013/10741-8). Additional financial
help was provided by Conselho Nacional de
Desenvolvimento Científico e Tecnológico, and
Fundação de Apoio ao Ensino, Pesquisa e
Assistência do Hospital das Clínicas da Faculdade de
Medicina de Ribeirão Preto.
Competing Interests: The authors have declared
that no competing interests exist.
Introduction
Toxoplasmosis is a worldwide infectious disease caused by Toxoplasma gondii, an obligate
intracellular apicomplexan parasite [1–3]. This disease constitutes an economic and public
health problem in different countries. Toxoplasma gondii infects nearly one-third of the world’s
population, but its prevalence varies from 10 to 80% depending on the economic, cultural, and
health status of the region. In endemic countries, such as Brazil and France, 50–80% of the
population is infected by the parasite [4]. Infection of most healthy individuals is asymptomatic, but immunocompromised individuals, especially those with acquired immunodeficiency
PLOS ONE | DOI:10.1371/journal.pone.0144507 December 10, 2015
1 / 12
Chitinase from Toxoplasma gondii
syndrome (AIDS), can develop toxoplasmosis. Infection of developing fetuses can also occur
and is life threatening [5–9].
Chitin is a homopolymeric form of β(1–4)-linked N-acetyl-D-glucosamine (GlcNAc) residues, which constitutes most of the exoskeleton of nematodes, arthropods, mollusks, and the
cell wall of fungi (reviewed by [10]). Chitin is hydrolyzed by chitinases, which exert important
functions in many organisms [11]. A number of protozoan parasites use chitin and chitinases
in their life cycles. Trypanosoma cruzi, Leishmania donovani, and Plasmodium spp. do not produce chitin, but secrete chitinases that act during their life cycle in the invertebrate host. Notably, Plasmodium ookinetes initiate the invasion of the mosquito midgut by secreting a
chitinase necessary to cross the chitin-containing peritrophic matrix en route to the epithelial
cell surface [12–14]. This chitinase is crucial to the Plasmodium life cycle; silencing of this chitinase gene resulted in parasites that were impaired in their ability to form oocysts in the midgut
of Anopheles mosquitoes. For this reason, this chitinase in P. falciparum became an immunological target for blocking malaria parasite transmission in humans. There is evidence that each
protozoan parasite has evolved to use chitin and chitinases differently and in a stage-specific
manner.
In T. gondii, chitin was first discovered during the tachyzoite to bradyzoite life-stage transition. During cyst formation, chitin became detectable in the cyst wall, as indicated by wheat
germ agglutinin (WGA) binding [15], also reported for Entamoeba [16] and Giardia [17]. The
composition of the WGA-binding material was confirmed by treating cysts with an exogenous
chitinase, rendering the cysts unable to bind WGA, resulting in disruption of the cyst wall and
bradyzoite release [15]. The detection of chitin also demonstrated that the parasitophorous
vacuole is modified into the cyst wall, an event that occurs early in T. gondii differentiation
[18]. More recently, Nance and collaborators [19] reported the chitinase-dependent control of
T. gondii cysts in the mouse brain. The implicated enzyme is produced by a macrophage population in the brain and is activated in response to chitin within the cyst wall [19, 20]. This active
mammalian chitinase (AMCase) accounts for the efficient degradation and destruction of chitin in the cyst wall, culminating in protozoan cyst clearance from the brain and increased host
survival [19]. AMCase-deficient mice displayed impeded parasite eradication and lower survival rates when infected with T. gondii [19].
No chitinases are currently known to occur in T. gondii. Herein, we describe the purification
and characterization of an active chitinase, N-acetyl-β-D-glucosaminidase (NAGase), from a
virulent strain of T. gondii tachyzoites. We show that this enzyme induces macrophage activation, as manifested by pro-inflammatory cytokine production such as IL-12, TNF-α, and IL-6.
Since these cytokines are associated with a protective immune response to T. gondii, we postulate that T. gondii chitinase might influence the pathogenesis of toxoplasmosis.
Results
Chitinase activity of T. gondii tachyzoites
We previously identified chitinase activity in Paracoccidioides brasiliensis extracts [21] and
developed tools, such as specific antibodies, to characterize this enzyme (Pb_chitinase). These
antibodies were also used to isolate chitinases from other pathogenic organisms [22]. Toxoplasma gondii tachyzoites (RH strain type I) were immobilized by anti-Pb_chitinase IgY on
agarose beads and adsorbed a single protein from the total extract of the parasite. The molecular mass of the isolated component was 13.7 kDa, as determined by SDS-PAGE analysis (Fig
1A). The preparation displayed considerable NAGase activity, as verified by the release of pnitrophenol from the substrate p-nitrophenol-β-N-acetyl glucosamine (pNPGlcNAc; Fig 1B).
2 / 12
Fig 1. Chitinase activity from T. gondii. Soluble T. gondii antigens were purified by affinity with an
IgY-Sepharose 4B column, and the chitinase activity of the delayed fractions was measured. (A)
Electrophoresis analysis of purified chitinase from T. gondii. First lane—MW (Molecular Weight Ladder),
second lane—purified chitinase in 12% SDS-PAGE. (B) Crude extract and purified chitinase activity from T.
gondii was measured. Error bars represent standard errors calculated from three replicates.
We assumed that the putative 13 kDa protein was responsible for NAGase activity, and we provisionally named the preparation Tg_chitinase.
To analyze the effects of pH and temperature on enzymatic activity, we evaluated Tg_chitinase over a 25–65°C temperature range (in 0.1 M phosphate citrate buffer at pH 4.0), and a
2.5–7.5 pH range. The optimal temperature and pH of the Tg_chitinase was estimated at 50°C
and 4.0, respectively (Fig 2A and 2B). In addition, Tg_chitinase had a Km of 0.34 mM and a
Vmax of 2.64 U/mg protein (Table 1).
Amino acid sequence and predicted 3D structure
The 13.7 kDa band, corresponding to the putative Tg_chitinase, was excised from the
SDS-PAGE gel and subjected to in situ trypsin digestion followed by mass spectrometry. The
minimum criterion for peptide matching was performed using Peptide Prophet [23] at a score
greater than 0.8. Peptides that matched this criterion were further grouped by protein sequence
using the Protein Prophet [24] algorithm and only proteins with an error rate of 5% or less
were considered. Two peptide sequences were identified, one for a hypothetical protein
(TGME49_286465; 13.6 kDa) and one for a peroxiredoxin PX3 (TGME49_230410; 30 kDa)
Fig 2. Effect of pH and temperature on T. gondii chitinase activity. Optimal (A) pH and (B) temperature
profiles for Tg_chitinase from T. gondii. Maximum activity was standardized as 100% and enzymatic activities
were measured at 405 nm. Data are representative of three independent assays.
3 / 12
Table 1. General catalytic properties of Tg_chitinase and other microbial chitinases.
Strain
Molecular mass (kDa)
pH
Temperature (°C)
Km (mM)
Vmax (U/mg)
Ref.
Toxoplasma gondii
14
4.0
50
0.34
2.64
This study
Paracoccidioides brasiliensis
70
5.0
37
0.28
3.25
[21]
Trypanosoma cruzi
48
5.5
-
1.5
-
[30]
Pseudomonas fluorescens
50
8.0
37
0.13
-
[45]
Clostridium paraputrificum
45.5
7.0
50
7.9
21.8
[46]
Trichoderma harzianum
36
4.0
50–60
8.06
3.36
[47]
Streptomyces cerradoensis
58.9
5.5
50
0.13
1.95
[48]
(Table 2). The TGE49_286465 sequence was used to predict its 3D structure using I-TASSER
[25] (Fig 3).
The predicted protein did not show domains or binding sites following a BLAST search
against the Pfam protein domain database [26]. Analysis using Phyre2 [27] showed 90% model
confidence composed of 50% alpha helices and 13% beta strands. The model template was
selected for alignment with other protein databases by using a heuristic method to maximize
confidence. About 103 residues were modeled and showed low confidence (12%) to a transcriptional factor with an AT-rich interactive domain-containing protein 4a (40% similarity)
and to a NagB/RpiA/CoA transferase-like protein (47% similarity). Notably, an analysis using
the InterPro database revealed homology with a putative sugar-binding domain (IPR007324)
of Bacillus subtilis [28], a result typical for chitinases. However, more structural studies are necessary to elucidate the real identity of this protein.
T. gondii chitinase is located in the cytoplasm of the apical region of
tachyzoites
We determined the subcellular localization of Tg_chitinase by reacting tachyzoites (T. gondii
RH strain) with IgY specific to the NAGase of P. brasiliensis. We determined that Tg_chitinase
has a punctate distribution in the tachyzoite cytoplasm, being clearly prominent at the parasite
apical extremity (Fig 4). This localization pattern suggests that Tg_chitinase may be actively
involved in the invasion process of the parasite.
T. gondii chitinase induces macrophage activation
Considering that several chitinases and chitinase-like proteins play important roles in mediating and directing immune responses (reviewed by [10]), we investigated the effect exerted by
Tg_chitinase on cytokine production by peritoneal macrophages. Cells were obtained from
BALB/c and C57BL/6 mice, which are susceptible and resistant to T. gondii infection, respectively. A dose-response curve showed that chitinase concentrations of 1, 2.5, 5, and 10 μg/mL
were effective in stimulating cytokine production. Following treatment with 2.5 μg/mL of Tg_
chitinase, murine macrophages were elicited from both BALB/c and C57BL/6 mice, increasing
the production of IL-12, IL-6, and TNF-α, and reaching levels as high as the positive controls
Table 2. LC-MS/MS mass spectrometry analysis of peptides generated by trypsin digestion of Tg_chitinase from T. gondii.
Ion Percent
Mr (calculated)
Delta
Peptide sequence
39%
1153.5480
-0.2780
SEIYQGDSVR
57%
966.5250
+0.4660
VTLSEVYR
4 / 12
Fig 3. Amino acid sequence and predicted 3D structure of Tg_chitinase from T. gondii. Tg_chitinase
from T. gondii was identified by mass spectrometry using the amino acid sequences of tryptic peptides listed
in Table 2 (indicated in bold). (A) The amino acid sequence obtained from analysis of the peptide
(SEIYQGDSVR) identified by BLASTP T. gondii GT1 (TGGT1_286465). (B) Predicted 3D structure of
Tg_chitinase using I-TASSER.
(i.e., Pam3CSK4 and LPS) (Fig 5A–5C). In contrast, Tg_chitinase did not induce peritoneal
macrophages to produce the anti-inflammatory cytokine IL-10 (Fig 5D), as was observed in
the positive controls.
Discussion
We have demonstrated for the first time the isolation and partial characterization of a chitinase
from T. gondii. The purified enzyme can be assigned to the class of β-acetyl-glucosaminidases
based on its ability to cleave pNPGlcNAc. The adopted purification procedure, based on an
affinity towards specific antibodies for paracoccin, a chitinase from P. brasiliensis, yielded a single 13.7 kDa protein, as verified by SDS-PAGE analysis. This protein is apparently responsible
for NAGase activity and received the provisional name Tg_chitinase. The Michaelis constant
Fig 4. Tg_chitinase subcellular localization. (A) T. gondii tachyzoite DNA was stained with DAPI (blue), and (B) immunostained for Tg_chitinase with an
anti-chitinase antibody, which was biotinylated with an antibody conjugated to anti-streptavidin-FITC (green). Superimposition of images stained for
Tg_chitinase and DAPI (Merge and phase microscopy, C and D, respectively). Tg_chitinase is localized throughout the cytosol of T. gondii tachyzoites.
Scale bar = 2.5 μm.
5 / 12
Fig 5. Tg_chitinase induces pro-inflammatory cytokines by peritoneal macrophages. Adherent cells from BALB/c mice peritoneal cavities were
stimulated in vitro for 48 h with purified chitinase from T. gondii. Pam3CSK4 (1 μg/mL), LPS+IFN-γ (1 μg/mL and 1.5 ng/mL) were used as a positive controls.
The culture supernatants were assayed for (A) IL-12, (B) IL-6, (C) TNF-α, and (D) IL-10 levels. Data is from a minimum of 3 independent experiments
(mean ± SD). *p < 0.05 between Tg_chitinase and medium.
(Km; 0.34 mM) indicated that this chitinase has higher affinity for the substrate than chitinases
previously identified in T. cruzi (1.5 mM), Clostridium paraputrificum (7.9 mM), and Trichoderma harzianum (8.06 mM) (Table 1). Although few other chitinases from microorganisms
have been described (Table 1), some of their characteristics were elucidated herein: (a) the optimal pH for chitinase activity is usually in the range of 4.0–7.0; (b) the optimal temperature is
usually 50°C; and (c) their molecular mass is commonly between 15 and 50 kDa.
Our research on a chitinase from Paracoccidioides brasiliensis (i.e., paracoccin) identified an
enzymatic domain and a carbohydrate-recognition domain (CRD) specific to GlcNAc [21, 22].
Our limited MS analyses of Tg_chitinase allowed for its identification as a protein derived
from T. gondii, and also revealed a region with possible homology with a putative CRD from B.
subtilis [28]. This suggests that Tg_chitinase and paracoccin have similar features. Nonetheless,
additional studies are required to elucidate the domains of Tg_chitinase. Indeed, NAGase
activity was previously detected in T. gondii-infected mammalian cells; the magnitude of enzymatic activity varied with infection duration [29]. Nevertheless, the study did not identify the
enzyme implicated, or its origin, whether derived from the parasite or host cell. NAGase activity has also been detected in T. cruzi epimastigotes [30], but its biological role is unknown. Otherwise, chitinases from Leishmania spp. [12] and Plasmodium spp. [13] were reported to play
important roles in disrupting chitinous structures of the digestive system of its invertebrate
host, making transmission to the mammalian host possible.
It is plausible that Tg_chitinase has an integral role in T. gondii infection based on its similarity to a mammalian chitinase that controls the protozoan cyst burden in the brain. Despite
the absence of GlcNAc polymers in vertebrates, chitinases and chitinase-like proteins (C/
CLPs), which are hydrolytically inactive, are well conserved in vertebrate species. Several studies have shown that these proteins are involved in mediating the degradation of the chitinous
exterior of pathogens, similar to what occurs in T. gondii cysts or in immune response regulation (Reviewed by [10]). Chitinases and CLPs are consistently reported as stimulating alternative macrophage activation, augmenting adaptative Th2 immunity, and mediating the effector
functions of IL-13 [31]. Several authors consider that C/CLPs play a pivotal role in both innate
and adaptive type 2 immunity. Intriguingly, the two chitinases derived from pathogens that
6 / 12
had their immunomodulation properties investigated (i.e. paracoccin and Tg_chitinase),
induced the production of Th1 cytokines by macrophages. We showed herein that Tg_chitinase activates macrophages from both C57BL/6 and BALB/c mice, augmenting levels of IL-12,
IL-6, and TNF-α, but not IL-10. Paracoccin induced high production of Th1 cytokines and was
able to confer protection against fungal infection in mice. A second Tg_chitinase sequence
identified by MS was homologous with a peroxiredoxin PX3. This enzyme is known to induce
an alternative pattern of macrophage activation associated with IL-10 production [32], therefore, we do not consider it as a component of T. gondii tachyzoites.
The results of the present study suggest that Tg_chitinase induces the production of Th1
cytokines, especially IL-12, which favors the hypothesis that this enzyme might influence acute
phase pathogenesis of T. gondii infection. It is well established that cytokines are crucial in the
development of toxoplasmosis. The production of pro-inflammatory cytokines, such as IL-12,
are essential to develop a T helper 1 response, characterized by the presence of large amounts
of interferon gamma (IFN-γ), which protects against infection [33]. Interferon gamma release
triggers nitric oxide production by macrophages, promoting the intracellular destruction of
protozoans, [34] and the differentiation of tachyzoites into bradyzoites, which replicate more
slowly and form cysts in brain and muscle tissues [35]. Considering that enzymes are crucial
for pathogenesis [36], and the fact that Tg_chitinase stimulates macrophages to release proinflammatory cytokines, especially IL-12, allows us to postulate that it might play an important
role in the pathogenesis of toxoplasmosis, thereby contributing to the increase in slowly dividing bradyzoites that reside in tissue cysts.
Materials and Methods
Ethics Statement
This study was approved by the Ethics Committee and the Institutional Review Board of the
University of São Paulo [approval number 065/2012].
Toxoplasma gondii culture
We used the highly virulent RH strain of T. gondii in all experiments. The parasite was maintained by intraperitoneal passage in female Swiss mice (Mus musculus), aged 6–7 weeks, which
were purchased from the animal house of the Campus of Ribeirao Preto, University of Sao
Paulo. All mice were maintained in small groups inside isolator cages with light/dark cycle of
12 hours, besides food and water ad libitum were provided, in the animal housing facility of
School of Medicine of Ribeirao Preto—Univesity of Sao Paulo. The mice were humanely euthanized by CO2 chamber and all efforts were made to minimize animal suffering. The parasites
were collected 48–72 h after infection as previously described [37, 38]. Parasites obtained from
peritoneal exudates were washed with phosphate-buffered saline [PBS; 10 mM sodium phosphate containing 0.15 M sodium chloride (both w/v) at pH 7.2] and centrifuged at 1000 ×g for
10 min. The pellet was then lyophilized and stored at -20°C until use.
Soluble Toxoplasma gondii antigen (STAg)
The lyophilized pellet was re-suspended in PBS containing 0.8 mM phenylmethylsulfonyl
fluoride (Sigma Chemical Co., St. Louis, MO, USA) and sonicated (Fisher Scientific, Pittsburgh,
PA, USA) as described in [39], with three pulses at 10 kHz and 50 W for 50 s each. Soluble
proteins were recovered by centrifugation at 3000 ×g for 30 min at 4°C and constituted the
crude extract. The protein concentration was quantified by the colorimetric method of the
7 / 12
bicinchoninic acid assay (BCA; Pierce Chemical Co., Rockford, IL, USA) using bovine serum
albumin as the standard.
Purification of N-acetyl-β-D-glucosaminidase (NAGase) from
Toxoplasma gondii
NAGase was purified by immunoaffinity chromatography on an IgY-Sepharose 4B column
equilibrated and incubated with slow rotation overnight at 4°C. The purified product was
washed with PBS until the flow through had an OD280 less than 0.002. The bound protein was
eluted with 0.1 M glycine at pH 2.5 and subsequently neutralized with 1 M tris-HCl at pH 8.5–
9.0. The material was dialyzed against PBS using an Amicon1 Pro Purification System (W. R.
Grace & Co., Beverly, MA, USA) with a YM-10 membrane (Millipore Co., Billerica, MA,
USA). The protein concentration was quantified as described above.
Enzyme assay and characterization
NAGase activity was measured colorimetrically using the substrate pNPGlcNAc (Sigma) as
previously described [40] with slight modifications [21, 22]. The total reaction volume (0.5
mL) contained 0.1 mL of 5 mM pNPGlcNAc (w/v), 0.35 mL of 0.1 M sodium acetate buffer (w/
v), and 0.05 mL (50 μg) of crude extract. After incubation at 37°C, 1 mL of 0.5 M sodium carbonate (w/v) was added to the mixture to stop the reaction. The amount of liberated p-nitrophenol was measured spectrophotometrically at 405 nm. One unit of enzyme activity was
defined as the amount of protein required to produce 1 μM p-nitrophenol per min at 37°C.
The reported enzyme activity values correspond to the mean values of at least three replicates.
In order to determine the Km value, we used a non-linear regression analysis of the data
obtained by measuring the rate of pNPGlcNAc hydrolysis (from 0.01 to 0.1 mM; w/v), using
GraphPad Prism v. 6.00 (GraphPad Software, San Diego, CA, USA). To determine the optimal
pH and temperature for enzyme activity, enzymatic reactions were conducted using 0.1 M
phosphate citrate buffer (pH 2.5–5.0; w/v) or 0.1 M sodium acetate buffer (pH 5.5–7.5; w/v) at
a range of temperatures (25–65°C).
SDS-PAGE analysis and protein identification by mass spectrometry
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (12% SDS-PAGE) was conducted
according to [41]. Pre-stained standards (PageRuler; Fermentas, Ontario, Canada) were used
to estimate the molecular weights of the sample proteins. The samples were stained with 0.25%
Coomassie Brilliant Blue R-250 (w/v) and destained with a mixture of methanol/acetic acid/
water (v/v/v; 4:1:5). After SDS-PAGE, the purified NAGase band was manually excised from
the gel, prepared, and analyzed by LC-MS/MS mass spectrometry (XEVO-TQS mass spectrometer; Waters, San Diego, CA, USA) coupled with a UPLC chromatography system
(Waters, San Diego, CA, USA) according to [42]. Raw data were converted to mzXML and
automatically processed using Labkey Server v. 12, using theX!Tandem search algorithm [43].
Immunofluorescence
For subcellular NAGase localization, we used tachyzoites of T. gondii RH strain, which were
freshly isolated from infected mice using peritoneal washes. Parasites were fixed in 4% paraformaldehyde (w/v) at room temperature for 20 min, and then allowed to adhere to Biobondtreated coverslips for 15 min. Permeabilization was conducted with 0.3% Triton X-100 (w/v)
for 20 min followed by a 30 min blocking period with 0.3% bovine serum albumin (BSA)
diluted in PBS. A 1:100 dilution of anti-NAGase IgY-biotinylated antibodies was incubated
8 / 12
with parasites at room temperature for 1 h. After five washes with PBS, the parasites were incubated with anti-streptavidin-FITC antibody for 30 min. All samples were then rinsed in PBS
and coverslips were mounted with ProLong™ antifade reagent (Life Technologies, Carlsbad,
CA, USA) and examined with a Leica TCS SP5 scanning confocal microscope (Carl Zeiss, Jena,
Germany).
Cytokine production analysis
Thioglycolate-elicited macrophages were stimulated with NAGase (0.5, 1, 2.5, 5 and 10 μg/mL)
for 48 h in the cytokine production assay. Pam3CSK4 (1 μg/mL), LPS (1 μg/mL), and IFN-γ
(1.5 ng/mL) (Invitrogen, San Diego, CA, USA) were used as positive controls. IL-6, IL-12p40,
TNF-α, and IL-10 levels in the supernatant of peritoneal macrophage cultures from BALB/c
and C57BL6 mice were measured by the capture enzyme-linked immunosorbent assay
(ELISA) with antibody pairs purchased from BD Biosciences (Pharmingen, San Diego, CA,
USA). The ELISA procedure was performed according to the manufacturer’s protocol. The
quantity of cytokines was determined from a standard curve, using murine recombinants IL12p40, IL-6, TNF-α, and IL-10.
Prediction of three-dimensional (3D) structures and statistical analysis
Three-dimensional structures were predicted using I-TASSER [25], as previously described
[44]. Data were analyzed using GraphPad Prism v. 6.00 (GraphPad Software, San Diego, CA,
USA) and tested by one-way ANOVA followed by Bonferroni multiple comparisons. The data
analyzed were the means from at least three independent experiments performed in triplicate.
P values less than 0.05 were considered statistically significant.
Acknowledgments
This study was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo
(Grant number 2013/10741-8). Additional financial help was provided by Conselho Nacional
de Desenvolvimento Científico e Tecnológico, and Fundação de Apoio ao Ensino, Pesquisa e
Assistência do Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto. We are grateful to Dr Maria Aparecida Souza for fruitful discussions of our results. We also thank Patricia
Vendruscolo and Sandra Thomaz for technical support.
Author Contributions
Conceived and designed the experiments: FA ASS TAS AMP CFP ACPAM NTC NSM ARLD
WRP RNS MCRB. Performed the experiments: FA ASS TAS AMP CFP ACPAM NTC NSM
ARLD WRP. Analyzed the data: FA ASS TAS RNS MCRB. Contributed reagents/materials/
analysis tools: FA NSM ARLD JRM RNS MCRB. Wrote the paper: FA ASS TAS NSM ARLD
RNS MCRB.
References
1.
Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: from animals to humans. International journal for parasitology. 2000; 30(12–13):1217–58. PMID: 11113252; PubMed Central PMCID:
PMC3109627.
2.
Montoya JG, Rosso F. Diagnosis and management of toxoplasmosis. Clinics in perinatology. 2005; 32
(3):705–26. doi: 10.1016/j.clp.2005.04.011 PMID: 16085028.
3.
Wasmuth JD, Pszenny V, Haile S, Jansen EM, Gast AT, Sher A, et al. Integrated Bioinformatic and Targeted Deletion Analyses of the SRS Gene Superfamily Identify SRS29C as a Negative Regulator of
Toxoplasma Virulence. Mbio. 2012; 3(6). doi: ARTN e00321-12 doi: 10.1128/mBio.00321-12 PMID:
WOS:000313100700005.
9 / 12
4.
Jensen KD, Camejo A, Melo MB, Cordeiro C, Julien L, Grotenbreg GM, et al. Toxoplasma gondii superinfection and virulence during secondary infection correlate with the exact ROP5/ROP18 allelic combination. Mbio. 2015; 6(2):e02280. doi: 10.1128/mBio.02280-14 PMID: 25714710; PubMed Central
PMCID: PMC4358003.
5.
Jung C, Lee CYF, Grigg ME. The SRS superfamily of Toxoplasma surface proteins. International journal for parasitology. 2004; 34(3):285–96. doi: 10.1016/J.Ijpara.2003.12.004 PMID:
WOS:000220413500005.
6.
Suzuki Y, Conley FK, Remington JS. Differences in Virulence and Development of Encephalitis during
Chronic Infection Vary with the Strain of Toxoplasma-Gondii. Journal of Infectious Diseases. 1989; 159
(4):790–4. PMID: WOS:A1989U006300033.
7.
Luft BJ, Remington JS. Toxoplasmic encephalitis in AIDS. Clinical infectious diseases: an official publication of the Infectious Diseases Society of America. 1992; 15(2):211–22. PMID: 1520757.
8.
Grigg ME, Ganatra J, Boothroyd JC, Margolis TP. Unusual abundance of atypical strains associated
with human ocular toxoplasmosis. The Journal of infectious diseases. 2001; 184(5):633–9. doi: 10.
1086/322800 PMID: 11474426.
9.
Arantes TE, Silveira C, Holland GN, Muccioli C, Yu F, Jones JL, et al. Ocular Involvement Following
Postnatally Acquired Toxoplasma gondii Infection in Southern Brazil: A 28-Year Experience. American
journal of ophthalmology. 2015; 159(6):1002–12 e2. doi: 10.1016/j.ajo.2015.02.015 PMID: 25743338.
10.
Koch BE, Stougaard J, Spaink HP. Keeping track of the growing number of biological functions of chitin
and its interaction partners in biomedical research. Glycobiology. 2015; 25(5):469–82. doi: 10.1093/
glycob/cwv005 PMID: 25595947; PubMed Central PMCID: PMC4373397.
11.
Duo-Chuan L. Review of fungal chitinases. Mycopathologia. 2006; 161(6):345–60. doi: 10.1007/
S11046-006-0024-Y PMID: WOS:000238151600001.
12.
Schlein Y, Jacobson RL, Messer G. Leishmania infections damage the feeding mechanism of the sandfly vector and implement parasite transmission by bite. Proceedings of the National Academy of Sciences of the United States of America. 1992; 89(20):9944–8. PMID: 1409724; PubMed Central
PMCID: PMC50250.
13.
Shahabuddin M, Toyoshima T, Aikawa M, Kaslow DC. Transmission-blocking activity of a chitinase
inhibitor and activation of malarial parasite chitinase by mosquito protease. Proceedings of the National
Academy of Sciences of the United States of America. 1993; 90(9):4266–70. PMID: 8483942; PubMed
Central PMCID: PMC46487.
14.
Shahabuddin M, Vinetz JM. Chitinases of human parasites and their implications as antiparasitic targets. Exs. 1999; 87:223–34. PMID: 10906963.
15.
Boothroyd JC, Black M, Bonnefoy S, Hehl A, Knoll LJ, Manger ID, et al. Genetic and biochemical analysis of development in Toxoplasma gondii. Philosophical transactions of the Royal Society of London
Series B, Biological sciences. 1997; 352(1359):1347–54. doi: 10.1098/rstb.1997.0119 PMID: 9355126;
PubMed Central PMCID: PMC1692023.
16.
Arroyo-Begovich A, Carabez-Trejo A, Ruiz-Herrera J. Identification of the structural component in the
cyst wall of Entamoeba invadens. The Journal of parasitology. 1980; 66(5):735–41. PMID: 7463242.
17.
Ward HD, Alroy J, Lev BI, Keusch GT, Pereira MEA. Identification of Chitin as a Structural Component
of Giardia Cysts. Infection and immunity. 1985; 49(3):629–34. PMID: WOS:A1985AQB9100028.
18.
Coppin A, Dzierszinski F, Legrand S, Mortuaire M, Ferguson D, Tomavo S. Developmentally regulated
biosynthesis of carbohydrate and storage polysaccharide during differentiation and tissue cyst formation in Toxoplasma gondii. Biochimie. 2003; 85(3–4):353–61. doi: 10.1016/S0300-9084(03)00076-2
PMID: WOS:000183340200010.
19.
Nance JP, Vannella KM, Worth D, David C, Carter D, Noor S, et al. Chitinase dependent control of protozoan cyst burden in the brain. PLoS pathogens. 2012; 8(11):e1002990. doi: 10.1371/journal.ppat.
1002990 PMID: 23209401; PubMed Central PMCID: PMC3510238.
20.
Reese TA, Liang HE, Tager AM, Luster AD, Van Rooijen N, Voehringer D, et al. Chitin induces accumulation in tissue of innate immune cells associated with allergy. Nature. 2007; 447(7140):92–6. doi: 10.
1038/nature05746 PMID: 17450126; PubMed Central PMCID: PMC2527589.
21.
dos Reis Almeida FB, de Oliveira LL, Valle de Sousa M, Roque Barreira MC, Hanna ES. Paracoccin
from Paracoccidioides brasiliensis; purification through affinity with chitin and identification of N-acetylbeta-D-glucosaminidase activity. Yeast. 2010; 27(2):67–76. doi: 10.1002/yea.1731 PMID: 19908201;
22.
Dos Reis Almeida FB, Carvalho FC, Mariano VS, Alegre AC, Silva Rdo N, Hanna ES, et al. Influence of
N-glycosylation on the morphogenesis and growth of Paracoccidioides brasiliensis and on the biological activities of yeast proteins. Plos One. 2011; 6(12):e29216. doi: 10.1371/journal.pone.0029216
PMID: 22216217; PubMed Central PMCID: PMC3244461.
10 / 12
23.
Keller A, Nesvizhskii AI, Kolker E, Aebersold R. Empirical statistical model to estimate the accuracy of
peptide identifications made by MS/MS and database search. Anal Chem. 2002; 74(20):5383–92. doi:
10.1021/ac025747h PMID: WOS:000178639700032.
24.
Nesvizhskii AI, Keller A, Kolker E, Aebersold R. A statistical model for identifying proteins by tandem
mass spectrometry. Anal Chem. 2003; 75(17):4646–58. doi: 10.1021/ac0341261 PMID:
WOS:000185192300049.
25.
Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nature protocols. 2010; 5(4):725–38. doi: 10.1038/nprot.2010.5 PMID: 20360767;
26.
Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. Pfam: the protein families
database. Nucleic Acids Res. 2014; 42(D1):D222–D30. doi: 10.1093/nar/gkt1223 PMID:
WOS:000331139800034.
27.
Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. The Phyre2 web portal for protein modeling,
prediction and analysis. Nature protocols. 2015; 10(6):845–58. doi: 10.1038/nprot.2015.053 PMID:
25950237.
28.
Zeng X, Saxild HH, Switzer RL. Purification and characterization of the DeoR repressor of Bacillus subtilis. Journal of bacteriology. 2000; 182(7):1916–22. PMID: 10714997; PubMed Central PMCID:
PMC101877.
29.
Rose NR, Milisauskas V, Zeff G. Antigenic and Enzymatic Changes in Infected and Transformed
Human Diploid Cells. Immunol Commun. 1975; 4(1):1–16. doi: 10.3109/08820137509055757 PMID:
WOS:A1975W126900001.
30.
ElMoudni B, Rodier MH, Jacquemin JL. Purification and characterization of N-acetylglucosaminidase
from Trypanosoma cruzi. Experimental Parasitology. 1996; 83(2):167–73. PMID: ISI:
A1996UZ39700001.
31.
Lee CG, Da Silva CA, Dela Cruz CS, Ahangari F, Ma B, Kang MJ, et al. Role of chitin and chitinase/chitinase-like proteins in inflammation, tissue remodeling, and injury. Annual review of physiology. 2011;
73:479–501. doi: 10.1146/annurev-physiol-012110-142250 PMID: 21054166; PubMed Central
PMCID: PMC3864643.
32.
Marshall ES, Elshekiha HM, Hakimi MA, Flynn RJ. Toxoplasma gondii peroxiredoxin promotes altered
macrophage function, caspase-1-dependent IL-1beta secretion enhances parasite replication. Veterinary research. 2011; 42:80. doi: 10.1186/1297-9716-42-80 PMID: 21707997; PubMed Central PMCID:
PMC3141401.
33.
Hunter CA, Subauste CS, Van Cleave VH, Remington JS. Production of gamma interferon by natural
killer cells from Toxoplasma gondii-infected SCID mice: regulation by interleukin-10, interleukin-12, and
tumor necrosis factor alpha. Infection and immunity. 1994; 62(7):2818–24. PMID: 7911785; PubMed
Central PMCID: PMC302887.
34.
SchartonKersten TM, Wynn TA, Denkers EY, Bala S, Grunvald E, Hieny S, et al. In the absence of
endogenous IFN-gamma, mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing
to control acute infection. J Immunol. 1996; 157(9):4045–54. PMID: WOS:A1996VP22700035.
35.
Lyons RE, McLeod R, Roberts CW. Toxoplasma gondii tachyzoite-bradyzoite interconversion. Trends
in parasitology. 2002; 18(5):198–201. PMID: 11983592.
36.
Almeida F, Wolf JM, Casadevall A. Virulence-associated enzymes of Cryptococcus neoformans.
Eukaryotic cell. 2015. doi: 10.1128/EC.00103-15 PMID: 26453651.
37.
Camargo ME, Ferreira AW, Mineo JR, Takiguti CK, Nakahara OS. Immunoglobulin G and immunoglobulin M enzyme-linked immunosorbent assays and defined toxoplasmosis serological patterns. Infection
and immunity. 1978; 21(1):55–8. PMID: 361569; PubMed Central PMCID: PMC421956.
38.
Pinzan CFS-S, A.; Almeida F.; Lai L.; Lopes C. D.; Lourenço E. V.; Panunto-Castelo A.; Matthews S.;
Roque-Barreira M. C. Vaccination with Recombinant Microneme Proteins Confers Protection against
Experimental Toxoplasmosis in Mice. Plos One. 2015. doi: 10.1371/journal.pone.0143087
39.
Lourenco EV, Pereira SR, Faca VM, Coelho-Castelo AAM, Mineo JR, Roque-Barreira MC, et al. Toxoplasma gondii micronemal protein MIC1 is a lactose-binding lectin. Glycobiology. 2001; 11(7):541–7.
doi: 10.1093/Glycob/11.7.541 PMID: WOS:000169850400004.
40.
Yabuki M, Mizushina K, Amatatsu T, Ando A, Fujii T, Shimada M, et al. Purification and Characterization of Chitinase and Chitobiase Produced by Aeromonas-Hydrophila Subsp Anaerogenes-A52. J Gen
Appl Microbiol. 1986; 32(1):25–38. doi: 10.2323/Jgam.32.25 PMID: WOS:A1986D051200003.
41.
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature. 1970; 227(5259):680–5. PMID: 5432063.
42.
Castro LDS, Pedersoli WR, Antonio ACC, Steindorff AS, Silva-Rocha R, Martinez-Rossi NM, et al.
Comparative metabolism of cellulose, sophorose and glucose in Trichoderma reesei using high-
11 / 12
throughput genomic and proteomic analyses. Biotechnol Biofuels. 2014; 7. doi: Artn 41 doi: 10.1186/
1754-6834-7-41 PMID: WOS:000334629900001.
43.
MacLean B, Eng JK, Beavis RC, McIntosh M. General framework for developing and evaluating database scoring algorithms using the TANDEM search engine. Bioinformatics. 2006; 22(22):2830–2. doi:
10.1093/bioinformatics/btl379 PMID: WOS:000241958000022.
44.
Dos Reis Almeida FB, Pigosso LL, de Lima Damasio AR, Monteiro VN, de Almeida Soares CM, Silva
RN, et al. alpha-(1,4)-Amylase, but not alpha- and beta-(1,3)-glucanases, may be responsible for the
impaired growth and morphogenesis of Paracoccidioides brasiliensis induced by N-glycosylation inhibition. Yeast. 2014; 31(1):1–11. doi: 10.1002/yea.2983 PMID: 24155051; PubMed Central PMCID:
PMC4235422.
45.
Park JK, Kim WJ, Park YI. Purification and characterization of an exo-type beta-N-acetylglucosaminidase from Pseudomonas fluorescens JK-0412. Journal of Applied Microbiology. 2011; 110(1):277–86.
doi: 10.1111/j.1365-2672.2010.04879.x PMID: ISI:000285207600030.
46.
Li H, Morimoto K, Katagiri N, Kimura T, Sakka K, Lun S, et al. A novel beta-N-acetylglucosaminidase of
Clostridium paraputrificum M-21 with high activity on chitobiose. Applied Microbiology and Biotechnology. 2002; 60(4):420–7. doi: 10.1007/s00253-002-1129-y PMID: ISI:000180027700008.
47.
De Marco JL, Valadares-Inglis MC, Felix CR. Purification and characterization of an N-acetylglucosaminidase produced by a Trichoderma harzianum strain which controls Crinipellis perniciosa. Applied
Microbiology and Biotechnology. 2004; 64(1):70–5. doi: 10.1007/s00253-003-1490-5 PMID:
ISI:000220519600009.
48.
Sobrinho IDJ, Bataus LAM, Maitan VR, Ulhoa CJ. Purification and properties of an N-acetylglucosaminidase from Streptomyces cerradoensis. Biotechnology Letters. 2005; 27(17):1273–6. doi: 10.1007/
s10529-005-0218-2 PMID: ISI:000232404700004.
12 / 12

Proteínas de micronema 1 e 4 de Toxoplasma gondii reconhecem N

Transcrição

Documentos relacionados

EFEITOS DE UMA INFECÇÃO CAUSADA POR

arquivo - Sistema CPV

Anexo 1

TUELLA 2013 Douro DOC Red/Tinto

Setor 02. Neurofarmacologia

MITOSIS (III ANO

Description of the nest and eggs of the Black-and

Prova - Colégio Militar Dom Pedro II

PROFESSOR DE LÍNGUA ESTRANGEIRA - INGLÊS

A Independencia Americana e um pouco de sua historia