Clique para visualizar o trabalho completo. - LEMC

Сomentários

Transcrição

Clique para visualizar o trabalho completo. - LEMC
RAQUEL GIRARDELLO
AVALIAÇÃO DOS MECANISMOS DE RESISTÊNCIA À POLIMIXINA B EM
ISOLADOS CLÍNICOS DE Acinetobacter baumannii
Tese
apresentada
à
Universidade
Federal de São Paulo - Escola Paulista
de Medicina, para obtenção do Título de
Doutor em Ciências.
São Paulo
2012
RAQUEL GIRARDELLO
CARACTERIZAÇÃO DOS MECANISMOS DE RESISTÊNCIA À POLIMIXINA B
EM ISOLADOS CLÍNICOS DE Acinetobacter baumannii
Tese
apresentada
à
Universidade
Federal de São Paulo - Escola Paulista
de Medicina, para obtenção do Título de
Doutor em Ciências.
Orientadora:
Cristina Gales
São Paulo
2012
Professora
Dra.
Ana
UNIVERSIDADE FEDERAL DE SÃO PAULO
ESCOLA PAULISTA DE MEDICINA
DISCIPLINA DE INFECTOLOGIA
Chefe do Departamento:
Professor Dr. Álvaro Nagib Atala
Coordenador do curso de Pós-graduação:
Professor Dr. Ricardo Sobhie Diaz
São Paulo
2012
RAQUEL GIRARDELLO
CARACTERIZAÇÃO DOS MECANISMOS DE RESISTÊNCIA À POLIMIXINA B
EM ISOLADOS CLÍNICOS DE Acinetobacter baumannii
Presidente da Banca:
Profª Drª Ana Cristina Gales
Banca Examinadora:
Prof. Dr. Alexandre Prehn Zavascki
Profª Drª Silvia Figueiredo Costa
Prof. Dr. Guilherme Henrique Campos Furtado
Prof. Dr. Nilton Lincopan
Suplentes:
Prof. Dr. Antônio Carlos Campos Pignatari
Profª Drª Anna Sara Shafferman Levin
São Paulo
2012
Girardello, Raquel
Avaliação dos mecanismos de resistência à polimixina B entre
isolados clínicos de Acinetobacter baumannii. Raquel Girardello - São Paulo,
2012. vi. 137 f.
Tese (Doutorado) - Universidade Federal de São Paulo. Escola Paulista
de Medicina. Programa de Pós-graduação em Ciências Básicas em Infectologia.
Título em inglês: Evaluation of mechanisms of resistance to polymyxin B
in Acinetobacter baumannii clinical isolates.
1. Polimixinas; 2. Acinetobacter baumannii; 3. Lipopolissacarídeo; 4. Two
component systems; 5. Parede celular.
DEDICATÓRIA
Dedico este estudo aos meus pais Valcir Girardello e Maria Rossi
Girardello pela imensa dedicação e auxílio para minha formação pessoal e
profissional e, em agradecimento por acreditarem sempre, independente de
qualquer dificuldade, no meu crescimento e sucesso.
AGRADECIMENTOS
Agradeço à minha orientadora Drª Ana Cristina Gales, pela oportunidade oferecida
e pelo exemplo de dedicação, inteligência e esforço que levarei comigo para o resto de
minha vida.
Agradeço a toda a minha família, em especial meus pais Valcir Girardello e Maria
Rossi Girardello e meu irmão e cunhada Ricardo Girardello e Susana Vassoller por
estarem sempre de braços abertos a espera toda vez que eu precisar. Vocês são a força
que me faz seguir em frente cada vez mais.
Agradeço à Professora Drª Maria Cristina Brognharo Tognin pela confiança e pelo
auxílio e indicação ao laboratório ALERTA, essenciais para que este trabalho tenha sido
realizado.
Agradeço ao Professor Dr. Antonio Carlos Campos Pignatari pelo grande exemplo
de vida que nos oferece sempre nos lembrando da importância de nossos estudos na
vida de pacientes com os quais ele e outros médicos convivem diariamente pelos
hospitais do Brasil e do mundo.
Agradeço a Tiago Massao Yamanaka pelo grande auxílio durante a realização
desta tese, na parte experimental e na formatação deste documento, além da pronta
disponibilidade para suporte em todos os momentos durante o decorrer da minha
formação.
Um agradecimento especial ao colega de laboratório e amigo Rodrigo Cayô, pela
dedicação e auxílio técnico e científico nos experimentos desta tese, em especial os
experimentos de PBPs e porinas.
Agradeço aos colegas de laboratório Talita Trevizani Rocchetti, Paulo José
Martins Bispo e Liana Carballo de Menezes pelo grande auxílio nos experimentos de
PCR em Tempo Real.
Agradeço à Cecilia Godoy Carvalhaes e André Mario Doi pelas correções deste
trabalho e pela amizade e sempre pronta disponibilidade.
Agradeço ao Centro de Microscopia Eletrônica da UNIFESP, em especial aos
funcionários André Aguillera e Márcia Tanakai e à Professora Drª Edna Haapalainen
pelos experimentos de microscopia eletrônica de transmissão deste estudo.
Agradeço a toda a família LEMC-ALERTA pela convivência nesses quatro anos
de estudos, de confraternizações, alegrias e tristezas, muitas risadas e muito trabalho e,
principalmente, muitas amizades criadas. Levarei todos vocês sempre no meu coração.
Agradeço à secretária do laboratório Rosana Capecce pela amizade e auxílio em
diversos momentos.
Agradeço à Professora Dra Halha Ostrensky Saridakis por todo cuidado e
ensinamentos durante a realização do mestrado, na Universidade Estadual de Londrina.
E, por fim, mas não menos importante, um agradecimento muito especial aos
meus orientadores de iniciação científica, durante a graduação na Universidade de Passo
Fundo, Professor Dr. Luiz Carlos Kreutz e Professora Dra. Laura Beatriz Rodrigues por
me ensinarem o caminho da microbiologia, ensinamentos esses que carrego comigo até
hoje e nunca serão esquecidos.
SUMÁRIO
Índice de Tabelas......................................................................................................
i
Índice de Figuras.......................................................................................................
ii
RESUMO..................................................................................................................
iv
ABSTRACT..............................................................................................................
vi
1. INTRODUÇÃO......................................................................................................
01
2. REVISÃO BIBLIOGRÁFICA................................................................................
04
2.1 Acinetobacter baumannii..............................................................................
05
2.2 Opções terapêuticas e mecanismos de resistência.....................................
06
2.2.1 β-lactâmicos.........................................................................................
06
2.2.1.1 Produção de enzimas β-lactamases..........................................
07
2.2.1.2 Alteração de porinas...................................................................
09
2.2.1.3 Hiperexpressão de sistemas de efluxo.......................................
10
2.2.1.4 Alterações de PBP.....................................................................
12
2.2.2 Polimixinas...........................................................................................
14
2.2.2.1 Mecanismos de resistência às polimixinas.....................................
17
3. OBJETIVOS..........................................................................................................
26
4. MATERIAL E MÉTODOS.....................................................................................
28
4.1 Fluxograma..................................................................................................
29
4.2 Seleção dos isolados bacterianos................................................................
30
4.3 Indução de resistência à polimixina B..........................................................
31
4.4 Estabilidade da resistência induzida à polimxina B.....................................
32
4.5 Análise da similaridade genética por PFGE.................................................
32
4.6 Teste de sensibilidade aos antimicrobianos................................................
33
4.7 Microscopia eletrônica de transmissão........................................................
36
4.8 Cultivo em meio hipotônico..........................................................................
36
4.9 Sequenciamento do sistema de dois componentes PmrAB........................
37
4.10 PCR em Tempo Real para quantificação da transcrição do sistema de
dois componentes PmrAB..................................................................................
38
4.10.1 Extração de RNA Total e síntese de cDNA...................................... 38
4.10.2 Quantificação relativa da transcrição gênica...................................
39
4.10.3 Análise da quantificação relativa da transcrição gênica..................
39
4.11 Associação de resistência às polimixinas com mecanismos de
resistência relacionados à parede celular bacteriana........................................
40
4.11.1 Avaliação de proteínas de membrana externa.............................
40
4.11.1.1 Extração de proteínas de membrana externa........................
40
4.11.1.2 Avaliação do perfil de proteínas de membrana externa por
SDS-PAGE...........................................................................................
41
4.11.1.3 Quantificação relativa da transcrição dos genes que
codificam porinas.................................................................................
42
4.11.2 Quantificação relativa da transcrição do gene adeB, que codifica
a proteína estrutural do sistema de efluxo AdeABC.................................
42
4.11.3 Sequenciamento dos genes que codificam as PBPs....................
42
5. RESULTADOS.....................................................................................................
45
5.1 Caracterização dos isolados de A. baumannii.............................................
45
5.2 Perfil de sensibilidade aos antimicrobianos................................................
46
5.3 Estabilidade da indução de resistência à polimixina B................................
48
5.4 Análise da similaridade genética..................................................................
48
5.5 Microsopia Eletrônica de Transmissão (MET).............................................
49
5.6 Cultivo em meio hipotônico..........................................................................
50
5.7 Sequenciamento dos genes que compõem o sistema regulatório de dois
componentes PmrAB.........................................................................................
51
5.8 Quantificação relativa da transcrição do sistema regulatório de dois
componentes PmrAB.........................................................................................
51
5.9 Avaliação da influência de resistência à polimixina B em mecanismos
relacionados à parede celular bacteriana..........................................................
52
5.9.1 Expressão de Proteínas de Membrana Externa...................................
52
5.9.2 Quantificação relativa da transcrição da bomba de efluxo AdeABC....
55
5.9.3 Alterações nas PBPs............................................................................
56
6. DISCUSSÃO.........................................................................................................
59
7. CONCLUSÕES.....................................................................................................
72
8. REFERÊNCIAS....................................................................................................
74
9. ANEXOS...............................................................................................................
98
ÍNDICE DE TABELAS
Tabela 1. Sequências de oligonucleotídeos iniciadores utilizados para as reações
de PCR e sequenciamento.......................................................................................
43
Tabela 2. Seqüências de oligonucleotídeos iniciadores utilizados para reações
PCR em tempo real...................................................................................................
44
Tabela 3. Padronização da curva de melting para cada gene submetido à PCR
em tempo real...........................................................................................................
44
Tabela 4. Isolados sensíveis e resistentes à polimixina B, selecionados para o
estudo, antes e após o cultivo na presença de polimixina B....................................
46
Tabela 5. Perfil de sensibilidade de isolados A. baumannii sensíveis e resistentes
às polimixinas, antes e após a indução de resistência com sulfato de polimixina
B................................................................................................................................
47
Tabela 6. Perfil de sensibilidade à polimixina B durante o cultivo na ausência da
droga, após a indução de resistência.......................................................................
48
Tabela 7. Mutações dos genes que codificam as PBP de alto peso molecular nos
isolados de A. baumannii antes e após o cultivo na presença de sulfato de
polimixina B...............................................................................................................
58
i
ÍNDICE DE FIGURAS
Figura 1. Estrutura química das moléculas de polimixinas......................................
15
Figura 2. Estrutura química do sulfato de colistina e colistimetato de sódio...........
16
Figura 3. Desenho esquemático da parede celular bacteriana de bactérias Gram
negativas...................................................................................................................
18
Figura 4. Esquema da regulação do desenvolvimento de resistência às
polimxinas por isolados de Enterobactérias controlado por sistemas de dois
componentes.............................................................................................................
21
Figura 5. Desenho esquemático do sistema de dois componentes que regula o
desenvolvimento de resistência à polimixinas em isolados de A. baumannii...........
23
Figura 6. Desenho esquemático das passagens de subcultivos na presença de
concentrações crescentes de sulfato de polimixina B para a indução de
resistência à mesma, nos isolados de A. baumannii................................................
32
Figura 7. Desenho esquemático da distribuição das concentrações de polimixina
B na placa de microdiluição em caldo.......................................................................
36
Firgura 8. Desenho esquemático da placa de microdiluição em caldo (TREK
Diagnostics) utilizada para avaliação da sensibilidade aos antimicrobianos............
36
Figura 9. Perfil de similaridade genética pela metodologia de PFGE......................
50
Figura 10. Microscopia eletrônica de transmissão de isolados clínicos de A.
baumannii, cultivados na presença e ausência de polimixina B...............................
51
Figura 11. Quantificação relativa da transcrição dos genes do sistema regulatório
de dois componentes PmrAB nos isolados de A. baumannii.................................... 53
Figura 12. Quantificação relativa da transcrição dos genes que codificam as
porinas dos isolados de A. baumannii antes e após o cultivo na presença de
55
polimixina B...............................................................................................................
ii
Figura 13. Gel de SDS-PAGE das proteínas de membrana externa (OMPs) dos
isolados clínicos e os mutantes induzidos de A. baumannii.....................................
56
Figura 14. Quantificação da transcrição relativa do gene adeB para os isolados
de A. baumannii, antes e após o cultivo na presença de polimixina B.....................
57
iii
RESUMO
A. baumannii é um agente etiológico frequente de infecções relacionadas à
assistência à saúde no Brasil, pois possui grande capacidade em sobreviver em
condições adversas e desenvolver ou adquirir mecanismos de resistência aos
antimicrobianos. As altas taxas de resistência juntamente com a falta de novas opções
terapêuticas disponibilizadas pelas indústrias farmacêuticas atualmente, tem levado à
necessidade de incluir novamente na prática clínica, drogas antigas como as polimixinas
que, atualmente, constituem uma das últimas opções terapêuticas em casos de infecções
por bacilos Gram negativos multirresistentes. Neste estudo foram analisados os fenótipos
de resistência “natural” e induzida à polimixina B em isolados clínicos de A. baumannii.
Um isolado sensível e outro resistente às polimixinas foram submetidos ao cultivo em
concentrações crescentes de polimixina B para a indução de resistência às mesmas. Os
isolados clínicos de A. baumannii foram analisados por microscopia eletrônica de
transmissão, antes e após o cultivo na presença de polimixina B. Foram realizados o
sequenciamento e qRT-PCR do sistema de dois componentes PmrAB, relacionado com o
surgimento de resistência às polimixinas em A. baumannii. Análises dos mecanismos de
resistência relacionados à parede celular bacteriana foram realizadas para estudar a
associação destes ou não com os fenótipos de resistência às polimixinas. O isolado
sensível
à
polimixina
reverteu
o
perfil
de
sensibilidade
aos
β-lactâmicos
e
aminoglicosídeos após a indução de resistência à polimixina B. Esse perfil de
sensibilidade foi estável, mesmo após o cultivo na ausência do antimicrobiano. Esse
mesmo isolado não conseguiu sobreviver em meio hipotônico, sugerindo uma diminuição
da integridade da parede celular bacteriana. Essas alterações no perfil de sensibilidade
não foram observadas no isolado com resistência “natural” quando cultivado na presença
de polimixina B. Nesse isolado, diferente do isolado sensível, foi observado um
espessamento na parede celular, mesmo antes da exposição ao antimicrobiano. O
sequenciamento do sistema de dois componentes PmrAB mostrou duas mutações no
iv
gene pmrB, somente no isolado com resistência induzida à polimixina B. Para esses
genes, também foram observados diferentes níveis de transcrição entre o isolado com
resistência induzida e com resistência “natural”, sugerindo que esse segundo fenótipo
não seja regulado pelo sistema PmrAB. A diminuição da expressão da porina OmpW foi
relacionada ao surgimento de resistência induzida às polimixinas nos isolados de A.
baumannii. As mutações nas PBPs de alto peso molecular observadas nos isolados com
resistência “natural” à polimixina podem ser responsáveis pelo fenômeno de
espessamento da parede celular e, consequentemente, pelo fenótipo de resistência. A
concentração dos íons presentes no meio de cultura deve ser avaliado antes da
realização dos testes de sensibilidade às polimixinas, para garantir a confiabilidade e
reprodutibilidade dos testes.
v
ABSTRACT
A. baumannii is a common pathogen associated to health care infections in Brazil,
due to its capacity to survive in adverse conditions and develop resistance to broad
spectrum antimicrobial agents. The high resistance rate combined to together with the
absence of new antimicrobial options turned polymyxins the last line antimicrobial drugs to
treat Gram negative MDR infections. In this study both, an in vitro induced and a noninduced polymyxin-resistant phenotype in A. baumannii clinical isolates were analyzed.
The in vitro induced and the non-induced A. baumannii isolates were subcultured in
progressive polymyxin B concentration. The transmission electron microscopy was
performed previous or not the polymyxin B exposure. The PmrAB two component
regulatory system were analyzed by sequencing and qRT-PCR. The polymyxin resistance
determinants associated with the bacterial cell wall were studied. A modification on the
susceptibility testing profile of the induced isolate was observed after polymyxin B
exposure, mainly due to a reduction on the β-lactam and aminoglycosides MICs values.
This susceptibility profile was stable after subculturing the strain in the absence of
antimicrobial pressure. Moreover, this isolate could not survive in a hypotonic environment
suggesting a rupture on the cell wall integrity. This phenomenon was not observed in the
“natural” polymyxin resistant isolate when exposed to polymyxin B pressure. In the noninduced polymyxin resistant isolate, unlike the induced one, a cell wall thickness was
observed, comparing to the same strain previously drug exposure. The PmrAB
sequencing showed two mutations in the pmrB gene, only in the induced resistant isolate.
Different transcription rates between the induced and the non-induced polymyxin B
resistant isolates was also observed when evaluating the two component system genes
suggesting that the non-induced phenotype was not regulated by this system. In addition,
a decrease in the OmpW expression was observed in the induced polymyxin B resistant
strain but not in the non-induced one. The mutations observed in high molecular weight
vi
PBPs of non-induced polymyxin B resistant isolate may be responsible to the thickness in
the cell wall presented by this isolate.
vii
Introdução
1. INTRODUÇÃO
1
Introdução
1. INTRODUÇÃO
Microrganismos resistentes aos antimicrobianos constituem um dos principais
problemas enfrentados por hospitais do mundo inteiro, incluindo os brasileiros. Infecções
causadas por bacilos Gram negativos, como Acinetobacter baumannii, Pseudomonas
aeruginosa e Klebsiella pneumoniae eram, até a algumas décadas, tratadas com diversos
antimicrobianos, principalmente os beta-lactâmicos. No entanto, ao longo dos anos,
esses microrganismos tem desenvolvido, cada vez mais, diferentes mecanismos de
resistência a esta classe de antimicrobianos, sendo eles, a produção de β-lactamases, a
hiperexpressão de sistemas de efluxo, a perda ou a redução da expressão de porinas e
alterações nas proteínas ligadoras de penicilinas (PBPs), tornando esses antimicrobianos
ineficazes contra infecções causadas por esses microrganismos.
A espécie A. baumannii está normalmente envolvida como agente etiológico de
infecções relacionadas à assistência à saúde, como infecções do sistema respiratório ou
de corrente sanguínea e são, frequentemente, responsáveis por surtos hospitalares de
difícil controle. A capacidade de sobreviver em condições adversas, em desenvolver ou
adquirir mecanismos de resistência aos antimicrobianos, aliado a sua resistência
intrínseca, torna as infecções causadas por esses microrganismos de difícil tratamento.
As altas taxas de resistência juntamente com a ausência de novas opções terapêuticas
disponibilizadas pelas indústrias farmacêuticas atualmente, tem levado à necessidade de
incluir novamente na prática clínica, drogas antigas como as polimixinas, que estavam
em desuso desde a década de 70, devido à nefrotoxicidade e à neurotoxicidade
relacionadas ao seu uso.
Segundo um estudo do Sentry Antimicrobial Surveillance Program, as polimixinas
permanecem
ativas
contra
a maioria
dos
microrganismos
não fermentadores
pertencentes às espécies A. baumannii e P. aeruginosa. Apesar disso, embora raro,
relatos de resistência a essas drogas já vem sendo observados em amostras clínicas,
2
Introdução
porém mais frequentemente em mutantes laboratoriais que apresentam resistência
induzida às polimixinas. Os diversos estudos que tentaram elucidar os mecanismos de
resistência às polimixinas não conseguiram esclarecer ainda o aparecimento dos dois
distintos fenótipos de resistência às polimixinas, observados na clínica, um mecanismo,
denominado “natural”, intrínseco ao isolado e, outro fenótipo, que é observado quando há
a exposição da bactéria à polimixina. Cada um dos fenótipos de resistência é,
provavelmente, regulado por diferentes sistemas, o que ainda necessita ser
extensivamente estudado.
Este estudo teve por objetivo avaliar as diferenças nos mecanismos de resistência
“natural” e induzida à polimixina B em isolados clínicos de A. baumannii e sua associação
com outros mecanismos de resistência aos betalactâmicos. Desta maneira, por meio da
compreensão dos distintos mecanismos bacterianos envolvidos na resistência às
polimixinas, esperamos entender como podemos menos favorecer a seleção de
resistência às polimixinas.
3
Revisão Bibliográfica
2. REVISÃO BIBLIOGRÁFICA
4
Revisão Bibliográfica
2. REVISÃO BIBLIOGRÁFICA
2.1 Acinetobacter baumannii
Microrganismos pertencentes ao gênero Acinetobacter spp. são coco-bacilos
Gram negativos que apresentam metabolismo oxidativo, sendo portanto, classificados
como parte do grupo dos não-fementadores. Dentre as espécies já descritas
pertencentes ao gênero Acinetobacter, A. baumannii é a espécie de maior importância
clínica, pois apresenta maior taxa de resistência aos antimicrobianos disponíveis, como
aminoglicosídeos, fluoroquinolonas e beta-lactâmicos (Vila et al., 2007’; Yau et al., 2009;
Gales et al., 2011). A. baumannii é um patógeno oportunista responsável por uma
variedade de infecções, como as do trato respiratório e de corrente sanguínea no
ambiente hospitalar, e, especialmente, em unidades de terapia intensiva (UTI)
(Monterrubio-Villar et al., 2009). Sua capacidade de sobreviver em superfícies inertes
(Jawad et al., 1998), bem como sua habilidade para trocar material genético e adquirir
determinantes de resistência aos antimicrobianos pode ter contribuído para o sucesso e a
longevidade deste microrganismo no ambiente nosocomial, e consequente disseminação
causando surtos de difícil controle (Higgins et al., 2010), já que geralmente os clones
responsáveis por esses surtos tornam-se endêmicas nas unidades acometidas.
Vila et al. (2007) descreve alguns fatores que favorecem a persistência de
Acinetobacter spp. no ambiente hospitalar, entre eles, a habilidade desses isolados em
sobreviver em ambientes com diferentes temperaturas e valores de pH, além de suas
necessidades nutricionais mínimas. Devido a sua maior persistência, a aquisição de
elementos genéticos móveis como plasmídios, transposons e integrons, que são
responsáveis pela transmissão de genes de resistência é favorecida entre diferentes
indivíduos pertencentes à mesma espécie ou não. Esses fatores limitam ainda mais as
opções terapêuticas disponíveis.
5
Revisão Bibliográfica
2.2 Opções terapêuticas e mecanismos de resistência
Devido ao fenótipo de multirresistência apresentado por isolados de A. baumannii,
as opções terapêuticas, como quinolonas e aminoglicosídeos, já não são mais eficazes
frente estes patógenos em muitos centros médicos mundiais. Os carbapenens são,
normalmente, os antimicrobianos de primeira escolha para o tratamento dessas
infecções. No entanto, desde o início da década de 90, surtos causados por isolados de
A. baumannii resistentes aos carbapenems tem sido descritos com maior frequência
(Wang et al., 2007; Giannouli et al., 2010).
Para isolados com resistência aos carbapenens, geralmente a tigeciclina e/ou as
polimixinas
podem
constituir
opções
terapêuticas
disponíveis
ou
os
únicos
antimicrobianos disponíveis para tanto. Embora a tigeciclina tenha sido somente
aprovada pela “Food and Drug Administration” (FDA) para o tratamento de infecções de
pele e partes moles, infecções intra-abdominais complicadas e pneumonia comunitária
(Tygacil, bula do medicamento, 2007), esse antimicrobiano tem sido frequentemente
utilizado no tratamento de infecções causadas por A. baumannii (Curcio et al., 2008).
Porém, devido à sua farmacocinética e ao mecanismo bacteriano responsável pela sua
resistência, hiperexpressão de sistemas de efluxo, estar presente no cromossomo
bacteriano, relatos de resistência à tigeciclina em A. baumannii tem surgido com uma
frequência cada vez maior (Peleg et al., 2007, Navon-Venezia et al., 2007; Horsey et al.,
2010; Al-Sweih et al., 2011). Desta maneira, as polimixinas e a associação de
ampicilina/sulbactam representam as principais opções terapêuticas empregadas no
tratamento das infecções causdas por A. baumannii resistentes aos carbapenens
(Oliveira et al., 2008).
2.2.1 β-Lactâmicos
No Brasil, os isolados de A. baumannii, em geral, apresentam taxas de resistência
aos carbapenems entre 25% a 45% (Levin et al., 1999). Entretanto, um estudo conduzido
por Prates et al. (2011) mostrou que a taxa de resistência aos carbapenenens isolados de
6
Revisão Bibliográfica
A. baumannii em uma UTI de um hospital terciário no sul do país aumentou de 29,4% em
2006 para 78% em 2008, muito acima da média nacional. O mesmo estudo mostrou que
a incidência de A. baumannii resistente aos carbapenens foi de 3,78/1000 pacientes-dia
durante o período de estudo (1,49 pacientes-dia em 2006 para 5,45 em 2008) e a
mortalidade observada nesses pacientes foi de 69,7%.
Os mecanismos de resistência aos β-lactâmicos em isolados clínicos de A.
baumannii
incluem:
(i)
produção
de
β-lactamases
(Poirel
et
al.,
2010);
(ii)
impermeabilidade de membrana externa associado à perda ou à diminuição da
expressão de porinas (Mussi et al., 2005) e, (iii) hiperexpressão de sistemas de efluxo
(Huang et al., 2008). No entanto, há informações limitadas sobre o papel das
modificações nas proteínas ligadoras de penicilina (PBPs) na resistência aos βlactâmicos em A. baumannii (Gehrlein et al., 1991; Obara & Nakae, 1991; FernándezCuenca et al., 2003; Cayô et al.; 2010).
2.2.1.2 Produção de β-lactamases
A produção de β-lactamases é o principal mecanismo de resistência aos βlactâmicos em A. baumannii e em outros bacilos Gram negativos. Estas enzimas se
encontram armazenadas no espaço periplásmico, por onde os β-lactâmicos precisam
atravessar para chegar até o seu sítio alvo que são as PBPs, localizadas na membrana
interna da célula bacteriana. Isolados clínicos de A. baumannii já foram descritos
carreando uma grande variedade de β-lactamases. As β-lactamases da classe C de
Ambler codificada pelo gene blaAmpC é cromossomal e, portanto, intrínseca em A.
baumannii. Distintamente do que ocorre em outros bacilos Gram negativos, que também
possuem as enzimas AmpC cromossomais, o gene blaAmpC não é induzível em A.
baumannii. Entretanto, a presença da sequência de inserção ISAba1 a montante deste
gene leva à sua hiperexpressãoe, consequentemente, resistência às cefalosporinas de
amplo espectro (Bush & Jacoby, 2010; Lee et al., 2011).
7
Revisão Bibliográfica
Outro grupo de β-lactamases também descrito em A. baumannii, são as
pertencentes a classe A de Ambler e ao grupo funcional 2be, conhecidas como βlactamases de espectro ampliado (ESβL) e por conferirem a resistência às cefalosporinas
de amplo espetro. Em A. baumannii já foram descritas ESβL do tipo TEM (Peleg et al.,
2008), SHV (Peleg et al., 2008), CTX-M (Peleg et al., 2008), PER (Opazo et al., 2012) e
GES (Bogaerts et al., 2010). Embora relatos já tenham sido descritos, acredita-se que a
prevalência de ESβL em isolados de A. baumannii seja relativamente baixa, quando
comparada àquelas apresentadas por isolados de enterobactérias e de P. aeruginosa.
As metalo-β-lactamases (MβLs), pertencentes à classe B de Ambler, são capazes
de degradar todos os antimicrobianos β-lactâmicos com exceção do aztreonam, e são
muito frequentes em isolados clínicos de P. aeruginosa. As MβLs também foram
descritas em isolados clínicos de A. baumannii, sendo o segundo grupo de
carbapanemases mais frequente nestes microrganismos. Os grupos de MβLs descritos
até o momento em A. baumannii foram do tipo IMP (Yamamoto et al., 2011), VIM (Huang
et al., 2008), SIM (Lee et al., 2005), e NDM-1 (Bogaerts et al., 2012). A carbapenemase
de classe A do tipo KPC, inicialmente descrita em isolados de K. pneumoniae nos
Estados Unidos, em 2001, se disseminou mundialmente, não somente para outras
espécies de enterobactérias, como também para isolados de P. aeruginosa e A
baumannii (Robledo et al., 2010). Outra carbapenemase pertecente a classe A de Ambler
também já foi descrita em A. baumannii, sendo esta do tipo GES (Bonnin et al., 2011).
Felizmente, essas enzimas ainda são restritas a determinadas regiões geográficas.
Dentre todas as β-lactamases produzidas por isolados de A. baumannii, as mais
importantes e prevalentes são aquelas pertencentes ao grupo das oxacilinases com
atividade frente aos carbapenems, conhecidas como CHDLs. As oxacillinases constituem
um grupo de β-lactamases com propriedades estruturais e bioquímicas heterogêneas
(Poirel et al., 2010), pertecentes a classe D de Ambler. Estas enzimas variam desde βlactamases de espectro limitado, capazes de hidrolisar somente a oxacilina, até βlactamases do tipo ESβL, com capacidade de hidrolisar também as cefalosporinas de
8
Revisão Bibliográfica
amplo espectro, e as CHDLs que hidrolisam os carbapenens menos eficientemente que
as MβLs. Em Acinetobacter spp., as oxacilinases do tipo ESβL são menos
frequentemente detectadas que as CHDLs, sendo que estas estão divididas em cinco
clusters principais. O cluster OXA-51, que está presente no cromossomo de A.
baumannii, podendo também ser encontrada concomitantemente em plasmídeos em
algumas regiões na Ásia (Lee et al., 2012). Nessa região, inclusive o plasmídeo
carreando o gene blaOXA-51 foi transferido para a espécie A. nosocomialis (Lee et al.,
2012). Os outros quatro clusters principais de CHDL são: o cluster OXA-23 (Paton et al.,
1993), o cluster OXA-24 (Bou et al., 2000), o cluster OXA-58 e o cluster OXA-143, que
podem estar localizados tanto no plasmídeo como no cromossomo bacteriano (Bush e
Jacoby, 2010; Poirel et al., 2010). No Brasil, a resistência aos carbapenens em isolados
clínicos de A. baumannii está principalmente associada à produção de OXA-23 (DallaCosta et al., 2003), seguida pela produção de OXA-143 (Antonio et al., 2011; Werneck et
al., 2011a; Mostachio et al., 2012) e da MβL IMP-1 (Gales et al., 2003). Esporadicamente,
isolados produtores de OXA-58 e de OXA-72 (variante do cluster OXA-24) foram
relatados no Brasil (Antonio et al., 2011; Werneck et al., 2011b). Assim como ocorre para
o gene blaAmpC, a expressão dos genes blaOXA-51-like, blaOXA-23-like e blaOXA-58-like também está
associada à presença de sequências de inserção. Diferente do que ocorre com as MβL,
os carbapenems não são seu substrato preferencial e não apresentam atividade frente às
cefalosporinas de amplo espectro (Poirel et al., 2010).
2.2.1.3 Alteração de porinas
Porinas são proteínas de membrana externa que formam canais para o transporte
de moléculas através das membranas, pois essas apresentam baixa permeabilidade aos
solutos hidrofílicos (Vila et al., 2007). Assim como ejeção do antimicrobiano por meio de
sistemas de efluxo, a redução da permeabilidade celular, por perdas ou modificações de
porinas pode desempenhar papel significativo no desenvolvimento de resistência aos
diversos antimicrobianos. A superfície celular de A. baumannii é menos permeável em
9
Revisão Bibliográfica
relação à superfície de outros bacilos Gram negativos, devido ao menor número e
tamanho das suas porinas (Obara et al., 2001; Sato e Nakae, 1991; Lee et al., 2011). A
proteína de membrana externa mais expressa em A. baumannii é a OmpHMP, de 35,6
kDa que é homóloga à porina OmpA e OprF de enterobactérias e P. aeruginosa,
respectivamente. Porinas pertencentes à família da OmpA permitem a penetração de
antimicrobianos β-lactâmicos e sacarídeos de até 800 Da (Gribum et al., 2003; Nitzan et
al., 1999).
Isolados de A. baumannii resistentes a imipenem apresentam perda ou diminuição
da expressão das porinas 33-36 kDa; CarO (29 kDa) e uma proteína de 43 kDa homóloga
à OprD de P. aeruginosa (Vila et al., 2007). Vila et al. (2007) sugere que as porinas CarO
e OprD-like possam funcionar como canais inespecíficos e específicos, respectivamente,
para entrada de carbapenens na célula de A. baumannii. Dois estudos brasileiros
avaliaram a associação entre a produção de β-lactamases e a alteração de porinas no
fenótipo de resistência aos carbapenens em isolados clínicos de A. baumannii (Costa et
al., 2000; Mostachio et al., 2012). O estudo de Costa et al. (2000) avaliou a indução da
resistência in vivo a imipenem em três pacientes após a terapia com este antimicrobiano.
Foram isolados de cada paciente duas cepas sendo uma antes e a outra após a terapia
com imipenem. Eles obervaram que em um dos pacientes houve a perda de uma porina
de 31-36 kDa (correspondente à porina 33-36 kDa) no isolado resistente, quando este era
comparado ao isolado sensível. Um estudo recente, Mostachio et al. (2012) verificaram
que na maioria dos isolados com altos níveis de resistência ao meropenem havia tido a
perda de uma porina de 43 kDa. O mesmo estudo verificou também a perda da porina
33-36 kDa. Nesses isolados os autores verificaram uma alta prevalência da OXA-143,
seguido de OXA-23 e IMP-1.
2.2.1.4 Hiperexpressão de sistemas de efluxo
Associada à produção de enzimas, a hiperexpressão de sistemas de efluxo tem
sido relacionada a altos níveis de resistência aos β-lactâmicos em isolados de A.
10
Revisão Bibliográfica
baumannii. A hiperexpressão do sistema de efluxo AdeABC pertencente à família RND
(“Resistance-Nodulation-Division”) promove a resistência aos aminoglicosídeos, aos βlactâmicos,
ao
cloranfenicol,
à
eritromicina,à
tetraciclina,
à
tigeciclina
e
às
fluoroquinolonas (Magnet et al., 2001; Resenfeld et al., 2012), O sistema AdeABC é
composto por três proteínas: AdeA, uma proteína de fusão de membrana; AdeB, a
proteína que faz o transporte e; AdeC, a proteína de membrana externa. Esse sistema de
efluxo é o mais descrito em espécies de Acinetobacter spp. e tem sido relacionado com
níveis mais elevados de resistência aos carbapenens em isolados produtores de OXA-23
(Lee et al., 2010; Lee et al., 2011). A hiperexpressão deste sistema é regulada pelos
genes adeR e adeS (Coyne et al., 2010; Marchand et al., 2004).
O sistema de efluxo AdeFGH possui como substrato os antimicrobianos
cloranfenicol, clindamicina, fluoroquinolonas, trimetoprim, tetraciclina, tigeciclina e
sulfonamidas (Coyne et al., 2010). O aumento da expressão desse sistema de efluxo é
devido à mutação do gene adeL, localizado à montante do gene adeFGH que codifica a
proteína reguladora transcricional LysR (Coyne et al., 2010).
Outro sistema de efluxo AdeIJK está presente em todos os isolados de A.
baumannii e promove resistência à ticarcilina, às cefalosporinas, ao aztreonam, às
fluoroquinolonas, à tetraciclina, à tigeciclina, às lincosamidas, à rifampicina, ao
cloranfenicol, ao cotrimazole, à novobiocina e ao ácido fusídico. O sistema regulatório da
hiperexpressão desse sistema de efluxo foi descrito recentemente por Rosenfeld et al.
(2012) e envolve o gene adeN que atua reprimindo a expressão de AdeIJK.
A família de sistemas de efluxo MFS (“Major Facilitator Superfamily”) também é
encontrada em A. baumannii. O sistema de efluxo Tet é responsável pela resistência à
tetraciclina em bactérias Gram negativas e seus genes podem estar presentes em
transposons que estão inseridos em plasmídios normalmente conjugativos. Esse sistema
de efluxo é regulado pela presença da tetraciclina. Na ausência dessa droga, a proteína
repressora bloqueia a transcrição dos genes estruturais do sistema de efluxo (Chopra e
Robertz, 2001). Em isolados de A. baumannii os principais sistemas dessa família são
11
Revisão Bibliográfica
TetA que confere resistência à tetraciclina e TetB que confere resistência à tetraciclina e
à minociclina. A tigeciclina não é afetada por esses sistemas de efluxo; porém, é ejetada
pelo sistema AdeABC (Martí et al., 2006).
A família MATE (“Multidrug and toxic compound extrusion”) inclui o sistema de
efluxo AbeM que confere resistência à norfloxacina, à ciprofloxacina, à gentamicina, à
canamicina, à eritromicina, ao cloranfenicol, ao trimetoprim, além de alguns antissépticos.
Esse sistema utiliza a força próton-motriz para ejetar os antimicrobianos da célula
bacteriana (Su et al., 2005).
2.2.1.5 Alterações de PBPs
Na membrana interna da parede celular bacteriana estão localizadas as PBPs,
que são responsáveis pela síntese do peptideoglicano e constituem o alvo de ação dos
antimicrobianos β-lactâmicos. O peptidioglicano é composto por cadeias de glicano
formadas alternadamente pelo ácido acetilglicosamina e pelo ácido acetilmurâmico. Cinco
aminoácidos são ligados ao ácido acetilmurâmico. (Ghuysen et al., 1968; Schleifer e
Kandler, 1972; Vollmer et al., 2004; Vollmer et al., 2008). Na transglicosilação, as PBPs
catalizam a polimerização de cadeias de glicano e, na transpeptidação, essas proteínas
promovem a ligação cruzada entre as cadeias laterais de peptideoglicano. Dessa forma,
essas proteínas são responsáveis por determinar a forma da célula bacteriana e
assegurar que essa seja mantida por gerações seguintes. O peptideoglicano celular
intacto permite à célula bacteriana resistir a danos devido às pressões intracelular e
extracelular (Sauvage et al., 2008).
As PBPs são divididas em duas categorias, as PBPs de alto peso molecular e as
PBPs de baixo peso molecular. As PBPs de alto peso molecular são PBPs
multifuncionais responsáveis pela polimerização do peptídioglicano e inserção do mesmo
na parede celular pré-existente (Goffin e Ghuysen, 1998; Born et al., 2006). Dependendo
de sua estrutura e atividade catalítica do seu domínio N-terminal elas são pertencentes
às classes A ou B. Nas PBPs de classe A de Escherichia coli, chamadas PBP1a, PBP1b
12
Revisão Bibliográfica
e PBP1c, o domínio N-terminal é responsável pela atividade de glicosiltransferase,
catalizando a elongação de cadeias de glicano não ligadas. Nas PBPs de classe B,
chamadas PBP2 e PBP3, o domínio N-terminal desempenha papel na morfogênese
celular e não possuem atividade de glicosiltransferase (Höltje et al., 1998; Zapun et al.,
2008). Em ambas as classes A e B, o domínio C-terminal cataliza a ligação cruzada entre
as duas cadeias de glicano através da atividade de transpeptidase (Sauvage et al., 2008).
As PBPs 1a e 1b, são as principais transpeptidases e transglicosilases da célula
bacteriana. Entretanto, a deleção de apenas uma dessas duas proteínas não é letal para
a célula bacteriana. A função da PBP1c ainda não foi completamente elucidada até o
momento, e não está presente em todos os bacilos Gram negativos. Ela não sofre
alteração pela maioria dos antimicrobianos β-lactâmicos e sua hiperexpressão não supre
a ausência da PBP1a e da PBP1b. As PBPs de classe B são transpeptidases
monofuncionais, onde a PBP2 tem função de elongase, enquanto a PBP3 está envolvida
no complexo de divisão celular.
As PBPs de baixo peso molecular ou de classe C podem ser subdivididas nas
subclasses C1, C2 e C3 (Sauvage et al., 2008). Essas proteínas estão envolvidas na
separação celular, maturação e reciclagem do peptideoglicano. A PBP4 e PBP7 são
endopeptidases que clivam as ligações cruzadas entre as duas cadeias de glicano,
entretanto, parecem que a PBP4 não é encontrada no genoma de A. baumannii (Cayô et
al., 2011). A PBP5 é a principal carboxipeptidase e é responsável pela clivagem do
domínio terminal D-Ala-D-Ala tornando a cadeia de peptídio disponível para a
transpeptidação (Spratt e Strominger, 1976). Em E. coli, as PBP6 e PBP6b possuem
sequencias homólogas à sequencia da PBP5 e, assim como ela, também possuem ação
de carboxipeptidase. Em isolados de Acinetobacter spp. somente a PBP6 é idêntica à
PBP5 (Cayô et al., 2011). As outras PBPs de baixo peso moleculas já descritas PBP4b e
AmpH possuem função desconhecida (Sauvage et al., 2008).
As PBPs possuem variado grau de afinidade pelos β-lactâmicos e, dessa forma,
alterações nessas proteínas são responsáveis pelo desenvolvimento de resistência à
13
Revisão Bibliográfica
esses antimicrobianos (Sauvage et al., 2008). Ainda existem poucos estudos em relação
à participação de PBPs na resistência aos β-lactâmicos em isolados de A. baumannii
(Gehrlein et al., 1991; Obara & Nakae, 1991; Fernández-Cuenca et al., 2003; Cayô et al.;
2011). Gehrhein et al. (1991) associou alterações nas PBPs de isolados clínicos de A.
baumannii com resistência à imipenem nesses isolados.
2.2.2 Polimixinas
As polimixinas são antimicrobianos polipeptídicos descobertos em 1947 como
produto
do
microrganismo
de
solo
Paenibacillus
(Bacillus)
polymyxa.
Esses
antimicrobianos são utilizados na prática clínica nas formas de polimixina B e E, essa
última também chamada de colistina. A estrutura química das duas polimixinas se
diferencia pela presença de um único aminoácido na mesma posição, D-Leucina na
molécula de colistina e D-Fenilalanina na molécula de polimixina B (Bergen et al., 2006),
conforme mostrado na Figura 1. O sulfato de colistina é utilizada somente na formulação
tópica, enquanto que o colistimetato de sódio é uma preparação para uso parenteral e
seus principais componentes são colistina A e colistina B (Figura 2), que diferem em sua
composição pelo resíduo de ácidos graxos (Landman et al., 2008). Desde sua descoberta
até a década de 1960, essas drogas eram opções terapêuticas frequentemente usadas
para o tratamento de infecções graves por bacilos P. aeruginosa. A partir da década de
1970, as polimixinas foram gradativamente substituídas pelas cefalosporinas de amplo
espectro e pelos aminoglicosídeos, que apresentavam o espectro de atividade,
semelhante, mas com menor toxicidade. Até a década de 1990, as polimixinas eram
utilizadas somente em formulações tópicas ou inalatórias no tratamento de infecções não
graves ou na prevenção da colonização por P. aeruginosa em pacientes com fibrose
cística, respectivamente (Li et al., 2006a).
14
Revisão Bibliográfica
A molécula de polimixina consiste de uma cadeia lateral de ácidos graxos ligada a
um anel peptídeo policatiônico composta de dez aminoácidos. Por serem compostos
catiônicos,
as
polimixinas
possuem
alta
afinidade
por
superfícies
carregadas
negativamente, como o lipopolissacarídeo (LPS)
(
da membrana externa bacteriana. Os
antimicrobianos
icrobianos dessa classe agem na membrana celular externa da parede celular
bacteriana, deslocando as moléculas
léculas de cálcio e magnésio que estabilizam o LPS,
promovendo o aumento da permeabilidade celular. Logo após, essas drogas interagem
da mesma forma com a membrana interna da célula, promovendo a liberação dos
componentes celulares, levando
lev
à morte celular bacteriana (Hancock,
Hancock, 1997).
1997
Figura 1: Estrutura química das moléculas de polimixinas.
polimixina A: Molécula de polimixina B;
B: Molécula de colistina. Adaptado de Bergen et al., 2006.
15
Revisão Bibliográfica
Figura 2: Estrutura química da colistina - A e do colistimetato de sódio - B (Li et al.,
2006b).
Atualmente, as taxas de infecção causada por bactérias Gram negativas
resistentes à maioria dos antimicrobianos utilizados comumente na clínica tem
aumentado com grande rapidez, restringindo cada vez mais as opções terapêuticas.
Associado
a
esse
fato,
a
indústria
farmacêutica
não
tem
produzido
novos
antimicrobianos, para os quais as bactérias ainda não tenham desenvolvido mecanismo
de resistência. Dessa forma, as polimixinas foram novamente introduzidas na prática
clínica, em alguns casos, como a última opção terapêutica ainda efetiva.
As polimixinas possuem um amplo espectro de ação contra bactérias Gram
negativas, com algumas exceções, como, Proteus spp. Burkholderia spp., Serratia spp.,
Morganella morgannii e Providencia spp., que apresentam resistência intrínseca a esse
agente antimicrobiano. A resistência às polimixinas ainda é rara entre microrganismos
não fermentadores, como Acinetobacter spp. e P. aeruginosa (Gales et al., 2001; Gales
et al., 2006). Um estudo recente do Sentry Antimicrobial Surveillance Program apontou
16
Revisão Bibliográfica
que polimixina B ainda apresenta excelente atividade contra bactérias Gram negativas,
incluindo aquelas que apresentam resistência aos carbapenens. No entanto, esses
autores observaram uma tendência a um aumento da resistência às polimixinas entre os
isolados de K. pneumoniae de hospitais localizados na América Latina. Esses isolados
apresentam concentrações inibitórias mínimas (CIMs) de polimixina B e colistina mais
elevadas do que as observadas entre isolados não fermentadores que apresentam esse
fenótipo (Gales et al., 2011; Sader et al., 2011).
2.2.2.1 Mecanismos de resistência às polimixinas
O mecanismo de resistência às polimixinas não está completamente elucidado até
o momento. Em geral, são observados dois fenótipos de resistência, o primeiro,
denominado resistência natural, provavelmente resultante de mutação no genoma
bacteriano e que promove baixo grau de resistência com CIMs próximas aos pontos de
corte para mudança de categoria de sensibilidade. O segundo fenótipo de resistência às
polimixinas é denominado mecanismo adaptativo, no qual a bactéria, inicialmente
sensível, desenvolve resistência às polimixinas após à exposição cem concentrações
crescentes de polimixinas. Esse último mecanismo pode levar a CIMs bem mais
elevadas, acima de 128 µg/mL e pode ser um fenótipo reversível, dependendo da
espécie bacteriana, na ausência da pressão seletiva estabelecida pela droga (Skiada et
al., 2011). Dessa forma, a utilização do antimicrobiano em doses não suficientes para
erradicação do patógeno pode contribuir para o surgimento do fenótipo adaptativo de
resistência às polimixinas.
A parede celular de bactérias Gram negativas é formada por uma membrana
interna que separa o conteúdo intracelular do espaço periplasmático onde estão
presentes as betalactamases, seguida por uma camada fina de peptideoglicano. Esses
microrganismos possuem a membrana externa fosfolipídica envolvendo a célula. A
17
Revisão Bibliográfica
parede celular bacteriana é ancorada por moléculas de LPS que cobrem
cobre a área externa
total da superfície celular bacteriana, com exceção dos espaços ocupados pelas porinas
(Nikaido, 2003). O LPS é composto por três regiões,, em sua extremidade mais interna,
por um lipídio A, na porção central por um core de oligossacarídeo
arídeo e, em sua
extremidade mais externa,, por um antígeno O (Figura 3).
Figura 3. Desenho esquemático da parede celular bacteriana de bactérias Gram
negativas (Adaptado de Brock, 2003).
Lipídio A é a porção que ancora o LPS na superfície da membrana interna e é
composto por fosfolipídioss baseados em moléculas de glicosamina. O lipídio A é a
endotoxina bacteriana, responsável por ativar os receptores do sistema imunológico TollToll
Like 4, desencadeando a resposta inflamatória,
inflamatória que pode levar ao choque tóxico (Raetz e
Whitfield, 2002; Koch et al.,
., 2012;
2012 Triantafilou et al., 2012).. Devido à grande afinidade da
18
Revisão Bibliográfica
molécula de polimixina pelo lipídio A, cuja carga é negativa, essa droga também
apresenta atividade anti-endotoxina (Chen et al., 2010).
O core de oligossacarídeo é uma pequena porção central do LPS dividida em core
externo e core interno (lipídio A proximal), esse último é composto por heptose e resíduos
de ácido 3-deoxi-D-manno-oct-2-ulosonico (KDO). Assim como o lipídio A, o core de
oligossacarídeo é uma região altamente conservada e desempenha papel crucial na
estabilização das funções de barreira da membrana externa bacteriana (Heinrichs et al.,
1998; Nikaido, 2003). Durante sua formação, o core de oligossacarídeo é agregado a um
lipídio A pré-formado, por transferência sequencial do radical glicosil a partir de
precursores de açúcares. Esse processo envolve um complexo de glicosiltransferases
associadas à membrana, agindo na face interna da membrana celular interna. Após a
síntese do LPS, o MsbA, um transportador do tipo ABC, é responsável por lançar o lipídio
A através da membrana (Heinrichs et al., 1998; Nikaido, 2003).
A porção do antígeno-O é a mais externa da molécula de LPS e, dessa forma,
define as propriedades da superfície celular em espécies que não produzem cápsula.
Essa porção do LPS é importante para fugir do ataque do sistema imunológico do
hospedeiro. Para isso, essa porção é menos conservada do que o lipídio A e o core de
oligossacarídeo. Microrganismos produtores de cápsula podem não possuir o core de
oligossacarídeo em seu LPS, ou esse não estar aparente na superfície celular (Nikaido,
2003).
Estudos em Salmonella enterica foram os primeiros a demonstrar a associação
entre alterações no LPS bacteriano e diminuição da sensibilidade às polimixinas. A
principal alteração encontrada foi uma adição de 4-amino-arabinose na porção do lipídio
A do LPS (Castelli et al., 2000; Navarre et al., 2005). Logo após os estudos com S.
enterica, essas alterações de LPS também foram descritas em outras espécies, inclusive
entre microrganismos não fermentadores (Gunn et al., 1998; Moskowitz et al., 2004;
Winfield et al., 2005). Em geral, alterações no LPS bacteriano são descritas como
19
Revisão Bibliográfica
responsáveis por alterações na carga de superfície da célula bacteriana e redução na
afinidade do antimicrobiano pela parede celular.
A regulação gênica do desenvolvimento de resistência às polimixinas, por meio de
alterações no LPS conhecida até o momento, é realizada pelos sistemas de dois
componentes (“Two Component Systems”). Esses sistemas são ativados por fatores
ambientais, como, presença de ferro, concentrações elevadas de cálcio ou baixas de
magnésio, ou ainda, alterações do pH no meio. A presença de polimixinas no meio
também desencadeia a ativação desses sistemas (Groisman et al., 1997, Moskowitz et
al., 2012).
Esses sistemas de dois componentes são sistemas globais de regulação gênica,
utilizados por diversas espécies bacterianas para regulação da expressão de diferentes
fatores de resistência e também de virulência. Eles são constituídos por uma proteína
sensor de histidina quinase que percebe estímulos ambientais, sofrendo uma reação de
autofosforilação, ativando uma segunda proteína citoplasmática, por uma reação de
transfosforilação. A segunda proteína, então, promove a ativação ou a repressão dos
genes alvo, desencadeando a resistência às polimixinas (Gooderhan e Hancock, 2009).
Estudos com isolados de K. pneumoniae mostraram a participação dos sistema
PhoPQ e PmrAB em diferentes condições ambientais para o desenvolvimento de
resistência às polimixinas (Mitrophanov et al., 2008, Mitrophanov e Groisman, 2008).
Mitrophanov et al. (2008) observaram que em baixas concentrações de magnésio, o
sistema PhoPQ é ativado promovendo a expressão do gene pmrD. Tanto a expressão de
pmrD, quando a presença de ferro estimulam a ativação do sensor quinase pmrB, que
promove a ativação de PmrA, que por sua vez, leva a modificações no LPS bacteriano
em K. pneumoniae e à resistência às polimixinas. O mesmo grupo de pesquisa, em
estudos anteriores avaliando outras enterobactérias como S. enterica e E. coli,
mostraram a participação desses dois sistemas. No entanto, nessas duas espécies, tanto
20
Revisão Bibliográfica
o sistema PhoPQ quanto o sistema PmrAB ativaram
ativa m diretamente o gene pmrD (Figura 4,
Kato et al., 2003; Kato et al., 2007).
Figura 4. Esquema da regulação do desenvolvimento de resistência às polimixinas
polim
por
isolados de Enterobactérias controlado por sistemas de dois componentes. A. Sistema
regulatório em S. enterica. B. Sistema regulatório em K. pneumoniae (Mitrophanov et al.,
2008).
A resistência às polimixinas em isolados de P. aeruginosa envolve uma complexa
rede de sistemas de dois componentes. Até este momento, o envolvimento de três destes
sistemas com resistência às polimixinas foram descritos,, o sistema PmrAB, PhoPQ e,
mais recentemente, o sistema ParR/S (Barrow e Kwon, 2009; Fernández et al., 2010;
Miller et al.,
., 2011; Moskowitz et al., 2012). Alterações
ções no sistema PmrAB,
PmrA por meio de
mutações no gene pmrB,, associado à expressão dependente de pmrA,
pmrA representam
importantes mecanismos de regulação de resistência às polimixinas (Barrow e Kwon,
2009; Moskowitz et al.,
., 2012). O sistema PhoPQ
PhoPQ está envolvido na modificação do lipídio
lip
A do LPS de bactérias Gram negativas, devido à mutações que levam a perda de função
do gene phoQ e contribuem para o desenvolvimento de altos níveis de resistência às
polimixinas
limixinas (Barrow e Kwon, 2009; Miller et al., 2011). Ambos os sistemas, PmrAB e
PhoPQ,
Q, promovem modificações na expressão do operon arnBCADTEF
BCADTEF responsável pela
adição de 4-amino-arabinose
arabinose no lipídio A, que leva à alteração no fenótipo de resistência
21
Revisão Bibliográfica
às polimixinas. O sistema de dois componentes ParRS foi o último descrito até o
momento em isolados de P. aeruginosa com resistência adaptativa às polimixinas. Esse
sistema foi relacionado a mutações no operon arnBCADTEF na presença de
concentrações subinibitórias de polimixina, que levaram à modificações no LPS e
conseqüente resistência à mesma (Fernández et al., 2010).
Em A. baumannii, somente o operon pmrCAB foi descrito, até o momento, como
relacionado à resistência às polimixinas. Seus genes compõem um sistema de dois
componentes, onde o pmrB é o sensor de histidina quinase e o pmrA é a proteína
reguladora da resposta. Esse sistema controla a expressão do gene pmrC o qual é
responsável pela adição de fosfoetanolamina ao lipídio A do LPS da parede celular
bacteriana levando à resistência bacteriana (Figura 5). Mutações nos genes pmrA ou
pmrB também promovem diminuição da sensibilidade às polimixinas (Adams et al., 2009;
Arroyo et al., 2011).
22
Revisão Bibliográfica
Figura 5: Desenho esquemático do sistema de dois componentes que regula o
desenvolvimento de resistência à polimixinas em isolados de A. baumannii (A). Operon
PmrCAB (B). Adaptado de Mitrophanov et al., 2008.
Em 2010, Moffat et al.
al relataram a perda total do LPS bacteriano em isolados de
A. baumannii com resistência in vitro à colistina. Esses autores observaram a mutação no
gene que codifica o LPS, lpxA,, que levou a perda total do LPS da parede celular
bacteriana. Moffat et al. (2010) ainda sugerem que esses isolados
ados conseguiram elaborar
uma parede celular na ausência de LPS para sobreviver às pressões externas e internas.
Esses autores afirmaram
m que a perda do LPS promoveu a diminuição da integridade da
parede celular bacteriana e, consequentemente levou a mudanças
mudanç
no perfil de
sensibilidade dos isolados de A. baumannii.. Alguns estudos descrevem a mudança do
perfil de sensibilidade com reversão da resistência aos antimicrobianos, incluindo aqueles
23
Revisão Bibliográfica
para os quais os isolados de Acinetobacter spp. são intrinsecamente resistentes (Gordon
et al., 2010; Cai et al., 2012). Alguns autores sugerem, tanto em estudos in vivo quanto in
vitro, o uso da associação sinérgica de polimixinas a outros antimicrobianos como
carbapenens, tigeciclina, vancomicina, rifampicina, ampicilina/sulbactam ou amicacina,
para tratamento de infecções graves causadas por A. baumannii (Fulnecky et al., 2005;
Biancofiore et al., 2007; Pantopoulou et al., 2007; Bassetti et al., 2008; Song et al., 2008;
Principe et al., 2009; Candel et al., 2010; Pankuch et al., 2010; Rodriguez et al., 2010;
Hornsey et al., 2011; Santimaleeworagun et al., 2011; Sheng et al., 2011; Shields et al.,
2011; Peck et al., 2012).
Além de alterações no LPS bacteriano, a produção de cápsula polissacarídica já
foi relacionada com a diminuição da sensibilidade às polimixinas em isolados de K.
pneumoniae (Llobet et al., 2008; Cheng et al., 2010). Cheng et al. (2010) observaram que
amostras mutantes para o gene ugd, responsável pela biossíntese de cápsula
apresentavam maior sensibilidade às polimixinas em relação à cepa selvagem, o que
demonstra que, nessa espécie, a produção de cápsula também está envolvida com
resistência às polimixinas.
A membrana externa da parede celular de bactérias Gram negativas permite a
passagem de moléculas de nutrientes pequenas e lipofílicas. No entanto, sua natureza
hidrofóbica dificulta a entrada de solutos hidrofílicos por ela, como a maioria dos
nutrientes celulares. Sendo assim, a parede celular bacteriana possui canais formados
por proteínas que permitem a entrada dessas moléculas e a saída de moléculas tóxicas
para a célula. Essas proteínas são denominadas porinas e servem de porta de entrada
para os antimicrobianos hidrofílicos na célula bacteriana. Dessa forma, a perda ou a
diminuição na expressão de porinas contribuem para a resistência. A regulação da
expressão de porinas em resposta à presença de antimicrobianos é uma estratégia de
sobrevivência desenvolvida por bactérias de diferentes espécies (Nikaido, 2003). Um
estudo conduzido por Vila e colaboradores (2007) observou que a redução na expressão
24
Revisão Bibliográfica
da porina OmpW (21 kDa) foi observada em isolados mutantes resistentes à colistina de
A. baumannii selecionados in vitro, demonstrando um possível papel dessa porina na
resistência a essa classe de antibióticos (Vila et al., 2007; Lee et al., 2011).
Em 2006, Li et al. (2006b) descreveram o aparecimento de heterorresistência à
colistina em isolados de A. baumannii. Heterorresistência é denominada quando é
detectado o surgimento de uma subpopulação resistente em uma população de isolados
sensíveis à colistina. Após esse estudo, outros relatos de heterorresistência à colistina
começaram a ser publicados em todo o mundo (Ko et al., 2007; Yau et al., 2009;
Rodriguez et al., 2009; Chang et al., 2012). Entretanto, o conceito de heterorresistência
ainda não é concenso entre pesquisadores. Ainda não se sabe se a base para essa
resistência é a presença de uma população de indivíduos geneticamente distintos ou se a
variação no sistema regulatório entre indivíduos idênticos pode ser suficiente para a
expressão de resistência às polimixinas (Adams et al., 2009). Segundo Cai et al. (2012),
a prévia exposição à colistina contribui para o desenvolvimento de heterorresistência,
selecionando isolados com CIMs mais elevadas, o que pode levar a falha terapêutica. O
uso inapropriado do antimicrobiano é um fator de risco tanto para o surgimento de
heterorresistência quanto para o aparecimento dos fenótipos de indução de resistência
nos isolados clínicos. Hawley et al. (2008) observaram em seu estudo que, dos pacientes
com infecções por A. baumannii que estavam recebendo polimixina em seu tratamento,
eram isoladas cepas com CIMs para polimixinas extremamente elevadas, acima dos
pontos de corte para mudança de categoria de sensibilidade. Esses autores ressaltam a
importância em monitorar a emergência de resistência durante o uso prolongado de
polimixinas para evitar falha terapêutica em tratamento por infecções causadas por A.
baumannii multirresistentes. Lopez-Rojaz et al. (2011) sugerem que as taxas de
resistência às polimixinas ainda são baixas devido à um custo energético sofrido pelo
isolado bacteriano para o desenvolvimento do fenótipo de resistência, reduzindo seu
fitness. Entretanto, Rolain et al. (2011) afirmam que essas taxas de resistência
25
Revisão Bibliográfica
aumentarão assim que o uso da droga se tornar mais comum, levando ao
desenvolvimento de resistência por adaptação à pressão seletiva exercida pela droga. AlSweih et al. (2011) prevê grandes problemas clínicos assim que a atividade das
polimixinas for reduzida e não existirem outras opções terapêuticas disponíveis para o
tratamento de infecções por bacilos Gram negativos multirresistentes.
26
Objetivos
3. OBJETIVOS
27
Objetivos
3. OBJETIVOS
3.1 Geral.
Estudar os mecanismos de resistência, “natural” e induzida, à polimixina B em
isolados clínicos de Acinetobacter baumannii e sua associação com os mecanismos de
resistência a antimicrobianos.
3.2 Específicos.
•
Promover a indução de resistência à polimixina em isolados de A. baumannii
sensível e naturalmente resistente à polimixina B;
•
Confirmar a similaridade genética entre os isolados de A. baumannii antes e após
a indução de resistência à polimixina B;
•
Avaliar a estabilidade do fenótipo de resistência induzida à polimixina B;
•
Avaliar o perfil de sensibilidade aos antimicrobianos de cada isolado de A.
baumannii, antes e após a indução de resistência à polimixina B;
•
Avaliar a estrutura da célula bacteriana dos isolados de A. baumannii antes e
após a indução de resistência à polimixina B por meio de microscopia eletrônica
de transmissão.
•
Realizar o sequenciamento e análise de transcrição do sistema de dois
componentes PmrAB dos isolados de A. baumannii antes a após a indução de
resistência à polimixina B;
•
Avaliar a interferência da indução de resistência à polimixina B com outros
mecanismos de resistência que atuam na síntese da parede celular por meio da
análise das proteínas de membrana externa, das proteínas ligadoras de
penicilinas e do sistema de efluxo AdeABC.
28
Material e Métodos
4. MATERIAL E MÉTODOS
29
Material e Métodos
4.
MATERIAL E MÉTODOS
4.1 Fluxograma.
No fluxograma abaixo encontram-se resumidamente descritos os testes realizados
neste estudo:
Estabilidade do
A027 (S)
Indução de
A009 (R)
resistência à
fenótipo de
resistência
polimixina B
Microscopia
Análise da
similaridade
A027 e A027Ind
eletrônica de
genética por PFGE
A009 e A009Ind
transmissão
Cultura em meio
Teste de sensibilidade
hipotônico
aos antimicrobianos
Sequenciamento
PmrAB
ANÁLISE DOS MECANISMOS DE RESISTÊNCIA
qRT-PCR
RELACIONADOS À PAREDE CELULAR
PmrAB
Efluxo
Porina
PBPs
qRT-PCR
qRT-PCR
Sequenciamento
SDS-PAGE
30
Material e Métodos
4.2 Seleção dos isolados bacterianos
Foi selecionado para este estudo um isolado clínico de A. baumannii resistente à
polimixina B, A009 (CIM, 16 µg/mL), isolado em 30/06/2007 de um paciente
diagnosticado com infecção do trato respiratório inferior, que não recebeu polimixina B
durante seu tratamento. A partir do isolado resistente, para fins comparativos, foi
selecionado um isolado de A. baumannii sensível à polimixina B, A027 (CIM, 0,25 µg/mL),
recuperado também de um paciente com infecção de trato respiratório inferior, na mesma
época (30/06/2007). Ambos isolados estavam armazenados no banco de microrganismos
do Laboratório Especial de Microbiologia Clínica (LEMC). Neste estudo, foi denominada
resistência “natural”, aquela resistência observada no isolado A009, sem exposição às
polimixinas. A resistência apresentada após o subcultivo na presença de polimixina B foi
denominada resistência induzida.
O perfil de sensibilidade à polimixina B havia sido previamente determinado pelo
laboratório clínico e, após a seleção dos isolados, foi confirmado pela técnica de
microdiluição em caldo, de acordo com o item 4.3.
Os isolados foram inicialmente identificados pelo método automatizado Phoenix
System (BD Diagnostics). A identificação foi confirmada pelo sequenciamento da porção
16S do rRNA de aproximadamente 1500bp, utilizando as sequência de oligonucleotídeos
16S-8F e 16S-1493R contidas na Tabela 1, nas seguintes condições de termociclagem:
desnaturação inicial à 94ºC por 5 min, seguida por 35 ciclos de desnaturação a 94ºC por
20 segundos, anelamento dos primers a 53ºC por 45 segundos e extensão das fitas a
72ºC por 30 segundos, e uma extensão final à 72ºC por 10 minutos (Mendes et al., 2007).
Após a identificação, foi realizada a caracterização dos isolados quanto à
presença de genes codificadores de CHDLs, de acordo com as metodologias descritas
por Woodford et al., 2006.
31
Material e Métodos
4.3 Indução de resistência à polimixina B
Os dois isolados de A. baumannii, sensível e resistente à polimixina B,
B foram
submetidos ao cultivo em concentrações crescentes de sulfato de polimixina B (SigmaAldrich,, St Louis, MO, USA),
USA em dias consecutivos, até a obtenção de isolados
resistentes à polimixina B.
B Os subcultivos começaram a ser realizados utilizando uma
diluição de polimixina B de 0,125 µg/mL, abaixo da concentração inibitória
inibitóri mínima (CIM)
dos isolados, até atingir a concentração de 64 µg/mL
g/mL em meio de cultura sólido Luria
Bertani (LB) (Oxoid, Basingstoke, Inglaterra) (Figura 6). Os isolados com resistência
induzida à polimixina B foram submetidos no total a nove passagens de subcultivos em
meio LB Agar até a obtenção da cepa resistente.
Figura 6. Desenho esquemático das passagens de subcultivos na presença de
concentrações crescentes de sulfato de polimixina B para a indução de resistência à
mesma, nos isolados de A. baumannii.
32
Material e Métodos
4.4 Estabilidade da resistência induzida à polimixina B
Após a obtenção dos mutantes resistentes pela indução, esses isolados foram
submetidos ao subcultivo em dias consecutivos em ágar LB na ausência de polimixina B,
para verificar a estabilidade do fenótipo de resistência induzida na presença da droga e
verificar se a CIM retornaria ao valor inicial, observado antes da indução.
4.5 Análise da similaridade genética por “Pulsed Field Gel Eletrophoresis”
(PFGE)
A relação genética entre os isolados de A. baumannii, antes e após o cultivo na
presença de polimixina B, foi avaliada pela técnica de PFGE com o objetivo de comprovar
que os isolados estudados permaneciam os mesmos, após os diversos repiques
realizados na presença de polimixina B descartando, assim, a possibilidade de
contaminação.
As amostras foram incubadas por 18 horas em 10 mL de caldo LB (Oxoid,
Basingstoke, Inglaterra) e, então, centrifugadas por 20 minutos a 3000 rpm. O
sobrenadante foi desprezado e o precipitado, contendo as células bacterianas, diluído em
1 mL de solução salina, homogeneizado e transferido para tubo de microcentrífuga
previamente pesado.
Os tubos foram centrifugados por 5 minutos a 12000 rpm e o sobrenadante
removido. O sedimento bacteriano foi diluído em solução salina, na proporção 1:1 entre o
volume de diluente e o peso do material obtido pela centrifugação. Esse último valor foi
calculado pela subtração do peso do tubo vazio pelo peso do tubo contendo o precipitado
de células. Após minuciosa homogeneização, 40 µL da mistura foi transferido para outro
tubo contendo 300 µL de tampão TEN (Tris 100 mM pH 7,5; EDTA 100 mM, NaCl 150
mM). Foi adicionado, então, 340 µL de agarose de baixo ponto de fusão e colocado em
moldes para a formação de blocos de gel.
33
Material e Métodos
Depois de solidificados, os blocos foram incubados a 37ºC, por no mínimo 4 horas
em solução EC (Tris 6 mM pH 6,5, NaCl 1 M; EDTA 0,01 M, Brij 58 0,5%, Sarcosil 0,5% e
Deoxiglicolato 0,2%). A solução de EC foi removida e substituída por 2 mL de solução ES
(EDTA 0,4 M pH 9,3 e Sarcosil 10%) contendo 1 mg/mL de proteinase K 20 mg/mL. As
amostras foram incubadas por 12 horas a 50ºC. Após o tratamento com proteinase K,
foram realizadas quatro lavagens com CHEF-TE (Tris 0,1 M pH 7,5, EDTA 0,1 M), de 30
a 60 minutos cada. Os blocos foram armazenados em CHEF-TE. O DNA bacteriano
contido nos blocos de agarose foi submetido à clivagem com ApaI, a 37ºC por 12 a 18
horas, de acordo com instruções do fabricante (New England Biolabs, Ipswich, EUA).
A eletroforese foi realizada em gel de agarose 1%, em TBE 0,5x (Tris 0,089 M,
ácido bórico 0,089 M e EDTA 0,002 M), no sistema CHEF-DR III (BioRad Laboratories,
Califórnia, EUA) à temperatura de 13oC e utilizando corrente elétrica de 200 Volts
(6V/cm). O gel foi corado com GelRed (Uniscience) e fotografado sob iluminação
ultravioleta em Transiluminador (BioRad Laboratories, Califórnia, EUA).
O gel foi analisado por inspeção visual, utilizando os critérios de Tenover et al.
(1995) para avaliar a similaridade genética entre os isolados. Para serem considerados
idênticos, os isolados deveriam apresentar o mesmo perfil eletroforético.
4.6 Teste de sensibilidade aos antimicrobianos
O perfil de sensibilidade aos antimicrobianos foi determinado utilizando a
metodologia de microdiluição em caldo, seguindo as recomendações do CLSI (2009)
para polimixina B. O sal de sulfato de polimixina B foi obtido da Sigma-Aldrich (St Louis,
MO, USA). Uma solução mãe contendo 2.560 µg/mL de sulfato de polimixina B foi
preparada em água ultrapura e diluída 1:10 em caldo Mueller-Hinton - MH (Oxoid,
Basingstoke, Inglaterra) para obtenção da maior concentração de 256 µg/mL a ser
testada. A partir dessa diluição, foram realizadas diluições seriadas até a obtenção da
concentração de 0,125 µg/mL. Cem microlitros de cada diluição foi dispensado em
microplaca, conforme mostrado na Figura 7.
34
Material e Métodos
O inóculo bacteriano foi preparado em caldo MH a uma turbidez correspondente à
escala 0,5 de McFarland (1.5 x 108) e diluído novamente em caldo MH, para a
concentração de 2,5 x 105 para obtenção de um volume final de 5 mL. Cem microlitros do
inóculo bacteriano foi dispensado na placa de microdiluição e, dessa maneira, tanto o
inóculo bacteriano quanto a concentração do antimicrobiano se reduziram à metade ao
final do experimento.
Para determinar o perfil de sensibilidade à amicacina, à ciprofloxacina, à
levofloxacina, ao aztreonam, à cefoxitina, à tigeciclina, à ceftriaxona, à ceftazidima, à
cefepima, ao imipenem, ao meropenem e à piperacilina/tazobactam, foram utilizadas
placas de microdiluição em caldo liofilizadas obtidas da TREK Diagnostics (Cleveland,
Ohio, USA) e os testes foram realizados conforme recomendações do fabricante (Figura
8).
Foram utilizadas como controle de qualidade as cepas ATCC 25922 de
Escherichia coli e ATCC 27853 de P. aeruginosa. A leitura das placas de microdiluição foi
realizada visualmente. A CIM foi considerada como a primeira concentração a inibir
completamente o crescimento bacteriano. Os resultados foram interpretados de acordo
com os pontos de corte estabelecidos pelo CLSI (2012), com excessão da tigeciclina para
a qual foram utilizados os pontos de corte do EUCAST (2012).
35
Material e Métodos
Figura
7.
Desenho
esquemático
da
distribuição
das
concentrações de polimixina B na placa de microdiluição em
caldo.
AMI
32
AMI
16
AMI
8
AMI
4
POLI
4
POLI
2
POLI
1
POLI
0.5
CIPRO
2
CIRPO
1
CIPRO
0.5
CIPRO
0.25
LEVO
4
LEVO
2
LEVO
1
LEVO
0.5
AZT
16
AZT
8
AZT
4
AZT
2
AZT
1
FOX
16
FOX
8
FOX
4
TGC
4
TGC
2
TGC
1
TGC
0.5
TGC
0.25
TGC
0.12
TGC
0.06
TGC
0.03
AXO
32
AXO
16
AXO
8
AXO
4
AXO
2
AXO
1
AXO
0.5
AXO
0.25
TAZ
16
TAZ
8
TAZ
4
TAZ
2
TAZ
1
TAZ
0.5
TAZ
0.25
TAZ
0.12
FEP
16
FEP
8
FEP
4
FEP
2
FEP
1
FEP
0.5
FEP
0.25
FEP
0.12
IMI
8
IMI
4
IMI
2
IMI
1
IMI
0.5
IMI
0.25
IMI
0.12
IMI
0.06
MERO
8
MERO
4
MERO
2
MERO
1
MERO
0.5
MERO
0.25
MERO
0.12
MERO
0.06
P/T
64/4
P/T
32/4
P/T
16/4
P/T
8/4
P/T
4/4
P/T
2/4
POS
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
Firgura 8. Desenho esquemático da placa de microdiluição
microdiluição em caldo (TREK Diagnostics)
utilizada para avaliação da sensibilidade aos antimicrobianos. AMI: amicacina; POLI:
polimixina B; CIPRO: ciprofloxacina; LEVO: levofloxacina; AZT; aztreonam; FOX:
cefoxitina; TGC: tigeciclina; AXO: ceftriaxona; TAZ: ceftazidima; FEP: cefepima; IMI:
imipenem; MERO: meropenem;
meropene P/T: piperacilina/tazobactam;
obactam; POS: controle positivo; NEG:
controle negativo.
36
Material e Métodos
4.7 Microscopia Eletrônica de Transmissão (MET)
Os isolados bacterianos foram cultivados em 20 mL de Caldo LB na presença e
na ausência de polimixina B até atingirem uma absorbância de 0,6 a um comprimento de
onda de 660 nm em espectrofotômetro BioMate 5, ThermoSpectronic (Thermo Fisher
Scientific, Wilmington, DE, USA), correspondente à fase exponencial de crescimento
bacteriano. A cultura foi centrifugada a 12.000 rpm por 10 minutos em temperatura
ambiente. O pellet foi ressuspenso em 1 mL de Glutaraldeído 2,5% adicionado a FA 2%
em tampão cacodilato de sódio 0,1 M pH 7,2. O material foi então incubado por 1 hora
em temperatura ambiente para a primeira fixação. Decorrido esse período, foi realizada a
primeira lavagem com 3 ciclos de 15 minutos com tampão cacodilato de sódio 0,1 M pH
7,2. A segunda fixação foi realizada com tetróxido de ósmio 2%, diluído em tampão
cacodilato de sódio 0,1 M pH 7,2, por 2 horas. Depois da fixação, foi realizada a outra
lavagem com tampão cacodilato de sódio 0,1 M pH 7,2 por duas vezes de 10 minutos
cada. O material foi então desidratado gradativamente com etanol 70%, 90% e 100% por
2 ciclos de 15 minutos cada, seguido por 2 ciclos de 30 minutos com óxido de propileno.
Após a desidratação o material foi submetido à infiltração em resina EPON de acordo
com as seguintes etapas: incubação do material com a mistura resina:óxido de propileno
(1:2) por 12 horas; seguido por resina:óxido de propileno (1:1) por 8 horas; resina:óxido
de propileno (2:1) por 12 horas e, por último, resina pura por 4 horas. Foi então realizada
a aplicação de vácuo por 2 horas. A inclusão e polimerização foram realizadas a 60ºC por
48 horas. As amostras foram visualizadas em microscópio eletrônico de transmissão Jeol
1200 EXII.
4.8 Cultivo em meio hipotônico
Os isolados de A. baumannii foram submetidos ao cultivo em água destilada
estéril por 8 horas para verificar se as alterações observadas por MET correspondiam as
alterações na estrutura da parede celular bacteriana. Após a incubação, os isolados
37
Material e Métodos
foram cultivados em meio LB ágar por 18 horas, a 37ºC. O crescimento no meio LB após
o cultivo em água descarta uma deficiência estrutural na parede celular.
4.9 Sequenciamento do sistema de dois componentes PmrAB
Os isolados de A. baumannii, cultivados na presença e ausência de polimixina B,
foram submetidos à PCR utilizando sequências de oligonucleotídeos iniciadores
(Invitrogen) específicos para os genes que compõem o sistema de dois componentes
PmrAB envolvidos na regulação da resistência às polimixina.
Para o gene pmrA, que codifica a proteína reguladora da resposta transcricional,
foram utilizadas as sequências de oligonucleotídeos, com anelamento interno e externo
aos gene, pmrA1_F, pmrA1_R, pmrA2_F e pmrA2_R, respectivamente. Para o gene
pmrB, que codifica a proteína sensor quinase, foram utilizadas as sequências pmrB1_F,
pmrB1_R, pmrB2_F e pmrB2_R, que anelam externamente e internamente ao gene,
respectivamente. Todas as sequências de oligonucleotídeos possuem temperatura de
anelamento de 55ºC e estão descrita na Tabela 1. A PCR foi realizada em termociclador
EP Gradient (Eppendorf) e as condições de ciclagem foram as seguintes: desnaturação
inicial a 95ºC por 10 minutos, seguido por 35 ciclos de desnaturação a 95ºC por 30
segundos, anelamento dos oligonucleotídeos (20 µm) a 55ºC por 30 segundos e
extensão das fitas a 72ºC por 3 minutos. Após os 35 ciclos, foi realizada uma extensão
final a 72ºC por 10 minutos. A eletroforese foi realizada em gel de agarose a 1,5%,
utilizando um marcador de peso molecular conhecido de 1 Kb (Fermentas, USA).
Os fragmentos gerados na PCR foram purificados com Kit PCR CleanUp (Qiagen,
Hilden, Alemanha) e submetidos ao sequenciamento utilizando 2 µL de BigDye
Terminator v 3.1 (Applied Biosystems, Warrington, United Kingdom), diluídos em 6 µL de
Tampão Big Dye Terminator 5x (Applied Biosystems, Warrington, United Kingdom),
adicionado a 1 µL do oligonucleotídio diluído a 3,2 µm e 5 µL de DNA purificado. A
reação foi completada com água para a obtenção de um volume final de 20 µL. As
condições de ciclagem foram as seguintes: desnaturação do DNA a 95ºC por 1 minuto;
38
Material e Métodos
anelamento dos oligonucleotídeos a 50ºC por 30 segundos e extensão das fitas a 60ºC
por 3 minutos. O sequenciamento foi realizado em ABI Prism 3500 Series (Applied
Biosystems).
As sequências obtidas foram comparadas com sequências depositadas no banco
de dados do GeneBank (http://blast.ncbi.nlm.nih.gov/Blast.cgi) e analisadas utilizando as
ferramentas de alinhamento do software DNA Star.
4.10 PCR em Tempo Real (qRT-PCR) para quantificação da transcrição do
sistema de dois componentes PmrAB
4.10.1 Extração de RNA Total e síntese de cDNA
Os isolados foram cultivados em 20 mL de Caldo LB na presença e ausência de
sulfato de polimixina B (Sigma-Aldrich, St Louis, MO, USA) a 37ºC, sob agitação, até
atingirem a fase logarítmica de crescimento, correspondente à absorbância de 0,5 a 0,6 a
um comprimento de onda de 600 nm em espectrofotômetro BioMate 5, ThermoSpectronic
(Thermo Fisher Scientific, Wilmington, DE, USA), correspondente à fase exponencial de
crescimento. Um mililitro da cultura foi adicionado a 1 mL de RNA Protect Bacteria
Reagent (Qiagen, Hilden, Alemanha), homogeneizado por completo em vórtex e
incubado por 5 minutos em temperatura ambiente. Transcorrido esse período, foi
realizada uma centrifugação por 10 minutos a 12.000 rpm em temperatura ambiente. O
RNA foi então extraído a partir do sedimento bacteriano resultante, utilizando o RNeasy
Mini Kit (Qiagen, Hilden, Alemanha), de acordo com as recomendações do fabricante.
Para retirada de resíduos de DNA bacteriano foi realizado um tratamento com RNAse
Free-DNAse Set (Qiagen, Hilden, Alemanha) durante a extração do RNA. O RNA total foi
quantificado em NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). A
reação de transcriptase reversa foi realizada utilizando 30 ng de RNA de cada amostra,
com High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Warrington,
United Kingdom), de acordo com as recomendações do fabricante. A reação foi incubada
39
Material e Métodos
por 10 minutos a 25ºC, seguido por 120 minutos a 37ºC, em termociclador Eppendorf. O
cDNA foi armazenado em freezer -80ºC até sua utilização.
4.10.2 Quantificação relativa da transcrição gênica
A técnica de PCR em tempo real foi utilizada para quantificar a transcrição relativa
dos genes que compõe o sistema de dois componentes PmrAB, que estão envolvidos no
desenvolvimento de resistência às polimixinas em A. baumannii.
O cDNA preparado a partir da extração de RNA das amostras de A. baumannii,
sensíveis e resistentes às polimixinas, foi submetido à reação de PCR em tempo real
utilizando sequências de oligonucleotídeos iniciadores (Invitrogen, Eragny, France)
específicos para cada gene que compõe o sistema de dois componentes PmrAB,
RT_pmrA_F e RT_pmrA_R para o gene pmrA e, RT_pmrB_F e RT_pmrB_R para o gene
pmrB (Tabela 2).
As reações de PCR em tempo real foram realizadas em triplicata
utilizando 12,5 µL de Platinum SyBR Green qPCR com ROX (Invitrogen, Eragny, France),
adicionado de 0,25 µL de cada oligonucleotídeo iniciador. À mistura, foi adicionado 2 µL
de cDNA para obtenção de um volume final de 25 µL. A reação de PCR foi realizada no
equipamento Real Time 7500 (Applied Biosystems, Warrington, United Kingdom).
4.10.3 Análise da quantificação relativa da transcrição gênica
Para determinação da eficiência de cada oligonucleotídeo foi realizada uma curva
de desnaturação (“melting curve”) utilizando um extrato de DNA a partir de um inóculo
bacteriano do isolado sensível A027, na escala 0,5 de McFarland. Desse inóculo inicial foi
realizada uma diluição seriada de 1:10 até a diluição de 10-8. Todas as reações de qRTPCR foram realizadas em triplicata e o gene ribossomal 16S foi utilizado como gene de
referência para a normalização da transcrição dos genes alvo.
A eficiência das reações de amplificação dos genes estudados foi determinada de
acordo com a fórmula E = (10-1/slope -1) x 100, onde “slope” representa a inclinação da reta
no gráfico de regressão linear das médias dos valores de Ct observadas nas 3 replicatas
40
Material e Métodos
das reações de qRT-PCR para as diluições seriadas do extrato do isolado sensível A027.
Ct (“Ciclo Threshold”) é considerado o ciclo em que foi detectada fluorescência durante a
amplificação da reação de qRT-PCR, acima do limite basal de fluorescência observado
no início da reação.
A análise da expressão foi realizada utilizando o software SDS v 2.0 (Applied
Biosystems, Warrington, Reino Unido) pelo método Ct comparativo (∆∆Ct), onde a
expressão normalizada (EN) é calculada de acordo com a fórmula ∆Ct = Ctgene alvo – Ctgene
endógeno.
Para a correção do cálculo da RQ, a eficiência da reação de cada gene foi
calculada utilizando o modelo matemático descrito por Pfaffl et al. (2001), utilizando o
software SDS v 2,0.
A transcrição relativa de cada gene alvo para os isolados clínicos de A. baumannii
foi calculada em relação à transcrição de cada gene no isolado A027, sensível à
polimixina B a partir da diferença entre o ∆Ct de cada gene alvo na amostra referência e
o ∆Ct de cada gene na amostra a ser testada. Dessa forma, o valor de RQ indica quantas
vezes um gene é transcrito em uma amostra em relação à expressão quantificada na
amostra usada como referência, utilizando a fórmula RQ = 2-∆∆Ct.
As temperaturas de melting e a eficiência de cada oligonucleotídeo para as
reações estão descritas na Tabela 3.
4.11 Associação de resistência às polimixinas com mecanismos de
resistência relacionados à parede celular bacteriana
4.11.1 Avaliação de proteínas de membrana externa
4.11.1.1 Extração de proteínas de membrana externa
Para verificar possíveis alterações no perfil de porinas e PBPs das membranas
dos isolados de A. baumannii após o cultivo na presença de sulfato de polimixina B,
41
Material e Métodos
esses foram submetidos ao SDS-PAGE do extrato de proteínas de membrana externa e
interna.
Os isolados foram cultivados em 15 mL de caldo LB na presença e ausência de
sulfato de polimixina B, a 37ºC, sob agitação, por 24 horas. Os inóculos foram
centrifugados a 4.000 rpm, por 15 minutos, a 4ºC. O sedimento bacteriano foi então
ressuspenso em 1 mL de tampão TrisMg (Tris 10mM; MgCl2 5mM), pH7,3 e sonicado por
5 ciclos de 30 segundos, parando por 1 segundo a cada 5 segundos corridos. Após essa
etapa, foi realizada outra centrifugação a 5.000 rpm, por 5 minutos, a 4ºC. O
sobrenadante foi transferido para outro tubo e centrifugado novamente por 30 minutos, a
17.000 rpm, a 4ºC. O sobrenadante foi descartado e 800 µL de Sarcosil 30% foi
adicionado ao sedimento e incubado por 30 minutos em temperatura ambiente.
Transcorrido esse período, foi realizada uma nova centrifugação de 30 minutos, a 17.000
rpm, a 4ºC. O sedimento foi então lavado com tampão TrisMg (Tris 10mM; MgCl2 5mM),
pH 7,3
e centrifugado por 30 minutos, a 17.000 rpm, a 4ºC. O sobrenadante foi
descartado e o sedimento, correspondente à porção da membrana externa, foi
ressuspenso em 40 µL do tampão TrisMg (Tris 10 mM; MgCl2 5 mM), pH 7,3. O extrato
protéico foi armazenado a uma temperatura de -20ºC até sua utilização. Os extratos
protéicos foram quantificados com reagente de Bradford.
4.11.1.2 Avaliação do perfil de proteínas de membrana externa por SDS-PAGE
As concentrações dos extratos protéicos foram igualadas em tampão de amostra
Laemmi Sample Buffer (BioRad Laboratories, Hercules, CA, EUA) adicionado de 2Mercaptoetanol (Merck, Darmstadt, Germany) e aquecidas a 100ºC por 5 minutos. Vinte
microlitros da mistura foi adicionada ao gel de poliacrilamida a 15%. A eletroforese foi
realizada a uma voltagem de 15 V por 30 minutos para a entrada do material no gel de
poliacrilamida, seguido por uma voltagem foi aumentada para 100 V por 2 horas. Foi
utilizado um marcador de peso molecular Pre-stained SDS-Page Standards, Broad
Range (Roche Diagnostics).
42
Material e Métodos
4.11.1.3 Quantificação relativa da transcrição dos genes que codificam porinas
O cDNA foi preparado a partir da extração de RNA dos isolados de A. baumannii
cultivados, na presença e ausência de sulfato de polimixina B, conforme item 4.10.1 e foi
submetidos à reação de qRT-PCR para verificar alterações na expressão dos genes
responsáveis por codificar as proteínas de membrana externa CarO, OmpA e OmpW.
Foram utilizados oligonucleotídeos iniciadores (Invitrogen, Eragny, France) específicos
para cada porina, descritos na Tabela 2. A reação de PCR em tempo real foi realizada de
acordo com o protocolo descrito no item 4.10.2.
4.11.2 Quantificação relativa da transcrição do gene adeB, que codifica a
proteína estrutural do sistema de efluxo AdeABC
Os isolados de A. baumannii cultivados na presença e ausência de polimixina B
foram submetidos à reação de qRT-PCR para verificar alterações na transcrição do
sistema de efluxo AdeABC. A extração de RNA e a síntese do cDNA foram realizados de
acordo com o protocolo descrito no item 4.10. Foram utilizados oligonucleotídeos
iniciadores (Invitrogen, Eragny, France) específicos para o gene adeB, responsável pela
síntese da proteína estrutural que está acoplada à membrana e compõe os sistema de
efluxo AdeABC, AdeB_F e AdeB_R (Tabela 2). A reação de qRT-PCR foi realizada de
acordo com o protocolo descrito no item 4.10.
4.11.3 Sequenciamento dos genes que codificam as PBPs
Para verificar possíveis alterações nas PBPs nos isolados de A. baumannii antes
e após o cultivo na presença de polimixina B, foram realizados sequenciamento dos
genes que codificam as PBPs de alto peso molecular de classe A (PBP1a e PBP1b) e
classe B (PBP2 e PBP3), responsáveis pela síntese da parede celular bacteriana de
acordo com o protocolo descrito no item 4.9. Foram utilizadas sequencias de
oligonucleotídeos iniciadores descritos anteriormente por Cayô et al. (2011), encontradas
na Tabela 1.
43
Material e Métodos
Tabela 1. Sequências de oligonucleotídeos iniciadores utilizados para as reações de
PCR e sequenciamento.
Fragmento
Primer
Sequência (5’-3’)
Referência
(pb)
pmrA1_F
TGTGGTTCTCTGAAAGTTGGAA
Este estudo
1.060
pmrA1_R
GGGTGCTCAGCTGTTCTTTC
pmrA2_F
GATGGTTTGGCTCAATTGGCG
Este estudo
Este estudo
227
pmrA2_R
CGGGCAAGCAACTCATCAAAC
pmrB1_F
AAATCGTGAATGGGCAATCT
Este estudo
Este estudo
1.914
pmrB1_R
CTGCCCTTGGAATATGGTTC
pmrB2_F
GCAGCCATTATTCGTCGTGG
Este estudo
Este estudo
229
pmrB2_R
GTGCAGTCACAGGTGTTCGT
PBP1a_ponA_F
ATGTATCTCTATATTGCCCCA
Este estudo
Cayô et al., 2011
2.450
PBP1a_ponA_R
ATCAAGTTTTCTAATTCATCTTTTTCA
PBP1a_ponA2_F
GAACGTCGCAACTGGATTTT
Cayô et al., 2011
Cayô et al., 2011
2.450
PBP1a_ponA4_R
TGACTGTTATTTTTGTCCGTCTG
PBP1b_mrcB_F
GTTATAACTACCACTTGAAATGATTCG
Cayô et al., 2011
Cayô et al., 2011
2390
PBP1b_mrcB_R
TGAAGTTTGAACGTGGTATCG
PBP1b_mrcB3_F
GATGGACCTTGAACCAAACC
Cayô et al., 2011
Cayô et al., 2011
2.390
PBP1b_mrcB3_R
GGTTTGGTTCAAGGTCCATC
PBP2_pbpA_F
AGCACTTTCCTTTAAAAGATATCCAG
Cayô et al., 2011
Cayô et al., 2011
2.010
PBP2_pbpA_R
ATTCATCGACCTCGTTTGTAGC
PBP2_pbpA3_F
TCCAAATGGATGAAAGGTGA
Cayô et al., 2011
Cayô et al., 2011
2.010
PBP2_pbpA3_R
TTGCACGTAAAACATGTGGAA
PBP3_ftsI_F
TTACCTGCGAATAGGATTTTCTG
Cayô et al., 2011
Cayô et al., 2011
1.758
PBP3_ftsI_R
ATGTGGCGGTTTTATCTGCT
PBP3_ftsI3_F
TCAAACCAATAATTTGGGCATT
Cayô et al., 2011
Cayô et al., 2011
1.758
PBP3_ftsI3_R
TTATTACCCRCAACCTCAGC
16S_8F
AGAGTTTGATCCTGGCTCAG
Cayô et al., 2011
Mendes et al., 2007
1.485
16S_1493R
ACGGCTACCTTGTTACGACTT
Mendes et al., 2007
44
Material e Métodos
Tabela 2. Seqüências de oligonucleotídeos iniciadores utilizados para reações PCR em
tempo real.
Fragmento
Primer
Sequência (5’-3’)
RT_pmrA_F
GATGGTTTGGCTCAATTGGCG
(pb)
Referência
Este estudo
227
RT_pmrA_R
CGGGCAAGCAACTCATCAAAC
RT_pmrB_F
GCAGCCATTATTCGTCGTGG
Este estudo
Este estudo
229
RT_pmrB_R
GTGCAGTCACAGGTGTTCGT
OmpA_F
CTCTTGCTGGCTTAAACG
Este estudo
Pereira, 2009
254
OmpA_R
TGTGTGACCTTCGATACG
OmpW_F
TTAGCATCAGCAGGTTGG
Pereira, 2009
Pereira, 2009
120
OmpW_R
TATTGGTATCGGGGCAAC
CarO_F
GCAATGGCAGATGAAGC
Pereira, 2009
Pereira, 2009
111
CarO_R
TAAAGCACCACCGTAACC
AdeB_F
GGATTATGGCGACAGAAGGA
Pereira, 2009
Pereira, 2009
106
AdeB_R
AATACTGCCGCCAATACCAG
16S_F
CAGCTCGTGTCGTGAGATGT
Pereira, 2009
Pereira, 2009
150
16S_R
CGTAAGGGCCATGATGACTT
Pereira, 2009
Tabela 3. Padronização da curva de melting para cada gene submetido à PCR em tempo
real.
Temperatura de
Concentração do
Eficiência (%)
Slope
Melting
inóculo
pmrA
80,8
142,97
-2,594
10 -10
-1
-4
pmrB
80,4
113,8
-3,03
10 -10
-1
-5
OmpW
78,3
124,2
-2,851
10 -10
-1
-4
OmpA
81,1
117,45
-2,964
10 -10
-1
-4
CarO
79,3
119,4
-2,93
10 -10
-1
-4
AdeB
77,9
125,7
-2,828
10 -10
-1
-4
45
Resultados
5. RESULTADOS
46
Resultados
5. RESULTADOS
5.1 Caracterização dos isolados de A. baumannii
Os isolados clínicos de A. baumannii sensível (A027) e resistente (A009) à
polimixina B e seus mutantes com resistência induzida, A027Ind e A009Ind foram
caracterizados quanto à presença de genes que codificam enzimas β-lactamases. O
isolado A027 e seu mutante com resistência induzida A027Ind foram positivos para os
genes blaOXA-51, blaOXA-23 e blaTEM-1 (Tabela 4).
A indução de resistência à polimixina B foi realizada com dez subcultivos
consecutivos até a diluição de 64 µg/mL de sulfato de polimixina B. A partir dessa diluição
não foram recuperados os isolados de A. baumannii (Tabela 4).
Tabela 4. Isolados sensíveis e resistentes à polimixina B, selecionados para o estudo,
antes e após o cultivo na presença de polimixina B.
CIM Polimixina
Isolado
Espécie
B(µg/mL) /
(Categoria de
Sensibilidade)
Sítio de
Data do
Detecção de genes que
isolamento
isolamento
codificam β-lactamases
a
A027
A. baumannii
0,25 (S)
Trato Resp Inferior
26/07/2007
blaOxa-23, blaOxa-51, blaTEM-1
A009
A. baumannii
16 (R)
Trato Resp Inferior
30/06/2007
blaOxa-51
A027Ind
A. baumannii
>64 (R)
Trato Resp Inferior
Mutante
blaOxa-23, blaOxa-51, blaTEM-1
A009Ind
A. baumannii
>64 (R)
Trato Resp Inferior
Mutante
blaOxa-51
a. Categoria de sensibilidade de acordo com os ponto de corte do CLSI (2012).
5.2 Perfil de sensibilidade aos antimicrobianos
O perfil de sensibilidade aos antimicrobianos dos isolados de A. baumannii está
descrito na Tabela 5. O isolado clínico de A. baumannii A027 apresentou sensibilidade
somente à polimixina B (CIM, 0,25 µg/mL) e à tigeciclina (CIM, 1 µg/mL). Quando esse
isolado foi submetido ao cultivo na presença de 8 µg/mL de sulfato de polimixina B
(A027Ind) tornou-se resistente à mesma (CIM, >64 µg/mL), mas, passou a ser sensível a
outros antimicrobianos como aos carbapenems: meropenem (CIM, de >8 para 1µg/mL) e
47
Resultados
imipenem (CIM, de >8 para 2 µg/mL); às cefalosporinas: ceftazidima (CIM, de >16 para 8
µg/mL), cefepima (CIM, de >16 para 4 µg/mL) e ceftriaxona (CIM, de >32 para 4 µg/mL);
ao aztreonam (CIM, de >16 para 4 µg/mL) e à piperacilina/tazobactam (CIM, de >16
µg/mL para 8 µg/mL). Não foi observada alteração no perfil de sensibilidade às
quinolonas nesse isolado. O isolado clínico resistente à polimixina A009 (CIM, 16 µg/mL),
apresentou sensibilidade aos outros antimicrobianos testados com exceção de cefoxitina
(CIM, >16 µg/mL). A cultura desse isolado na presença de polimixina B (A009Ind),
aumentou sua CIM de polimixina B de 16 µg/mL para 64 µg/mL. Porém, não houve
alteração no perfil de sensibilidade aos outros antimicrobianos testados para o isolado
A009Ind (Tabela 5).
Tabela 5. Perfil de sensibilidade de isolados A. baumannii sensíveis e resistentes às
polimixinas, antes e após a indução de resistência com sulfato de polimixina B.
Concentração Inibitória Mínima (µg/mL)/Categoria de sensibilidadea.
Antimicrobiano
A027
A027Ind
A009
A009Ind
Polimixina B
0,25 (S)
>128 (R)
16 (R)
64 (R)
Amicacina
>32 (R)
≤4 (S)
≤4 (S)
8 (S)
Aztreonam
>16 (R)
4 (S)
8 (S)
16 (S)
Tigeciclina
1 (S)
0,5 (S)
0,25 (S)
0,12 (S)
Ciprofloxacina
>2 (R)
>2 (R)
≤0,25 (S)
≤0,25 (S)
Levofloxacina
>4 (R)
>4 (R)
≤0,5 (S)
≤0,5 (S)
Cefoxitina
>16 (R)
16 (S)
>16 (R)
>16 (R)
Ceftriaxona
>32 (R)
4 (S)
8 (S)
8 (S)
Ceftazidima
>16 (R)
8 (S)
2 (S)
8 (S)
Cefepima
>16 (R)
4 (S)
0,5 (S)
1 (S)
Doripenem
>16 (R)
1 (S)
0,25 (S)
0,25 (S)
Imipenem
>8 (R)
2 (S)
0,12 (S)
0,25 (S)
Meropenem
>8 (R)
1 (S)
0,12 (S)
0,25 (S)
Pipe/Tazo
>64 (R)
8 (S)
≤2 (S)
4 (S)
a. Categoria de sensibilidade de acordo com CLSI (2012).
48
Resultados
5.3 Estabilidade da indução de resistência à polimixina B
Os isolados de A. baumannii com resistência induzida à polimixina B foram
submetidos ao cultivo na ausência do antimicrobiano para verificar a estabilidade da
resistência desenvolvida. O isolado sensível A027Ind não reverteu seu perfil de
sensibilidade após o cultivo na ausência da droga, mostrando a estabilidade do novo
fenótipo de resistência. Já o isolado resistente A009Ind reverteu o perfil de sensibilidade
para a CIM inicial de 16 µg/mL, após a ausência de pressão seletiva exercida pela
polimixina B (Tabela 6).
Para verificar a estabilidade do perfil de sensibilidade aos carbapenens
apresentado pelo isolado A027Ind, ele foi submetido ao cultivo na presença de
concentrações crescentes de imipenem. Entretanto, o isolado não foi recuperado, ainda
nas diluições correspondentes à categoria de sensibilidade.
Tabela 6. Perfil de sensibilidade à polimixina B durante o cultivo na ausência da droga,
após a indução de resistência.
1º rep
2º rep
3º rep
4º rep
5º rep
6º rep
7º rep
8º rep
9º rep
A027Ind
>128
>128
>128
>128
>128
>128
128
>128
128
A009Ind
64
64
16
32
32
16
32
16
16
5.4 Análise da similaridade genética
Os isolados clínicos de A. baumannii e seus mutantes com resistência induzida à
polimixina B apresentaram perfis de similaridade genética idênticos por meio da
metodologia de PFGE, descartando a possibilidade de uma possível contaminação ao
longo dos subcultivos para indução de resistência à polimixina B (Figura 9).
49
Resultados
Figura 9. Perfil de similaridade genética pela metodologia de PFGE. Coluna 1 e 6:
Marcador de peso molecular 48 kb; Coluna 2: Isolado clínico A027; Coluna 3: Isolado
mutante A027Ind; Coluna 4: Isolado clínico A009; Coluna 5: Isolado mutante A009Ind.
5.5 Avaliação da parede celular bacteriana dos isolados de A. baumannii por
MET
Para verificar alterações na parede celular dos isolados clínicos de A. baumannii e
seus derivados mutantes, foi realizada a metodologia de MET. Em ambos isolados
induzidos A027Ind e A009Ind foi observada uma deposição de “grânulos” na porção
interna da membrana citoplasmática. Não foi observada,
observada, por análise visual, alteração na
integridade da parede celular do isolado A027Ind em relação ao isolado A027. O isolado
A009, resistente à polimixina B apresentou um aumento na espessura da parede celular
em relação ao isolado sensível à polimixina B A027. Quando esse isolado foi exposto à
polimixina B o espessamento de parede foi
f mantido (Figura 10).
50
Resultados
Figura 10. Microscopia eletrônica de transmissão de isolados clínicos de A. baumannii,
cultivados na presença e ausência de polimixina B. A: Isolado A027, sensível à polimixina
B; B: Isolado sensível submetido ao cultivo na presença de polimixina B (A027Ind); C:
Isolado A009, resistente à polimixina B; D: Isolado naturalmente resistente submetido ao
cultivo na presença de polimixina B (A009Ind).
5.6 Cultivo em meio hipotônico
Para verificar alterações estruturais na parede celular bacteriana após o cultivo
consecutivo em concentrações crescentes de sulfato de polimixina B, os isolados foram
cultivados em água destilada estéril para verificar a estabilidade da parede celular. Todos
os isolado foram capazes de sobreviver em meio hipotônico, com exceção do isolado
A027Ind, inicialmente sensível à polimixina B, que se tornou resistente após o cultivo na
presença da droga.
5.7 Sequenciamento dos genes que compõem o sistema regulatório de dois
componentes PmrAB
51
Resultados
Os isolados clínicos de A. baumannii foram submetidos ao sequenciamento dos
genes que compõem o sistema de dois componentes PmrAB, antes e após o cultivo na
presença de sulfato de polimixina B. Não foi observada nenhuma mutação no gene pmrA,
em nenhum dos isolados testados. No sequenciamento do gene pmrB foram observadas
duas alterações. O isolado A027Ind teve a deleção de um aminoácido Treonina na
posição 28 e uma inserção de Glutamina na posição 45 quando comparado à cepa
parental A027. Não foi observada mutação no isolado A009 e seu mutante induzido
A009Ind.
5.8 Quantificação relativa da transcrição do sistema regulatório de dois
componentes PmrAB
A quantificação relativa da transcrição dos genes do sistema de dois componentes
PmrAB foi realizada em comparação com à transcrição do isolado sensível à polimixina B
A027. O isolado A027Ind apresentou um aumento na transcrição do gene pmrA. Porém,
nesse isolado, houve redução na transcrição do gene pmrB (Figura 11). O isolado
resistente à polimixina B, A009, e seu mutante induzido A009Ind apresentaram um nível
de transcrição maior para o gene sensor quinase pmrB em relação ao isolado sensível
A027. No entanto, esse aumento não resultou em aumento da transcrição do gene pmrA,
o qual teve uma transcrição menor em relação ao isolado sensível, nesses dois isolados
(Figura 11).
52
Resultados
Figura 11. Quantificação relativa da transcrição dos genes do sistema regulatório de dois
componentes PmrAB nos isolados de A. baumannii estudados.
5.9 Avaliação da influência de resistência às polimixina
polimixina B em mecanismos
relacionados
os à parede celular bacteriana
5.9.1 Expressão de
e Proteínas de Membrana Externa
O isolado A027, sensível à polimixina B, foi utilizado como parâmetro para a
determinação da transcrição relativa de todas as porinas. Dessa forma,
forma, foi determinado
um valor de transcrição de 1 para esse isolado. O isolado A027Ind apresentou uma
redução na transcrição do gene que codifica a porina OmpW em relação à sua cepa
selvagem sensível A027 (Figura 12). Essa redução pode ser comprovada, como pode ser
observado na Figura 13, onde há ausência da banda correspondente à essa porina. O
53
Resultados
isolado A009, já apresentou uma redução na transcrição do gene ompW em relação ao
isolado sensível A027, mesmo antes da exposição à droga. Seu isolado mutante A009Ind
manteve essa menor transcrição, não havendo mudança significativa entre eles (Figura
12). No entanto, para esses isolados, não foi possível estabelecer uma relação entre as
metodologias de qRT-PCR e SDS-PAGE utilizadas, já que a redução no nível de
transcrição do gene ompW foi acompanhada pelo aumento da intensidade da banda no
gel de SDS-PAGE (Figuras 12 e 13).
Foi observado um aumento na transcrição do gene ompA no isolado A027Ind.
Pela metodologia de qRT-PCR foi observado um nível de transcrição reduzido do gene
que codifica essa porina nos isolados A009 e seu mutante induzido A009Ind em relação
ao isolado sensível A027. Porém, os resultados do qRT-PCR não foram corroborados
pelo SDS-PAGE, onde a porina OmpA parece ter a sua expressão reduzida no isolado
A027Ind e aumentada no isolado A009 e seu mutante induzido A009Ind (Figuras 12 e
13).
Tanto o isolado com resistência induzida, A027Ind, quanto o isolado com
resistência “natural” A009 apresentaram uma transcrição mais elevada do gene que
codifica a porina CarO em relação ao isolado sensível à polimixina B, A027. Porém, no
SDS-PAGE, a expressão da porina CarO pareceu estar reduzida no isolado A027Ind e
muito aumentada nas isolados A009 e A009Ind (Figuras 12 e 13).
54
Resultados
Figura 12. Quantificação relativa da transcrição dos genes que codificam as porinas dos
isolados de A. baumannii antes e após o cultivo na presença de polimixina B.
55
Resultados
1
2
3
4
5
6
7
250 kDa
150 kDa
100 kDa
75 kDa
50 kDa
B
C
37 kDa
D
E
F
25 kDa
G
20 kDa
15 kDa
Figura 13. Gel de SDS-PAGE das proteínas de membrana externa (OMPs) dos isolados clínicos e
os mutantes induzidos de A. baumannii. Coluna 1 e 7: Marcador de peso molecular Dual Color
(BioRad); Coluna 2: Isolado clínico A027, sensível à polimixina B; Coluna 3: Isolado A027Ind,
sensível com resistência induzida à polimixina B; Coluna 4: Isolado clínico A009, resistente à
polimixina B; Coluna 5: Isolado A009Ind, com resistência induzida à polimixina B. Coluna 6:
ATCC 19606; A: Omp D (43 kDa); B: OprB (40 kDa); C: Omp HMP (OmpA, 35,6 kDa); D: 33-36
kDa (31 kDa); E: CarO (29 kDa); F: Omp25 (25 kDa) e G: OmpW (21 kDa).
5.9.2 Quantificação relativa da transcrição da bomba de efluxo AdeABC
A quantificação relativa da transcrição do gene adeB foi realizada utilizando o
valor de transcrição da amostra sensível à polimixina, B A027, para fins comparativos. O
isolado sensível à polimixina B quando submetido ao cultivo na presença de polimixina B
(A027Ind), teve uma redução no nível de transcrição do gene. O isolado A009 apresentou
56
A
Resultados
um nível de transcrição menor do gene adeB em relação ao isolado sensível à polimixina
B,, assim como seu mutante com resistência induzida A009Ind (Figura 14).
Figura 14. Quantificação da transcrição relativa do gene adeB para os isolados de A.
baumannii,, antes e após o cultivo na presença de polimixina B.
5.9.3 Sequenciamento das PBPs
Devido a observação de alterações na parede dos isolados de A. baumannii, bem
como a mudança no perfil de sensibilidade aos antimicrobianos β-lactâmicos,
β
esses
isolados foram submetidos ao sequenciamento dos genes que codificam as PBPs de alto
peso molecular das classes A (PBP1a, PBP1b) e B (PBP2 e PBP3), para verificar
possíveis mutações nesses genes.
genes. Os resultados do sequenciamento das PBPs estão
descritos na Tabela 7.
No isolado A009, com resistência “natural” à polimixina B, foram observados
diversas mutações
ões pontuais nos
no quatro genes de PBPs avaliados que geraram alterações
de aminoácidos na proteína resultante,
resultante, principalmente nos genes ponA e mrcB
57
Resultados
codificadores das PBPs de classe A PBP1a e PBP1b, respectivamente. Essas mutações
se mantiveram quando esse isolado foi cultivado na presença de polimixina B (A009Ind).
Algumas dessas mutações estão próximas aos motivos conservados dos sítios de
transglicosilação e/ou transpeptidação (mutações sublinhadas na Tabela 7), dessa forma,
são possíveis mutações candidatas a causar alterações na estrutura das quatro PBPs
avaliadas, podendo levar ao espessamento da parede celular, observadas pela
metodologia de MET nesses isolados (Figura 10). No isolado A009 e seu respectivo
mutante induzido, foi observada uma inserção de uma Treonina na posição 804 do gene
ponA condificador da PBP1a, marcado em vermelho, que alterou o “frame” de leitura da
sequência de aminoácidos desse ponto em diante (Tabela 7). No quinto motivo
conservado do sítio de transpetidação do gene mrcB codificador da PBP1b para os
isolados A009 e A009ind observou-se um mudança de uma Leucina por uma Metionina
na posição 320. Ambos os aminoácidos são apolares.
Diferente do observado no isolado com resistência natural à polimixina B, o
isolado sensível A027 e seu mutante com resistência induzida A027Ind apresentaram
somente uma mutação na PBP1a e na PBP3. Essas mutações não foram relacionadas
com o surgimento de resistência induzida à polimixina B pelo fato de já estarem
presentes no isolado antes da exposição ao antimicrobiano (Tabela 7).
58
Resultados
Tabela 7. Mutações encontradas na sequencia de aminoácidos dos genes codificadores de PBPs de alto peso molecular nos isolados de A.
baumannii antes e após o cultivo na presença de sulfato de polimixina B.
Concentração Inibitória Mínima (µg/mL)
Proteínas Ligadoras de Penicilinas
PBP1a
PBP1b
PBP2
PBP3
ponA
mrcB
pbpA
ftsI
Transglicosilase/Transpeptidase
Transglicosilase/Transpeptidase
Elongase
Divisão Celular
0,1 0,12 0,25
N83T; A206S; K300Q; A308S; E334Q;
Q345E; S351N; S352N; A385G; V495S;
A606S; D611E; V615A; T636A; T637A;
T715A; V716I; G746D; A748S; Q750K;
E773A; T775V; V778I; T804A; T805N;
N806T; D808N; F809D; D810F; L812D;
P813L; G814P; E815G; I817E; V818I; I819V;
P820I; S821P; K822S; T823K; T824A;
P825A; A827P; M828A; K829M; P830K;
S831P; Q832S; G833Q; A834G; P836A;
K837P; R838R; E839R; K840E; D841K;
E842D; L843E; E844L; N845E; L846N;
I847L; N848I; Q849N; I850Q; E851I;
Y90F; V126A; S164N; L320M; N343G;
N396D; A406T; N407Q; Q476K; V484I;
I504V; T543P; S632P; A634T; S704T;
R712H; S714T; A732T; T754A; D766P;
T769S
N97D; V98P;T100A; D170E;
I231V; V321A; A345S; N427S;
S437T; T483S; P530S; V600I;
K609N; N638G; S640T; T647A;
S648A; A649T; P650T; S652A;
A655T; T657A; T661A; T663A
V52I; I72V; I98M; T114S;
N122K; A149T; I216V;
S384T; S409T; R423K;
P483A; K513T; N542S
0,3 0,25 0,25
N83T; A206S; K300Q; A308S; E334Q;
Q345E; S351N; S352N; A385G; V495S;
A606S; D611E; V615A; T636A; T637A;
T715A; V716I; G746D; A748S; Q750K;
E773A; T775V; V778I; T804A; T805N;
N806T; D808N; F809D; D810F; L812D;
P813L; G814P; E815G; I817E; V818I; I819V;
P820I; S821P; K822S; T823K; T824A;
P825A; A827P; M828A; K829M; P830K;
S831P; Q832S; G833Q; A834G; P836A;
K837P; R838R; E839R; K840E; D841K;
E842D; L843E; E844L; N845E; L846N;
I847L; N848I; Q849N; I850Q; E851I;
Y90F; V126A; S164N; L320M; N343G;
N396D; A406T; N407Q; Q476K; U484T;
I504U; T543P; S632P; A634T; S704T;
R712H; S714T; D723A; A732T; T754A;
I761A; E763A; P764S; D766P; T769S;
N778S
N97D; V98P;T100A; D170E;
I231V; V321A; A345S; N427S;
S437T; T483S; P530S; V600I;
K609N; N638G; S640T; T647A;
S648A; A649T; P650T; S652A;
A655T; T657A; T661A; T663A
V52I; I72V; I98M; T114S;
N122K; A149T; I216V;
S384T; S409T; R423K;
P483A; K513T; N542S
Isolados
PO PTZ FOX CRO CAZ FEP AZT IPM MEM DOR
A009
A009Ind
16
64
8
16
>16
>16
8
8
2
8
0,5
1
8
16
A027
0,25 >64 >16 >32 >16 >16 >16 >8
A027Ind
>128
8
16
4
8
4
4
2
>8
>16
V495S
0
0
A583V
1
1
V495S
0
0
A583V
59
Discussão
6. DISCUSSÃO
60
Discussão
6. DISCUSSÃO
As polimixinas constituem, frequentemente, a única opção terapêutica para o
tratamento de infecções causadas por P. aeruginosa e A. baumannii resistentes aos
carbapenens. Embora a resistência às polimixinas ainda seja baixa nessas espécies, ela
tem se tornado mais frequente em amostras de K. pneumoniae produtoras de KPC e a
compreensão dos seus mecanismos de resistência é de fundamental importância visto
que não há, a um curto prazo, nenhuma droga sendo desenvovolvida pela industria
farmacêutica que seja efetiva contra esses patógenos (Gales et al., 2011).
Nos últimos anos, diferentes estudos vem tentando determinar o mecanismo de
resistência às polimixinas (Cai et al., 2012). Como amostras clínicas de P. aeruginosa e
A. baumannii resistentes à polimixina são raramente isoladas pelos laboratórios de
microbiologia em pacientes que não foram expostos à polimixina, a maioria dos estudos
que avalia os mecanismos de resistência às polimixinas se utilizaram de isolados clínicos
de A. baumannii sensíveis às polimixinas que tiveram a resistência a este agente
induzida in vitro
ou em cepas de P. aeruginosa, isoladas de pacientes com fibrose
cística, que receberam polimixina por tempo prolongado no tratamento e/ou profilaxia de
infecção crônica (Moffat et al., 2010; Arroyo et al., 2011; Beceiro et al., 2011; Moffat et al.,
2011; Moskowitz et al., 2012).
Dois fenótipos distintosde resistência às polimixinas tem sido observado, sendo o
primeiro decorrente da indução pela presença da droga e um segundo fenótipo de
resistência “natural”, não correlacionado com a exposição prévia às polimixinas.
Geralmente, isolados com resistência induzida às polimixinas atingem CIMs elevadas,
acima de 128 µg/mL. Diferente disso, o fenótipo de resistência apresentado por isolados
que não foram expostos à polimixina, possui CIMs próximas ao ponto de corte de
resistência estabelecido pelo CLSI, ≥ 8 µg/mL (CLSI, 2012). Os isolados selecionados
para este estudo possuíam essas características. O isolado com resistência induzida
(A027) apresentou CIM > 64 µg/mL à polimixina B, enquanto o isolado com resistência
“natural” (A009) apresentou uma CIM de 16 µg/mL para esse antimicrobiano. O isolado
61
Discussão
clínico de A. baumannii que apresentou resistência à polimixina B, foi selecionado por
apresentar sensibilidade aos outros antimicrobianos e, também por ter sido isolado de um
paciente que não havia recebido previamente polimixinas em seu tratamento e, desta
maneira, minimizar a chance de que tivesse havido indução de resistência às mesmas.
Em nosso estudo, o isolado clínico de A. baumannii sensível à polimixina B (A027)
apresentou, inicialmente, resistência aos β-lactâmicos, aminoglicosídeos e quinolonas.
Além da polimixina B, esse isolado apresentou sensibilidade somente à tigeciclina. De
acordo com estudos do programa de vigilância “SENTRY antimicrobial surveillance
programme”, esse isolado representa o perfil de sensibilidade encontrado em muitas
regiões do mundo entre isolados de A. baumannii (Yau et al., 2009; Gales et al., 2011).
Em nosso estudo, a resistência à polimixina B induzida no isolado A027ind se
mostrou estável, já que, mesmo após vários subcultivos em meio de cultura sem a adição
de sulfato de polimixina B a resistência foi mantida. Resultados semelhantes foram
observados em isolados clínicos de A. baumannii in vivo, durante terapia com colistina e
mesmo após diversos cultivos na ausência do antimicrobiano, seu fenótipo de
sensibilidade também não foi recuperado. (Rodrigues et al., 2009). Diferente do
fenômeno que ocorre com isolados de A. baumannii, Moskowitz et al. (2012) mostrou que
isolados de P. aeruginosa que foram submetidos ao cultivo na presença de colistina,
reverteram seu fenótipo de sensibilidade quando cultivados na ausência da droga.
Em nosso estudo foi observado que, ao mesmo tempo em que a resistência à
polimixina B foi desenvolvida pela indução devido à pressão seletiva exercida pelo
antimicrobiano, o isolado mutante resultante dessa indução, A027Ind, passou a
apresentar sensibilidade a outros antimicrobianos aos quais era, anteriormente,
resistente, entre eles os β-lactâmicos e os aminoglicosídeos. Assim como o
desenvolvimento de resistência à polimixina B, o perfil de sensibilidade aos β-lactâmicos
também foi estável no isolado A027Ind, sugerindo uma desestruturação irreversível da
parede celular, que poderia ter facilitado a ação dos outros antimicrobianos. Essa
mudança no perfil de sensibilidade pode fazer com que essas amostras não sejam
62
Discussão
detectadas nos laboratórios de microbiologia, pois esses pacientes geralmente utilizam
outros antimicrobianos em associação com polimixinas.
Estudos clínicos têm sugerido a associação de polimixina B com outros
antimicrobianos para o tratamento de infecção por A baumannii multirresistentes (MDR).
Relatos de sucesso terapêutico em casos, onde houve
a utilização de colistina em
associação com rifampicina ou amicacina para infecções respiratórias e de corrente
sanguínea por A. baumannii MDR levaram foram publicados e incentivaram ainda mais
estudos de sinergismo entre esses antimicrobianos (Fulnecky et al., 2005; Petrosillo et
al., 2005; Biancofiore et al., 2007; Bassetti et al., 2008; Song et al., 2008). Estudos mais
recentes têm descrito a associação dos carbapenens, imipenem, meropenem e, mais
recentemente, doripenem, além de tigeciclinacom colistina com boa resposta clínica para
o tratamento de infecções por A. baumannii multirresistentes (Principe et al., 2009;
Candel et al., 2010; Pankuch et al., 2010; Rodriguez et al., 2010; Hornsey et al., 2011;
Santimaleeworagun et al., 2011; Sheng et al., 2011; Shields et al., 2011; Peck et al.,
2012). A desestruturação observada no isolado A027ind poderia justificar em parte o
sucesso do sinergismo entre as polimixinas e outras classes de antimicrobianos. Essa
desestruturação da parede poderia favorecer a entrada dos outros antimicrobianos.
Entretanto, em nosso estudo não foi observada redução nas CIM para quinolonas no
isolado A027Ind, possivelmente pelo fato de que o mecanismo de ação e resistência a
esses agentes são relacionados à síntese de DNA bacteriano e não com a parede celular
(Sheng et al., 2009).
Além da restituição da sensibilidade aos carbapenens, estudos têm demonstrado
que bactérias Gram negativas com resistência induzida às polimixinas podem tornar-se
sensíveis até mesmo a antimicrobianos aos quais apresenta resistência intrínseca, entre
eles a vancomicina (Gordon et al., 2010), devido ao aumento da permeabilidade do
envoltório celular, facilitando o acesso da vancomicina ao seu sítio de ligação na
membrana celular interna bacteriana.
63
Discussão
O isolado A027 apresentou resistência aos β-lactâmicos devido à produção de
carbapenemase OXA-23, provavelmente associada a ISAbaI. Mesmo após a indução de
resistência à polimixina B e a alteração do fenótipo de sensibilidade aos β-lactâmicos,
esses genes ainda estavam presentes no isolado A027Ind, o que indica que essa
reversão de sensibilidade aos diversos antimicrobianos não foi devido à perda de
plasmídios ao longo dos vários subcultivos para indução de resistência à polimixina B,
mas, possivelmente pela perda da integridade da parede celular bacteriana. Outra
observação realizada em nosso estudo e que reforça essa hipótese, é o fato de que
somente o isolado A027Ind não conseguiu sobreviver em meio hipotônico, sugerindo uma
fragilidade maior em sua parede celular após o cultivo na presença de polimixina B.
Moffat et al. (2010) sugerem a diminuição da integridade da parede celular de
isolados de A. baumannii submetidos à indução de resistência à colistina em laboratório
devido à perda total de LPS, por meio de espectrometria de massa. Mutações nos genes
que catalisam a síntese do LPS foram observadas, o que justificaria a perda total do LPS
bacteriano nesses isolados. Em outro estudo, esses mesmos autores descreveram uma
seqüência de inserção ISAba11 nos genes que codificam a síntese de LPS, lpxA e lpxC,
que justificaria os resultados obtidos no primeiro estudo (Moffat et al., 2011). Esses
autores também relacionam a inativação desses genes com a alteração do perfil de
sensibilidade aos outros antimicrobianos. Mais experimentos são necessários para
determinar se nossos isolados resistentes à polimixina B sofreram mutações nos genes
que codificam o LPS.
Pela metodologia de MET, foi observada uma deposição de “grânulos” na porção
intracelular da membrana interna em ambos isolados submetidos à indução de
resistência à polimixina B. Por essa metodologia não foi possível observar diferenças na
integridade da parede celular no isolado A027Ind, que possam ter provocado as
alterações observadas no perfil de sensibilidade. Entretanto, foi observado um
espessamento de parede celular no isolado com resistência “natural” à polimixina B. Essa
64
Discussão
observação sugere que o mecanismo observado no fenótipo de resistência “natural” às
polimixinas é diferente do mecanismo observado no fenótipo de resistência induzida a
esses antimicrobianos.
Em estudos anteriores, experimentos com microscopia eletrônica de varredura e
microscopia de força atômica mostraram diferenças na topografia e rugosidade da
superfície celular de A. baumannii em isolados com resistência in vitro à colistina (Gordon
et al., 2010; Soon et al., 2011a). Soon et al. (2009) observaram que a natureza e o grau
de dano na parede celular de isolados de A. baumannii submetidos ao tratamento com
colistina foi similar na fase estacionária e logarítmica da curva de crescimento bacteriano.
Esses autores analisaram a superfície celular desses isolados em baixas (4 µg/mL) e
elevadas (32 µg/mL) concentrações de colistina. O tratamento com 4 µg/mL de colistina
promoveu o aparecimento de pequenas cavidades ao longo da superfície celular
bacteriana e aumento da rugosidade, mas a forma celular foi mantida. Eles também
observaram diferenças na topografia celular e presença de debris ao longo de algumas
células após o tratamento com colistina. Na presença de 32 µg/mL, os isolados de A.
baumannii apresentaram uma superfície mais lisa à inspeção visual. Além disso, o
número de células foi reduzido e apresentaram uma tendência em formar “clusters”.
Moffat et al. (2011) também observaram diferenças na integridade das membranas de
isolados sensíveis e resistentes in vitro à colistina, utilizando provas de fluorescência para
superfícies hidrofóbicas, sugerindo a modificação estrutural da parede celular bacteriana
após o contato com o antimicrobiano.
A molécula de polimixina B é carregada positivamente e, por isso, possui alta
afinidade pela superfície celular bacteriana negativa. A redução nessa carga diminui a
afinidade desses agentes antimicrobianos pela célula bacteriana, desenvolvendo
resistência aos mesmos. O mecanismo de espessamento de parede é conhecido em
isolados de Staphylococcus aureus quando apresenta resistência à vancomicina, um
antimicrobiano da classe dos glicopeptídeos que age na parede celular, se ligando à
porção D-Ala-D-Ala dos resíduos de mureína, inibindo a síntese do peptideoglicano pelas
65
Discussão
PBPs presentes na membrana interna da célula bacteriana. A parede mais espessa age
como uma barreira para a vancomicina atingir seu sítio alvo (Sanyal e Greenwood, 1993;
Norazah et al., 2009). No entanto, não foi encontrada na literatura a relação entre
espessamento de parede e resistência às polimixinas. Devido ao mecanismo de ação das
polimixinas ser por alteração eletrostática na parede celular bacteriana, sugerimos que o
espessamento de parede observado no isolado resistente à polimixina B poderia ter
levado a uma redução da carga negativa da membrana celular de A. baumannii ou uma
maior dificuldade para o antimicrobiano em atingir o LPS bacteriano. Segundo Nikaido et
al. (2003), microrganismos com hiperprodução de cápsula polissacarídica podem não
apresentar a porção antígeno O do LPS na parede celular bacteriana, dessa forma, a
parede celular poderia apresentar uma superfície com carga menos negativa.
Diversos estudos tem demonstrado a participação de sistemas de dois
componentes na regulação do desenvolvimento de resistência às polimixinas (Adams et
al., 2010; Arroyo et al., 2005; Moskowitz et al., 2004). Em isolados de A. baumannii é
encontrado o sistema PmrAB que envolve a participação da proteína PmrC para adição
de fosfoetanolamina no lipídio A, promovendo modificações no LPS bacteriano e
consequente alteração no sítio de ligação das polimixinas (Miller et al., 2011; Beceiro et
al., 2011; Moskovitz et al., 2012).
Estudos mais recentes demontraram que mutações no gene pmrB tem levado ao
desenvolvimento de resistência às polimixinas em isolados de A. baumannii e P.
aeruginosa (Adams et al., 2011; Moskowitz et al., 2012). Nossos isolados de A.
baumannii foram submetidos ao sequenciamento dos genes que compõe o sistema de
dois componentes PmrAB e foram encontradas alterações no gene pmrB no isolado
A027Ind, com resistência induzida. Essas alterações não foram observadas no isolado
com resistência “natural”.
Para verificar alterações que possam ser promovidas por essa mutação,
realizamos análise da transcrição desses genes por qRT-PCR. Foram detectados
diferentes níveis de transcrição entre o isolado que apresentou resistência induzida e
66
Discussão
àquele que já apresentava resistência “natural”. Quando o isolado sensível foi submetido
ao cultivo na presença de polimixina B (A027Ind), foi observado um aumento da
transcrição do gene pmrA, que foi ativado pelo sensor quinase pmrB, que, por sua vez,
apresentou uma redução da transcrição após a indução. A proteína PmrB é a mais
externa do sistema e tem função de sensor quinase, que reconhece fatores ambientais e
desencadeia a expressão do sistema, neste caso, a presença da polimixina B no meio
(Miller et al., 2011). Essa redução da transcrição de pmrB pode ter sido devido à
desestruturação da parede celular bacteriana em decorrência da localização dessa
proteína ou mesmo devido à auto-regulação do sistema de dois componentes. Os
resultados de transcrição de PmrAB nos isolados sensível e seu mutante com resistência
induzida à polimixina B estão de acordo com resultados já observados por Baceiro et al.
(2011).
Diferente do isolado A027Ind, a transcrição de pmrB no isolado com resistência
“natural” à polimixina B, A009, estava elevada em relação ao isolado sensível A027. No
entanto, a transcrição desse gene não resultou na ativação de pmrA nesse isolado, nem
em seu respectivo mutante induzido, reforçando nossa hipótese de que a resistência
“natural” às polimixinas envolve outro mecanismo de regulação gênica. Não foi observada
mutação no gene pmrA, que pudesse justificar a dimiuição da transcrição nesse isolado.
Em um estudo de Adams et al. (2011), a deleção do gene pmrB, promoveu a
perda do perfil de resistência induzida à colistina. No entanto, Moskowitz et al. (2012)
afirmam que a resistência à colistina mediada por PmrB é dependente de PmrA, pois a
indução de resistência não foi capaz de ser atingida no isolado com deleção do gene
pmrA, mesmo após ativação de pmrB. Dessa forma, podemos afirmar que a resistência
observada no isolado A009 não estava sendo regulada pelo sistema PmrAB, diferente do
observado com o isolado A027Ind. Entretanto, mais estudos são necessários para
determinar o mecanismo que está envolvido no fenótipo de resistência “natural” à
polimixina B (Andrews et al., 2002; Arroyo et al., 2011; Miyazaki et al., 2009; Moskowitz et
al., 2004).
67
Discussão
Alterações no LPS da parede celular bacteriana, com adição de 4-aminoarabinose
e fosfoetanolamina no lipídio A tem sido descritas (Miller et al., 2011; Moskowitz et al.,
2011; Arroyo et al., 2011). Segundo Adams et al. (2011), essas alterações modificam a
natureza do LPS, tornando-o mais hidrofílico. As polimixinas são antimicrobianos
detergentes, dessa forma, possuem natureza lipofílica. Essas alterações promovidas pela
indução de resistência promovem diminuição da interação da droga com as membranas
celulares bacterianas. O mecanismo de ação das polimixinas envolve interação com as
cargas negativas da parece celular bacteriana. De acordo com Soon et al. (2011b), os
isolados clínicos de A. baumannii, assim como ATCC 19606, apresentaram diminuição na
carga negativa da membrana quando foram submetidos ao cultivo na presença de
polimixina B e colistina, reduzindo a interação do antimicrobiano pela superfície celular.
Dessa forma, experimentos de mensuração de cargas de superfície ainda são
necessários para esclarecimento das alterações sofridas pelos isolados de A. baumannii
avaliados neste estudo. Esses mecanismos de resistência descritos até o momento
correspondem ao fenótipo adaptativo de resistência às polimixinas.
Como a desestruturação da parede celular poderia interferir com o mecanismo de
ação e resistência de outros antimicrobianos que agem na síntese de parede celluar,
avaliamos os mecanismos de resistência a beta-lactâmicos nos isolados expostos à
polimixina B, estudamos mecanismos de resistência conhecidos, envolvidos com a
parede celular bacteriana. Por experimentos de qRT-PCR, foi observada uma redução na
expressão do sistema de efluxo AdeABC no isolado induzido A027Ind em relação à sua
cepa parental sensível. O sistema de efluxo atua na resistência aos β-lactâmicos por
ejetar da célula bacteriana os antimicrobianos e, também, as enzimas β-lactamases
produzidas no espaço periplasmático da mesma, as quais vão atuar sobre o
antimicrobiano e reduzir sua atividade na célula (Rosenfeld et al., 2012). Estudos
sugerem que a enzima OXA-23 atue em associação com a hiperexpressão do sistema de
efluxo AdeABC, para que sua ação seja significativa no perfil de resistência aos
carbapenens em isolados de A. baumannii (Lee et al. 2010). Dessa forma, a diminuição
68
Discussão
da expressão desse sistema de efluxo pode estar associada com perfil de sensibilidade
aos carbapenens observado no isolado A027Ind, após a indução de resistência à
polimixina B.
Análises de porinas mostraram alterações em suas transcrições nos isolados de
A. baumannii, antes e após a indução de resistência à polimixina B. Vila et al. (2007) citou
em seu estudo que os resultados observados sugeriam a modificação na expressão da
porina OmpW em isolados mutantes de A. baumannii com resistência à polimixina B
induzida em laboratório. Essa observação foi confirmada em nosso estudo pelos
experimentos de qRT-PCR e SDS-PAGE de proteínas de membrana externa. A porina
OmpW teve uma redução na sua expressão após o cultivo na presença de polimixina B.
A porina OmpW possui natureza hidrofóbica e é relacionada à osmorregulação
bacteriana (Xu et al., 2005; Berg et al., 2004). Hong et al. (2006) observaram uma alta
afinidade de uma molécula detergente, utilizada na extração de proteínas de membrana
externa, pela porina OmpW. A molécula de polimixina possui natureza detergente, dessa
forma, a diminuição da expressão de OmpW, pode contribuir para a redução da afinidade
de antimicrobianos dessa classe pela superfície celular bacteriana, contribuindo para o
aumento da resistência. Já a diminuição da expressão da porina CarO tem sido
relacionada com o aumento da resistência aos carbapenens (Vila et al., 2007). O isolado
com resistência induzida à polimixina, A027Ind, que se tornou sensível aos β-lactâmicos
após a indução de resistência à polimixina B, apresentou aumento da expressão das
porinas OmpA e CarO após à exposição ao antimicrobiano. Esse aumento de expressão,
assim como a diminuição da expressão do sistema de efluxo AdeABC, pode ter
contribuído para o perfil de sensibilidade exibido por esse isolado após a indução de
resistência à polimixina B. Os outros resultados de transcrição de porinas por qRT-PCR e
expressão dessas proteínas no gel de SDS-PAGE não puderam ser relacionados,
provavelmente, por alguma particularidade das técnicas que não foram controladas em
nosso estudo. Esses resultados necessitam de maiores análises posteriores.
69
Discussão
Para verificar o mecanismo utilizado para promover o espessamento de parede
observado no isolado com resistência “natural” à polimixina B, estudamos possíveis
alterações nas PBPs dos isolados de A. baumannii. As PBPs são proteínas presentes na
membrana interna da parede celular bacteriana e são responsáveis pela síntese e
organização do peptideoglicano na parede celular, promovendo a manutenção da forma
celular por gerações seguintes (Sauvage et al., 2008). Em nosso estudo, foram
sequenciados os genes que codificam as PBPs de alto peso molecular, de classe A,
PBP1a e PBP1b, que exercem função de transpeptidases e transglicosilases. Também
foram sequenciadas as PBPs de classe B, PBP2 que desempenha o papel de elongase e
PBP3 que está envolvida no processo de divisão celular (Sauvage et al., 2008).
As PBPs de classe A, 1a e 1b, possuem função de transglicosilação, catalisando a
polimerização de cadeias de glicano e, função de transpeptidação promovendo a ligação
cruzada entre as cadeias de glicano através das cadeias laterais de pentapeptídeo
(Sauvage et al., 2008). Sauvage et al. (2008) afirmam que na inativação de uma das duas
proteínas, a outra substitui sua função na síntese de peptideoglicano para manutenção
da atividade da célular bacteriana. As PBPs de classe B, PBP3 e PBP4 possuem função
de elongase e divisão celular, respectivamente. É sabido que alterações nessas PBPs
promovem redução da afinidade da superfície celular por β-lactâmicos, levando à
resistência aos mesmos (Sauvage et al., 2008).
Yun et al. (2011) relata a participação da PBP1a, PBP3 e PBP5 de A. baumannii,
associada com outros mecanismos de resistência como hiperexpressão de sistemas de
efluxo AdeABC e AdeIJK, além de produção de β-lactamases, na diminuição da
sensibilidade dessa especíe aos β-lactâmicos. No entanto, não existe na literatura relatos
da relação entre modificações de PBPs e perfil de resistência às polimixinas. Cayô et al.
(2011) observaram que a maioria das mutações encontradas nos genes que codificavam
as PBPs de alto peso molecular foram silenciosas não gerando alterações de
aminoácido. Estes autores observaram que estas mutações sempre ocorriam nas
mesmas posições (prováveis “Hot Spot Mutations”) e estavam mais relacionadas ao perfil
70
Discussão
clonal do que a resistência aos β-lactâmicos, uma vez que essas mesmas mutações
também estavam presentes nas cepas sensíveis. O mesmo foi observado para a cepa
sensível e seu mutante induzido em nosso estudo. Entretanto, um grande número de
mutações foi observado para a cepa resistente e seu mutante induzido, incluindo
alterações no “frame” de leitura no final da PBP1a, além de uma mutação ocorrida no
quinto motivo conservado do sítio de transpeptidação da PBP1b dessas cepas. Tais
mutações, até o momento, não foram descritas em nenhuma cepa de A. baumannii, cujas
sequencias de PBPs foram avaliadas, o que leva a crer que, provavelmente, essas
mutações representem um fator evolutivo na resistência “natural” às polimixinas. Além
disso, as mutações observadas nas sequencias de PBPs de alto peso molecular de
classe A (PBP1a e PBP1b) podem justificar o aumento da parede celular no isolado A009
observada na MET. Entretanto, estudos posteriores com inclusão de PBPs sem mutação
nesse isolado serão realizados para verificar a reversão ou não do fenótipo de
sensibilidade e determinar sua associação com o fenótipo de resistência “natural” à
polimixina B.
A resistência às polimixinas, seja ela por um mecanismo adaptativo ou por um
mecanismo “natural”, merece grande atenção por profissionais da saúde, para evitar que
haja a perda dessa opção terapêutica para o tratamento de infecções por A. baumannii e
outros bacilos Gram negativos que apresentem resistência a todos os outros
antimicrobianos disponíveis comercialmente. Felizmente, a resistência “natural” ainda é
raramente observada na clínica. No entanto, sabendo da capacidade dos isolados de A.
baumannii em se adaptar ao ambiente, sob pressão seletiva e em adquirir diferentes
mecanismos de resistência, o uso de outros antimicrobianos deve ser realizado com
extrema cautela para que o mecanismo “natural” de resistência às polimixinas não
comece a ser relatado em isolados multirresistentes, acabando com as possibilidades de
tratamento para essas infecções.
71
Discussão
A resistência aos diversos antimicrobianos apresentada por isolados clínicos de A.
buamannii vem aumentando as taxas de mortalidade por infecções que anteriormente
eram mais facilmente tratadas com β-lactâmicos ou outros antimicrobianos. Novos alvos
terapêuticos precisam ser descobertos já que esses microrganismos possuem um amplo
arsenal para defesa contra os antimicrobianos já existentes. Dessa forma, as polimixinas
tornaram-se a última opção para tratamento de infecções por bacilos Gram-negativos
multirresistentes. No entanto, atualmente o conhecimento dos mecanismos de resistência
às polimixinas tornou-se essencial para manter a viabilidade dessa droga até que novas
opções terapêuticas estejam disponíveis para serem utilizadas.
72
Conclusões
7. CONCLUSÕES
73
Conclusões
7. CONCLUSÕES
•
A resistência induzida às polimixinas verificada para o isolado incialmente
sensível é estável, ao contrário do observado para o isolado incialmente
resistente à polimixina B quando submetido ao cultivo na presença de
polimixina B;
•
A indução da resistência às polimixinas no isolado MDR A027 levou a
reversão da sensibilidade aos β-lactâmicos e aos aminoglicosídeos;
•
A resistência induzida está relacionada à desestruturação da parede celular
bacteriana com provável contribuição da diminuição da expressão da porina
OmpW.
•
A resistência “natural” pode estar relacionada ao espessamento da parede
celular e, pode estar associada a mutações nos genes codificadores das
PBPs;
•
O sistema regulatório de dois componentes PmrAB está associado à
resistência induzida às polimixinas, mas essa associação não foi observada
no fenótipo de resistência “natural” neste estudo;
•
Os resultados deste estudo nos permitem sugerir que os dois fenótipos de
resistência, “natural” e induzido, às polimixinas observados em isolados de
A. baumannii resultam de distintos mecanismos de resistência.
74
Referências
8. REFERÊNCIAS
75
Referências
8. REFERÊNCIAS
Adams MD, Nickel GC, Bajaksouzian S, Lavender H, Murthy AR, Jacobs MR, Bonomo
RA. Resistance to Colistin in Acinetobacter baumannii Associated with Mutations in the
PmrAB Two-Component System. Antimicrob Agents Chemother. 2009; 53(9):3628-3634.
Al-Sweih NA, Al-Hubail MA, Rotimi VO. Emergence of tigecycline and colistin resistance
in Acinetobacter species isolated from patients in Kuwait hospitals. J Chemother. 2011;
23(1):13-16.
Andrews J, Walker R, King A. Evaluation of media available for testing the susceptibility of
Pseudomonas aeruginosa by BSAC methodology. J Antimicrob Chemother. 2002;
50:479-486.
Antonio CS, Neves PR, Medeiros M, Mamizuka EM, Elmor de Araújo MR, Lincopan N.
High prevalence of carbapenem-resistant Acinetobacter baumannii carrying the blaOXA-143
gene in Brazilian hospitals. Antimicrob Agents Chemother. 2011; 55(3):1322-1323.
Arroyo LA, García-Curiel A, Pachón-Ibañez ME, Llanos AC, Ruiz M, Pachón J, Aznar J.
Reliability of the E-Test Methods for Detection of Colistin Resistance in Clinical Isolates of
Acinetobacter baumannii. J Clin Microbiol. 2005; 43(2):903-905.
Arroyo LA, Herrera CM, Fernandez L, Hankins JV, Trent MS, Hancock REW. The
pmrCAB Operon Mediates Polymyxin Resistance in Acinetobacter baumannii ATCC
17978 and Clinical Isolates through Phosphoethanolamine Modification of Lipid A. J.
Agents Chemoter. 2011; 55(8):3743-3751.
76
Referências
Barrow K, Kwon DH. Alterations in two-component regulatory systems of phoPQ and
pmrAB are associated with polymyxin B resistance in clinical isolates of Pseudomonas
aeruginosa. Antimicrob Agents Chemother. 2009; 53(12):5150-5154.
Bassetti M, Repetto E, Righi E, Boni S, Diverio M, Molinari MP, Mussap M, Artioli S,
Ansaldi F, Durando P, Orengo G, Bobbio Pallavicini F, Viscoli C. Colistin and rifampicin in
the treatment of multidrug-resistant Acinetobacter baumannii infections. J Antimicrob
Chemother. 2008; 61(2):417-420.
Beceiro A, Llobet E, Aranda J, Bengoechea JA, Doumith M, Hornsey M, Dhanji H, Chart
H, Bou G, Livermore DM, Woodford N. Phosphoethanolamine modification of lipid A in
colistin-resistant variants of Acinetobacter baumannii mediated by the pmrAB twocomponent regulatory system. Antimicrob Agents Chemother. 2011; 55(7):3370-3379.
Berg B Van den, Clemons WM Jr, Collinson I, Modis Y, Hartmann E, Harrison SC,
Rapoport TA. X-ray structure of a protein-conducting channel. Nature. 2004;
427(6969):36-44.
Bergen PJ, Li J, Rayner CR, Nation RL. Colistin methanesulfonate is an inactive prodrug
of colistin against Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2006;
50(6):1953-1958.
Biancofiore G, Tascini C, Bisà M, Gemignani G, Bindi ML, Leonildi A, Giannotti G,
Menichetti F. Colistin, meropenem and rifampin in a combination therapy for multi-drugresistant Acinetobacter baumannii multifocal infection. A case report. Minerva Anestesiol.
2007; 73(3):181-185.
77
Referências
Bogaerts P, Naas T, El Garch F, Cuzon G, Deplano A, Delaire T, Huang TD, Lissoir B,
Nordmann P, Glupczynski Y. GES extended-spectrum β-lactamases in Acinetobacter
baumannii isolates in Belgium. Antimicrob Agents Chemother. 2010; 54(11):4872-4878.
Bogaerts P, Rezende de Castro R, Roisin S, Deplano A, Huang TD, Hallin M, Denis O,
Glupczynski Y. Emergence of NDM-1-producing Acinetobacter baumannii in Belgium. J
Antimicrob Chemother. 2012 Feb 16. [Epub ahead of print].
Born P, Breukink E, Vollmer W. In vitro synthesis of cross-linked murein and its
attachment to sacculi by PBP1A from Escherichia coli. J Biol Chem. 2006; 281(37):2698526993.
Bonnin RA, Nordmann P, Potron A, Lecuyer H, Zahar JR, Poirel L. Carbapenemhydrolyzing GES-type extended-spectrum beta-lactamase in Acinetobacter baumannii.
Antimicrob Agents Chemother. 2011; 55(1):349-354.
Bou G, Oliver A, Martínez-Beltrán J. OXA-24, a novel class D beta-lactamase with
carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob Agents
Chemother. 2000; 44(6):1556-1561. Erratum in: Antimicrob Agents Chemother. 2006;
50(6):2280.
Bush K, Jacoby GA. Updated functional classification of beta-lactamases. Antimicrob
Agents Chemother. 2010; 54(3):969-976. Review.
Cai Y, Chai D, Wang R, Liang B, Bai N. Colistin resistance of Acinetobacter baumannii:
clinical reports, mechanisms and antimicrobial strategies. J. Antimicrob. Chemother. 2012;
[Epub ahead of print].
78
Referências
Candel FJ, Calvo N, Head J, Sánchez A, Matesanz M, Culebras E, Barrientos A, Picazo
J. A combination of tigecycline, colistin, and meropenem against multidrug-resistant
Acinetobacter baumannii bacteremia in a renal transplant recipient: pharmacodynamic
and microbiological aspects. Rev Esp Quimioter. 2010; 23(2):103-108.
Castelli MA, Véscovi EG, Soncini FC. The Phosphatase Activity Is the Target for Mg21
Regulation of the Sensor Protein PhoQ in Salmonella. J Biol Chem. 2000; 275(30):22948–
22954.
Cayô R, Rodríguez MC, Espinal P, Fernández-Cuenca F, Ocampo-Sosa AA, Pascual A,
Ayala JA, Vila J, Martínez-Martínez L. Analysis of genes encoding penicillin-binding
proteins in clinical isolates of Acinetobacter baumannii. Antimicrob Agents Chemother.
2011; 55(12):5907-5913.
Chang KC, Lin MF, Lin NT, Wu WJ, Kuo HY, Lin TY, Yang TL, Chen YC, Liou ML. Clonal
spread of multidrug-resistant Acinetobacter baumannii in eastern Taiwan. J Microbiol
Immunol Infect. 2012; 45(1):37-42.
Cheng HY, Chen YF, Peng HL. Molecular characterization of the PhoPQ-PmrDPmrAB
mediated pathway regulating polymyxin B resistance in Klebsiella pneumoniae CG43. J
Biomed Scien. 2010; 1760.
Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular
biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001;
65(2):232-260.
79
Referências
CLSI. Clinical Laboratory Standard Institute Methods for Dilution Antimicrobial
Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard—Eighth
Edition. Document M07-A8. Vol. 29 No. 2. Wayne, Pa. 2009.
CLSI. Clinical Laboratory Standard Institute. Performance standards for antimicrobial
susceptibility testing; Twenty-First Informational Supplement. Document M100-S22,
Wayne, Pa. 2012.
Costa SF, Woodcock J, Gill M, Wise R, Barone AA, Caiaffa H, Levin AS. Outer-membrane
proteins pattern and detection of beta-lactamases in clinical isolates of imipenem-resistant
Acinetobacter baumannii from Brazil. Int J Antimicrob Agents. 2000;13(3):175-182.
Coyne S, Rosenfeld N, Lambert T, Courvalin P, Périchon B. Overexpression of
resistance-nodulation-cell division pump AdeFGH confers multidrug resistance in
Acinetobacter baumannii. Antimicrob Agents Chemother. 2010; 54(10):4389-4393.
Curcio D, Fernández F, Cané A, Barcelona L, Stamboulian D. Indications of a new
antibiotic in clinical practice: results of the tigecycline initial use registry. Braz J Infect Dis.
2008;12(3):198-201.
Dalla-Costa LM, Coelho JM, Souza HA, Castro ME, Stier CJ, Bragagnolo KL, Rea-Neto A,
Penteado-Filho SR, Livermore DM, Woodford N. Outbreak of carbapenem-resistant
Acinetobacter baumannii producing the OXA-23 enzyme in Curitiba, Brazil. J Clin
Microbiol. 2003; 41(7):3403-3406.
Fernández L, Gooderham WJ, Bains M et al. Adaptive resistance to the "last hope"
antibiotics polymyxin B and colistin in Pseudomonas aeruginosa is mediated by the novel
80
Referências
two-component regulatory system ParR-ParS. Antimicrob Agents Chemother. 2010;
54(8):3372-3382.
Fernández-Cuenca, F., L. Martínez-Martínez, M. C. Conejo, J. A. Ayala, E. J. Perea, and
A. Pascual. Relationship between beta-lactamase production, outer membrane protein
and penicillin-binding protein profiles on the activity of carbapenems against clinical
isolates of Acinetobacter baumannii. J Antimicrob Chemother. 2003; 51:565-574.
Fulnecky EJ, Wright D, Scheld WM, Kanawati L, Shoham S. Amikacin and colistin for
treatment of Acinetobacter baumannii meningitis. J Infect. 2005; 51(5):e249-251.
Gales
AC,
Reis
AO,
Jones
RN.
Contemporary
Assessment
of
Antimicrobial
SusceptibilityTesting Methods for Polymyxin B and Colistin: Review of Available
Interpretative Criteria and Quality Control Guidelines. J Clin Microbiol. 2001; 39(1):183–
190.
Gales AC, Tognim MC, Reis AO, Jones RN, Sader HS. Emergence of an IMP-like
metallo-enzyme in an Acinetobacter baumannii clinical strain from a Brazilian teaching
hospital. Diagn Microbiol Infect Dis. 2003; 45(1):77-79.
Gales AC, Jones RN, Sader HS. Global assessment of the antimicrobial activity of
polymyxin B against 54 731 clinical isolates of Gram-negative bacilli: report from the
SENTRY antimicrobial surveillance programme (2001-2004). Clin Microbiol Infect. 2006;
12(4):315-321.
Gales AC, Jones RN, Sader HS. Contemporary activity of colistin and polymyxin B against
a worldwide collection of Gram-negative pathogens: results from the SENTRY
81
Referências
Antimicrobial Surveillance Program (2006–09). J Antimicrob Chemother. 2011; 66:2070–
2074.
Gehrlein M, Leying H, Cullmann W, Wendt S, Opferkuch W. Imipenem resistance in
Acinetobacter baumanii is due to altered penicillin-binding proteins. Chemotherapy. 1991;
37(6):405-412.
Ghuysen JM. Use of bacteriolytic enzymes in determination of wall structure and their role
in cell metabolism. Bacteriol Rev. 1968; 32(4 Pt 2):425-464.
Giannouli, M., S. Cuccurullo, V. Crivaro, A. Di Popolo, M. Bernardo, F. Tomasone, G.
Amato, S. Brisse, M. Triassi, R. Utili, and R. Zarrilli. Molecular epidemiology of multidrugresistant Acinetobacter baumannii in a tertiary care hospital in Naples, Italy, shows the
emergence of a novel epidemic clone. J Clin Microbiol. 2010; 48:1223-1230.
Goffin C, Ghuysen JM. Multimodular penicillin-binding proteins: an enigmatic family of
orthologs and paralogs. Microbiol Mol Biol Rev. 1998; 62(4):1079-1093. Review.
Gooderham WJ, Hancock REW. Regulation of virulence and antibiotic resistance by twocomponent regulatory systems in Pseudomonas aeruginosa. FEMS Microbiol Rev. 2009;
33:279–294.
Gordon NC, Png K, Wareham DW. Potent synergy and sustained bactericidal activity of a
vancomycin-colistin combination versus multidrug-resistant strains of Acinetobacter
baumannii. Antimicrob Agents Chemother. 2010; 54(12):5316-5322.
82
Referências
Gribun A, Nitzan Y, Pechatnikov I, Hershkovits G, Katcoff DJ. Molecular and structural
characterization of the HMP-AB gene encoding a pore-forming protein from a clinical
isolate of Acinetobacter baumannii. Curr Microbiol. 2003; 47(5):434-443.
Groisman EA, Kayser J, Soncini FC. Regulation of Polymyxin Resistance and Adaptation
to Low-Mg2+ Environments. J Bacteriol. 1997; 179(22):7040-7045.
Gunn JS, Lim KB, Krueger J, Kim K, Guo L, Hackett M, Miller SI. PmrA-PmrB-regulated
genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol
Microbiol. 1998; 27(6):1171-1182.
Hancock RE. Peptide antibiotics. Lancet. 1997; 349(9049):418-422. Review.
Hawley JS, Murray CK, Jorgensen JH. Colistin heteroresistance in Acinetobacter and its
association with previous colistin therapy. Antimicrob Agents Chemother. 2008; 52(1):351352.
Heinrichs DE, Yethon JA, Whitfield C. Molecular basis for structural diversity in the core
regions of the lipopolysaccharides of Escherichia coli and Salmonella enterica. Mol
Microbiol. 1998; 30(2):221-232. Review.
Higgins, P. G., C. Dammhayn, M. Hackel, and H. Seifert. 2010. Global spread of
carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother. 65:233-238.
Höltje JV. Growth of the stress-bearing and shape-maintaining murein sacculus of
Escherichia coli. Microbiol Mol Biol Rev. 1998; 62(1):181-203. Review.
83
Referências
Hong H, Patel DR, Tamm LK, Berg B. The outer membrane protein OmpW Forms an
Eight-stranded B-Barrel with a Hydrophobic Channel. J Biol Chem. 2006; 281(11):75687577.
Hornsey M, Ellington MJ, Doumith M, Thomas CP, Gordon NC, Wareham DW, Quinn J,
Lolans K, Livermore DM, Woodford N. AdeABC-mediated efflux and tigecycline MICs for
epidemic clones of Acinetobacter baumannii. J Antimicrob Chemother. 2010; 65(8):15891593.
Hornsey M, Wareham DW. In vivo efficacy of glycopeptide-colistin combination therapies
in a Galleria mellonella model of Acinetobacter baumannii infection. Antimicrob Agents
Chemother. 2011; 55(7):3534-3537.
Huang, L., L. Sun, G. Xu, and T. Xia. Differential susceptibility to carbapenems due to the
AdeABC efflux pump among nosocomial outbreak isolates of Acinetobacter baumannii in
a Chinese hospital. Diagn Microbiol Infect Dis. 2008; 62:326-332.
Jawad, A., H. Seifert, A. M. Snelling, J. Heritage, and P. M. Hawkey. 1998. Survival of
Acinetobacter baumannii on dry surfaces: comparison of outbreak and sporadic isolates. J
Clin Microbiol. 36:1938-1941.
Kato A, Latifi T, Groisman EA. Closing the loop: the PmrA/PmrB two-component system
negatively controls expression of its posttranscriptional activator PmrD. Proc Natl Acad
Sci U S A. 2003; 100(8):4706-4711.
Kato A, Mitrophanov AY, Groisman EA. A connector of two-component regulatory
systems promotes signal amplification and persistence of expression. Proc Natl Acad Sci
U S A. 2007; 104(29):12063-12068.
84
Referências
Ko KS, Suh JY, Kwon KT, Jung SI, Park KH, Kang CI, Chung DR, Peck KR, Song JH.
High rates of resistance to colistin and polymyxin B in subgroups of Acinetobacter
baumannii isolates from Korea. J Antimicrob Chemother. 2007; 60(5):1163-1167.
Koch L, Hofer S, Weigand MA, Frommhold D, Poeschl J, Ruef P. Inhibition of LPSInduced Activation of Coagulation by p38 MAPK Inhibitor. ISRN Hematol. 2012;
2012:762614.
Landman D, Georgescu C, Martin DA, Quale J. Polymyxins revisited. Clin Microbiol Rev.
2008; 21(3):449-465. Review.
Lee K, Yum JH, Yong D, Lee HM, Kim HD, Docquier JD, Rossolini GM, Chong Y. Novel
acquired metallo-beta-lactamase gene, bla(SIM-1), in a class 1 integron from
Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother.
2005; 49(11):4485-4491.
Lee Y, Yum JH, Kim CK, Yong D, Jeon EH, Jeong SH, Ahn JY, Lee K. Role of OXA-23
and AdeABC efflux pump for acquiring carbapenem resistance in an Acinetobacter
baumannii strain carrying the blaOXA-66 gene. Ann Clin Lab Sci. 2010; 40(1):43-48.
Lee K, Yong D, Jeong SH, Chong Y. Multidrug-resistant Acinetobacter spp.: increasingly
problematic nosocomial pathogens. Yonsei Med J. 2011; 52(6):879-891.
Lee YT, Kuo SC, Chiang MC, Yang SP, Chen CP, Chen TL, Fung CP. Emergence of
carbapenem-resistant non-baumannii species of Acinetobacter harboring a blaOXA-51-like
gene that is intrinsic to Acinetobacter baumannii. Antimicrob Agents Chemother. 2012;
56(2):1124-1127.
85
Referências
Levin AS, Barone AA, Penço J, Santos MV, Marinho IS, Arruda EA, Manrique EI, Costa
SF. Intravenous colistin as therapy for nosocomial infections caused by multidrugresistant Pseudomonas aeruginosa and Acinetobacter baumannii. Clin Infect Dis. 1999;
28(5):1008-1011.
Li J, Nation RL, Turnidge JD, Milne RW, Coulthard K, Rayner CR, Paterson DL. Colistin:
the re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections.
Lancet Infect Dis. 2006a; 6(9):589-601. Review.
Li J, Rayner CR, Nation RL et al. Heteroresistance to colistin in multidrug-resistant
Acinetobacter baumannii. Antimicrob Agents Chemother. 2006b; 50:2946–2950.
Llobet E, Toma´s JM, Bengoechea JA. Capsule polysaccharide is a bacterial decoy for
antimicrobial peptides. Microbiol. 2008;154:3877–3886.
López-Rojas R, Domínguez-Herrera J, McConnell MJ, Docobo-Peréz F, Smani Y,
Fernández-Reyes M, Rivas L, Pachón J. Impaired virulence and in vivo fitness of colistinresistant Acinetobacter baumannii. J Infect Dis. 2011; 203(4):545-548.
Madigan MT. et al. Microbiologia de Brock. 12. ed. Porto Alegre: ArtMed, 2010.
Magnet S, Courvalin P, Lambert T. Resistance-nodulation-cell division-type efflux pump
involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454.
Antimicrob Agents Chemother. 2001; 45(12):3375-3380.
Marchand I, Damier-Piolle L, Courvalin P, Lambert T. Expression of the RND-type efflux
pump AdeABC in Acinetobacter baumannii is regulated by the AdeRS two-component
system. Antimicrob Agents Chemother. 2004; 48(9):3298-3304.
86
Referências
Martí S, Fernández-Cuenca F, Pascual A, Ribera A, Rodríguez-Baño J, Bou G, Miguel
Cisneros J, Pachón J, Martínez-Martínez L, Vila J; Grupo de Estudio de Infección
Hospitalaria (GEIH). Prevalence of the tetA and tetB genes as mechanisms of resistance
to tetracycline and minocycline in Acinetobacter baumannii clinical isolates. Enferm Infecc
Microbiol Clin. 2006; 24(2):77-80.
Mendes RE, Kiyota KA, Monteiro J, Castanheira M, Andrade SS, Gales AC, Pignatari AC,
Tufik S. Rapid detection and identification of metallo-beta-lactamase-encoding genes by
multiplex real-time PCR assay and melt curve analysis. J Clin Microbiol. 2007; 45(2):544547.
Miller AK, Brannon MK, Stevens L et al. PhoQ mutations promote lipid A modification and
polymyxin resistance of Pseudomonas aeruginosa found in colistin-treated cystic fibrosis
patients. Antimicrob Agents Chemother. 2011; 55(12):5761-5769.
Mitrophanov AY, Jewett MW, Hadley TJ, Groisman EA. Evolution and dynamics of
regulatory architectures controlling polymyxin B resistance in enteric bacteria. PLoS
Genet. 2008; 4(10):e1000233.
Mitrophanov AY, Groisman EA. Signal integration in bacterial two-component regulatory
systems. Genes Dev. 2008; 22(19):2601-2611. Review.
Miyazaki H, Horii T, Nagura O, Suda T, Chida K, Nakamura H. Effect of the inoculum size
on
carbapenem
susceptibilities
of
beta-Lactamase-Negative,
Ampicillin-Resistant
Haemophilus influenza. Current Microbiol. 2009; 58:18-24.
Moffatt JH, Harper M, Harrison P, Hale JD, Vinogradov E, Seemann T, Henry R, Crane B,
St Michael F, Cox AD, Adler B, Nation RL, Li J, Boyce JD. Colistin resistance in
87
Referências
Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production.
Antimicrob Agents Chemother. 2010; 54(12):4971-4977.
Moffatt JH, Harper M, Adler B, Nation RL, Li J, Boyce JD. Insertion sequence ISAba11 is
involved in colistin resistance and loss of lipopolysaccharide in Acinetobacter baumannii.
Antimicrob Agents Chemother. 2011; 55(6):3022-3024.
Monterrubio-Villar, J., C. González-Velasco, S. Valdezate-Ramos, A. Córdoba-López, P.
Villalón-Panzano, and J. A. Saéz-Nieto. 2009. Outbreak of multiresistant Acinetobacter
baumannii in a polyvalent intensive care unit: clinical, epidemiological analysis and PFGEprinting evolution. Eur J Clin Microbiol Infect. Dis. 28:1281-1284.
Moskowitz SM, Ernst RK, Miller SI. PmrAB, a two-component regulatory system of
Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides
and addition of aminoarabinose to lipid A. J Bacteriol. 2004; 186(2):575-579.
Moskowitz SM, Brannon MK, Dasgupta N, Pier M, Sgambati N, Miller AK, Selgrade SE,
Miller SI, Denton M, Conway SP, Johansen HK, Høiby N. PmrB mutations promote
polymyxin resistance of Pseudomonas aeruginosa isolated from colistin-treated cystic
fibrosis patients. Antimicrob Agents Chemother. 2012; 56(2):1019-1030.
Mostachio AK, Levin AS, Rizek C, Rossi F, Zerbini J, Costa SF. High prevalence of OXA143 and alteration of outer membrane proteins in carbapenem-resistant Acinetobacter
spp. isolates in Brazil. Int J Antimicrob Agents. 2012;39(5):396-401.
Mussi, M. A., A. S. Limansky, and A. M. Viale. Acquisition of resistance to carbapenems in
multidrug-resistant clinical strains of Acinetobacter baumannii: natural insertional
88
Referências
inactivation of a gene encoding a member of a novel family of beta-barrel outer membrane
proteins. Antimicrob Agents Chemother. 2005; 49:1432-1440.
Navarre WW, Halsey TA, Walthers D et al. Co-regulation of Salmonella enterica genes
required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ.
Mol Microbiol. 2005; 56(2):492–508.
Navon-Venezia S, Leavitt A, Carmeli Y. High tigecycline resistance in multidrug-resistant
Acinetobacter baumannii. J Antimicrob Chemother. 2007; 59(4):772-774.
Nitzan Y, Pechatnikov I, Bar-El D, Wexler H. Isolation and characterization of heatmodifiable proteins from the outer membrane of Porphyromonas asaccharolytica and
Acinetobacter baumannii. Anaerobe. 1999; 5(1):43-50.
Nikaido, H. Molecular basis of bacterial outer membrane permeability revisited. Microbiol
Mol Biol Rev. 2003; 67(4):593-656.
Norazah A, Salbiah N, Nurizzat M, Santhana R. Vancomycin treatment failure in a
vancomycin susceptible methicillin-resistant Staphylococcus aureus (MRSA) infected
patient. Med J Malaysia. 2009; 64(2):166-167.
Obara M, Nakae T. Mechanisms of resistance to β-lactam antibiotics in Acinetobacter
calcoaceticus. J Antimicrob Chemother. 1991; 28:791-800.
Oliveira MS, Prado GV, Costa SF, Grinbaum RS, Levin AS. Ampicillin/sulbactam
compared with polymyxins for the treatment of infections caused by carbapenem-resistant
Acinetobacter spp. J Antimicrob Chemother. 2008; 61(6):1369-1375.
89
Referências
Opazo A, Sonnevend A, Lopes B, Hamouda A, Ghazawi A, Pal T, Amyes SG. Plasmidencoded PER-7 β-lactamase responsible for ceftazidime resistance in Acinetobacter
baumannii isolated in the United Arab Emirates. J Antimicrob Chemother. 2012 Mar 14.
[Epub ahead of print] PubMed PMID: 22419799.
Pankuch GA, Seifert H, Appelbaum PC. Activity of doripenem with and without
levofloxacin, amikacin, and colistin against Pseudomonas aeruginosa and Acinetobacter
baumannii. Diagn Microbiol Infect Dis. 2010; 67(2):191-197.
Pantopoulou A, Giamarellos-Bourboulis EJ, Raftogannis M, Tsaganos T, Dontas I,
Koutoukas P, Baziaka F, Giamarellou H, Perrea D. Colistin offers prolonged survival in
experimental infection by multidrug-resistant Acinetobacter baumannii: the significance of
co-administration of rifampicin. Int J Antimicrob Agents. 2007; 29(1):51-55.
Paton R, Miles RS, Hood J, Amyes SG, Miles RS, Amyes SG. ARI 1: beta-lactamasemediated imipenem resistance in Acinetobacter baumannii. Int J Antimicrob Agents. 1993;
2(2):81-87.
Peck KR, Kim MJ, Choi JY, Kim HS, Kang CI, Cho YK, Park DW, Lee HJ, Lee MS, Ko KS.
In vitro time-kill studies of antimicrobial agents against blood isolates of imipenemresistant Acinetobacter baumannii, including colistin- or tigecycline-resistant isolates. J
Med Microbiol. 2012; 61(3):353-360.
Peleg AY, Potoski BA, Rea R, Adams J, Sethi J, Capitano B, Husain S, Kwak EJ, Bhat
SV, Paterson DL. Acinetobacter baumannii bloodstream infection while receiving
tigecycline: a cautionary report. J Antimicrob Chemother. 2007; 59(1):128-131.
90
Referências
Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful
pathogen. Clin Microbiol Rev. 2008 Jul;21(3):538-582. Review.
Pereira AS. Determinação da Concentração de Antimicrobiano Capaz de Prevenir o
Aparecimento de Mutantes Resistentes em Amostras Clínicas de Acinetobacter spp. Tese
de Doutorado. Universidade Federal de São Paulo. São Paulo, 2009. 171 pp.
Petrosillo N, Chinello P, Proietti MF, Cecchini L, Masala M, Franchi C, Venditti M,
Esposito S, Nicastri E. Combined colistin and rifampicin therapy for carbapenem-resistant
Acinetobacter baumannii infections: clinical outcome and adverse events. Clin Microbiol
Infect. 2005; 11(8):682-683.
Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR.
Nucleic Acids Res. 2001; 29(9):e45.
Prates CG, Martins AF, Superti SV, Lopes FS, Ramos F, Cantarelli VV, Zavascki AP. Risk
factors for 30-day mortality in patients with carbapenem-resistant Acinetobacter
baumannii during an outbreak in an intensive care unit. Epidemiol Infect. 2011;
139(3):411-418.
Principe L, D'Arezzo S, Capone A, Petrosillo N, Visca P. In vitro activity of tigecycline in
combination with various antimicrobials against multidrug resistant Acinetobacter
baumannii. Ann Clin Microbiol Antimicrob. 2009; 8:18.
Poirel L, Naas T, Nordmann P. Diversity, epidemiology, and genetics of class D betalactamases. Antimicrob Agents Chemother. 2010; 54:24-38.
91
Referências
Raetz CR, Whitfield C. Lipopolysaccharide endotoxins. Annu Rev Biochem. 2002; 71:635700.
Robledo IE, Aquino EE, Santé MI, Santana JL, Otero DM, León CF, Vázquez GJ.
Detection of KPC in Acinetobacter spp. in Puerto Rico. Antimicrob Agents Chemother.
2010; 54(3):1354-1357.
Rodriguez CH, Bombicino K, Granados G, Nastro M, Vay C, Famiglietti A. Selection of
colistin-resistant Acinetobacter baumannii isolates inpostneurosurgical meningitis in an
intensive care unit with high presence of heteroresistance to colistin. Diagn Microbiol
Infect Dis. 2009; 65(2):188-191.
Rodriguez CH, De Ambrosio A, Bajuk M, Spinozzi M, Nastro M, Bombicino K, Radice M,
Gutkind G, Vay C, Famiglietti A. In vitro antimicrobials activity against endemic
Acinetobacter baumannii multiresistant clones. J Infect Dev Ctries. 2010; 4(3):164-167.
Rolain JM, Roch A, Castanier M, Papazian L, Raoult D. Acinetobacter baumannii resistant
to colistin with impaired virulence: a case report from France. J Infect Dis. 2011;
204(7):1146-1167.
Rosenfeld N, Bouchier C, Courvalin P, Périchon B. Expression of the ResistanceNodulation-Cell Division Pump AdeIJK in Acinetobacter baumannii Is Regulated by AdeN,
a TetR-Type Regulator. Antimicrob Agents Chemother. 2012; 56(5):2504-2510.
Sader HS, Farrell DJ, Jones RN. Susceptibility of Klebsiella spp. to colistin and polymyxin
B: results from the SENTRY Antimicrobial Surveillance Program (2006–2009).
International J Antimicrob Agents. 2011; 37:174–185.
92
Referências
Santimaleeworagun W, Wongpoowarak P, Chayakul P, Pattharachayakul S, Tansakul P,
Garey KW. In vitro activity of colistin or sulbactam in combination with fosfomycin or
imipenem against clinical isolates of carbapenem-resistant Acinetobacter baumannii
producing OXA-23 carbapenemases. Southeast Asian J Trop Med Public Health. 2011;
42(4):890-900.
Sanyal D, Greenwood D. An electronmicroscope study of glycopeptide antibiotic-resistant
strains of Staphylococcus epidermidis. J Med Microbiol. 1993; 39(3):204-210.
Sato K, Nakae T. Outer membrane permeability of Acinetobacter calcoaceticus and its
implication in antibiotic resistance. J Antimicrob Chemother. 1991; 28(1):35-45.
Sauvage E, Kerff F, Terrak M, Ayala JA, Charlier P. The penicillin-binding proteins:
structure and role in peptidoglycan biosynthesis. FEMS Microbiol Rev. 2008; 32(2):23458. Review. Erratum in: FEMS Microbiol Rev. 2008; 32(3):556.
Schleifer KH, Kandler O. Peptidoglycan types of bacterial cell walls and their taxonomic
implications. Bacteriol Rev. 1972 Dec;36(4):407-77. Review.
Sheng WH, Wang JT, Li SY, Lin YC, Cheng A, Chen YC, Chang SC. Comparative in vitro
antimicrobial susceptibilities and synergistic activities of antimicrobial combinations
against carbapenem-resistant Acinetobacter species: Acinetobacter baumannii versus
Acinetobacter genospecies 3 and 13TU. Diagn Microbiol Infect Dis. 2011; 70(3):380-386.
Shields RK, Kwak EJ, Potoski BA, Doi Y, Adams-Haduch JM, Silviera FP, Toyoda Y,
Pilewski JM, Crespo M, Pasculle AW, Clancy CJ, Nguyen MH. High mortality rates among
solid organ transplant recipients infected with extensively drug-resistant Acinetobacter
baumannii: using in vitro antibiotic combination testing to identify the combination of a
93
Referências
carbapenem and colistin as an effective treatment regimen. Diagn Microbiol Infect Dis.
2011; 70(2):246-52.
Skiada A, Markogiannakis A, Plachouras D, Daikos GL. Adaptive resistance to cationic
compounds in Pseudomonas aeruginosa. Int J Antimicrob Agents. 2011;37:187–193.
Song JY, Lee J, Heo JY, Noh JY, Kim WJ, Cheong HJ, Hwang IS. Colistin and rifampicin
combination in the treatment of ventilator-associated pneumonia caused by carbapenemresistant Acinetobacter baumannii. Int J Antimicrob Agents. 2008; 32(3):281-284.
Soon RL, Nation RL, Hartley PG, Larson I, Li J. Atomic force microscopy investigation of
the morphology and topography of colistin-heteroresistant Acinetobacter baumannii
strains as a function of growth phase and in response to colistin treatment. Antimicrob
Agents Chemother. 2009; 53(12):4979-4786.
Soon RL, Nation RL, Harper M, Adler B, Boyce JD, Tan CH, Li J, Larson I. Effect of
colistin exposure and growth phase on the surface properties of live Acinetobacter
baumannii cells examined by atomic force microscopy. Int J Antimicrob Agents. 2011a;
38(6):493-501.
Soon RL, Nation RL, Cockram S. Moffatt JH, Harper M, Adler B, Boyce JD, Larson I, Li J.
Different surface charge of colistin-susceptible and –resistant Acinetobacter baumannii
cells measured with zeta potential as a function of growth phase and colistin treatment. J
Antimicrob Chemoter. 2011b; 66:126-133.
Spratt BG, Strominger JL. Identification of the major penicillin-binding proteins of
Escherichia coli as D-alanine carboxypeptidase IA. J Bacteriol. 1976; 127(1):660-663.
94
Referências
Su XZ, Chen J, Mizushima T, Kuroda T, Tsuchiya T. AbeM, an H+-coupled Acinetobacter
baumannii multidrug efflux pump belonging to the MATE family of transporters. Antimicrob
Agents Chemother. 2005; 49(10):4362-4364.
Tenover, F. C.; Arbeit, R. D.; Goering, R. V.; Mickelsen, P. A.; Murray, B. E.; Persing, D.
H.; Swaminathan, B. Interpreting chromosomal DNA restriction patterns produced by
pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;
33(9):2233-2239.
Triantafilou M, Mouratis MA, Lepper P, Haston RM, Baldwin F, Lowes S, Ahmed MA,
Schumann C, Boyd O, Triantafilou K. Serum proteins modulate lipopolysaccharide and
lipoteichoic acid-induced activation and contribute to the clinical outcome of sepsis.
Virulence. 2012; 3(2). [Epub ahead of print]
Vila J., Martí S, Sánchez-Céspedes J. Porins, efflux pumps and multidrug resistance in
Acinetobacter baumannii. J Antimic Chemother. 2007;59:1210-1215.
Vollmer W, Höltje JV. The architecture of the murein (peptidoglycan) in Gram-negative
bacteria: vertical scaffold or horizontal layer(s)? J Bacteriol. 2004; 186(18):5978-5987.
Review.
Vollmer W, Joris B, Charlier P, Foster S. Bacterial peptidoglycan (murein) hydrolases.
FEMS Microbiol Rev. 2008; 32(2):259-286.
Walsh TR. Clinically significant carbapenemases: an update. Curr Opin Infect Dis. 2008;
(4):367-371. Review.
95
Referências
Wang, H., P. Guo, H. Sun, H. Wang, Q. Yang, M. Chen, Y. Xu, and Y. Zhu. 2007.
Molecular epidemiology of clinical isolates of carbapenem-resistant Acinetobacter spp.
from Chinese hospitals. Antimicrob Agents Chemother. 51:4022-4028.
Werneck JS, Picão RC, Girardello R, Cayô R, Marguti V, Dalla-Costa L, Gales AC,
Antonio CS, Neves PR, Medeiros M, Mamizuka EM, Elmor de Araújo MR, Lincopan N.
Low prevalence of blaOXA-143 in private hospitals in Brazil. Antimicrob Agents Chemother.
2011a; 55(9):4494-4495.
Werneck JS, Picão RC, Carvalhaes CG, Cardoso JP, Gales AC. OXA-72-producing
Acinetobacter baumannii in Brazil: a case report. J Antimicrob Chemother. 2011b;
66(2):452-454.
Winfield MD, Latifi T, Groisman EA. Transcriptional regulation of the 4-amino-4-deoxy-Larabinose biosynthetic genes in Yersinia pestis. J Biol Chem. 2005; 280(15):1476514772.
Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, Amyes SG,
Livermore DM. Multiplex PCR for genes encoding prevalent OXA carbapenemases in
Acinetobacter spp. Int J Antimicrob Agents. 2006; 27(4):351-353.
Xu C, Wang S, Ren H, Lin X, Wu L, Peng X. Proteomic analysis on the expression of
outer membrane proteins of Vibrio alginolyticus at different sodium concentrations.
Proteomics. 2005; 5(12):3142-3152.
Yamamoto M, Nagao M, Matsumura Y, Matsushima A, Ito Y, Takakura S, Ichiyama S.
Interspecies dissemination of a novel class 1 integron carrying blaIMP-19 among
Acinetobacter species in Japan. J Antimicrob Chemother. 2011; 66(11):2480-3.
96
Referências
Yau W, Owen RJ, Poudyal A, Bell JM, Turnidge JD, Yu HH, Nation RL, Li J. Colistin
hetero-resistance in multidrug-resistant Acinetobacter baumannii clinical isolates from the
Western Pacific region in the SENTRY antimicrobial surveillance programme. J Infect.
2009; 58(2):138-144.
Yun SH, Choi CW, Kwon SO, Park GW, Cho K, Kwon KH, Kim JY, Yoo JS, Lee JC, Choi
JS, Kim S, Kim SI. Quantitative proteomic analysis of cell wall and plasma membrane
fractions from multidrug-resistant Acinetobacter baumannii. J Proteome Res. 2011;
10(2):459-69
Zapun A, Contreras-Martel C, Vernet T. Penicillin-binding proteins and beta-lactam
resistance. FEMS Microbiol Rev. 2008; 32(2):361-385. Review.
97
Referências
9. ANEXOS
98

Documentos relacionados

R001 - Grupo de Pesquisa Profa. Anita Marsaioli

R001 - Grupo de Pesquisa Profa. Anita Marsaioli identificados neste estudo. Palavras-chave: Acinetobacter baumannii, resistência aos carbapenems, metalo- lactamases, oxacilinases

Leia mais

universidade ceuma pró-reitoria de pós

universidade ceuma pró-reitoria de pós blaOXA-51 em 140 (98.6%) isolados. A técnica de ARDRA-PCR detectou diferenças intraespecíficas entre os 142 isolados, demonstrando ser uma ferramenta molecular útil para o estudo da diversidade gen...

Leia mais

Clique para visualizar o trabalho completo. - LEMC

Clique para visualizar o trabalho completo. - LEMC 5.3. Perfil de sensibilidade aos antimicrobianos ...................................................... 65 5.4. Avaliação dos genes codificadores de β-lactamases e a relação desses com a presença d...

Leia mais

Clique para visualizar o trabalho completo. - LEMC

Clique para visualizar o trabalho completo. - LEMC Dinâmica da resistência aos β-lactâmicos em amostras clínicas de Acinetobacter spp. isolados no Brasil e na Espanha. Rodrigo Cayô da Silva - São Paulo, 2012. xxvi, 239f. Tese (Doutorado) - Universi...

Leia mais