do Arquivo (Click Aqui) - PGA/UEM

Сomentários

Transcrição

do Arquivo (Click Aqui) - PGA/UEM
MARILDA PEREIRA CAIXETA
CARACTERIZAÇÃO MORFOLÓGICA DE ISOLADOS DE Guignardia
citricarpa
MARINGÁ - PARANÁ - BRASIL
FEVEREIRO – 2006
MARILDA PEREIRA CAIXETA
CARACTERIZAÇÃO MORFOLÓGICA DE ISOLADOS DE Guignardia
citricarpa
Dissertação apresentada à Universidade
Estadual de Maringá como parte das
exigências do Programa de Pós-Graduação
em Agronomia, área de concentração em
Proteção de Plantas, para obtenção do título
de Mestre.
MARINGÁ - PARANÁ - BRASIL
FEVEREIRO – 2006
Aos meus pais, José (Saudades) e Clarinda, pelo constante
apoio, compreensão, amizade, confiança e responsáveis pela
minha formação.
Ao meu marido Batista.
Aos meus irmãos, irmãs, cunhados, cunhadas e sobrinhos.
Aos meus amigos e colegas.
A todas as pessoas que acreditaram em mim.
A todos aqueles que venham se beneficiar deste trabalho.
Dedico.
i
AGRADECIMENTOS
Nenhuma conquista é o resultado exclusivo do nosso esforço. Assim
agradeço:
A Deus, Criador dos Dons, que me deu a vida, a luz, a concessão da
força e a coragem de realizar, caminhando mais e mais no caminho do saber;
À Profa. Dra. Maria Júlia de Corazza Nunes, pela orientação, amizade,
dedicação,
conhecimento
transmitido,
sugestões
e
colaboração
nesta
dissertação;
A meu marido e companheiro Batista, pela sempre presença, ajuda e
por todo apoio e amor dispensados a minha pessoa;
Ao Prof. Dr. William Mário de Carvalho Nunes, pelo incentivo, atenção,
disponibilidade na busca de isolados e de fontes bibliográficas para o
desenvolvimento deste trabalho, pelas críticas e sugestões e, principalmente,
pela amizade;
Ao Prof. Dr. Dauri José Tessmann, que, além dos préstimos
profissionais, sempre manifestou uma palavra amiga e encorajadora;
Ao curso de Pós-Graduação do Departamento de Agronomia, da
Universidade Estadual de Maringá, em especial a todos os professores, pelos
ensinamentos transmitidos e pela convivência serena durante todo o período;
A meus familiares, pelo carinho, apoio e incentivo nos momentos
difíceis e de incertezas;
i
Ao amigo e sempre presente Ricardo Ribeiro de Oliveira, pela ajuda na
execução das análises estatísticas;
Aos amigos e colegas incentivadores: Marina, Gilmara, Antônio
Augusto, Luciana, Francislene, Josiane, Rúbia, Alessandra, Edgar, Bárbara,
Ronilda, Franciele, Cláudia, Clara, Fernanda e Akemi, pela ajuda nos
momentos difíceis ocorridos durante esse período, incentivo, carinho e
amizade;
Aos técnicos de laboratório José Júnior Severino e Mauro José Moreira
(Laboratório de Fitopatologia - UEM), Carlos Alexandre Zanutto (Núcleo de
Pesquisa em Biotecnologia Aplicada - NBA), pela sempre disposição, auxílio e
orientação na parte prática dos trabalhos;
À Universidade Estadual de Maringá e à Coordenação do curso de Pós
– Graduação em Agronomia, pela oportunidade em realizar esse curso.
Ao Conselho Nacional de Desenvolvimento Científico (CNPq), pela
concessão da bolsa de estudo;
À Profa. Dra. Chirlei Glienke de Blanco (UFPR), Prof. Dr. Antonio de
Góes (UNESP) e Alexandre Mello (ESALQ-USP), pela cessão de isolados de
Guignardia citricarpa.
A todas as pessoas que direta ou indiretamente, colaboraram para a
realização deste trabalho.
i
BIOGRAFIA
MARILDA PEREIRA CAIXETA, filha de José Pereira Caixeta e Clarinda
Marra Caixeta, nasceu em Patos de Minas, Minas Gerais, aos vinte dias do
mês de novembro de 1959.
Graduou-se em Ciências Biológicas pela Faculdade de Filosofia
Ciências e Letras de Patos de Minas – MG, em dezembro de 1989.
Participou do Curso de Pós-Graduação Latu Sensu pela Faculdade de
Filosofia Ciências e Letras de Patrocínio – MG, em 1990.
Atuou como professora no ensino fundamental e médio na Rede
Pública Estadual de Minas Gerais.
Em março de 2004, iniciou o curso de Mestrado em Agronomia, na
área de Proteção de Plantas, na Universidade Estadual de Maringá,
completando com este trabalho os requisitos necessários à obtenção do título
de Mestre em Agronomia.
v
ÍNDICE
RESUMO...........................................................................................................
ABSTRACT........................................................................................................
1. INTRODUÇÃO...............................................................................................
2. REVISÃO DE LITERATURA..........................................................................
2.1. Distribuição Geográfica e Danos da Mancha Preta do Citros
(MPC).............................................................................................................
2.2. Etiologia..................................................................................................
2.3. Hospedeiros e sintomatologia.................................................................
2.4. Epidemiologia e ciclo da doença............................................................
2.5. Medidas de controle da doença..............................................................
2.6. O emprego da Reação da Polimerase em Cadeia (PCR) na
identificação de fitopatógenos.......................................................................
2.7. Caracterização morfológica.............................................................
3. MATERIAL E MÉTODOS...............................................................................
3.1. Origem dos Isolados de G. citricarpa......................................................
3.2. Isolamento e Manutenção dos Isolados de G. citricarpa........................
3.3. Caracterização morfológica em diferentes meios culturais, diferentes
temperaturas e fotoperíodos.........................................................
3.3.1. Avaliação das características culturais............................................
3.3.1.1. Características Culturais a 20oC, 25oC e 30oC........................
3.3.2. Avaliação formação de estruturas reprodutivas..............................
3.3.2.1. Picnídios...................................................................................
3.3.2.2. Conídios...................................................................................
3.4. A reação da polimerase em cadeia com Isolados de G.
citricarpa..............................
3.4.1.Extração do DNA..............................................................................
3.4.2. Reação da polimerase em cadeia (PCR)........................................
4. RESULTADOS E DISCUSSÃO.....................................................................
4.1. Avaliação do crescimento micelial..........................................................
4.2. Avaliação da esporulação.......................................................................
4.2.1 Formação de estruturas reprodutivas...............................................
4.3 Identificação por PCR dos isolados em nível especifico........................
6. CONCLUSÕES..............................................................................................
7. REFERÊNCIAS..............................................................................................
8. APÊNDICES..................................................................................................
v
xii
ix
1
5
5
6
9
11
13
15
17
19
19
21
22
22
22
23
23
23
24
24
25
27
27
34
34
38
40
41
49
RESUMO
CAIXETA, Marilda Pereira, M.Ss. Universidade Estadual de Maringá, fevereiro
de 2006. Caracterização Morfológica de isolados de Guignardia citricarpa.
Professora Orientadora: Dra. Maria Júlia de Corazza Nunes.
Guignardia citricarpa, fase anamórfica Phyllosticta citricarpa, é o agente
etiológico da mancha preta dos citros (MPC) e pode causar lesões em folhas,
ramos e, principalmente, na casca dos frutos depreciando-os para o mercado
de frutas frescas. A doença ocorre em vários países e tem causado grandes
danos a citricultura. Apesar de existirem variações do patógeno relativamente
grande quanto às características morfológicas das estruturas vegetativas e
reprodutivas entre isolados, poucos trabalhos foram desenvolvidos nesse
sentido. Este trabalho tem como objetivo quantificar o efeito dos diferentes
meios de cultivo, fotoperíodo e temperatura nas características vegetativas e
reprodutivas, assim como identificar e confirmar a espécie de 18 isolados de G.
citricarpa, originados de diversas regiões, através de PCR (reação da
polimerase em cadeia). Os resultados mostram que ocorreu interação entre
meio de cultura, temperatura e fotoperíodo. Os meios de cultura que mais
proporcionaram crescimento micelial foram cenoura-dextrose-ágar (CDA) e
aveia-ágar (AA), nas temperaturas de 20 e 25oC, sob os fotoperíodos de 12/12
horas e luz contínua. As colônias atingiram até 90 mm de diâmetro em um
período de 24 dias. A maior produção de conídios foi verificada no meio batatadextrose-ágar (BDA), no fotoperíodo 12/12 horas e na temperatura de 25oC.
Uma produção de conídio relativamente alta também foi observada no meio AA
a 25oC, sob o fotoperíodo 12/12 horas. Para a maior parte dos isolados ocorreu
a formação de conídios em baixas quantidades, na temperatura de 20oC, nos
meios AA e BDA, nos fotoperíodos 12/12 horas e escuro contínuo. No meio de
cultivo CDA, nenhum isolado esporulou sob quaisquer das condições
experimentais utilizada e a maioria dos isolados crescidos neste meio produziu
apenas picnídios vazios. Sob a temperatura de 30oC, em todos os fotoperíodos
e meios de cultivo, foi verificada, para a maioria dos isolados, apenas a
v
produção de hifas e picnídios. Dos 18 isolados estudados e submetidos ao
teste da PCR, apenas um isolado não foi confirmado ser pertencente à espécie
G. citricarpa.
Palavras-chave:
Phyllosticta
citricarpa,
Caracterização morfológica, PCR
v
mancha
preta
dos
citros,
ABSTRACT
CAIXETA, Marilda Pereira, M.Ss. The State University of Maringá, February of
2006. Morphological Characterization of Guignardia citricarpa isolates..
Adviser: Drª. Maria Júlia of Corazza Nunes.
Guignardia citricarpa, anamorphic phase Phyllosticta citricarpa, is the ethiologic
agent of citrus black spots, and it can cause lesions in leaves, branches, and,
mainly in the peel of fruits making them less valuable for the markets of fresh
fruit. The disease occurs in several countries, and it has been causing great
damage to citriculture. Although, there are relatively extensive variations of the
pathogen concerning the morphologic characteristics of the vegetative and
reproductive structures among the isolates, few works were developed in this
sense. This work has as its objective to quantify the effect of different cultivation
media, photoperiod and temperature in the vegetative and reproductive
characteristics, as well as to identify and to confirm through PCR (Polymerase
chain reaction) 18 G. citricarpa isolates species from several areas. The results
showed that there was an interaction between culture medium, temperature and
photoperiod. The cultivation media that provided more mycelial growth were the
carrot-dextrose-agar (CDA) and oat-agar (AA) at the temperatures of 20 and
25º C under the 12/12 hour-photoperiods and continuous light. The colonies
reached up to 90mm of diameter within 24 days. The largest conideos
production was verified in the potato-dextrose-agar medium (BDA) in the 12/12
hour-photoperiod and at 25ºC. A relatively high conideo production was also
observed in the AA medium at 25ºC under the 12/12 hour- photoperiod. For the
majority of isolates the formation of conideos occured in low quantities at 20ºC
in the AA and BDA media in the 12/12 hour-photoperiods and continuous
darkness. In the CDA cultivation medium, none of the isolates sporulated under
any of the used experimental conditions, and most of the grown isolates
produced only empty picnides. At 30ºC, in all of the photoperiods and cultivation
media for most of the isolates it was verified only hyphas and picnides
production. Only one out of the 18 isolates studied and submitted to the PCR
test was not confirmed for the G. citricarpa species.
Key-wors: Phyllosticta
characterization, PCR.
citricarpa,
citrus
i
black
spots,
morphological
1. INTRODUÇÃO
As plantas cítricas, originadas da Ásia tropical e subtropical, foram
introduzidas no Brasil pelos primeiros colonizadores, inicialmente no Estado da
Bahia, de onde se expandiram para outros Estados brasileiros, principalmente
em direção às regiões Sudeste e Sul. No início do século XX, o
estabelecimento de grandes centros populacionais na Região Centro-Sul, como
Rio de Janeiro e São Paulo, garantiu o consumo da produção, permitindo que a
citricultura começasse a se desenvolver como uma promissora atividade
agrícola. Atualmente, o Brasil possui uma área plantada com a cultura de citros
de aproximadamente 820 mil hectares (Instituto de Economia Agrícola, 2004),
destacando-se como o maior produtor mundial de citros. A grande importância
que a citricultura representa para o Brasil refere-se ao fato de que este
agronegócio é responsável por cerca de 400 mil empregos diretos e indiretos,
gerando receitas superiores a dois bilhões de dólares por ano (SPÓSITO et al.,
2003). E entre os estados brasileiros, São Paulo se destaca como sendo o
maior produtor de citros (ROSSETTI, 2001).
Dados do Instituto Brasileiro de Geografia e Estatística (IBGE, 2004)
apontam o Estado do Paraná com uma produção de apenas 2% da produção
de laranjas do país, ocupando, assim, uma posição pouco destacada na
citricultura brasileira. Na região Sul, no Vale do Ribeira, estão concentrados
pomares de tangerinas destinadas, principalmente, ao consumo “in natura”,
enquanto que nas Regiões Norte e Noroeste do Estado estão implantados
pomares comerciais de laranjas doces, cuja produção está voltada,
principalmente, para o abastecimento da indústria de suco concentrado para
exportação. O potencial para o crescimento da citricultura no Estado do Paraná
está localizado nas Regiões Norte e Noroeste em função das condições
edafoclimáticas e topográficas favoráveis e das grandes extensões de terras
disponíveis para o plantio da cultura (IAPAR, 2005). No entanto, em
decorrência do cancro cítrico, essas áreas foram interditadas à citricultura por
um período de aproximadamente 30 anos, mais por motivos políticos do que
fitossanitários (MARIMOTO, 1986).
1
Apesar da importância econômica da citricultura brasileira, a cultura
tem enfrentado vários problemas, principalmente quanto aos aspectos
fitossanitários, demandando estudos técnicos e científicos com a finalidade de
solucioná-los.
Entre as várias doenças fúngicas que têm afetado a citricultura
brasileira, a mancha preta dos citros (MPC), causada por Guignardia citricarpa
Kiely, (anamórfico Phylosticta citricarpa) vem, atualmente, causando um grande
impacto econômico à citricultura devido à redução da produtividade dos
pomares e à depreciação dos frutos para consumo “in natura”, tanto no
mercado interno, quanto para exportação, além de onerar os custos de
produção devido às diferentes estratégias empregadas para o controle da
doença.
A MPC ocorre em vários países onde se cultiva citros. A doença já foi
registrada na Oceania, principalmente na Austrália, onde foi descrita pela
primeira vez, na África, na Ásia e na América do Sul, inclusive no Brasil. Esta
doença é considerada quarentenária A1 pela União Européia, ocasionando,
dessa forma, restrições para exportações de frutos cítricos brasileiros para os
países dessa comunidade (SPÓSITO et al., 2003).
No Brasil, a MPC foi constatada pela primeira vez por volta de 1938, no
Estado de São Paulo e, nos anos de 1980, a doença se expandiu para o Rio de
Janeiro e Rio Grande do Sul, com níveis epidêmicos em alguns locais.
O
clima
em
alguns
Estados
brasileiros
favorece
a
MPC,
proporcionando condições ambientais favoráveis ao patógeno por longos
períodos durante o ano e, conseqüentemente, a severidade da doença tem
alcançado altos níveis quando comparados com os de outros países. Como o
patógeno apresenta infecção latente no hospedeiro e uma das vias de
disseminação é através de mudas infectadas, a doença vem apresentando nos
últimos anos uma distribuição mais ampla, atingindo outros Estados brasileiros,
como Minas Gerais, Espírito Santo e Paraná, conforme previsto, recentemente,
por Goes (GOES et al., 2000).
No Estado do Paraná, apesar da rigorosa vigilância sanitária, a doença
foi constatada pela primeira vez no mês de setembro de 2004, em pomares do
município de Cerro Azul, próximo ao Vale do Ribeira, na região Sul (NUNES et
al., no prelo).
2
Uma importante característica da MPC é o seu longo período de
incubação, uma vez que a infecção ocorre desde o seu crescimento inicial, mas
os sintomas só aparecem a partir da fase de transição entre a cor verde e a
maturação, ou após sua colheita, ou, ainda, durante o armazenamento e
transporte. Com exceção da laranja azeda (Citrus aurantium L.) e seus
híbridos, quase todas as espécies e variedades de citros são susceptíveis ao
patógeno, particularmente os limões verdadeiros [C. limon (L.) Burm. f.],
seguidos das variedades de laranjas doces [C. sinenses (L) Osbeck], cujo
amadurecimento dos frutos ocorre durante os períodos de temperaturas mais
elevadas (KOTZÉ, 1981). A principal fonte de inóculo primário do patógeno é
constituída pelos ascósporos produzidos pelos pseudotécios desenvolvidos em
folhas em decomposição no solo, sendo sua produção favorecida pela
alternância
de
períodos
de
molhamento
e
secamento
das
folhas
(FEITCHENBERGER, 1996). A fase anamórfica de G. citricarpa produz
picnídios que se desenvolvem em frutos e folhas fixadas à planta (SPÓSITO,
2003).
A maioria dos estudos sobre G. citricarpa trata do uso de medidas de
controle, principalmente, aquelas que se empregam químicos sintéticos.
Estudos
de
caracterização
morfo-fisiológica
de
patógenos
fornecem
informações úteis que podem auxiliar no manejo da cultura contra determinada
doença. No entanto, poucos trabalhos desta natureza foram desenvolvidos até
o momento, sendo raros aqueles que comparam os isolados brasileiros com
populações do patógeno de outros países. Considerando que a MPC é uma
doença nova no Estado do Paraná e que os isolados de G. citricarpa ainda não
foram caracterizados nas condições paranaenses, justifica-se a realização
deste estudo que teve como objetivos:
-
Identificar isolados de G. citricarpa em materiais de laranja ‘Pêra’ e
tangerinas ‘Ponkan’ e ‘Montenegrina’, coletados em pomares do município
de Cerro Azul, região Sul, e da região Noroeste do Paraná, através da
reação da polimerase em cadeia (PCR), utilizando “primers” específicos.
3
-
Caracterizar os isolados de G. citricarpa de frutos cítricos sintomáticos de
pomares comerciais paranaenses através de seus caracteres morfológicas,
comparando-os com isolados já identificados de outras regiões do Brasil e
da África do Sul.
4
2. REVISÃO DE LITERATURA
2.1. Distribuição Geográfica e Danos da Mancha Preta do Citros (MPC)
Segundo Paul et al. (2004), as primeiras descrições oficiais da doença
foram realizadas na Austrália em 1895, sendo, porém, estabelecida a sua
relação com o patógeno a partir de 1897. No ano de 1929, a MPC foi notificada
na África do Sul, onde rapidamente tornou-se o principal problema fitossanitário
da citricultura desse país, causando perdas consideráveis nos frutos de laranja
‘Valência’, ainda nos pomares ou na fase pós-colheita. (KOTZÉ, 1981;
SCHUTTE et al., 1997; PAUL, et al., 2004). Nos anos subseqüentes, a doença
disseminou-se para outros países da África (Swazilândia, Quênia, Nigéria,
Zimbabwe, Rodésia e Moçambique), dirigindo-se para a Ásia (China, Filipinas,
Indonésia, Japão e Hong-Kong) e para a América do Sul (Argentina, Peru,
Uruguai, Venezuela e Brasil) (KOTZÉ, 1981; 1988; FEICHTENBERGER, 1996;
TIMMER et al., 2000; PAUL, et al., 2004).
A MPC tem sido responsável por elevados prejuízos na cultura de
citros, envolvendo milhões de dólares em diferentes regiões produtoras de
citros do mundo, especialmente na África do Sul, Austrália, Taiwan, China,
Japão e Brasil (LARANJEIRA et al., 2005). Sua importância do ponto de vista
econômico se torna ainda maior, devido ao fato de atingir variedades
importantes de laranjas doces apreciadas para consumo “in natura”,
especialmente as de maturação tardia.
No Brasil, a mancha preta dos citros foi descrita inicialmente no Estado
de São Paulo em frutos das variedades ‘Pêra’ e ‘Seleta’, obtidos em uma feira
livre
do
município
de
Piracicaba,
entre
os
anos
1938
e
1940
(FEICHTENBERGER 1996). Na década de 1980, a doença foi detectada, em
caráter epidêmico, pela primeira vez em pomares comerciais do município de
São Gonçalo do Itaboraí (Baixada Fluminense), Rio de Janeiro, causando
perdas consideráveis em mexerica ‘Rio’ (Citrus deliciosa Tem.) (ROBBS et al.,
1980) e, posteriormente, em pomares de laranjas ‘Lima’, ‘Seleta’, ‘Folha
5
Murcha’, ‘Natal’, ‘Pêra Rio’ e ‘Valência’ (GOES et al., 1990). Nessa ocasião, foi
constatada apenas a forma anamórfica do patógeno. A MPC foi descrita pela
primeira vez no Estado do Rio Grande do Sul, em 1986, no Vale do Caí, e,
desde então, tem causado sérios prejuízos para a citricultura desse Estado
(FEICHTENBERGER, GOES, 1998).
Durante alguns anos não foi dada muita importância à doença, devido
a uma temporária redução de inóculo resultante da epidemia da tristeza dos
citros, virose que redundou na eliminação de aproximadamente 11 milhões de
plantas cítricas nas décadas de 1930 a 1940 (GOES, 1998). De acordo com
este autor, em 1992, a MPC foi novamente constatada no Estado de São
Paulo, causando elevados prejuízos em limão ‘Siciliano’, em pomares
localizados na região de Mogi-Guaçú.
Atualmente, a MPC encontra-se disseminada em 44 municípios do
Estado de São Paulo, podendo, no entanto, ter abrangência geográfica maior,
pelo fato dos pomares estarem localizados em regiões de condições
ambientais muito favoráveis à formação de inóculo. A doença foi também
notificada no ano de 2001, no Estado de Minas Gerais, na região de Guaxupé
no Triângulo Mineiro, em 2002, no Sul do Estado do Espirito Santo (COSTA et
al., 2003) e, em 2004, no Paraná, em pomares do município de Cerro Azul,
região Sul, e em pomares da região Noroeste do Estado (NUNES et al., 2006,
no prelo).
2.2. Etiologia
A mancha preta, também chamada de pinta preta dos citros, é uma
doença causada pelo fungo Guignardia citricarpa Kiely, um Loculoascomiceto
da ordem Dothideales e da família Dothideaceae. A fase assexual, ou
anamórfica deste patógeno, identificada em 1889 por McAlpine como Phoma
citricarpa (McAlp.), foi reclassificada em 1973 como Phyllostictina citricarpa,
McAlp. (Petrak.) e, atualmente, como Phyllosticta citricarpa (McAlp.) van der
A.a. (Laranjeira et al., 2005; Baayen et al., 2002). O estágio teleomófico ou
sexual, denominado de Guignardia citricarpa Kiely, foi descrito em 1948 por
Kiely (KOTZÉ, 1988).
6
De acordo com a literatura, existem duas formas morfologicamente
idênticas de G. citricarpa: uma que provoca a MPC, embora também possa
produzir infecções assintomáticas em citros, e outra endofítica, não patogênica,
que provoca apenas infecções assintomáticas em folhas de citros e de plantas
de
mais
de
vinte
famílias,
além
de
Rutaceae
(KOTZÉ,
1988;
FEICHTENBERGER, 1996; FEICHTENBERGER et al., 1997). Apesar dessas
diferenças, as duas raças não podem ser distinguidas por microscopia óptica
(MEYER et al., 2001). Conseqüentemente, como ressaltado por Feichtenberger
(1996), a simples presença de Guignardia no pomar não significa que a doença
ocorra na área.
Recentemente, no entanto, Meyer et al. (2001) compararam isolados
das duas estirpes através da análise de seqüências dos espaços transcritos
internos do DNA ribossomal (ITS) e através da análise dos comprimentos dos
fragmentos de restrição (RFLP) do produto da PCR dessas seqüências,
encontrando suporte para concluir sobre a existência de duas espécies
distintas. Diferentes isolados destas duas formas de Guignardia foram,
também, comparados por Baayem et al., (2002), através de análises
morfológicas e moleculares, baseadas nas seqüências de regiões ITS e no
polimorfismo do comprimento de fragmentos amplificados (AFLP). A análise
dos resultados confirmou que se trata de duas diferentes espécies: G.
mangiferae (Phyllosticta capitalensis P), a espécie endofítica, e G. citricarpa,
patogênica. A existência e as características dessas duas espécies já haviam
sido descritas por McOnie (1964), não justificando segundo Baayem et al.
(2002), a inclusão das raças não patogênicas de G. mangifera na legislação de
quarentena. Adicionalmente, Bonants et al. (2003) utilizaram grupos de
“primers” que amplificam as regiões ITS do DNA ribossomal, específicos para
G. citricarpa e G. mangiferae, e testaram sua especificidade contra 37 isolados
de G. citricarpa, 29 isolados de G. mangiferae e 10 isolados de espécies
relacionadas a Guinardia e Phyllosticta e de outros fungos que infectam citros.
Os resultados indicaram que o par de “primers” denominados de GCF3
(forward primer) e GCR7 (reverse primer) foi específico para G. citricarpa,
amplificando um fragmento de 490 pb, não detectado na espécie G. mangífera
e em outras espécies de fungos que infectam citros, utilizadas como controle.
No entanto, este par de “primers” também gerou produtos de PCR nas
7
espécies G. bidwellii e G. aesculi, porém, os tamanhos dos fragmentos foram
de aproximadamente 1000 e 400 pb, respectivamente, diferindo estas espécies
de G. citricarpa.
G. citricarpa produz ascósporos em folhas caídas e em decomposição
no solo. Os ascósporos são liberados com a presença de água livre e
transportados pelo vento até as partes suscetíveis da planta, onde ocorre a
infecção primária (SMITH, 1996). O período latente varia de quatro a seis
meses (TIMMER, 1999). Em frutos e ramos podem ser formados picnídios
cujos conídios são dispersos por respingos de chuvas a curtas distâncias
(KOTZÉ, 1981; 1988).
Na forma teleomórfica de G. citricarpa, os pseudotécios produzidos em
folhas em decomposição no solo apresentam-se isolados ou agregados,
globulosos de 100 - 175μm de diâmetro e apresentam um ostíolo circular não
papilado. Os pseudotécios maduros contêm ascos. Os ascos são cilíndricoclavados, bitunicados, tendo no seu interior oito ascósporos, unicelulares,
hialinos, multigutulados, cilíndricos dilatado no centro (12,5 a 16 x 4,5 a 6,5μm)
e com apêndices hialinos nas duas extremidades obtusas (SUTTON,
WATERSTON, 1966; KOTZÉ, 1981; 1988; FEICHTENBERGER et al., 1997).
Os ascósporos não foram encontrados em lesões de frutos ou folhas presas na
planta (KOTZÉ, 1988).
Goes e Kupper (2002) descreveram o ascoma como um pseudotécio
peritecióide, uniloculado, solitário ou agregado, imerso ou irrompente, marromescuro, globuloso e subglobuloso, ostiolado com papila ou pescoço ostiolar. A
parte
externa
da
parede
ascomal
é
constituída
por
células
pseudoparenquimatosas espessas e a interna com células hialinas e delgadas,
com o centro pseudoparenquimatoso.
A fase anamórfica de G. citricarpa produz picnídios em lesões de
frutos, folhas e pecíolos, ocasionalmente no pedúnculo de frutos, e, também,
em grande número de folhas mortas (BEETON et al., 1996). Os picnídios são
de coloração marrom-escura ou preta, solitários ou agregados, globulosos (115
a 190μm de diâmetro), apresentando um ostíolo levemente papilado, circular,
de 12 a 14,5μm de diâmetro. Os conídios, cuja forma é obvóide a elíptica (8 a
10,5 x 5,5 a 7μm), são hialinos, unicelulares, multigutulados, com um apêndice
8
hialino numa das extremidades e um ápice levemente arredondado (SUTTON,
WATERSTON, 1966; KOTZÉ, 1981; 1988).
2.3. Hospedeiros e sintomatologia
Com exceção da laranja azeda (C. aurantium L) de seus híbridos e da
lima ácida Tahiti [C latifólia (Yu. Tanaka) Tanaka], única variedade cítrica em
que a doença não foi observada, quase todas as espécies de citros são
suscetíveis ao G. citricarpa. Das espécies suscetíveis, os limões verdadeiros,
particularmente o ‘Eureka’ e o ‘Siciliano’, são os mais afetados, seguidos das
variedades de laranjas doces e tangerinas, cujo amadurecimento dos frutos se
dá durante temperaturas mais elevadas (KOTZÉ, 1981, 1988; LARANJEIRA et
al., 2005).
Os sintomas são sempre mais freqüentes nas superfícies da planta
mais expostas aos raios solares, podendo ocorrer, principalmente, em ramos,
folhas e, com maior freqüência e severidade, nos frutos (KOTZÉ, 1981; 1988).
De acordo com Feichtenberger et al. (1997) e com os relatos do
Fundecitros (2000), os sintomas em folhas são mais raros e se caracterizam
por formação de lesões com o centro acinzentado e bordos salientes, marromescuros, com um halo amarelado, semelhantes aos sintomas encontrados nos
frutos. As lesões em folhas são mais freqüentemente encontradas em
tangerinas e limões verdadeiros.
Nos frutos, os sintomas são mais facilmente visíveis e caracterizados
por manchas necróticas, deprimidas, com bordas pretas e centro mais claro,
onde se constata, muitas vezes, a presença de picnídios/conídios, também
responsáveis pela disseminação da doença (FEICHTENBERGER et al., 1997).
A dimensão, o formato e a cor das lesões variam muito e, de acordo com essas
variações, os sintomas observados nos frutos podem ser classificados em
quatro (KOTZÉ, 1981, 1988) ou seis diferentes formas (AGUILAR-VILDOSO,
2002; LARANJEIRA et al., 2005).
De acordo com os autores, a Mancha dura é a lesão mais comum e
típica da doença e aparece, em geral, quando os frutos iniciam a maturação.
Em frutos verdes, surge um halo amarelado circundando as lesões, as quais
apresentam o centro necrótico deprimido, marrom-claro, e as bordas salientes,
9
marrom-escuras. Uma característica dessas lesões é a presença de pontos
negros no centro, correspondendo aos picnídios, corpos de frutificação do
fungo. Em frutos maduros, a lesão é circundada por um halo esverdeado.
No caso do sintoma da Falsa melanose, de um modo geral, surge
quando o fruto já ultrapassou seu período de suscetibilidade, que é de quatro a
cinco meses. São manchas escuras, pequenas e numerosas, dispersas ou
agregadas nos frutos, que normalmente aparecem com estes ainda verdes.
Este sintoma pode ser confundido com os de outra doença fúngica, a melanose
(Diaporthe citri Wolf). Entretanto, na melanose, as lesões são ásperas quando
comparadas as da falsa melanose. Em áreas de elevada pressão de inóculo,
esses são os primeiros sintomas a serem observados. Nesse sintoma, mesmo
os frutos em fases iniciais de desenvolvimento exibem amarelecimento
precoce, destacando-se em relação aos demais.
Em relação à Mancha sardenta, esta caracteriza-se por pequenas
lesões deprimidas e avermelhadas que, geralmente, ocorrem no período de
maturação dos frutos e na pós-colheita, podendo coalescer, formando grandes
lesões, ou permanecer pequenas e individualizadas.
Na Mancha virulenta, a coalescência das lesões se diferencia dos
demais tipos de sintomas, atingindo grandes áreas da superfície dos frutos.
Essas lesões desenvolvem-se com freqüência no final da safra, quando os
frutos já estão maduros e as temperaturas elevadas. Também podem ocorrer
após a colheita, durante o transporte e o armazenamento dos frutos. No centro
das lesões surgem pontuações escuras, que são os picnídios do fungo.
Já o sintoma, Mancha rendilhada corresponde a lesões superficiais
que atingem grandes áreas dos frutos, quando estes ainda estão verdes. Estas
lesões não apresentam corpos de frutificação.
Por fim, a expressão do sintoma Mancha trincada está associada à
presença do ácaro da falsa ferrugem (Phyllocoptruta oleivora). As lesões são
arredondadas, ocorrendo em frutos ainda verdes, e, com a maturação,
apresentam trincas em sua superfície, não apresentando corpos de frutificação.
Na literatura internacional são considerados apenas quatro dos seis
sintomas associados à MPC: mancha dura, falsa melanose, mancha sardenta e
mancha virulenta, não citando os sintomas mancha rendilhada e mancha
trincada (KOTZÉ, 1981, 1988; TIMMER et al., 2000).
1
Os sintomas da MPC são favorecidos por vários fatores, sendo os mais
importantes
a
radiação
solar
intensa
e
as
altas
temperaturas
(FEICHTENBERGER, 1996). Spósito (2003), estudando os danos causados
por G. citricarpa à cultura de citros, sugeriu que as diferentes manifestações
dos sintomas estão, provavelmente, associadas à suscetibilidade do tecido no
momento da infecção e às condições climáticas prevalecentes durante e após
a infecção. Cardoso Filho (2003) argumentou que, embora as lesões estejam
limitadas ao flavedo, elas depreciam os frutos para a comercialização “in
natura” e restringe as exportações para a União Européia, maior importador
dos frutos cítricos brasileiros. A doença é considerada quarentenária A1 na
União Européia, por não estar presente em seus países membros. Nesses
países, a tolerância em relação aos frutos importados com sintomas de doença
é zero. No entanto, como a MPC não modifica as qualidades internas dos
frutos, eles podem ser utilizados para a indústria de suco cítrico concentrado
(FAGAN, GOES, 2000; TIMMER et al., 2000).
Uma característica interessante dessa doença é que o patógeno pode
estar presente em um pomar por muitos anos, antes dos sintomas aparecerem.
Às vezes, podem levar de cinco a trinta anos para os primeiros sintomas se
tornarem visíveis e, em seqüência, tomar proporções epidêmicas (KOTZÉ,
1981; 1988). Ainda, segundo o autor, uma outra importante característica da
MPC é o seu longo período de incubação, uma vez que a infecção pode
ocorrer desde a fase inicial de crescimento dos frutos e os sintomas
aparecerem somente a partir da fase de transição entre a cor verde e a de
maturação. Para Kellerman et al., (1997), esta fase latente pode levar vários
meses após a queda das pétalas, dependendo da temperatura, variedade e
condições da planta. Klotz (1978) relatou que na África do Sul os frutos
mostram-se suscetíveis até, aproximadamente, 24 semanas após a queda das
pétalas, tornando-se aparentemente resistentes em fases subseqüentes.
2.4. Epidemiologia e ciclo da doença
Para estudar a epidemiologia da MPC é preciso considerar
disponibilidade de inóculo, as condições climáticas requeridas para a infecção
1
e, particularmente, o desenvolvimento do fruto em relação ao desenvolvimento
da doença (KOTZÉ, 1981; 1988).
A infecção pelo G. citricarpa pode ocorrer através dos esporos
assexuais ou picnidiósporos e pelos esporos sexuais ou ascósporos
(LARANJEIRA et al., 2005). No entanto, a importância dessas duas formas de
inóculo é, ainda, bastante discutida entre os autores. McOnie (1964)
considerou que os ascósporos constituem a principal fonte de inóculo da MPC,
mas que os picnidiósporos são pouco importantes para a evolução da doença.
Por outro lado, Goes (1998) ressaltou que no Brasil o processo infeccioso da
MPC pode ter início nos picnidiósporos ou nos ascósporos, enquanto que, em
países como a África do Sul, onde os períodos de floração e frutificação são
uniformes, o ciclo da doença depende especialmente dos ascósporos. Para
Kotzé (1981, 1988), os ascósporos são os principais propágulos do patógeno,
porém, quando a doença atinge proporções epidêmicas. O autor descreveu
que em um pomar da África do Sul, pouco atingido pela doença, foi observado
um pequeno número de ascósporos em folhas e galhos em decomposição no
solo. Entretanto, quando, nesse mesmo pomar, a doença atingiu níveis
epidêmicos, o número de ascósporos observados era bem mais elevado.
Os ascósporos se desenvolvem em folhas e galhos em decomposição,
após 40 a 180 dias da sua queda no solo dos pomares. Sua produção é
favorecida pela alternância entre os períodos de molhamento e seca das
folhas, condição essa bastante freqüente durante as estações chuvosas do ano
(FEICHTENBERGER, 1996; FEICHTENBERGER et al., 1997; GOES, 1998). A
disseminação ocorre por correntes de ar, as quais transportam os esporos a
curtas e longas distâncias, podendo ser também levados por respingos de
água das folhas do solo até as superfícies mais baixas da copa das plantas,
suscetíveis ao patógeno (KOTZÉ, 1981; TIMMER, 1999).
O período crítico da infecção inicia-se com o começo da frutificação e
se estende por 4-5 meses, sendo que os primeiros sintomas só aparecem após
6 meses (KOTZÉ, 1988). Nesse processo, os ascósporos, em contato com o
tecido vegetal, aderem-se a sua superfície através da mucilagem existente nas
suas extremidades e, na presença de água, germinam formando o tubo
germinativo e o apressório. O apressório emite uma delgada hifa de infecção
que penetra através da cutícula e se desenvolve formando uma pequena
1
massa micelial entre a cutícula e a epiderme nos frutos (KOTZÉ, 1981, 1988;
TIMMER, 1999; LARANJEIRA et al., 2005). De acordo com os autores, o fungo
pode permanecer em um estado de latência, na forma de micélio subcuticular,
por até 12 meses e, quando em condições favoráveis (temperatura acima de
21oC), evoluir para a doença.
Os picnidiósporos são produzidos em picnídios, os quais se formam em
lesões de frutos e folhas da copa das árvores e em decomposição no solo,
emergindo através de um ostíolo, por uma substância mucilaginosa
(FEICHTENBERGER, 1996). Ao contrário dos ascósporos, estes esporos não
possuem um mecanismo especial para serem disseminados através do ar
atmosférico, mas, quando se desenvolvem sobre folhas ou galhos mortos no
solo, podem ser inoculados em frutos ou folhas aderidos nos galhos inferiores
da copa das árvores, através de respingos da água da chuva. Os
picnidiósporos podem constituir, ainda, uma importante fonte de inóculo
quando presentes em lesões de frutos temporões ou de maturação tardia, que
permanecem na árvore após a floração e início da frutificação, atingindo frutos
mais jovens que estão situados em galhos mais baixos, através da água da
chuva ou orvalho (KOTZÉ, 1981, 1988).
Um outro fator agravante da doença, segundo Rossetti (2001), é as
condições climáticas que provocam a desfolha de planta, desprotegendo-a dos
raios solares que aceleram o ataque do patógeno e o surgimento de sintomas.
Dessa forma, todos os fatores que provocam a queda de folhas favorecem a
disseminação, pois os ascósporos, que se desenvolvem nas folhas caídas,
podem, através do vento, atingir pomares a quilômetros de distância. A autora
descreveu, ainda, que os frutos e as mudas afetadas pela doença são
transportados
de
regiões
contaminadas
para
outras
ainda
indemes,
principalmente em períodos em que as condições de umidade e temperatura
são elevadas e favoráveis. As plantas mais velhas e mais debilitadas são as
mais atingidas.
2.5. Medidas de controle da doença
Diversas medidas de controle da MPC, tecnicamente viáveis, têm sido
propostas, porém, muitas delas são incompatíveis do ponto de vista econômico
1
e ambiental. No Brasil, o controle da doença é baseado em informações
geradas, principalmente, na África do Sul, onde a doença é de importância
relevante (GOES, 2002).
A maioria das medidas tem como alvo a redução do inóculo e, de
acordo com Feichtenberger et al. (1997), abrange as seguintes estratégias:
plantio de mudas sadias produzidas em regiões livres da doença; remoção de
frutos temporões, infectados antes do início florada; controle do mato nas
linhas de plantio com herbicidas pós-emergentes; eliminação de plantas em
estado de depauperamento avançado no pomar; manutenção das plantas em
boas condições de nutrição e sanidade; pulverizações com fungicidas em
intervalos de 28 dias, visando à proteção dos frutos durante o período crítico de
suscetibilidade.
As pulverizações podem ser praticadas isoladamente ou combinadas.
De acordo com Kotzé (1981), a adição de óleo mineral ou vegetal (0,5%)
melhora a eficácia dos fungicidas no controle da doença.
Os
fungicidas
disponíveis
no
mercado
são
os
sistêmicos
(benzimidazóis) ou os de contato, à base de cobre (mancozebe). Schutte et al.
(1997) testaram os fungicidas óxido cúprico e óxido cloreto de cobre e
constataram que, em aplicações repetidas, esses agrotóxicos podem causar
fitotoxidez, provocando o aparecimento de manchas pequenas, arredondadas,
superficiais e de coloração escura nos frutos. Segundo os autores, esses
sintomas foram mais intensos no verão.
Posteriormente, dando continuidade a esses estudos, Schutte et al.
(2003) avaliaram o comportamento de G. citricarpa na presença do fungicida
azoxystrobina em formatação simples e em mistura com mancozebe e óleo
mineral, em diferentes concentrações. O melhor controle foi obtido com a
combinação de azoxystrobina, mancozebe e óleo mineral (0,075 +1,2 + 0,5
vol/vol do G a.i./ litro de água), na qual observaram até 100% de frutos sadios.
No Brasil, ensaios envolvendo o controle químico da doença, também
já foram realizados com sucesso (GOES et al., 2000; GOES, 2002; REIS et al.,
2002). Goes et al. (2000) estudaram a eficiência de fungicidas sistêmicos e
protetivos associados aos diferentes tipos de óleos mineral e vegetal no
controle da MPC em pomares comerciais do Estado de São Paulo. Todos os
tratamentos revelaram-se eficientes para o controle da doença, independentes
1
da época de avaliação. Por outro lado, a testemunha apresentou um alto
percentual de frutos com sintomas, variando de 94%, na primeira avaliação, a
100%, nas avaliações subseqüentes. Em estudos posteriores, Goes (2002)
testou quatro fungicidas, associados ou não a óleo mineral, aplicando-os sob a
forma de pulverização foliar, a cada 28 dias. Dentre os fungicidas testados, o
bernomyl e carbidazim, associados ou não ao óleo mineral, mostraram-se os
mais eficientes na redução do número de lesões nos frutos de tangerina ‘Rio’.
Um comportamento intermediário foi observado em relação aos fungicidas
oxicloreto de cobre, associado ou não ao óleo mineral, e mancozebe, acrescido
de óleo mineral. Em um outro ensaio, o efeito do fungicida oxicloreto de cobre
foi avaliado em diferentes épocas do ano em pomares de laranjas ‘Natal’ e
‘Valência’, com 14 anos de idade (REIS et al., 2002). Os resultados mostraram
que os frutos colhidos tardiamente dessas variedades tendem a expressar
maior quantidade de sintomas, principalmente, quando não pulverizados nos
meses de novembro, dezembro e janeiro.
2.6. O emprego da reação da polimerase em cadeia (PCR) na identificação
de fitopatógenos
De acordo com Shurtleff & Averre III (1997), a identificação dos
agentes causais de doenças de plantas envolve princípios científicos e
tecnológicos, incluindo a biologia molecular, que devem estar associados aos
conhecimentos sobre os hospedeiros e às práticas agrícolas empregadas.
Tradicionalmente, as diversas espécies de patógenos de plantas têm
sido estudadas através de métodos convencionais de diagnóstico, baseados na
sintomatologia da doença, os quais, na sua maioria, são demorados e de difícil
aplicação,
podendo
fornecer,
dependendo
das
condições
ambientais,
resultados imprecisos. Conseqüentemente, nos dias atuais, a agricultura
moderna demanda de métodos mais rápidos e acurados de diagnóstico, de
modo a orientar as tomadas de decisão no controle e manejo das doenças
(DUART, BOA, 2005).
A reação da polimerase em cadeia (PCR), desenvolvida em meados da
década de 80, tem causado uma verdadeira revolução na biologia, tanto na
pesquisa
básica,
visando
o
entendimento
1
de
processos
biológicos
fundamentais, como nas áreas aplicadas, abrindo enormes perspectivas para a
análise de genes, diagnósticos de doenças, detecção de agentes infecciosos
entre
outras
aplicações
(PASSAGLIA,
ZAHA,
1996;
FERREIRA,
GRATTAPAGIA, 1998).
Esta técnica envolve a síntese enzimática “in vitro” de milhões de
cópias de um segmento específico de DNA, como, por exemplo, parte do
genoma de uma bactéria, vírus, fungo ou qualquer outro microrganismo
fitopatogênico. Para isso, utiliza-se uma enzima DNA polimerase, termoestável, e dois oligonucleotídeos de síntese (“primers”) respectivamente
homólogos e complementares à seqüência nucleotídica do organismo em
questão (ALMEIDA, LIMA, 2001).
A
PCR
oferece
várias
vantagens
em
relação
aos
métodos
convencionais de diagnóstico e caracterização de fitopatógenos, entre as quais
se destacam: a não necessidade do isolamento e cultivo do microrganismo
antes de sua detecção por PCR; a alta sensibilidade e segurança, com
potencial teórico para detectar uma única molécula numa mistura complexa,
sem a necessidade de sondas radioativas; além de ser um método rápido e
versátil (HENSON, FRENCH, 1993).
Devido
às
vantagens,
esta
técnica
tem
sido
exaustivamente
empregada no diagnóstico e caracterização de vírus e viróides (HUANG et al.,
2004; LI et al., 2004; UGA et al., 2005; DU et al., 2006), bactérias (NUNES et
al., 2004; BEXTINE , MILLER, 2004; SUN et al., 2004; CUBERO, GRAHAM,
2005) e fungos fitopatogênicos (CHELKOWSKI et al., 1999; GAO et al., 2004,
MATSUDA et al., 2005).
Em relação ao fungo G. citricarpa, a maioria dos trabalhos tem utilizado
a técnica da PCR, geralmente associada à análise de seqüência e outras
técnicas moleculares, com a finalidade de identificar, caracterizar e diferenciar
os isolados desta espécie com os de G. mangifera e outras espécies
relacionadas (MEYER et al., 2001, 2002; BAAYEN et al., 2002; BONANTS et
al., 2003).
Bonants et al. (2003) compararam o método de detecção por PCR para
G citricarpa com os métodos de isolamento do microrganismo em meio de
cultura e incubação de frutos com lesões sob luz contínua por cinco dias,
sendo este último prescrito pela União Européia para diagnósticos de lesões da
1
MPC, sem a formação de picnídios. Os resultados mostraram que a eficácia da
detecção por PCR foi de 60-70% para lesões sem picnídios e de
aproximadamente 90% para lesões com picnídios, revelando-se muito mais
rápido e eficaz do que os métodos de isolamento em cultura e incubação, cuja
eficiência foi de 10% e 40-50%, respectivamente, para lesões sem picnídios.
2.7. Caracterização morfo-fisiológica
A caracterização das estruturas vegetativas e reprodutivas dos
microrganismos, tanto nos seus aspectos morfológicos como fisiológicos,
fornece informações importantes sobre o patógeno, contribuindo para o
esclarecimento da doença.
Para G. citricarpa, que é um patógeno relativamente novo no Brasil, os
estudos dos efeitos das variáveis climáticas e nutricionais sobre as
características morfofisiológicas são de grande utilidade na elaboração de
estratégias visando o estabelecimento de medidas de manejo da doença.
Até o momento, poucos trabalhos foram desenvolvidos envolvendo
estudos que estabelecem a quantificação de variáveis relacionadas aos
aspectos morfofisiológicos de G. citricarpa. Dentre estes trabalhos, destacamse aqueles que analisaram os efeitos da temperatura, dos períodos de
exposição à luz e dos diferentes meios de cultura sobre o crescimento micelial.
Lucon e Aguilar-Vildoso (1996) submeteram isolados de G. citricarpa
em diferentes temperaturas e meios de cultura e verificaram, em um dos
ensaios, que os isolados IAC 04/96, 06/96 e 13/96 incubados à temperatura
ambiente por 15 dias apresentaram melhor crescimento micelial nos meios de
cenoura-ágar e aveia-ágar. Em um outro ensaio, porém, os isolados IAC 04/96
e 06/96 apresentaram maior crescimento nos meios BDA e MA (malte-ágar) a
27oC ± 3oC.
Outros estudos foram desenvolvidos por Timossi et al., (2003), com o
objetivo
de
avaliar
os
efeitos
da
temperatura
e
luminosidade
no
desenvolvimento de G. citricarpa. Os resultados demonstraram que a 27oC,
sob luz contínua, ocorreu maior produção de pseudotécios. No entanto, a maior
porcentagem de ascósporos germinados foi constatada na temperatura de
24oC, após 16 horas de incubação sob luz contínua. Os autores concluíram
1
que houve resposta à influência de temperatura e luminosidade na germinação
dos ascósporos de G. citricarpa.
Schinor et al. (2002) isolaram G. citricarpa, em lesões de folhas de
laranjeira ‘Pêra’ e variedades afins em meio cenoura-ágar-glicose para
contagem de número de colônias por fragmentos de folha. Os autores
constataram que a 25oC, no escuro, o patógeno teve melhor crescimento
micelial.
Devido à escassez de informações relativa ao desenvolvimento da P.
citricarpa “in vitro”, recentemente, Mendes et al. (2005) analisaram o
crescimento micelial, a esporulação e a germinação de conídios de quatro
isolados de G. citricarpa em diferentes meios de cultura, temperatura e
luminosidade. Neste estudo, os meios que proporcionaram maior tamanho de
colônia foram ADA (aveia-dextrose-ágar), V8, CDA (cenoura-dextrose-ágar) e
BDAF (batata-dextrose-ágar + estrato de folhas de laranja), os quais não
diferiram estatisticamente entre si, mas sim em relação ao meio BDA. Quanto a
influência da luminosidade e temperatura, os autores constataram que o maior
crescimento das colônias ocorreu sob fotoperíodos de 12/12 horas e em escuro
contínuo a 24oC ±1oC. Observaram, também, que o maior número de conídios
foi produzido sob luz contínua sendo que o mesmo diferiu estatisticamente do
fotoperíodo 12/12 horas e do escuro contínuo, cuja produção foi praticamente
nula.
1
3. MATERIAL E MÉTODOS
Os ensaios experimentais foram realizados no Laboratório de Proteção
de Plantas e no Laboratório de Biologia Molecular (Núcleo de Pesquisa e
Biotecnologia Aplicada), ambos localizados no Campus da Universidade
Estadual de Maringá-UEM, em Maringá, Estado do Paraná, no período de
janeiro a novembro de 2005.
3.1. Origem dos Isolados de G. citricarpa
Os 18 isolados de G. citricarpa estudados foram obtidos de diferentes
regiões geográficas (Quadro 1). Cinco isolados (PC1, PC3, PCP6, PC12C,
PC13/36) foram fornecidos pelo Laboratório de Fitopatologia da Universidade
Federal do Paraná e são provenientes de pomares de diferentes municípios do
Estado de São Paulo, com exceção do isolado PC3, originário da África do Sul.
Os isolados Esalq1, Esalq2, Esalq3, cedidos por pesquisadores da Escola
Superior de Agronomia Luiz de Queiroz (ESALQ/USP), também são originados
da citricultura paulista. Dos seis isolados (C-38.3.1, C-38.4.3, C-38.5.3, C45.4.2, G-41.2.2, G-60.2.1) cedidos pala FCAL/UNESP - Jaboticabal, os quatro
primeiros são provenientes do Estado do Rio Grande do Sul, o quinto de São
Paulo e o último do Rio de Janeiro. Quatro supostos isolados de G. citricarpa
foram extraídos de frutos sintomáticos de pomares do Estado do Paraná. Os
isolados PR1,PR2, PR3 e PR4 foram extraídos de frutos de tangerina 'Ponkan'
(Figura 1B) e ‘Montenegrina’ (Figura 1C), coletados em pomares localizados no
Município de Cerro Azul, no Vale do Ribeira, da região Sul do Paraná. Para
obtenção da cultura pura de todos os isolados, foram utilizados meio de cultura
BDA.
1
Quadro 1. Isolados utilizados para caracterização, identificação e confirmação
através de análises morfofisiológica e molecular
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
Isolado
Esalq1
Esalq2
Esalq3
PR1
PR2
PR3
PR4
PC1
PC3C
PCP6
PC12C
PC13/36
C-38.3.1
C-38.4.3
C-38.5.3
G-41.2.2
G-45.4.2
C-60.2.1
Origem
Piracicaba/SP
Piracicaba/SP
Piracicaba/SP
Cerro Azul/PR
Cerro Azul/PR
Cerro Azul/PR
Cerro Azul/PR
São Paulo
África do Sul
São Paulo
São Paulo
São Paulo
R. G. do Sul
R. G. do Sul
Conchal/SP
R. G. do Sul
Itaboraí/RJ
Hospedeiro
Laranja ‘Pêra’
Limão ‘Siciliano’
Limão ‘Siciliano’
'Ponkan'
'Montenegrina'
'Ponkan’
'Montenegrina’
Laranja’ Baia’
Laranja’ Baia’
Laranja’ Baia’
Laranja ‘Natal
Laranja ‘Valência’
Laranja ‘Valência’
Instituição
ESALQ
ESALQ
ESALQ
UEM
UEM
UEM
UEM
UFPR
UFPR
UFPR
UFPR
UFPR
UNESP/FCAV
UNESP/FCAV
UNESP/FCAV
UNSSP/FCAV
UNESP/FCAV
UNESP/FCAV
Figura 1. Frutos com sintomas de mancha-preta: (A) Laranja ‘Pêra’, (B)
Tangerina ‘Ponkan’ e (C) Tangerina ‘Montenegrina’.
2
3.2. Isolamento e Manutenção dos Isolados de G. citricarpa
Para o isolamento de G. citricarpa de frutos coletados em pomares
paranaenses, foram utilizados fragmentos de tecidos das bordas das lesões,
abrangendo a zona de transição entre a parte lesionada e a parte sadia. Após a
desinfestação superficial com álcool 70%, por aproximadamente 30 segundos,
e imersão em solução de hipoclorito a 2%, também, durante 30 segundos, os
fragmentos foram lavados com água destilada esterilizada e colocados em
papel absorvente esterilizado para secagem. Os tecidos foram depositados em
placas de Petri, contendo 20mL de meio de cultura BDA e incubados em
câmara climatizada BOD, sob luz fluorescente a 25oC durante 22 dias. Após a
obtenção de cultura pura, os isolados foram mantidos em tubos de ensaio
contendo meio CDA para culturas estoque e armazenados em câmara fria a
uma temperatura de 4oC.
Tanto os isolados paranaenses quanto os cedidos pelas Instituições de
Ensino Superior foram transferidos para meio de cultura BDA (caldo de batata,
dextrose, ágar) em placas de Petri e encubados em estufa climatizada, tipo
BOD, a 25oC, sob luz fluorescente contínua. A cada 20 dias procedeu-se a
transferência dos isolados para novas placas de Petri, contendo o mesmo meio
de cultura e condições de crescimento, de forma a obter colônias novas
(vigorosas).
2
3.3. Caracterização morfológica em diferentes meios culturais, diferentes
temperaturas e fotoperíodos
3.3.1. Avaliação das características culturais
O estudo foi realizado em delineamento experimental inteiramente
casualizado (DIC) para cada isolado separadamente em arranjo fatorial de 3 x
3 x 3 (três meios de cultura, três fotoperíodos e três temperaturas) com cinco
repetições, perfazendo assim 12 análises. Para estes experimentos, cada placa
de Petri foi considerada uma unidade experimental.
Os isolados PC1, PC3, PCP6, PC12C, PC13/36, Esalq1, Esalq2,
Esalq3, PR1, PR2, PR3 e PR4 foram cultivados nos meios de cultivo BDA,
CDA (cenoura, 200g – dextrose, 108g – ágar, 20g/l) e AA (aveia em flocos, 30g
– ágar, 20 g/l) em três fotoperíodos de luz fluorescente: 12/12 horas, luz
contínua e ausência de luz, e três temperaturas: 20, 25 e 30°C constituindo o
arranjo fatorial.
O inóculo de cada isolado foi constituído de cultura com 20 dias de
idade. Discos de micélio foram cortados das bordas das colônias utilizando-se
de um vazador de rolha de 8,0 mm de diâmetro. Em seguida, com o auxílio de
uma alça de ponta-reta, os discos de micélio foram transferidos para placas de
Petri contendo os meios BDA, CDA e AA. As placas de Petri foram incubadas
em câmara climatizada do tipo BOD, em três diferentes fotoperíodos (escuro
contínuo, claro contínuo e alternado 12/12 horas) e em três diferentes
temperaturas (20, 25 e 30oC), durante 24 dias.
Foram avaliadas as seguintes variáveis: crescimento micelial,
coloração, formato e espessura das colônias miceliais, e por último, a
esporulação.
Após 24 dias de incubação, o crescimento micelial foi avaliado, período
em que a colônia do isolado apresentou o maior crescimento, ocupando toda a
superfície do meio de cultivo na placa de Petri. Para obter uma estimativa do
crescimento, mediu-se o diâmetro da colônia em dois sentidos diametralmente
opostos, com o auxílio de uma régua milimetrada. O diâmetro da colônia foi
expresso pela média aritmética dos diâmetros. A partir dos resultados foi obtida
a taxa de crescimento diário de cada isolado em cada condição de meio,
2
temperatura e fotoperíodo e estas foram submetidas à análise de variância ,
utilizando o teste F a 5% de significância para testar as hipóteses dos efeitos
principais e das interações. Efetuou-se a comparação das médias pelo teste de
agrupamento Scott knott a 5% de significância. O desdobramento, bem como
as análises, foram realizadas com o auxílio do programa Sisvar, versão 4.6.
3.3.2. Avaliação formação de estruturas reprodutivas
3.3.2.1. Picnídios
Após a última avaliação do crescimento micelial nos diferentes meios
de cultivo e fotoperíodo, duas placas de Petri de cada tratamento foram
selecionadas para a avaliação da produção de picnídios. Foram selecionadas
as placas de Petri que apresentaram maior uniformidade da colônia quanto à
simetria diametral e formação de setores.
Em cada placa de Petri, foram adicionados 6,0 mL de água destilada
esterilizada. Em seguida, raspou-se suavemente a superfície do meio de cultivo
manualmente para liberação dos picnídios. A suspensão obtida (picnídios +
hifas) foi transferida para um tubo de ensaio e agitada em vortex por
aproximadamente 1 minuto, para uniformizar a distribuição dos picnídios na
suspensão.
Em seguida, com o auxilio de uma pipeta graduada, transferiu-se uma
alíquota de 0,2 mL de suspensão para uma lâmina de microscopia, cobriu-se
com lamínula e procedeu-se a contagem dos picnídios ao microscópio óptico.
3.3.2.2. Conídios
O restante da suspensão usada para a quantificação de picnídios foi
reutilizado para a quantificação de conídios. Para isso, a suspensão de
picnídios foi novamente agitada no vortex por aproximadamente 1 minuto, para
2
a total liberação dos conídios. Em seguida, a suspensão foi filtrada em camada
dupla de gaze para retenção de micélio e picnídios. Com o auxílio de uma
pipeta graduada, uma alíquota de 0,2 mL da suspensão filtrada foi transferida
para Câmara de Neubauer e procedeu-se a contagem dos conídios.
3.4. A reação da polimerase em cadeia com isolados de G. citricarpa
3.4.1. Extração do DNA
Para a identificação molecular de G. citricarpa, o DNA genômico dos 18
isolados foi extraído com base na metodologia de Koenig et al. (1997).
Inicialmente, os isolados foram cultivados em meio sólido de cenoura-dextroseágar-CDA (200g de cenoura, 108g de dextrose, 20g de ágar para cada litro),
por 24 dias, a uma temperatura de 25oC, em incubadora climatizada do tipo
BOD, sob luz constante, para a produção de micélio. A massa micelial foi
separada do meio de cultura com o auxílio de uma espátula e transferida para
uma gaze esterilizada, adaptada a um funil, e foi lavada com água Milli-Q por
duas vezes. Em seguida, o micélio foi macerado em nitrogênio líquido, em um
gral com pistilo, até obter um pó fino. O material foi transferido para microtubos
de 1,5 mL, nos quais foram adicionado tampão de extração na proporção de
700 μl para aproximadamente 300 mg de micélio macerado. O tampão de
extração constituiu-se de uma mistura de tampão de lise nuclear (0,3 M de
sorbitol, 0,1 M de Tris HCl pH 7,5; 20mM de EDTA) e tampão de isolamento de
DNA
(0,2M
de
Tris-HCl,
pH
7,5;
50mM
de
EDTA
e
0,2mM
de
cetyltrimethylammonio bromil) e sarkosyl 50%, na proporção 1:1:0,4. Após a
homogenização em vortex por aproximadamente 30 segundos, as amostras
foram mantidas em banho-maria a 65oC, por 30 minutos. Em seguida, foram
adicionados 500 μl de acetato de potássio e a mistura para ser incubada em
gelo por 30 minutos, agitando-se os microtubos levemente a cada 5 minutos.
Após centrifugação por 10 minutos a 12000rpm, foram recolhidos 700 μl do
sobrenadante e transferidos para novos microtubos. A extração com solventes
orgânicos foi realizada adicionando-se 700 μl de clorofórmio e álcool isoamílico
na
proporção
24:1,
agitando-se
suavemente
2
os
microtubos
por
aproximadamente 20 vezes. Após centrifugação das amostras a 12000rpm por
10 minutos, o sobrenadante foi transferido para microtubos novos e o DNA foi
precipitado com dois volumes de etanol 100%, sendo a solução mantida a –
20oC “over night” e, no dia seguinte, centrifugada a 12000rpm por 10 minutos.
Após verter o etanol, o “pellet” foi lavado por duas vezes com 700 μl de etanol
70%, sendo cada etapa acompanhada de centrifugação, como no passo
anterior. Para facilitar a secagem do “pellet”, foram adicionados 500 μl de
etanol 100%, seguido de centrifugação durante 5 minutos a 12000rpm. Após a
centrifugação, o líquido foi vertido e os microtubos foram colocados sobre papel
absorvente, com a abertura para baixo, durante 10 minutos para a secagem. A
precipitação do DNA foi feita adicionando-se 50 μl de TE-RNAse (Tris-Cl
100mM, pH 7,5; EDTA 10mM; RNAse 20mg/mL) e incubando os microtúbulos
em banho-maria a 37oC por 60 minutos. A quantidade do DNA das amostras foi
estimada através de eletroforese em gel de agarose (0,8%), corado com
brometo de etídio, utilizando-se, para comparação, marcadores de DNA de λ.
Os DNAs das amostras foram estocados a – 20oC.
3.4.2. Reação da polimerase em cadeia (PCR)
Para a identificação dos isolados em nível específico através de PCR,
foram
utilizados
os
oligonucleotídeos
AAGTGTGAGTGTCGAAGGTGG
3´
“primers”
e
GCP1
GCP2
(OP8)
(OP9)
5´
5´
GACGACTCGCTTTTCTACGGC 3´, produzidos a partir de uma banda de
RAPD de 373pb, presente apenas em isolados patogênicos de G. citricarpa
(BLANCO, 1999; AZEVEDO, 2000). A PCR foi preparada em um volume de 25
μl contendo: tampão 10X (200mM de Tris – HCl, pH 8,4; 500mM de KCl),
50mM de MgCl2; 10mM de DNTPs; 10mM de cada ‘primer’; 2,5 unidades de
Taq DNA polimerase e, aproximadamente, 200ng de DNA. As reações de
amplificação foram conduzidas em um termociclador Eppendorf. A PCR foi
efetuada em 36 ciclos, sendo: 1 minuto a 94oC; 1 minuto a 67oC e 1 minuto a
72oC. As amostras foram colocadas a temperatura de 94oC por 1 minuto, antes
de iniciar os ciclos e a uma extensão excedente de 5 minutos a 72oC, após os
36 ciclos. Os produtos da PCR foram submetidos à eletroforese em gel de
2
agarose (1,4%), corado com brometo de etídio, a 90 volts. A visualização e
documentação do gel foram realizadas sob luz UV em equipamento de
fotodocumentação (UVPGDS – 8000 System).
2
4. RESULTADOS E DISCUSSÃO
4.1. Avaliação do crescimento micelial
A análise dos resultados de crescimento micelial mostrou que, para
cada isolado, pelo teste F a 5% de significância, houve interação de segunda
ordem (interação tripla) significativa. Estas interações, meios de cultura x
temperaturas x fotoperíodos foram desdobradas para cada isolado (meio de
cultura dentro de cada nível de fotoperíodo e temperatura, fotoperíodo dentro
de cada nível de meio de cultura e temperatura, e, temperatura dentro de cada
nível de meio de cultura e fotoperíodo). As condições que favoreceram ou
desfavoreceram o crescimento micelial dos diferentes isolados foram
capturadas
nos
quadros
de
desdobramento.
Estas
condições
estão
representadas nos três quadros de cada um dos isolados (Apêndice).
Para os isolados Esalq1 e Esalq2, as condições que mais favoreceram
o crescimento micelial foram observadas no meio CDA, no fotoperíodo
alternado e na temperatura de 25ºC e nos fotoperíodos claro e escuro nas
temperaturas de 20 e 25ºC (Quadro 2). Nestas condições, as médias de
crescimento micelial para o isolado Esalq1 foram de 0,3190, 0,3374, 0,3308,
0,3350, 0,3190 cm/dia, respectivamente, e para o isolado Esalq2 de 0,3597,
0,3500, 0,3394, 0,3408 e 0,3638 cm/dia, não diferindo estatisticamente a 5%
de significância pelo teste Scott-Knott (Apêndice 1 e 2). Contrariamente, as
menores médias de crescimento para o isolado Esalq1 foram observadas no
meio BDA, fotoperíodo alternado, claro e escuro, na temperatura de 30ºC, e no
meio AA, no fotoperíodo escuro a 20ºC, onde as médias de crescimento foram
de 0,1432, 0,1442, 0,1308 e 0,1644 cm/dia. Para o isolado Esalq2, estas
condições de menor crescimento foram observadas também no meio BDA, nos
fotoperíodos alternado e claro, a 30ºC, e no meio CDA, no fotoperíodo
alternado, a 30ºC, onde as médias foram 0,1072, 0,1192 e 0,1238 cm/dia,
respectivamente.
2
As condições de melhor crescimento micelial para o isolado Esalq3
foram as mesmas daquelas observadas para os isolados Esalq1 e Esalq2,
acrescidas do meio AA, fotoperíodo alternado, a temperatura de 25ºC. As
piores condições de crescimento para este isolado foram observadas no meio
BDA, fotoperíodo alternado, claro e escuro, a temperatura de 30ºC (0,1328,
0,1212 e 0,1440 cm/dia, respectivamente) (Apêndice 3).
Os isolados PR1 e PR2 apresentaram as melhores condições de
crescimento no meio CDA no fotoperíodo alternado na temperatura de 25ºC
(0,3232 e 0,3290 cm/dia) e nos fotoperíodos claro nas temperaturas de 20ºC
(0,3114 e 0,3272 cm/dia) e 25ºC (0,2994 e 0,3086 cm/dia) e no fotoperíodo
escuro também nas temperaturas de 20 (0,3384 e 0,3282 cm/dia) e 25ºC
(0,3232 e 0,3288 cm/dia). Para o isolado PR1, são adicionadas ainda como
melhores condições de crescimento: meio CDA, fotoperíodo alternado, a 20ºC
(0,3112 cm/dia); meio AA, fotoperíodo alternado, a 20ºC (0,2918 cm/dia) e
25ºC (0,3104 cm/dia) e fotoperíodo claro, a 25ºC (0,2924 cm/dia). Os isolados
obtiveram menor crescimento no meio BDA, na temperatura de 30ºC, nos três
fotoperíodos testados, e no meio CDA, fotoperíodo alternado, a 30ºC para o
isolado PR2 (Apêndice 4 e 5).
Para o isolado PR3, as condições que mais favoreceram o crescimento
micelial foram observadas no meio CDA, fotoperíodo alternado e claro, nas
temperaturas de 20 e 25ºC, e no fotoperíodo escuro, a 25ºC. No meio AA, o
melhor crescimento ocorreu no fotoperíodo claro, na temperatura de 25 e 30ºC.
Já a condição que mais desfavoreceu o crescimento deste isolado foi
observada no meio BDA, fotoperíodo escuro, na temperatura de 30ºC, cuja
média de crescimento foi de 0,087 cm/dia (Apêndice 6).
O meio CDA, no fotoperíodo alternado, na temperatura de 20ºC e
fotoperíodo claro, à temperatura de 20 e 25ºC, foram as melhores condições de
crescimento para o isolado PR4. As condições de menor crescimento para este
isolado foram constatadas no meio BDA, na temperatura de 30ºC, nos três
fotoperíodos avaliados, e no meio CDA, fotoperíodo alternado, também na
temperatura de 30ºC (Apêndice 7).
O isolado PC1 apresentou maior número de condições favoráveis para
o crescimento micelial, apresentando menor crescimento apenas no meio BDA,
fotoperíodo escuro, a 30ºC (0,1492 cm/dia). As melhores condições foram
2
observadas no meio CDA, fotoperíodo alternado e claro, nas três temperaturas,
e no fotoperíodo escuro, na temperatura de 25ºC, onde o crescimento micelial
atingiu todo o diâmetro da placa de Petri, ou seja, 0,3750 cm/dia, bem como no
meio AA, fotoperíodo alternado, na temperatura de 25 e 30ºC, e fotoperíodo
claro, nas três temperaturas (Apêndice 8).
Diferentemente do isolado PC1, o isolado PC3 apresentou o maior
número de condições desfavoráveis para o seu crescimento micelial. Estas
condições foram observadas no meio BDA, fotoperíodo claro, nas três
temperaturas testadas, no fotoperíodo escuro, a 30ºC, e no meio CDA, na
temperatura de 30ºC, nos três fotoperíodos avaliados. Este isolado obteve
melhor crescimento no meio AA, fotoperíodo alternado, a 30ºC (0,3290 cm/dia),
fotoperíodo escuro a 25ºC (0,2916 cm/dia), e no meio CDA, fotoperíodo
alternado, a 20ºC (0,3520 cm/dia) (Apêndice 9).
As condições que mais favoreceram o crescimento micelial do isolado
PC12C puderam ser observadas no meio CDA, fotoperíodo alternado, nas
temperaturas de 20 e 25ºC, com crescimento de 0,3384 cm/dia em ambas as
condições, no fotoperíodo claro, na temperatura de 25ºC, e no fotoperíodo
escuro, também a 25ºC. Esta condição também se repetiu no meio AA,
fotoperíodo escuro, na temperatura de 25ºC, onde o isolado apresentou
crescimento de 0,3150 cm/dia. A condição que mais desfavoreceu o
crescimento micelial foi observada no meio CDA, fotoperíodo escuro, e no meio
BDA, fotoperíodo claro, na temperatura de 30ºC, com crescimento de 0,0486 e
0,0786 cm/dia, respectivamente (Apêndice 10).
Duas condições de crescimento se destacaram para o isolado
PC13/36: meio AA, fotoperíodo alternado, na temperatura de 30ºC, cujo
crescimento foi de 0,3394 cm/dia, e no meio CDA, fotoperíodo claro, na
temperatura de 25ºC, com média de 0,3186 cm/dia. Contrapondo-se, as
condições que menos favoreceram o crescimento micelial foram constatadas
no meio BDA, fotoperíodo alternado, na temperatura de 20ºC (0,1364 cm/dia),
fotoperíodo claro, na temperatura de 20ºC (0,1406 cm/dia) e 25ºC (0,1178
cm/dia), fotoperíodo escuro, na temperatura de 30ºC (0,1078 cm/dia) e no meio
CDA, fotoperíodo claro, na temperatura de 30ºC (0,0954 cm/dia) (Apêndice 11).
Para o isolado PCP6, o meio AA, fotoperíodo claro, nas temperaturas
testadas, e o meio CDA, fotoperíodo claro, nas temperaturas de 20 e 25ºC e
2
fotoperíodo escuro, na temperatura de 20ºC, foram as melhores condições
para o crescimento micelial. O menor crescimento foi verificado no meio BDA,
na temperatura de 30ºC, nos três fotoperíodos avaliados (Apêndice 12).
Após o desdobramento das interações foi revelado o melhor meio de
cultivo e as melhores condições de fotoperíodo e temperatura para o
crescimento micelial de cada isolado. Todos os valores apresentados diferiram
estatisticamente das demais condições avaliadas. Um resumo das melhores
condições de meio, fotoperíodo e temperatura encontra-se descritas no quadro
1. Como pode-se observar neste quadro, independente do isolado, as melhores
condições de crescimento micelial foram no meio CDA, no fotoperíodo claro, na
temperatura de 25ºC. Por outro lado, as condições mais desfavoráveis ao
crescimento do patógeno foram o meio BDA, fotoperíodo escuro, na
temperatura de 30ºC.
Os resultados do presente estudo estão de acordo com aqueles
observados por Mendes et al. (2005), que também testaram os meios BDA,
CDA e AA e verificaram que o maior crescimento micelial ocorreu nos meios
CDA e AA. De acordo com os autores, o meio que mais se destacou foi o CDA
para todos os isolados, nas diferentes temperaturas e fotoperíodos, porém, o
meio BDA foi o menos estimulante ao crescimento micelial.
Lucon e Aguilar-Vildoso (1996) também estudaram meios de cultivo e
temperaturas mais adequadas para o crescimento micelial de G. citricarpa.
Esses autores observaram que os meios de cultura BDA e MA (malte-ágar)
apresentaram maior crescimento micelial para dois isolados testados e um
outro isolado apresentou menor crescimento em todos os tratamentos. Em
relação ao meio de cultura BDA, os resultados apresentados por estes autores
diferiram dos resultados obtidos no presente estudo, uma vez que o BDA foi o
meio que proporcionou menor crescimento micelial.
González et al. (2003) observaram que os meios de cultura mais
eficientes para o crescimento micelial desse patógeno foram os meios CDA,
BDA + estrato de levedura e BDA + estrato de folhas de laranja ‘Pêra’.
A variação da eficiência dos meios de cultura utilizados nesse tipo de
estudo deve-se, provavelmente, à concentração de dextrose utilizada no
preparo destes meios. No presente estudo, a quantidade dessa substância foi
3
de 108g/litro. A literatura mostra que esta concentração tem variado de um
estudo para outro.
Em relação à caracterização do formato das colônias, não foram
observadas diferenças nas suas conformações dentro de cada meio de cultura.
Colônias crescidas em meio CDA se caracterizaram por apresentar uma
delgada película de micélio, de cor preta, com crescimento radial regular ou
com formação de setores sobre a superfície do meio (Figura 2).
No meio de cultura BDA, observou-se um crescimento micelial espesso
sobre o meio, formando saliências (ondulações). A cor presente durante todo o
período observado foi preta, com as bordas tendendo para cinza escuro (Figura
2).
No meio AA, os micélios cresceram imersos no meio de cultura,
formando uma estrutura compacta, de cor cinza escura, tendendo para a cor
preta. Aqui, também as colônias cresceram no sentido radial, com exceção dos
isolados PC3 e PCP6, que, neste meio, apresentaram um padrão diferente dos
demais. Suas colônias desenvolveram micélios em setores irregulares (em
forma de renda), também imersos no meio de cultura. Essas formações de
colônias não estão de acordo com as descritas por Baayen et al. (2002). Neste
meio de cultura, os autores observaram a formação de pigmentos amarelos em
volta das colônias, com micélios centrais, na cor cinza ou verde oliva. Esses
pigmentos não foram observados no meio AA no presente estudo.
3
Quadro 2. Resumo das melhores condições de meio de cultura, fotoperíodo e temperatura para os isolados de G. citricarpa
originados de diferentes regiões.
Isolado
Esalq1
Esalq2
Esalq3
PR1
PR2
PR3
PR4
PC1
PC3C
PC12C
PC13/36
PCP6
Alternado
203 25 30
AA1
Claro
20 25 30
+
+
+
2
+
+
+
+
+
Escuro
20 25 30
-
Alternado
20 25 30
-
BDA
Claro
20 25 30
-
+
+
+
+
-
+
+
+
-
+
+
+
-
-
-
-
1
Escuro
20 25 30
-
Meio de cultura (AA- aveia-ágar; BDA- batata-dextrose-ágar; CDA- cenoura-dextrose-ágar );
Fotoperíodos;
3
Temperatura em graus Celsius.
(-) – Pior condição para o crescimento micelial para o isolado;
(+) – Melhor condição para o crescimento micelial para o isolado.
2
32
Alternado
20 25 30
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
20
+
+
+
+
+
+
+
+
+
CDA
Claro
25 30
+
+
+
+
+
+
+
+
+
+
+
+
Escuro
20 25 30
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-
Figura 2. Padrões de crescimento micelial apresentado pelos isolados PR1,
PR3, PC12C, Esalq3, PR2, PR4, PCP6, Esalq1 e Esalq2, nos meios
de cultivo AA (aveia-ágar), BDA (batata-dextrose-ágar) e CDA
(cenoura-dextrose-ágar).
33
4.2. Avaliação da esporulação
4.2.1 Formação de estruturas reprodutivas
Em relação à formação de estruturas reprodutivas, tipo conídios, o
maior destaque foi para o meio BDA. Para este, a maior produção de conídios
ocorreu no fotoperíodo alternado, na temperatura de 25ºC. Sob esta condição,
todos os isolados esporularam abundantemente, com exceção do isolado PC1,
no qual a formação de conídios foi muito baixa (Quadro 3). Nestas condições,
na temperatura de 20ºC, todos os isolados apresentaram esporulação; no
entanto, para os isolados Esalq1, Esalq3, PR1, PR2, PC1 e PC13/36 a
produção de esporos foi rara. Na temperatura de 30ºC, no fotoperíodo
alternado, os isolados PR3, PR4 e PC12C tiveram baixa formação de esporos
e os demais produziram apenas picnídios vazios, com exceção do isolado
PCP6, que produziu somente hifas.
Também para o meio de cultivo BDA, fotoperíodo claro, na temperatura
de 25ºC, a maioria dos isolados produziu esporos raros, com exceção dos
isolados Esalq1, PC1 e PCP6 que produziram apenas picnídios (Quadro 1).
Neste fotoperíodo, na temperatura de 30ºC, também foi menos estimulante à
produção de conídios, em relação às temperaturas de 25 e 20ºC, sendo que à
temperatura de 20ºC, metade dos isolados produziram esporos raros e a outra
metade apenas picnídios. Já na temperatura de 30ºC, apenas três isolados
produziram esporos raros (PR2, PC13/36, PCP6) e os demais produziram
somente picnídios vazios.
Ainda para o meio BDA, sob o fotoperíodo escuro, entre as três
temperaturas, a de 25ºC foi a que mais favoreceu a produção de conídios, com
quatro isolados esporulando abundantemente (PR3, PC3C, PC12C, PC13/36).
Sob 30ºC, nenhum isolado produziu picnídios, ocorrendo apenas a formação
de hifas. Na temperatura de 20ºC, com exceção do isolado PC1 que produziu
apenas hifas, os demais produziram esporos raros.
Para o meio de cultura aveia-ágar (AA), na condição de fotoperíodo
alternado e temperatura de 25ºC, semelhantemente ao ocorrido para o meio
BDA, todos os isolados esporularam abundantemente, a exceção dos isolados
PC1 e PC13/36 que produziram esporos raros. À 20ºC, também todos os
34
isolados esporularam, no entanto, raramente, a exceção do isolado Esalq1 que
produziu apenas hifas. Ainda neste fotoperíodo, na temperatura de 30ºC, cinco
dos doze isolados produziram picnídios (Esalq3, PR1, PR2, PR3 e PC1), os
demais, apenas hifas. Também no meio de cultura aveia-ágar e sob luz
contínua, entre as três temperaturas, a de 25ºC foi a melhor, pois houve
produção de conídios raros para sete isolados (Esalq2, Esalq3, PR1, PR2,
PR3, PR4 e PC3C). Já nas temperaturas de 20 e 30ºC, os isolados produziram
apenas hifas e picnídios. Para o fotoperíodo escuro e na temperatura de 20ºC,
todos os isolados produziram conídios raros, a exceção dos isolados Esalq2 e
PC1. Para esse fotoperíodo, na condição de 25ºC, apenas quatro dos doze
isolados (PR1, PR3, PR4, PC12C) produziram conídios raros e os demais,
hifas e picnídios. Na condição de 30ºC, apenas três dos doze isolados
produziram conídios raros e para os demais, hifas e picnídios.
Ao contrário do que aconteceu para os meios de cultura BDA e AA nos
diferentes fotoperíodos e temperaturas, onde foi observada produção de
conídios abundantes ou raros, para o meio CDA, não ocorreu a formação
destas estruturas reprodutivas. Contudo, no meio CDA, foi observada a
produção de picnídios para todos os isolados nos diferentes fotoperíodos e
temperaturas, a exceção do fotoperíodo escuro na temperatura de 25ºC, no
qual os isolados PC1, PC3C, PC12C, PC13/36 e PCP6 formaram apenas hifas.
Neste mesmo fotoperíodo, esta situação se repetiu para a temperatura de 20ºC
(isolados PC1, PC3C, PC13/36 e PCP6) e de 30ºC (isolados PC1, PC12C,
PCP6). A formação apenas de hifas também foi constatada na temperatura de
30ºC, no fotoperíodo alternado para o isolado PCP6 e no fotoperíodo claro para
o isolado PC13/36.
Em relação à esporulação, Mendes et al. (2005) constataram que para
alguns dos isolados avaliados, a temperatura ótima para a esporulação em
meio CDA, situou-se em torno de 25ºC, enquanto que para outros isolados, a
temperatura ótima para esporulação situou-se entre 15 a 20ºC.
Os resultados do presente estudo mostraram que nenhum dos 12
isolados estudados apresentou qualquer esporulação em meio CDA, mesmo
com temperaturas variando de 20 a 30ºC. A esporulação foi observada nos
meios AA e BDA.
35
Mendes et al. (2005) constataram ainda que, no meio CDA, a maior
esporulação ocorreu sob o fotoperíodo claro e que uma esporulação
intermediária e rara ocorreu sob condições de fotoperíodo alternado e escuro,
respectivamente. No entanto, neste estudo, todos os 12 isolados avaliados
esporularam, sendo que, para 10 desses isolados, nas condições de
fotoperíodo alternado, nos meios de cultivo AA e BDA, a esporulação foi mais
abundante.
Segundo
Dhingra
e
Sinclair
(1995),
o
meio
de
cultura
é
reconhecidamente um determinante de crescimento e esporulação, sendo
ainda que, um meio que favoreça a esporulação, não necessariamente
favorecerá o crescimento micelial. Os resultados obtidos neste estudo,
envolvendo crescimento micelial e esporulação, confirmaram essa assertiva.
Isolados tais como Esalq1, Esalq2, PR2, PR4 e PC12C, apresentaram os
maiores valores de crescimento micelial no meio CDA e esporulação nos meios
BDA e AA. Os maiores valores dessas variáveis foram constatados no
fotoperíodo alternado em ambos os meios de cultivo. Porém, para os isolados
Esalq3 e PR1, o meio BDA, fotoperíodo alternado e temperatura de 25ºC,
favoreceu a esporulação e o crescimento micelial. Comportamento semelhante
ocorreu para o isolado PR3, onde as condições que favoreceram o crescimento
micelial, ou seja, no meio AA, fotoperíodo claro, temperatura de 25ºC, também
favoreceram a esporulação.
Fato contrário ocorreu com outros isolados. O isolado PC3C
apresentou os menores valores de crescimento micelial no meio BDA,
fotoperíodo claro, na temperatura de 20 e 25ºC, mas foi observada a produção
de conídios. Da mesma forma, no meio BDA no fotoperíodo alternado e claro,
nas temperaturas 20 e 25ºC, respectivamente, não foi favorável ao crescimento
micelial para o isolado PC13/36, mas foi constatada a produção de conídios. A
esporulação para o isolado PCP6 também foi observada no meio BDA,
fotoperíodo claro, na temperatura 30ºC, condição esta, desfavorável ao
crescimento micelial.
36
Quadro 3 (A, B e C).
Formação de estruturas
reprodutivas assexuadas por isolados de Guignardia
citricarpa sob diferentes condições de cultivo
(A)
Isolado
Esalq1
Esalq2
Esalq3
PR1
PR2
PR3
PR4
PC1
PC3C
PC12C
PC13/36
PCP6
20
R
1,08
R
R
R
3,32
2,36
R
2,32
0,91
R
1,59
Alternado
25
30
2,18
63P
2,04
45P
1,89
72P
1,50
50P
1,80
60P
2,40
R
2,04
R
R
105P
1,60
57P
2,42
R
1,60 50,5P
2,37
H
20
7P
R
R
10P
R
10P
R
13,5P
R
R
12,5P
15,5P
BDA
Claro
25
26,5P
R
R
R
R
R
R
78,5P
R
R
R
54P
30
13,5P
27P
30P
39P
R
31P
36,5P
42P
68P
11,5P
R
R
20
R
R
R
R
R
R
R
H
R
R
R
R
Escuro
25
23P
R
R
R
R
2,33
R
103,5P
2,09
1,32
1,85
R
30
H
H
H
H
H
H
H
H
H
H
H
H
Escuro
25
78P
52P
111P
41P
69P
70P
60P
H
H
H
H
H
30
19P
9,5P
9,5P
30,5P
50P
38P
19P
H
3P
H
7P
H
(B)
Isolado
Esalq1
Esalq2
Esalq3
PR1
PR2
PR3
PR4
PC1
PC3C
PC12C
PC13/36
PCP6
30
11P
30P
44P
31,5P
42,5P
48,5P
33,5P
12,5P
3P
65P
12P
H
CDA
Claro
20
25
32P
42P
41P
52P
80P
38P
23P 51,5P
15,5P 42P
103P
34P
81P 24,5P
18P
6P
9,5P 16,5P
103P
5P
79P
11P
24,5P 43,5P
30
2P
7P
2P
3,5P
9,5P
18,5P
4P
38P
14,5P
6P
H
12P
20
16P
25,5P
23,5P
25,5P
32P
66P
52P
H
H
12P
H
H
Alternado
25
30
2,16
H
2,48
H
2,13
2,5P
2,22
2P
1,78
5,5P
2,38
5P
2,17
H
R
14,5P
1,74
H
2,37
H
R
H
2,32
H
AA
Claro
25
3P
R
R
R
R
R
R
H
R
H
H
H
30
H
H
2P
3P
3P
H
6,5P
15,5P
H
H
H
H
20
R
H
R
R
R
R
R
H
R
R
R
R
Alternado
20
25
110P
49P
101,5P 59P
115P
30P
53,5P
58P
116P
38P
78P
50P
46P
60,5P
72P
102P
105P
25P
64P
64,5P
50P
41P
160P
83P
(C)
Isolado
Esalq1
Esalq2
Esalq3
PR1
PR2
PR3
PR4
PC1
PC3C
PC12C
PC13/36
PCP6
20
H
R
R
R
R
R
R
R
R
R
R
R
20
H
H
H
2P
6,5P
H
H
H
H
4P
H
15,5P
Escuro
25
30
3,5P
H
H
H
H
H
R
11P
8P
9P
R
H
R
H
H
H
H
R
R
H
H
R
H
R
Resultados: Média da mensuração de duas placas-de-Petri; (H) hifas; (R) conídios
raros; números - referem-se a produção de conídios x 107, e quando seguido de letra
refere-se a produção de picnídios.
37
4.3. Identificação por PCR dos isolados em nível especifico
A Figura 3 mostra o perfil eletroforético dos produtos amplificados por
PCR das amostras dos 18 isolados, utilizados no presente estudo. Com
exceção do isolado PC1 (coluna 8), todas as demais amostras revelaram a
presença de um fragmento de aproximadamente 373 pb, correspondente ao
peso molecular de uma banda de RAPD, específica para isolados patogênicos
da espécie G. citricarpa, através da qual foram produzidos os “primers”
GCP1(OP8) e GCP2(OP9) (BLANCO, 1999; AZEVEDO et al., 2000).
Figura 3. Produto de amplificação de 373 pb do DNA de G. citricarpa
referentes aos 18 isolados estudados: M: Marcador; + Controle
positivo; - Controle negativo; 1. Esalq1; 2. Esalq2; 3. Esalq3; 4. PR1;
5. PR2; 6. PR3; 7. PR4; 8. PC1; 9. PC3C; 10. PCP6; 11. PC12C; 12.
PC13/36; 13. C-38.3.1; 14. C-38.4.3; 15. C-38.5.3; 16. G-41.2.2; 17.
G-45.4.2; 18. C-60.2.1.
Este resultado comprovou que os isolados extraídos de lesões de
frutos sintomáticos coletados em pomares das regiões Sul (FRPO, FRTA) e
Noroeste do Estado do Paraná (PR3 e PR4) pertencem à forma patogênica da
espécie G. citricarpa, como anteriormente descrito por Nunes et al. (no prelo).
38
A
análise
morfofisiológica
também
demonstrou
uma
grande
semelhança nos comportamentos destes isolados com aqueles dos demais
isolados de G. citricarpa, cedidos pelas instituições de ensino superior.
O isolado PC1, não identificado como G. citricarpa pela análise
molecular,
apresentou
um
comportamento
anômalo
na
caracterização
morfológica, evidenciado, principalmente, pela velocidade do crescimento
micelial na maioria dos meios de cultura e, também, pela baixa esporulação.
Trata-se,
provavelmente,
de
uma
outra
espécie
de
erroneamente junto com os outros isolados de G. citricarpa.
39
fungo,
enviada
5. CONCLUSÕES
De modo geral, verificou-se que houve resposta a influência da
temperatura, fotoperíodo e meio de cultura no crescimento micelial e produção
de estruturas reprodutivas e vegetativas para os diferentes isolados,
concluindo-se que:
- As melhores condições para o crescimento micelial foram o meio CDA,
fotoperíodo claro, na temperatura de 25ºC;
- Para a maioria dos isolados, a esporulação ocorreu a 25ºC nos meios BDA e
AA, no fotoperíodo alternado;
- O meio CDA não proporcionou esporulação para nenhum isolado nas
condições estudadas, ocorrendo apenas formação de picnídios e hifas;
- Os isolados PR1, PR2, PR3 e PR4, obtidos de material com sintomas de
mancha preta dos citros (MPC), de pomares do Estado do Paraná, foram
confirmados ser de Guignardia citricarpa, por PCR, através da amplificação do
fragmento de 373 pb, e pela análise morfofisiológica.
40
6. REFERÊNCIAS
AGUILAR-VILDOSO, C. I.; RIBEIRO, J. G. B.; FEICHTENBERGER, E.; GOES,
A.; SPÓSITO, M.B. Manual Técnico de Procedimentos da Mancha Preta dos
Citros. Brasília. MAPA/DAS/DDIV. 2002.
ALMEIDA, A. M.R.; LIMA, J.A.A. Princípios e Técnicas de Diagnose Aplicados
em Fitovirologia. Embrapa. p.125-140, 2001.
AMITH, J.L. A Study of the effect of various disease control programs on spore
releases of the citrus black spot pathogen Guignardia citricarpa. In:
INTERNATIONAL CITRUS CONGRESS, 8., Sun City, 1996. Anais. Sun City:
ISC, 1996. P.351-352.
AZEVEDO, J.L.; GUIENKE-BLANCO, C.; MACCHERONI Jr. W. “Processo de
isolamento e purificação do fungo Guignardia citricarpa; Processo de extração
de DNA genômico do fungo Guignardia citricarpa; Processo de estocagem do
fungo Guignardia citricarpa; Processo de obtenção de oligonucleotídeos
indicadores (Primers) específicos para a detecção de linhagens patogênicas de
Guignardia citricarpa causadora da mancha preta dos citros (MPC);
Oligonucleotídeos indicadores (Primers) obtidos de acordo com Kit para
diagnóstico molecular de linhagens patogênicas de Guignardia citricarpa
causadora da mancha preta dos citros (MPC). INPI PI0006501-3.2, 2000.
BAAYEN, R.P.; BONANTS, P.J.M.; VERKLEY, G.; CARROLL, G.C.; VAM DER
Aa.; DE WEERDT, M.; VAN BROUWERSHAVEN, I.R.; SCHUTTE, G.C.;
MACCHERONI JR, W.; GLIENKE DE BLACO, C.; AZEVEDO, J.L.
Nopathogenic isolates of the citrus black spot fungus, Guignardia citricarpa
identified as a cosmopolitan endophyte of wood plants, G. mangiferae
(Phyllosticta capitalensis). Phytopathology, v.92, n.5, p.464-477, 2002.
BALDASSARI, R.B. Influência de frutos sintomáticos de uma safra na
incidência da Guignardia citricarpa na safra subseqüente e período de
suscetibilidade de frutos de laranjeiras ‘Natal’ e ‘Valência’. 2001, 60p.
Dissertação (Mestrado Agronomia) – Faculdade de Ciências Agrárias e
Veterinárias, Universidade Estadual Paulista, Jaboticabal.
41
BEETON, K.V.; SCHUTTE, G.C.;VISSER, A.A. Guignardia citricarpa Kiely, the
cause of petiole infection attended with defoliation od lemons. In: CONGRESSO
INTERNACIONAL SOC. CITRICULTURE, 8. Sun City, 1996. Programme and
abstractes. p.116 (Abstract P117).
BEXTINE, B. R.; MILLER, T. A. Comparison of whole-tissue and xylem fluid
collection techniques to detect Xylella fastidiosa in grapevine and oleander.
Plant Disease, v.88, p.600-604, 2004.
BLANCO, C. “Guignardia citricarpa Kiely: Análise genética cariotípica e
interação com o hospedeiro”. 1999, 200p. Tese (doutorado) Universidade de
São Paulo.
BONANTES, P.J.M.; CARROLL, G.C.; WEERDT, M.; BROUWERSHAVEN,
I.R.; BAAYEN, R.P. Development and validation of a fast PCR-based detection
method for parhogenic isolats of the citrus black spot fungus, Guignardia
citricarpa. European journal of Plant Pathology v.109, p.503-513, 2003.
CALAVAN, E.C. Black spot of citrus. The California Citrograph. Los Angeles,
v.46, n.11, p.4, 18, 21-24, 1960.
CARDOSO FILHO, J.A. Efeitos de extratos de albedo de laranja (Citrus
sinensis) e do indutores de resistência ácido salicílico, acilbensolar-smetil e Saccharomyces cerevisiae no controle de Phyllosticta citricapa
(teleomorfo: Guignardia citricarpa). Piracicaba, 2003. 125p. Tese (Doutorado)
– Escola Superior de Agricultura “Luiz de Queiroz”, Universidade de São Paulo.
CHELKOWSKI, J.; BATEMAN, G.L.; MIROCHA, C.H.J. Idenification of toxigenic
Fusarium species using PCR assays. Journal Phytopthology, Berlin, v.147,
p.307-311, 1999.
COSTA, H.; VENTURA, J.A.; ARLEU, R.J.; AGUILAR-VILDOSO, C.I.
Ocorrência de pinta preta (Guignardia citricarpa) em citros no Estado do
Espirito Santo. Fitopatologia Brasileira, v.28, p.205, 2003. Suplemento.
CUBERO, J.; GRAHAM, J.H. Quantitative real-time polymerase chain reaction
for bacterial enumeration and allelic discrimination to differentiate Xanthomonas
strains on citrus. Phytopathology, v.95, p.1333-1340, 2005.
DHINGRA, O.D. & SINCLAIR, J.B. Basic Plant Pathology Methods, Lewis
Publisher. Boca Raton, Florida, 1995. 448p.
42
DOIDGE, E.M. Some diseases of citrus prevalent in South Africa. South
African Journal of Science. v.26, p.320-325, 1929.
DU, Z.; CHEN, J.; HIRUKI, C. Optimization and application of a multiplex RTPCR system for simultaneous detection of five potato viruses using 18S rRNA
as an internal control. Plant Disease, v.90, p.185-189, 2006.
DUART, V.; BOA, E. Enfoque usados na diagnose de doenças de plantas.
Revisão Anual de Patologia de Plantas (RAPP), v. 13, p.31-48, 2005.
FAGAN, C.; GOES, A. Efeito da mancha preta dos frutos cítricos causada por
Guignardia citricarpa nas características tecnológicas do suco de frutas de
laranjeira ‘Natal’ e ‘Valência’. Summa Phytopathologica, v.26, n.1, p.122,
2000.
FEICHTENBERGER, E. Mancha-preta dos citros no Estado de São Paulo.
Laranja, v.17, p.93-108, 1996.
FEICHTENBERGER, E.; GOES, A. de. Manual Técnico sobre Pinta Preta.
Araraquara: Fundecitrus, 1998.
FEICHTENBERGER, E.; MULLER, G.W.; GUIRADO, N. Doença dos citros. In:
KIMATI, H.; AMORIM, L.; BERGAMIN FILHO, A.; CAMARGO, L.E..A.;
REZENDE, J.A.M. (Ed.). Manual de Fitopatologia. São Paulo: Ceres, 1997.
cap.25, p.261-296.
FERREIRA, M.E.; GRATTAPAGIA, D. Introdução ao uso de Marcadores
Moleculares em Análise Genética. Embrapa, 3ª ed., p.37-38,1998.
FUNDECITRUS. Manual técnico sobre Pinta Preta. Araraquara; Fundo Paulista
de Defesa da Agricultura, 2000. 10p. (Boletim Técnico, Edição Especial).
GAO, X.; JACKSON, T.A.; LAMBERT, K.N.; LI, S.; HARTMAN, G. L.; NIBLACK,
T.L. Detection and quantification of Fusarium solani f. sp. glycines in soybean
roots with real-time quantitative polymerase chain reaction. Plant Disease,
v.88, p.1372-1413, 2004.
GOES, A. Controle da mancha preta dos frutos cítricos. Laranja. v.19, p.305320, 1998.
43
GOES, A.; GRAÇA, J.; BARROS, J.C. da S. M. de; PINHEIRO, J.E. Controle
da pinta preta em frutos de tangereina ‘Rio’ (Citrus deliciosa) ocasionada por
Phyllosticta citricarpa (Guignardia citricarpa Kiely). Fitopatologia Brasileira,
v.15, p.73-75, 1990.
GOES, A., ANDRADE, A. G. de, MORETTO, K. C. K. Efeito de diferentes tipos
de óleo na mistura de benomyl + mancozebe no controle da Guignardia
citricarpa, agente causal da mancha preta dos frutos cítricos. Summa
Phytopathologica, v. 26, p.233-236, 2000.
GOES, A.; CUPPER, C.K. Manejo Integrado Fruteiras Tropicais Doenças e
Pragas. In: ZAMBOLIM, L. Doenças causadas por fungos e bactérias na
cultura de citros, p.353-421, 2002.
GONZÁLEZ, J.E.R.; GOES, A. Influência do meio de cultura na produção de
picnidiósporos de Phyllosticta citricarpa. Fitopatologia Brasileira. v.28
(Suplemento) p.210, 2003.
HENSON, J.M.; FRENCH, R. The Polimerase Chain Reaction and plant
disease diagnosis. Annual Review Phytopathology, v.31, p.81-109, 1993.
HUANG, Z., RUNDELL, P. A., GUAN, X., POWELL, C. A. Detection and isolate
differentiation of Citrus tristeza virus in infected field trees based on reverse
transcription–polymerase chain reaction. Plant Disease, v.88, p.625-629, 2004.
IAPAR.
Instituto
Agronômico
do
Paraná.
Disponível
em:
http://www.iapar.br/zonpr/Mapa-Citros.htm>Acesso em: 08 fevereiro de 2006.
IBGE – Instituto Brasileiro de Geografia e Estatística. Disponível em
http://www.ibge.gov.br. Acessado em 03 dezembro de 2005.
Kellerman, C. R.; KOTZÉ, J. M. The black spot diseases fo citrus and its control
in South Africa. Proceending International Society Citriculture, Orlando, v.3,
p.992-996, 1997.
KIELY, T. B. Black spot of citrus in New South Wales coastal orchards. The
Agricultural Gazette, v.1, p.17-20, 1949.
44
KIELY, T. B. Preliminary studies on Guignardia citricarpa spp.: the ascigerous
stage of Phoma citricarpa and its relation to black spot of citrus. Proceedings
fo the Linnean Society of New South Wales, v.93, p.249-292, 1948.
KLOTZ, L.J. Fungal, bacterial, and nonparasitic diseases and injuries
originating in the seedbed, nursery and orchard. In: Reuther, W., Calavan, E. C.
& Carman, G. E. (eds). The citrus Industry. University of California, Davis, v.4,
p.1-66, 1978.
KOTZÉ, J. M. Black spot. In: W HITESIDE, J. O.; GARNSEY, S.M.; TIMMER, L.
W. (Ed.). Compendium of Citrus Diseases, St. Paul: APS Press, 1988. p.1012.
KOTZÉ, J. M. Epidemiology and control of citrus black spot in South África.
Plant Disease. v.65, n.12, p.945-950, 1981.
KOTZÉ, J.M. History and epidemiology of citrus black spot in South Africa.
Proc. Int. Soc. Citric., p.1296-1299, 1996.
KOTZÉ, J.M. Studies on the black spot disease of citrus caused by
Guignardia citricarpa Kiely, with particular reference to its epiphytology
and control at Letaba. 1963, 147p., Thesis (Ph.D.) - University of Pretoria,
Pretoria, South Africa.
LARANJEIRA, F.F.; AMORIM L.; BERGAMIN-FILHO, A.; AGUILAR-VILDOSO,
C.I.; COLETTA-FILHO, H.D. Fungos, procariotos e doenças abióticas. In:
MATTOS JÚNIOR, D. de; DE NEGRI, J.D.; PIO, R. M.; POMPEU JÚNIOR, J
(ed.). Citros. Cordeirópolis, SP: Centro Apta Citros Sylvio Moreira-IAC, p.511558, 2005.
LI, R.; SALIH, S.; HURTT, S. Detection of geminiviruses in sweetpotato by
polymerase chain reaction. Plant Disease, v.88, p.1347-1351, 2004.
LUCON, C.M.M.; AGUILAR-VILDOSO, C.A. Estudo do crescimento micelial de
isolados de G. citricarpa Kiely em diferentes temperaturas e meios de cultura.
Fitopatologia Brasileira, (Suplemento), v.21, p.390, 1996.
Mancha Preta em M.G. Informativo Centro de Citricultua, n.79, p.2, 2001.
MARIMOTO, F.; RODANTE, A.; NETO, A. F.; DEMENER, C.; ALVES,
J.G.;TORMEM, W. Manual Técnico de Citricultura. (Curitiba, Pr.). EmaterPr., 1991.
45
MATSUDA, Y.; SAMESHIME, T.; MORIURA, N.; INOUE, K.; NONOMURA, T.;
KAKUTANE, K.; NISHIMURA, H.; KUSAKARI, S.; TAKAMATSU, S.; TOYODA,
H. Identification of individual powdery mildew fungi infecting leaves and direct
detection of gene expression by single conidium polymerase chain reaction.
Phytopathology, v.95, p.1137-1143, 2005. .
McONIE, K.C. Source of inoculum of Guignardia citricarpa. the citrus black spot
pathogen. Phytopathology, v.54, p.64-67, 1964.
MENDES, D.; REIS, R.F.dos; MONTES DE OCA, A.G.; PEREIRA, G.T.;
GOES, A. Aspectos nutricionais e físicos no crescimento micelial, esporulação
e germinação de conídios de Phyllosticta citricarpa (=Guignardia citricarpa),
agente causal da mancha preta dos frutos cítricos. Summa Phytopathologica,
v.31, p,348-356, 2005.
MEYER, L.; SLIPPERS, B.; KORSTEN, L., KOTZÉ, J.M.; WINGFIELD, M.J.
Two distinc Guignardia species associated with citrus in South Africa. South.
Africa Journal of Scionce. v.97, p.191-194, 2001.
NUNES, W.M.C.; MEDINA, C.L.; MACHADO, M.A.; MACHADO, E.C.;
CORAZZA-NUNES, M.J.; MÜLLER. G. Transmissão de Xylella fastidiosa para
mudas de citros através de encostia de plantas-inóculo. Laranja, v.25, n.2,
p.349-356, 2004.
PASSAGLIA, L.M.P.; ZAHA, A. Técnicas de DNA recombinante. In ZAHA, A.
(coord.) Biologia molecular Básica. Porto Alegre: Editora Mercado Aberto,
336p.,1996.
PAUL, I.; VAN JAARSVELD, A.S.; KORSTEN, L.; HATTINGH, V. The potencial
global geographical distribution of Citrus Black Spot caused by Guignardia
citricarpa (Kiely): likelihood of disease establishment in the European Union.
Crop Protection v.24, p.297-308, 2005.
REIS, R.F.; GOES, A.; PEREIRA, G.T. Efeito da aplicação de oxicloreto de
cobre em diferentes épocas no controle da mancha preta dos citros causada
por Guignardia citricarpa. Summa Phytopathologica. v.29, p.12-18, 2003.
ROBBS, C. F.; PIMENTEL, J. P.; RIBEIRO, R.L.D. A mancha preta dos frutos
cítricos causada por Phoma citricarpa. Anais 13o Congresso Brasileiro de
Fitopatologia, Itaguaí, RJ, p. 455, 1980.
46
ROSSETTI, V. V.; Manual Ilustrado de Doenças dos Citros. Fundecitrus –
FEALQ. p.15-19; 127-131.
SCHINOR, E.H.; MOURÃO FILHO, F.A.A.; AGUILAR-VILDOSO, C.I.; TEÓFILO
SOBRINHO, J. Colonização de folhas de laranja `Pêra´ e variedades afins por
Guignardia citricarpa. Fitopatologia Brasileira, v.27, p. 479-483, 2002.
SCHUTTE, G.C.; BEETON, K.V.; KOTZÉ, J.M. Rind stippling on Valencia
oranges by copper fungicides used for control of citrus balack spot in South
Africa. Plant Disease, St. Paul, v.81, p.851-854, 1997.
SCHUTTE, G.C.; BEETON, K.V.; KOTZÉ, J.M. Rind stippling on Valencia
oranges by copper fungicides used for control of citrus black spot in Souht
Africa. Plant Disease, v.81, p.851-854, 1997.
SCHUTTE, G.C.; COTZÉ, J.M. Grass mulching as part fo an integrated control
programme for the control of citrus black spot. Citrus Journal, v.7, p.1820,1997.
SHURTLEFF, M.C.; AVERRE III, C.W. The Plant Desease Clinic and Field
Diagnosis of abiotic Diseases. Ed. The American Phytopatholgical Society
Press, St. Paul, 1997, 245p.
SPÓSITO, M.B. Dinâmica espacial e temporal da mancha-preta
(Guignardia citricarpa) e quantificação dos danos causados na cultura
dos citros. 2003, 112p. (Tese doutorado), Escola de Agricultura Luiz de
Queiroz, Universidade de São Paulo, Piracicaba.
SUN, X.; STALLl, R.E.; JONES, J.B.; CUBERO, J.; GOTTWALD, T.R.;
GRAHAM, J.H.; DIXON, W.N.; SCHUBERT, T.S.; CHALOUX, P.H.;
STROMBERG, V.K.; LACY, G.H.; SUTTON, B.D. Detection and
characterization of a new strain of citrus canker bacteria from Key/Mexican lime
and alemow in South Florida. Plant Disease, v.88, p.1179-1188, 2004.
SUTTON, B.C.; WATERSTON, J.M. Guignardia citricarpa Descriptions of
pathogenic fungi and bacteria. Surrey, England, Kew:
Commonwealth
Mycologicalo Institute, n.85, 1966.
TIMMER, L. W.; GARNSEY, S. M.; GRAHAM, J. H. Compendium of Citrus
Disease. 2.ed., St. Paul: APS Press, 2000. 92p.
47
TIMMER, L.W. Diseases of fruit and foliage. In: TIMMER, L.W.; DUNCAN, L.W.
(ed.). Citrus Health Manegement, Florida: APS Press, 1999. p.107-123.
TIMOSSI, A.J.; GOES, A.; KUPPER, K.C.; BALDASSARI, R.B.; REIS, R.F.,
Influência da temperatura e da luminosidade no desenvolvimento de
Guignardia citricarpa, agente causal da mancha preta dos frutos cítricos.
Fitopatologia Brasileira, v.28,p.489-494, 2003.
UGA, H., TSUDA, S. A one-step reverse transcription-polymerase chain
reaction system for the simultaneous detection and identification of multiple
tospovirus infections. Phytopathology, v.95, p.166, 2005.
48
8. APÊNDICES
49
Apêndice 1 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado Esalq1.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Fotop.
20ºC
25ºC
30ºC
AA
BDA
Altern
Claro
Escuro
Altern
Claro
Escuro
0,2708 a 0,2708 b 0,1644 a 0,2182 b 0,1788 b 0,2028 b
0,2938 a 0,2688 b 0,2948 c 0,2306 b 0,1714 b 0,1980 b
0,2898 a 0,1936 a 0,2174 b 0,1432 a 0,1142 a 0,1308 a
CDA
Altern
Claro
Escuro
0,2698 a 0,3374 b 0,3350 b
0,3190 b 0,3308 b 0,3190 b
0,2378 a 0,2262 a 0,2208 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
AA
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2708 b 0,2938 a 0,2898 b 0,2182 a 0,2306 b 0,1432 a
0,2708 b 0,2688 a 0,1936 a 0,1788 a 0,1714 a 0,1142 a
0,1644 a 0,2948 a 0,2174 a 0,2028 a 0,1980 a 0,1308 a
CDA
20ºC
25ºC
30ºC
0,2698 a 0,3190 a 0,2378 a
0,3374 b 0,3308 a 0,2262 a
0,3350 b 0,3190 a 0,2208 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura
Meio
AA
BDA
CDA
Altern
Claro
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2708 b 0,2938 b 0,2898 c 0,2708 b 0,2688 b 0,1936 b
0,2182 a 0,2306 a 0,1432 a 0,1788 a 0,1714 a 0,1142 a
0,2698 b 0,3190 b 0,2378 b 0,3374 c 0,3308 c 0,2262 c
20ºC
0,1644 a
0,2028 b
0,3350 c
Escuro
25ºC
30ºC
0,2948 b 0,2174 b
0,1980 a 0,1308 a
0,3190 b 0,2208 b
C.V. (%) 10,67
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
50
Apêndice 2 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado Esalq2.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,3050 b 0,2814 b 0,1856 a
0,2908 b 0,2722 b 0,2772 b
0,1922 a 0,2186 a 0,1666 a
BDA
Altern
Claro
Escuro
0,2592 b 0,1908 b 0,1808 a
0,2348 b 0,2182 b 0,2206 b
0,1072 a 0,1192 a 0,1512 a
Cenoura
Altern
Claro
Escuro
0,2834 b 0,3500 b 0,3408 b
0,3597 c 0,3394 b 0,3638 b
0,1238 a 0,2582 a 0,2640 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,3050 b 0,2908 a 0,1922 a 0,2592 b 0,2348 a 0,1072 a
0,2814 b 0,2722 a 0,2186 b 0,1908 a 0,2182 a 0,1192 a
0,1856 a 0,2772 a 0,1666 a 0,1808 a 0,2206 a 0,1512 b
Cenoura
20ºC
25ºC
30ºC
0,2834 a 0,3597 a 0,1238 a
0,3500 b 0,3394 a 0,2582 b
0,3408 b 0,3638 a 0,2640 b
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura
Meio
Aveia
BDA
Cenoura
Altern
Claro
Escuro
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,3050 b 0,2908 b 0,1922 b 0,2814 b 0,2722 b 0,2186 b 0,1856 a 0,2772 b 0,1666 a
0,2592 a 0,2348 a 0,1072 a 0,1908 a 0,2182 a 0,1192 a 0,1808 a 0,2206 a 0,1512 a
0,2834 b 0,3597 c 0,1238 a 0,3500 c 0,3394 c 0,2582 c 0,3408 b 0,3638 c 0,2640 b
C.V. (%) 10,80
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
51
Apêndice 3 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado Esalq3.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2832 b 0,2500 b 0,1970 a
0,3186 c 0,2876 c 0,2804 c
0,2372 a 0,2042 a 0,2376 b
BDA
Altern
Claro
Escuro
0,1960 b 0,2042 c 0,1696 a
0,2582 c 0,1672 b 0,2254 b
0,1328 a 0,1212 a 0,1440 a
Cenoura
Altern
Claro
Escuro
0,2914 b 0,3312 b 0,3390 b
0,3222 b 0,3230 b 0,3180 b
0,2326 a 0,2118 a 0,1882 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2832 c 0,3186 b 0,2372 b 0,1960 a 0,2582 c 0,1328 a
0,2500 b 0,2876 a 0,2042 a 0,2042 a 0,1672 a 0,1212 a
0,1970 a 0,2804 a 0,2376 b 0,1696 a 0,2254 b 0,1440 a
Cenoura
20ºC
25ºC
30ºC
0,2914 a 0,3222 a 0,2326 b
0,3312 b 0,3230 a 0,2118 b
0,3390 b 0,3180 a 0,1882 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura
Meio
Aveia
BDA
Cenoura
20ºC
0,2832 b
0,1960 a
0,2914 b
Altern
25ºC
0,3186 b
0,2582 a
0,3222 b
Claro
Escuro
30ºC
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2372 b 0,2500 b 0,2876 b 0,2042 b 0,1970 a 0,2804 b 0,2376 c
0,1328 a 0,2042 a 0,1672 a 0,1212 a 0,1696 a 0,2254 a 0,1440 a
0,2326 b 0,3312 c 0,3230 c 0,2118 b 0,3390 b 0,3180 c 0,1882 b
C.V. (%) 10,31
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
52
Apêndice 4 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PR1.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2918 b 0,2494 b 0,1810 a
0,3104 b 0,2924 c 0,2634 c
0,2210 a 0,2208 a 0,2168 b
BDA
Altern
Claro
Escuro
0,2374 b 0,2154 c 0,1942 b
0,2612 b 0,1880 b 0,2340 c
0,1600 a 0,1512 a 0,1416 a
Cenoura
Altern
Claro
Escuro
0,3112 b 0,3114 b 0,3384 b
0,3232 b 0,2994 b 0,3232 b
0,1450 a 0,2088 a 0,2476 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2918 c 0,3104 b 0,2210 a 0,2374 b 0,2612 c 0,1600 a
0,2494 b 0,2924 b 0,2208 a 0,2154 a 0,1880 a 0,1512 a
0,1810 a 0,2634 a 0,2168 a 0,1942 a 0,2340 b 0,1416 a
Cenoura
20ºC
25ºC
30ºC
0,3112 a 0,3232 a 0,1450 a
0,3114 a 0,2994 a 0,2088 b
0,3384 a 0,3232 a 0,2476 c
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura
Meio
Aveia
BDA
Cenoura
20ºC
0,2918 b
0,2374 a
0,3112 b
Altern
25ºC
0,3104 b
0,2612 a
0,3232 b
30ºC
20ºC
0,2210 b 0,2494 b
0,1600 a 0,2154 a
0,1450 a 0,3114 c
Claro
25ºC
0,2924 b
0,1880 a
0,2994 b
Escuro
30ºC
20ºC
25ºC
30ºC
0,2208 b 0,1810 a 0,2634 b 0,2168 b
0,1512 a 0,1942 a 0,2340 a 0,1416 a
0,2088 b 0,3384 b 0,3232 c 0,2476 c
C.V. (%) 8,50
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
53
Apêndice 5 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PR2.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2938 b 0,2510 b 0,1794 a
0,2930 b 0,2876 c 0,2992 b
0,2034 a 0,1868 a 0,1980 a
BDA
Altern
Claro
Escuro
0,2356 b 0,2168 b 0,2148 b
0,2474 b 0,2184 b 0,2386 b
0,1154 a 0,1034 a 0,1122 a
Cenoura
Altern
Claro
Escuro
0,2508 b 0,3272 b 0,3282 b
0,3290 c 0,3086 b 0,3288 b
0,1442 a 0,1648 a 0,1676 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2938 c 0,2930 a 0,2034 a 0,2356 a 0,2474 a 0,1154 a
0,2510 b 0,2876 a 0,1868 a 0,2168 a 0,2184 a 0,1034 a
0,1794 a 0,2992 a 0,1980 a 0,2148 a 0,2386 a 0,1122 a
Cenoura
20ºC
25ºC
30ºC
0,2508 a 0,3290 a 0,1442 a
0,3272 b 0,3086 a 0,1648 a
0,3282 b 0,3288 a 0,1676 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura
Meio
Aveia
BDA
Cenoura
Altern
20ºC
25ºC
30ºC
20ºC
0,2938 b 0,2930 b 0,2034 c 0,2510 b
0,2356 a 0,2474 a 0,1154 a 0,2168 a
0,2508 a 0,3290 c 0,1442 b 0,3272 c
Claro
25ºC
0,2876 b
0,2184 a
0,3086 b
Escuro
30ºC
20ºC
25ºC
30ºC
0,1868 b 0,1794 a 0,2992 b 0,1980 c
0,1034 a 0,2148 b 0,2386 a 0,1122 a
0,1648 b 0,3282 c 0,3288 c 0,1676 b
C.V. (%) 9,63
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
54
Apêndice 6 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PR3.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2718 a 0,2856 a 0,2372 b
0,2886 a 0,3262 a 0,2648 b
0,2812 a 0,3000 a 0,1680 a
BDA
Altern
Claro
Escuro
0,2034 b 0,1608 a 0,1642 b
0,2322 b 0,1562 a 0,2054 b
0,1652 a 0,1916 a 0,0870 a
Cenoura
Altern
Claro
Escuro
0,3330 b 0,3116 b 0,2270 b
0,3294 b 0,3298 b 0,3294 c
0,2282 a 0,2510 a 0,1530 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2718 a 0,2886 a 0,2812 b 0,2034 a 0,2322 b 0,1652 b
0,2856 a 0,3262 b 0,3000 b 0,1608 a 0,1562 a 0,1916 b
0,2372 a 0,2648 a 0,1680 a 0,1642 a 0,2054 b 0,0870 a
Cenoura
20ºC
25ºC
30ºC
0,3330 b 0,3294 a 0,2282 b
0,3116 b 0,3298 a 0,2510 b
0,2270 a 0,3294 a 0,1530 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura
Meio
Aveia
BDA
Cenoura
20ºC
0,2718 b
0,2034 a
0,3330 c
Altern
25ºC
0,2886 b
0,2322 a
0,3294 b
30ºC
20ºC
0,2812 c 0,2856 b
0,1652 a 0,1608 a
0,2282 b 0,3116 b
Claro
25ºC
0,3262 b
0,1562 a
0,3298 b
Escuro
30ºC
20ºC
25ºC
30ºC
0,3000 c 0,2372 b 0,2648 b 0,1680 b
0,1916 a 0,1642 a 0,2054 a 0,0870 a
0,2510 b 0,2270 b 0,3294 c 0,1530 b
C.V. (%) 14,14
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
55
Apêndice 7 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PR4.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2458 a 0,3014 a 0,2380 a
0,2660 a 0,2866 a 0,3044 b
0,2300 a 0,3228 a 0,2250 a
BDA
Altern
Claro
Escuro
0,1690 b 0,1824 b 0,1614 b
0,2354 c 0,1392 a 0,1770 b
0,1108 a 0,1020 a 0,0752 a
Cenoura
Altern
Claro
Escuro
0,3416 c 0,3312 b 0,2474 b
0,2772 b 0,3332 b 0,2876 c
0,1136 a 0,1464 a 0,1158 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2458 a 0,2660 a 0,2300 a 0,1690 a 0,2354 b 0,1108 a
0,3014 b 0,2866 a 0,3228 b 0,1824 a 0,1392 a 0,1020 a
0,2380 a 0,3044 a 0,2250 a 0,1614 a 0,1770 a 0,0752 a
Cenoura
20ºC
25ºC
30ºC
0,3416 b 0,2772 a 0,1136 a
0,3312 b 0,3332 b 0,1464 a
0,2474 a 0,2876 a 0,1158 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura.
Meio
Aveia
BDA
Cenoura
Altern
Claro
Escuro
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2458 b 0,2660 a 0,2300 b 0,3014 b 0,2866 b 0,3228 c 0,2380 b 0,3044 b 0,2250 c
0,1690 a 0,2354 a 0,1108 a 0,1824 a 0,1392 a 0,1020 a 0,1614 a 0,1770 a 0,0752 a
0,3416 c 0,2772 a 0,1136 a 0,3312 b 0,3332 c 0,1464 b 0,2474 b 0,2876 b 0,1158 b
C.V. (%) 13,58
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
56
Apêndice 8 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PC1
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2966 a 0,3750 a 0,2302 a
0,3750 b 0,3708 a 0,2520 a
0,3750 b 0,3750 a 0,3484 b
BDA
Altern
Claro
Escuro
0,2492 a 0,2646 a 0,1878 b
0,3064 b 0,2434 a 0,2860 c
0,3482 c 0,3190 b 0,1492 a
Cenoura
Altern
Claro
Escuro
0,3750 a 0,3750 a 0,3500 a
0,3750 a 0,3750 a 0,3750 b
0,3750 a 0,3750 a 0,3274 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2966 b 0,3750 b 0,3750 a 0,2492 b 0,3064 b 0,3482 b
0,3750 c 0,3708 b 0,3750 a 0,2646 b 0,2434 a 0,3190 b
0,2302 a 0,2520 a 0,3484 a 0,1878 a 0,2860 b 0,1492 a
Cenoura
20ºC
25ºC
30ºC
0,3750 a 0,3750 a 0,3750 b
0,3750 a 0,3750 a 0,3750 b
0,3500 a 0,3750 a 0,3274 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura.
Meio
Aveia
BDA
Cenoura
20ºC
0,2966 b
0,2492 a
0,3750 c
Altern
25ºC
0,3750 b
0,3064 a
0,3750 b
30ºC
20ºC
0,3750 a 0,3750 b
0,3482 a 0,2646 a
0,3750 a 0,3750 b
Claro
25ºC
0,3708 b
0,2434 a
0,3750 b
Escuro
30ºC
20ºC
25ºC
30ºC
0,3750 b 0,2302 b 0,2520 a 0,3484 b
0,3190 a 0,1878 a 0,2860 b 0,1492 a
0,3750 b 0,3500 c 0,3750 c 0,3274 b
C.V. (%) 7,96
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
57
Apêndice 9 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PC3C
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
BDA
Altern
Claro
Escuro
Altern
Claro
Escuro
0,2768 a 0,2730 a 0,2188 a 0,2564 c 0,0964 a 0,1124 b
0,2330 a 0,2478 a 0,2916 b 0,2068 b 0,0900 a 0,1648 c
0,3290 b 0,2870 a 0,2150 a 0,1168 a 0,0690 a 0,0590 a
Cenoura
Altern
Claro
Escuro
0,3520 c 0,1410 b 0,1154 a
0,1474 b 0,1304 b 0,1554 b
0,0896 a 0,0740 a 0,0904 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2768 b 0,2330 a 0,3290 b 0,2564 b 0,2068 b 0,1168 b
0,2730 b 0,2478 a 0,2870 b 0,0964 a 0,0900 a 0,0690 a
0,2188 a 0,2916 b 0,2150 a 0,1124 a 0,1648 b 0,0590 a
Cenoura
20ºC
25ºC
30ºC
0,3520 b 0,1474 a 0,0896 a
0,1410 a 0,1304 a 0,0740 a
0,1154 a 0,1554 a 0,0904 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura.
Meio
Aveia
BDA
Cenoura
20ºC
0,2768 a
0,2564 a
0,3520 b
Altern
Claro
25ºC
30ºC
20ºC
25ºC
30ºC
20ºC
0,2330 b 0,3290 b 0,2730 b 0,2478 b 0,2870 b 0,2188 b
0,2068 b 0,1168 a 0,0964 a 0,0900 a 0,0690 a 0,1124 a
0,1474 a 0,0896 a 0,1410 a 0,1304 a 0,0740 a 0,1154 a
Escuro
25ºC
0,2916 b
0,1648 a
0,1554 a
30ºC
0,2150 b
0,0590 a
0,0904 a
C.V. (%) 19,96
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
58
Apêndice 10 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PC12C
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
BDA
Altern
Claro
Escuro
Altern
Claro
Escuro
0,2646 a 0,3014 c 0,2478 a 0,2290 b 0,2104 b 0,1826 b
0,2806 a 0,2532 b 0,3150 b 0,2604 c 0,1064 a 0,1528 b
0,3126 b 0,1890 a 0,2478 a 0,1906 a 0,0786 a 0,1144 a
Cenoura
Altern
Claro
Escuro
0,3384 b 0,3208 b 0,2762 b
0,3384 b 0,3750 c 0,3292 c
0,1914 a 0,1058 a 0,0486 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2646 a 0,2806 a 0,3126 c 0,2290 b 0,2604 c 0,1906 c
0,3014 b 0,2532 a 0,1890 a 0,2104 b 0,1064 a 0,0786 a
0,2478 a 0,3150 b 0,2478 b 0,1826 a 0,1528 b 0,1144 b
Cenoura
20ºC
25ºC
30ºC
0,3384 b 0,3384 a 0,1914 c
0,3208 b 0,3750 a 0,1058 b
0,2762 a 0,3292 a 0,0486 a
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura.
Meio
Aveia
BDA
Cenoura
20ºC
0,2646 b
0,2290 a
0,3384 c
Altern
25ºC
0,2806 a
0,2604 a
0,3384 b
Claro
30ºC
20ºC
25ºC
30ºC
20ºC
0,3126 b 0,3014 b 0,2532 b 0,1890 b 0,2478 b
0,1906 a 0,2104 a 0,1064 a 0,0786 a 0,1826 a
0,1914 a 0,3208 b 0,3750 c 0,1058 a 0,2762 b
Escuro
25ºC
0,3150 b
0,1528 a
0,3292 b
30ºC
0,2478 c
0,1144 b
0,0486 a
C.V. (%) 10,45
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
59
Apêndice 11 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PC13/36
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,1580 a 0,2624 a 0,1908 b
0,2894 b 0,2584 a 0,2878 c
0,3394 c 0,3062 b 0,1438 a
BDA
Altern
Claro
Escuro
0,1364 a 0,1406 a 0,1918 b
0,1830 b 0,1178 a 0,1938 b
0,1868 b 0,1668 b 0,1078 a
Cenoura
Altern
Claro
Escuro
0,2854 b 0,2400 b 0,1904 b
0,2778 b 0,3186 c 0,2778 c
0,1576 a 0,0954 a 0,1600 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,1580 a 0,2894 b 0,3394 c 0,1364 a 0,1830 b 0,1868 b
0,2624 c 0,2584 a 0,3062 b 0,1406 a 0,1178 a 0,1668 b
0,1908 b 0,2878 b 0,1438 a 0,1918 b 0,1938 b 0,1078 a
Cenoura
20ºC
25ºC
30ºC
0,2854 c 0,2778 a 0,1576 b
0,2400 b 0,3186 b 0,0954 a
0,1904 a 0,2778 a 0,1600 b
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura.
Fotop.
Aveia
BDA
Cenoura
20ºC
0,1580 a
0,1364 a
0,2854 b
Altern
25ºC
0,2894 b
0,1830 a
0,2778 b
30ºC
20ºC
0,3394 c 0,2624 b
0,1868 b 0,1406 a
0,1576 a 0,2400 b
Claro
25ºC
0,2584 b
0,1178 a
0,3186 c
30ºC
20ºC
0,3062 c 0,1908 a
0,1668 b 0,1918 a
0,0954 a 0,1904 a
Escuro
25ºC
0,2878 b
0,1938 a
0,2778 b
30ºC
0,1438 b
0,1078 a
0,1600 b
C.V. (%) 9,45
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
60
Apêndice 12 (A, B e C)- Desdobramento da interação tripla significativa para o
isolado PCP6.
A- Análise do desdobramento da Temperatura dentro de cada nível de Meio e
Fotoperíodo.
Temp.
20ºC
25ºC
30ºC
Aveia
Altern
Claro
Escuro
0,2780 a 0,3666 a 0,2658 a
0,2842 a 0,3500 a 0,2770 a
0,3250 b 0,3458 a 0,2894 a
BDA
Altern
Claro
Escuro
0,1970 b 0,2584 c 0,0934 b
0,2628 c 0,2150 b 0,2084 c
0,0666 a 0,0914 a 0,0612 a
Cenoura
Altern
Claro
Escuro
0,3104 b 0,3750 b 0,3750 b
0,3314 b 0,3750 b 0,3314 a
0,1140 a 0,1510 a 0,3396 a
B- Análise do desdobramento do Fotoperíodo dentro de cada nível de Meio e
Temperatura.
Fotop.
Altern
Claro
Escuro
Aveia
BDA
20ºC
25ºC
30ºC
20ºC
25ºC
30ºC
0,2780 a 0,2842 a 0,3250 b 0,1970 b 0,2628 b 0,0666 a
0,3666 b 0,3500 b 0,3458 b 0,2584 c 0,2150 a 0,0914 a
0,2658 a 0,2770 a 0,2894 a 0,0934 a 0,2084 a 0,0612 a
Cenoura
20ºC
25ºC
30ºC
0,3104 a 0,3314 a 0,1140 a
0,3750 b 0,3750 b 0,1510 b
0,3750 b 0,3314 a 0,3396 c
C- Análise do desdobramento do Meio dentro de cada nível de Fotoperíodo e
Temperatura.
Meio
Aveia
BDA
Cenoura
Altern
20ºC
25ºC
30ºC
20ºC
0,2780 b 0,2842 a 0,3250 c 0,3666 b
0,1970 a 0,2628 a 0,0666 a 0,2584 a
0,3104 c 0,3314 b 0,1140 b 0,3750 b
Claro
25ºC
0,3500 b
0,2150 a
0,3750 b
Escuro
30ºC
20ºC
25ºC
30ºC
0,3458 c 0,2658 b 0,2770 b 0,2894 b
0,0914 a 0,0934 a 0,2084 a 0,0612 a
0,1510 b 0,3750 c 0,3314 c 0,3396 c
C.V. (%) 9,28
1
Dados não transformados;
2
Médias seguidas da mesma letra na vertical não diferem entre si pelo teste de
Scott-Knott a 5% de significância.
61

Documentos relacionados