Gateway ® Full ORF Clone Manual

Transcrição

Genomics & Proteomics Core Facility
Gateway® Full ORF Clone
Ver.
1.0
Date
27.12.06
Name
Bernhard Korn
1/25
Manual
Comment
Basic protocols for handling Gateway Full ORF Clones
Content
1. Introduction .................................................................................................................................. 2
2. Flow Chart.................................................................................................................................... 2
3. Quality control at DKFZ................................................................................................................ 3
4. Reagents to be supplied by the User........................................................................................... 3
5. Protocols ...................................................................................................................................... 4
5.1. Streaking stab cultures and preparing strains..................................................................... 4
5.2. Plasmid preparation by alkaline lysis .................................................................................. 5
5.3. Other plasmid preparation methods .................................................................................... 6
5.4. Restriction digest of Gateway Full ORF Clone plasmids .................................................... 6
5.5. Shuttling full ORFs by Gateway® LR reaction .................................................................... 7
5.5.1. Fast Gateway® LR protocol...................................................................................... 7
5.5.2. High Confidence Gateway® LR protocol.................................................................. 8
5.5.3. Multi Destination Gateway® LR protocol.................................................................. 9
5.6. Preparation of chemically competent E. coli ..................................................................... 10
5.7. Transformation of Gateway® LR reactions ....................................................................... 10
6. Appendix .................................................................................................................................... 11
6.1. Gateway Full ORF Clones: Vector Information ................................................................. 11
6.1.1. pDONR201 features ............................................................................................... 11
6.1.2. pDONR201 map ..................................................................................................... 12
6.1.3. pDONR221 features ............................................................................................... 13
6.1.4. pDONR221 map ..................................................................................................... 14
6.2. Genotypes of E. coli .......................................................................................................... 15
6.3. Sequences......................................................................................................................... 15
6.3.1. Primers.................................................................................................................... 15
6.3.2. Vectors.................................................................................................................... 16
7. Troubleshooting ......................................................................................................................... 20
8. Literature .................................................................................................................................... 22
8.1. General .............................................................................................................................. 22
8.2. Applications ....................................................................................................................... 22
8.2.1. Expression in Bacteria ............................................................................................ 22
8.2.2. Yeast Expression .................................................................................................... 23
8.2.3. Baculo Virus Expression......................................................................................... 23
8.2.4. Expression in Plant Cells ........................................................................................ 24
8.2.5. Mammalian Cell Line Expression ........................................................................... 24
8.2.6. Miscelleaous ........................................................................................................... 24
Bernhard Korn
Gateway Full ORF Clone Manual
10.04.2007
2/25
1. Introduction
The Gateway Full ORF Clones are designed to provide maximum flexibility. The Backbone of the
clones are Gateway® entry vectors (pDONR201 or pDONR221), allowing rapid and efficient
transfer the ORF of interest to any destination vector. The insert of each clone is fully sequenced
and analyzed.
Features of pDONR201 and pDONR221 vectors are:
• attL1 and attL2 sites for site-specific recombination of the Gateway Full ORF Clone with
any destination vector of interest when doing an LR reaction
• rrnB transcription termination sequences to prevent read-through and basal expression of
the gene of interest in E. coli
• Kozak-like consensus sequence at the start ATG for efficient translation initiation in
eukaryotic systems
• Kanamycin resistance gene for selection in E. coli
• pUC origin for high-copy replication and maintenance of the plasmid in E. coli
2. Flow Chart
Streak stab culture
(protocol 5.1)
Picking of colonies and preparation of bacterial strains
(protocol 5.1)
Minipreps of plasmids
(protocols 5.2 and 5.3)
Restriction analysis
(protocol 5.4)
Shuttling inserts
(Gateway® LR reaction, protocols 5.5.1 – 5.5.3)
(Transformation, protocol 5.7)
Expression construct
Bernhard Korn
10.04.2007
3/25
3. Quality control at DKFZ
Each clone is grown overnight in LB medium containing 50 µg/ml kanamycin at 37°C. All clones
exhibited growth under these conditions. The insert of each clone is sequenced completely,
including the vector–insert junctions. For detailed information on the sequence of the clone,
please visit www.dkfz.de/gpcf/index.php?id=38 or check for the EMBL/GenBank entry of your
clone of interest. Some of the clones do have base substitution relative to RefSeq. These
variations are annotated, but you should verify this information by aligning the clone sequence
with your desired protein coding sequence.
4. Reagents to be supplied by the User
•
•
•
•
Bernhard Korn
Gateway® LR Clonase™ Enzyme Mix 20 reactions, Invitrogen #11791-019
Destination vector of choice, can either be obtained from Invitrogen, or be constructed by
the user. GPCF will share Gateway destination vectors upon request. The destination
vector must contain ccdB gene3 flanked by attR1 and attR2 sites. Verify that the reading
frame of the destination vector is compatible with the Gateway Full ORF Clones
Agar plates containing the antibiotic coded by the destination vector of choice
Transformation-competent E. coli (e.g. XL series, DH series or similar)
10.04.2007
4/25
5. Protocols
5.1. Streaking stab cultures and preparing strains
We recommend that you prepare bacterial strains of your Gateway Full ORF Clones, to be able to
go back to the original master to produce more plasmid DNA if necessary. Prepare three to five
master stocks of each clone for long-term storage.
After receiving the bacterial stab cultures of Gateway Full ORF Clones, you should:
1. Streak a small portion of the bacterial stab culture on a LB plate containing 50 µg/ml
kanamycin. Incubate the plate at 37°C overnight.
2.
3.
4.
5.
Bernhard Korn
Isolate a single colony and inoculate 5–10 ml of LB containing 50 µg/ml kanamycin.
Grow the culture to stationary phase (OD600 = 1–2).
Mix 0.8 ml of culture with 0.2 ml of sterile glycerol and transfer to a kryovial.
Store at -80°C. Use one master stock to create working stocks for regular use.
10.04.2007
5/25
5.2. Plasmid preparation by alkaline lysis
Plasmids of Gateway Full ORF Clones can be isolated using standard plasmid isolation
techniques, which are in use in your lab.
Alkaline Lysis procedure according to Sambrook et al., 1989, with modifications.
1. Grow clone in 2 ml LB/kan (50 µg/ml) for 18-20 h with strong agitation (250 rpm)
2. Spin down 1.5 ml bacterial culture at >12000 xg for 30 sec at 4°C.
3. Remove the supernatant leaving the pellet as dry as possible, i.e. decant and then
remove traces of medium with a pipette or use a vacuum line.
4. Resuspend the pellet in 100 µl ice-cold AlkLysI by vigorous vortexing.
5. Add 200 µl freshly prepared AlkLysII, mix by inverting 5 times and store on ice for 15 min.
6. Add 150 µl AlkLysIIIB, mix by inverting the tube 5 times, store on ice for at least 3 min.
7. Spin > 12000 xg, 4°C, 5 min
• (Optional, but strongly recommended): add 450 µl phenol/chloroform to the
supernatant and extract, spin at >12000 xg for 2 min.
8. Precipitate the DNA by addition of 900 µl EtOH, mix by vortexing, and let sit at room
temperature for at least 2 min.
9. Spin > 12000 xg at 4°C for 5 min and remove the supernatant carefully.
10. Wash pellet with 1 ml 70% EtOH at 4°C.
11. Spin as in 9.
12. Dry pellet at room temperature for 10 min.
13. Resuspend in 50 µl TE.
14. Check 1 µl on a gel, either digested or undigested.
15. The average yield is about 3 µg/1.5 ml culture, when Gateway Full ORF Clones are used.
This is approx. 60 ng/µl.
AlkLys Solution I:
25 mM
10 mM
50 mM
Tris/Cl (pH 8,0)
EDTA (pH 8,0 or 7,6)
α-D-Glucose
H2O
AlkLys Solution II:
0,2 M
NaOH
1%
SDS
Prepare fresh every time.
AlkLys Solution III B:
3M
KAc
Glacial acetic acid
H2O
25 ml (1 M)
20 ml (0.5 M)
9,1 g
add 1 l
60 ml (5 M)
11,5 ml
28,5 ml
or 29,45 g
11,5 ml
to 100 ml
Phenol/chloroform/isoamylalcohol (25:24:1)
Mix equal volumes (1 l) of CHCl3 and melted phenol and add 1 M Tris base and mix vigorously.
Let settle and check pH. Repeat this procedure until pH of aqueous phase is about 8.0. Remove
aqueous phase and extract twice with 100 ml TE (pH 8.0). Aliquot and store in dark bottle at 4°C.
TE (pH 8,0), 10:1
10 mM
Tris/Cl (pH 8,0)
1 mM
EDTA
Add 10 ml 1 M Tris/Cl (pH 8,0) and 2 ml 0,5 M EDTA (pH 8,0) to 900 ml sterile MQ water, check
pH, adjust volume to 1 l and dispense into aliquots.
Bernhard Korn
10.04.2007
6/25
5.3. Other plasmid preparation methods
Many biochemical suppliers support plasmid minipreparations with appropriate kits, e.g. Qiagen,
Roche, Machery & Nagel, Clontech, Invitrogen, Stratagene, GE and others.
5.4. Restriction digest of Gateway Full ORF Clone plasmids
In order to characterize the insert size of a Gateway Full ORF Clone, we recommend cutting the
plasmids to be tested using the restriction enzyme BsrGI (e.g. obtained from New England
Biolabs).
BsrGI restriction site (T|GTACA) is present in attL sides, both attL1 and attL2 that flank the insert
of all Gateway Full ORF Clones. Therefore a BsrGI cut will release the insert, but won’t cut in the
backbone of the vectors (pDONR201 and pDONR221, respectively).
1. Mix on ice:
2.
200–400 ng
plasmid DNA
1 µl
10x restriction buffer, supplied with the enzyme
1U
BsrGI restriction enzyme
to 10 µl
water
3. Incubate at 37°C for 2h
4. Analyze the digest on a 1 % agarose gel using appropriate size markers (range 200 bp to
at least 4 kb)
Expect a vector fragment of 2,2 kb for pDONR201 (or 2,5 kb for pDONR221), and an insert band
whose size depends on the size of the ORF. In some cases there will be multiple bands beside
the vector fragment. This can be observed whenever the ORF sequence contains one or more
BsrGI recognition sites. Please verify the presence of BsrGI sites in the insert by checking the
ORF sequence.
Bernhard Korn
10.04.2007
7/25
5.5. Shuttling full ORFs by Gateway® LR reaction
We have optimized different types of LR Gateway® reaction protocols to fulfill different criteria.
Please apply the fast protocol if quick access to destination clones is required. This protocol can
also be automated easily. The high-confidence protocol ensures the most reliable shuttling of an
ORF of interest into the destination vector you are using, by maximizing the reliability of the LR
reaction and the amount of DNA and enzyme. Finally, the multi-destination protocol is most
convenient and cost-saving whenever you wish to shuttle one insert into multiple destination
vectors for multiple applications at the same time.
Always use Invitrogens LR Clonase to perform the Gateway® LR reaction.
5.5.1. Fast Gateway® LR protocol
This protocol allows you to create Full ORF Expression Clones within 1 day. You will perform the
LR recombination reaction to transfer the ORF into a destination vector of your choice (attR1/2cassette-containing vector), to create an attB-containing expression clone.
1. For a single BP reaction, assemble on ice:
2 µl
5x LR buffer Gateway®
3 µl
destination vector (150 ng/µl)
3 µl
water
0,5 µl Topoisomerase I (alternatively use linearized destination vector; linearize
using restriction enzyme cutting between ccdB and CmR genes of the
Gateway® cassette)
0,5 µl LR Clonase
total 10 µl
2. Incubate for 2 h at 25°C (preferably in PCR machine with heated lid or in water bath with
cover). O/n incubation results in an at least 5x higher efficiency.
3. Use immediately 5 µl for chemical transformation into standard E. coli (transformation
protocol see above, or use your favorite protocol).
4. Plate the transformation onto LB/antibiotic plate (using the antibiotic that is coded by your
destination vector).
5. Incubate o/n at 37°C
6. Pick at least two colonies and characterize the insert (see notes)
Note:
a. LR reaction efficiency is usually at > 90–95%, so the vast majority of the clones contain
exactly the right ORF in the frame that is defined by the Gateway Full ORF Clone and the
destination vector used. Therefore many users pick a single colony and use this clone
without further verification.
Bernhard Korn
10.04.2007
8/25
5.5.2. High Confidence Gateway® LR protocol
This protocol allows you to create Full ORF Expression Clones with high confidence within 3
days.
1. For a single BP reaction, assemble on ice:
4 µl
5x LR buffer
6 µl
destination vector (200–250 ng/µl)
2 µl
Gateway Full ORF Clone (150–250 ng/µl, or 1 µl of a miniprep)
6 µl
water
1 µl
Topoisomerase I (alternatively use linearized destination vector; linearize
using restriction enzyme cutting between ccdB and CmR genes of the
Gateway® cassette)
1 µl
LR Clonase
total 20 µl
2. Incubate o/n at 25°C (preferably in PCR machine with heated lid or in water bath with
cover, see notes).
3. Add 2 µl stop mix (2 µg/µl Proteinase K), and incubate for 10 min at 37°C.
4. Add:
2 µl
glycogen / Pellet Paint
4 µl
3M Na Acetate pH 5.2
100 µl
EtOH abs., and mix
5. Spin at 13.000 rpm for 15 min.
6. Wash pellet with at least 200 µl 70% EtOH.
7. Resuspend dried pellet in 5 µl water.
8. Use 1 µl for transformation of electrocompetent E. coli that have a transformation
efficiency of 109 cfu/µg plasmid. We recommend T-phage-resistant bacteria.
9. Plate the transformation onto LB/antibiotic plate (using the antibiotic that is coded by your
destination vector).
Notes:
a. Prolonged incubation of LR reaction increases the transformation efficiency significantly.
This is especially important when shuttling long inserts (> 2,5 kb)
b. LR reaction efficiency is usually at > 90–95%, so the vast majority of the clones contain
Bernhard Korn
10.04.2007
9/25
5.5.3. Multi Destination Gateway® LR protocol
This protocol allows you to create multiple different Full ORF Expression Clones (vector
constructs) of a single ORF via one Gateway® LR reaction and transformation. Make sure that
these destination vectors have different antibiotic resistance genes. Avoid kanamycin and
chloramphenicol, as these resistances are coded by the Gateway Full ORF Clone, and the
Gateway® cassette that are present in the destination vectors, respectively.
1. For a multi-destination BP reaction, assemble on ice:
4 µl 5x LR buffer Gateway®
1 µl destination vector 1 (100–250 ng/µl) - see notes
1 µl destination vector 2 (100–250 ng/µl)
optional 1 µl destination vector 3 (100–250 ng/µl)
optional 1 µl destination vector 4 (100–250 ng/µl)
2 µl Gateway Full ORF Clone (150–250 ng/µl)
to 18 µl water
1 µl Topoisomerase I (alternatively use linearized destination vectors;
linearize using restriction enzyme cutting between ccdB and CmR
genes of the Gateway® cassette)
1 µl LR Clonase
total
20 µl
2. Incubate o/n at 25°C (preferably in PCR machine with heated lid or in water bath with
cover, see notes).
3. Add 2 µl stop mix (2 µg/µl Proteinase K), and incubate for 10 min at 37°C.
4. Add:
2 µl Glycogen / Pellet Paint
4 µl 3M Na Acetate pH 5.2
100 µl EtOH abs., and mix
5. Spin at 13.000 rpm for 15 min.
6. Wash pellet with at least 200 µl 70% EtOH.
7. Resuspend dried pellet in 5 µl water.
8. Use 1 µl for transformation of electrocompetent E. coli that have a transformation
efficiency of 109 cfu/µg plasmid. We recommend T-phage-resistant bacteria.
9. Plate equal amounts of the transformation onto LB/antibiotic1, LB/antibiotic2,
(LB/antibiotic3, LB/antibiotic4) plates (using the antibiotics that are coded by your
respective destination vectors, see notes).
Notes:
a. Up to four different destination vectors have been used successfully in a single LR
reaction. Reduce the amount of each single vector accordingly to give 1 µg total
destination vector mix per LR reaction. The destination vectors used in combination
MUST code for different antibiotic resistances. Kanamycin and chloramphenicol should
NOT be amongst the antibiotics used as resistance genes to these are already carried on
the Gateway Full ORF Clones and the Gateway® cassette, respectively.
b. Prolonged incubation of LR reaction increases the transformation efficiency significantly.
This is especially important when shuttling long inserts (> 2,5 kb).
c. In order to achieve single colonies, we recommended that plating should be done at two
concentrations on two identical LB/antibiotics plates (e.g. 20 µl and 200 µl aliquots).
d. LR reaction efficiency is usually at > 90–95%, so the vast majority of the clones contain
Bernhard Korn
10.04.2007
10/25
5.6. Preparation of chemically competent E. coli
1. Inoculate 1 ml o/n-culture of phage-resistant E. coli (e.g. DH5α T phage-resistant) in 100
ml LB; incubate on shaker at 37°C.
2. Harvest in log phase at OD600 = 0,3–0,4, by spinning at 3600 rpm at 4°C for 10 min.
3. Resuspend in 50 ml 100 mM CaCl2 (ice-cold).
4. Leave on ice for 30 min and spin down as above.
a. For immediate use: Resuspend in 5 ml 100 mM CaCl2 (ice-cold). Storage at 4°C o/n
increases transformation efficiency approximately five-fold.
b. For long-term storage: Resuspend in < 5 ml 100 mM CaCl2, 15% glycerol (icecold).Freeze in 200 µl aliquots on dry ice and store at -80°C.
Notes:
a. E. coli prepared according to this protocol usually have a transformation efficiency of at
least 106/µg supercoiled plasmid.
b. It is absolutely essential that all steps of this protocol are performed as cold as possible,
this means: never remove cells from ice once they have been harvested.
LB (Luria-Bertani) medium
10 g
bacto-tryptone
5g
bacto-yeast extract
10 g
NaCl
Dissolve in 950 ml VE water, and adjust pH to 7 with 5 N NaOH (about 200 µl), if necessary. Fill
up to 1 l and autoclave.
5.7. Transformation of Gateway® LR reactions
1. Thaw on ice (takes about 15 min).
2. Transfer 100 µl aliquots to pre-cooled and labeled 15 ml Falcon tubes.
3. Add 1,7 µl ß-mercaptoethanol (1,44 M) to achieve a final concentration of 25 mM. Mix
cells and ß-mercaptoethanol by swirling the tube.
4. Incubate on ice for 10 min.
5. Add 1–3 µl of a Gateway® LR Clonase reaction to the bacteria.
6. Leave on ice for 30 min.
7. Heat shock at 42°C for 30 sec.
8. Add 0,9 ml of LB medium and incubate at 37°C on shaker for 30–60 min, 250 rpm.
9. Plate 25 µl and 250 µl of the transformation onto LB/antibiotic (according to the resistance
gene(s) carried by the destination/expression plasmids) plates. Store the remaining
transformation at 4°C.
10. Incubate the plate at 37°C overnight.
11. Isolate a single colony and inoculate into 5–10 ml of LB containing appropriate antibiotic.
12. Grow the culture to stationary phase (OD600=1–2).
13. Mix 0.8 ml of culture with 0.2 ml of sterile glycerol and transfer to a kryovial.
14. Store at -80°C. Use one master stock to create working stocks for regular use.
Bernhard Korn
10.04.2007
11/25
6. Appendix
6.1. Gateway Full ORF Clones: Vector Information
6.1.1. pDONR201 features
Description of the features in the vicinity of the cloning site of pDONR201. Please verify the
nature of the cloning vector (pDONR201 or pDONR221).
------------------>
tttatttgat gcctggcagt tccctactct cgcgttaacg ctagcatgga tctcgggccc
don5
caaataatga ttttattttg actgatagtg acctgttcgt tgcaacaaat tgatgagcaa
attL1
tgctttttta taatgccaag tttgtacaaa aaa gca ggc –stuffer– ATG-ORF –stuffer-
ac cca gct ttc ttgtacaaa gtgggcatta taagaaagca ttgcttatca atttgttgca
attL2
acgaacaggt cactatcagt caaaataaaa tcattatttg ccatccagct gcagctctgg
<---------------------cccgtgtctc aaaatctctg atgttacatt gcacaagata aaaatatatc
don3
red:
gray:
bold:
blue:
yyyyyy
Bernhard Korn
attL1/2
Stuffer between attL sites and ORF. This stuffer may vary in different Gateway Full ORF
Clones, please consult the GPCF web page and check for der exact clone sequence.
ORF sequence
Sequencing and PCR primers don5 and don3
Sequence underlined in green corresponds to the sequence fragment transferred to
destinations clones by LR reaction.
10.04.2007
12/25
6.1.2. pDONR201 map
rrnB T2 transcription terminator
NheI (45)
AflIII (3098)
pUC ori
AcyI (133)
don5 (100.0%)
HpaI (307)
ApaLI (2784)
NheI (311)
Bsp120I (326)
ApaI (330)
BsrGI (414)
pDONR201
pDONR201 Shuttle Clone
Gateway Entry Vector
(with dummy insert)
Kan(R)
dummy-ORF
BsrGI (1292)
PvuII (1387)
PstI (1392)
don3 (100.0%)
black bar:
orange bars:
blue bars:
red letters:
black letters:
gray letters:
Bernhard Korn
origin of replication
coding sequences (kanamycin resistance and ORF of interest)
terminator sequences
primer binding sites (sequences see “Oligonucleotide” section)
restriction enzyme sites (single cutter in vector)
restriction enzyme sites (dual cutter in vector)
10.04.2007
13/25
6.1.3. pDONR221 features
Description of the features in the vicinity of the cloning site of pDONR201. Please verify the
nature of the cloning vector (pDONR201 or pDONR221).
------------------>
tttatttgat gcctggcagt tccctactct cgcgttaacg ctagcatgga tgttttccca
don5
---------------------->
gtcacgacgt tgtaaaacga cggccagtct taagctcggg ccccaaataa tgattttatt
M13u
ttgactgata gtgacctgtt cgttgcaaca cattgatgag caatgctttt ttataatgcc
attL1
aactttgtac aaa aaa gca ggc –stuffer– ATG-ORF –stuffer– ac cca gct
ttc ttg tacaaa gttggcatta taagaaagca ttgcttatca atttgttgca
attL2
acgaacaggt cactatcagt caaaataaaa tcattatttg ccatccagct gatatcccct
<-----------------atagtgagtc gtattacatg gtcatagctg tttcctggca gctctggccc gtgtctcaaa
M13r
<---------------------atctctgatg ttacattgca caagataaaa taatatc
don3
red:
gray:
bold:
blue:
yyyyyy
Bernhard Korn
attL1/2
Stuffer between attL sites and ORF. This stuffer may vary in different Gateway Full ORF
Clones, please consult the GPCF web page and check for der exact clone sequence.
ORF sequence
Sequencing and PCR primers don5, don3, M13u, M13r
Sequence underlined in green corresponds to the sequence fragment transferred to
destinations clones by LR reaction.
10.04.2007
14/25
6.1.4. pDONR221 map
Nhe I (240)
Mlu I (231)
pUC ori
Pvu II (175)
Apa LI (3071)
Acy I (328)
rrnB T1 transcription termina
don5 (100.0%)
Hpa I (502)
Nhe I (506)
M13u (100.0%)
Mlu I (2689)
attL1
pDONR221
pDONR221 Shuttle Clone
Asp EI (550)
Bsp 120I (564)
Apa I (568)
Bsr GI (652)
Gateway Entry Vector
(with dummy insert)
dummy-ORF
attL2
Kan(R)
don3 (100.0%)
M13r (100.0%)
black bars:
orange bars:
blue bars:
green bars
red letters:
black letters:
gray letters:
Bernhard Korn
Bsr GI (1528)
Pvu II (1623)
Eco RV (1628)
origin of replication
coding sequences (kanamycin resistance and ORF of interest)
terminator sequences
attL recombination sites (used in LR Gateway® reaction)
primer binding sites
restriction enzyme sites (single cutter in vector)
restriction enzyme sites (dual cutter in vector)
10.04.2007
15/25
6.2. Genotypes of E. coli
Gateway destination vectors are delivered in DB3.1 strains, suppressing ccdB function. Gateway
Full ORF Clones are provided in DH5 or DH10 strains.
DH5α: F- φ80dlacZ∆M15∆(lacZYA-argF) U169 endA1 recA1 hsdR17(rK- mK+) deoR thi-1 supE44
λ- gyrA96 relA1
FOCUS (1986) 8:2, 9
DH5α T1-resistant: F- φ80dlacZ∆M15∆(lacZYA-argF) U169 endA1 recA1 hsdR17(rK- mK+) deoR
thi-1 supE44 λ- gyrA96 relA1 tonA
-
DH10B: F mcrA ∆(mrr-hsdRMS-mcrBC) φ80dlacZ∆M15 ∆lacX74 endA1 recA1 deoR ∆(ara,
leu)7697 araD139 galU galK nupG rpsL λLorow, D. and Jessee, J. (1990) FOCUS 12, 19
-
DH10B T-phage-resistant: F mcrA ∆(mrr-hsdRMS-mcrBC) φ80dlacZ∆M15 ∆lacX74 endA1
recA1 deoR ∆(ara, leu)7697 araD139 galU galK nupG rpsL λ- tonA
DB3.1: F- gyrA462 endA1 glnV44 ∆(sr1-recA) mcrB mrr hsdS20(rB-, mB-) ara14 galK2 lacY1
proA2 rpsL20(Smr) xyl5 ∆leu mtl1
6.3. Sequences
6.3.1. Primers
The Gateway Full ORF Clones may be characterized by PCR and/or sequencing. Please use the
recommended oligonucleotides sequences provided below.
don5:
don3:
M13u:
M13r:
Bernhard Korn
cgttaacgctagcatgga
tcttgtgcaatgtaacatcag
cgttgtaaaacgacggccagt
ccaggaaacagctatgac
10.04.2007
16/25
6.3.2. Vectors
> pDONR201
1 gttaacgcta gcatggatct cgggccccaa ataatgattt tattttgact gatagtgacc
61 tgttcgttgc aacaaattga tgagcaatgc ttttttataa tgccaacttt gtacaaaaaa
121 gctgaacgag aaacgtaaaa tgatataaat atcaatatat taaattagat tttgcataaa
181 aaacagacta cataatactg taaaacacaa catatccagt cactatgaat caactactta
241 gatggtatta gtgacctgta gtcgaccgac agccttccaa atgttcttcg ggtgatgctg
301 ccaacttagt cgaccgacag ccttccaaat gttcttctca aacggaatcg tcgtatccag
361 cctactcgct attgtcctca atgccgtatt aaatcataaa aagaaataag aaaaagaggt
421 gcgagcctct tttttgtgtg acaaaataaa aacatctacc tattcatata cgctagtgtc
481 atagtcctga aaatcatctg catcaagaac aatttcacaa ctcttatact tttctcttac
541 aagtcgttcg gcttcatctg gattttcagc ctctatactt actaaacgtg ataaagtttc
601 tgtaatttct actgtatcga cctgcagact ggctgtgtat aagggagcct gacatttata
661 ttccccagaa catcaggtta atggcgtttt tgatgtcatt ttcgcggtgg ctgagatcag
721 ccacttcttc cccgataacg gagaccggca cactggccat atcggtggtc atcatgcgcc
781 agctttcatc cccgatatgc accaccgggt aaagttcacg ggagacttta tctgacagca
841 gacgtgcact ggccaggggg atcaccatcc gtcgcccggg cgtgtcaata atatcactct
901 gtacatccac aaacagacga taacggctct ctcttttata ggtgtaaacc ttaaactgca
961 tttcaccagt ccctgttctc gtcagcaaaa gagccgttca tttcaataaa ccgggcgacc
1021 tcagccatcc cttcctgatt ttccgctttc cagcgttcgg cacgcagacg acgggcttca
1081 ttctgcatgg ttgtgcttac cagaccggag atattgacat catatatgcc ttgagcaact
1141 gatagctgtc gctgtcaact gtcactgtaa tacgctgctt catagcacac ctctttttga
1201 catacttcgg gtatacatat cagtatatat tcttataccg caaaaatcag cgcgcaaata
1261 cgcatactgt tatctggctt ttagtaagcc ggatccacgc gattacgccc cgccctgcca
1321 ctcatcgcag tactgttgta attcattaag cattctgccg acatggaagc catcacagac
1381 ggcatgatga acctgaatcg ccagcggcat cagcaccttg tcgccttgcg tataatattt
1441 gcccatggtg aaaacggggg cgaagaagtt gtccatattg gccacgttta aatcaaaact
1501 ggtgaaactc acccagggat tggctgagac gaaaaacata ttctcaataa accctttagg
1561 gaaataggcc aggttttcac cgtaacacgc cacatcttgc gaatatatgt gtagaaactg
1621 ccggaaatcg tcgtggtatt cactccagag cgatgaaaac gtttcagttt gctcatggaa
1681 aacggtgtaa caagggtgaa cactatccca tatcaccagc tcaccgtctt tcattgccat
1741 acggaattcc ggatgagcat tcatcaggcg ggcaagaatg tgaataaagg ccggataaaa
1801 cttgtgctta tttttcttta cggtctttaa aaaggccgta atatccagct gaacggtctg
1861 gttataggta cattgagcaa ctgactgaaa tgcctcaaaa tgttctttac gatgccattg
1921 ggatatatca acggtggtat atccagtgat ttttttctcc attttagctt ccttagctcc
1981 tgaaaatctc gataactcaa aaaatacgcc cggtagtgat cttatttcat tatggtgaaa
2041 gttggaacct cttacgtgcc gatcaacgtc tcattttcgc caaaagttgg cccagggctt
2101 cccggtatca acagggacac caggatttat ttattctgcg aagtgatctt ccgtcacagg
2161 tatttattcg gcgcaaagtg cgtcgggtga tgctgccaac ttagtcgact acaggtcact
2221 aataccatct aagtagttga ttcatagtga ctggatatgt tgtgttttac agtattatgt
2281 agtctgtttt ttatgcaaaa tctaatttaa tatattgata tttatatcat tttacgtttc
2341 tcgttcagct ttcttgtaca aagttggcat tataagaaag cattgcttat caatttgttg
2401 caacgaacag gtcactatca gtcaaaataa aatcattatt tgccatccag ctgcagctct
2461 ggcccgtgtc tcaaaatctc tgatgttaca ttgcacaaga taaaaatata tcatcatgaa
Bernhard Korn
10.04.2007
17/25
2521 caataaaact gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac
2581 gggaaacgtc gaggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat
2641 gggctcgcga taatgtcggg caatcaggtg cgacaatcta tcgcttgtat gggaagcccg
2701 atgcgccaga gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg
2761 agatggtcag actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta
2821 tccgtactcc tgatgatgca tggttactca ccactgcgat ccccggaaaa acagcattcc
2881 aggtattaga agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc
2941 tgcgccggtt gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc
3001 gtctcgctca ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg
3061 acgagcgtaa tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat
3121 tctcaccgga ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg
3181 aggggaaatt aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg
3241 atcttgccat cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt
3301 ttcaaaaata tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg
3361 atgagttttt ctaatcagaa ttggttaatt ggttgtaaca ctggcagagc attacgctga
3421 cttgacggga cggcgcaagc tcatgaccaa aatcccttaa cgtgagtttt cgttccactg
3481 agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt
3541 aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca
3601 agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac
3661 tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac
3721 atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct
3781 taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg
3841 gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga gatacctaca
3901 gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt
3961 aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta
4021 tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc
4081 gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc
4141 cttttgctgg ccttttgctc acatgttctt tcctgcgtta tcccctgatt ctgtggataa
4201 ccgtattacc gctagccagg aagagtttgt agaaacgcaa aaaggccatc cgtcaggatg
4261 gccttctgct tagtttgatg cctggcagtt tatggcgggc gtcctgcccg ccaccctccg
4321 ggccgttgct tcacaacgtt caaatccgct cccggcggat ttgtcctact caggagagcg
4381 ttcaccgaca aacaacagat aaaacgaaag gcccagtctt ccgactgagc ctttcgtttt
4441 atttgatgcc tggcagttcc ctactctcgc
Bernhard Korn
10.04.2007
18/25
> pDONR221
1 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga
61 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga
121 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca
181 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc
241 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta
301 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc
361 acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa
421 caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg
481 gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa
541 aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac
601 ctgttcgttg caacacattg atgagcaatg cttttttata atgccaactt tgtacaaaaa
661 agctgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga ttttgcataa
721 aaaacagact acataatact gtaaaacaca acatatccag tcactatgaa tcaactactt
781 agatggtatt agtgacctgt agtcgaccga cagccttcca aatgttcttc gggtgatgct
841 gccaacttag tcgaccgaca gccttccaaa tgttcttctc aaacggaatc gtcgtatcca
901 gcctactcgc tattgtcctc aatgccgtat taaatcataa aaagaaataa gaaaaagagg
961 tgcgagcctc ttttttgtgt gacaaaataa aaacatctac ctattcatat acgctagtgt
1021 catagtcctg aaaatcatct gcatcaagaa caatttcaca actcttatac ttttctctta
1081 caagtcgttc ggcttcatct ggattttcag cctctatact tactaaacgt gataaagttt
1141 ctgtaatttc tactgtatcg acctgcagac tggctgtgta taagggagcc tgacatttat
1201 attccccaga acatcaggtt aatggcgttt ttgatgtcat tttcgcggtg gctgagatca
1261 gccacttctt ccccgataac ggagaccggc acactggcca tatcggtggt catcatgcgc
1321 cagctttcat ccccgatatg caccaccggg taaagttcac gggagacttt atctgacagc
1381 agacgtgcac tggccagggg gatcaccatc cgtcgcccgg gcgtgtcaat aatatcactc
1441 tgtacatcca caaacagacg ataacggctc tctcttttat aggtgtaaac cttaaactgc
1501 atttcaccag cccctgttct cgtcagcaaa agagccgttc atttcaataa accgggcgac
1561 ctcagccatc ccttcctgat tttccgcttt ccagcgttcg gcacgcagac gacgggcttc
1621 attctgcatg gttgtgctta ccagaccgga gatattgaca tcatatatgc cttgagcaac
1681 tgatagctgt cgctgtcaac tgtcactgta atacgctgct tcatagcata cctctttttg
1741 acatacttcg ggtatacata tcagtatata ttcttatacc gcaaaaatca gcgcgcaaat
1801 acgcatactg ttatctggct tttagtaagc cggatccacg cggcgtttac gccccgccct
1861 gccactcatc gcagtactgt tgtaattcat taagcattct gccgacatgg aagccatcac
1921 agacggcatg atgaacctga atcgccagcg gcatcagcac cttgtcgcct tgcgtataat
1981 atttgcccat ggtgaaaacg ggggcgaaga agttgtccat attggccacg tttaaatcaa
2041 aactggtgaa actcacccag ggattggctg agacgaaaaa catattctca ataaaccctt
2101 tagggaaata ggccaggttt tcaccgtaac acgccacatc ttgcgaatat atgtgtagaa
2161 actgccggaa atcgtcgtgg tattcactcc agagcgatga aaacgtttca gtttgctcat
2221 ggaaaacggt gtaacaaggg tgaacactat cccatatcac cagctcaccg tctttcattg
2281 ccatacggaa ttccggatga gcattcatca ggcgggcaag aatgtgaata aaggccggat
2341 aaaacttgtg cttatttttc tttacggtct ttaaaaaggc cgtaatatcc agctgaacgg
2401 tctggttata ggtacattga gcaactgact gaaatgcctc aaaatgttct ttacgatgcc
2461 attgggatat atcaacggtg gtatatccag tgattttttt ctccatttta gcttccttag
2521 ctcctgaaaa tctcgataac tcaaaaaata cgcccggtag tgatcttatt tcattatggt
2581 gaaagttgga acctcttacg tgccgatcaa cgtctcattt tcgccaaaag ttggcccagg
2641 gcttcccggt atcaacaggg acaccaggat ttatttattc tgcgaagtga tcttccgtca
2701 caggtattta ttcggcgcaa agtgcgtcgg gtgatgctgc caacttagtc gactacaggt
2761 cactaatacc atctaagtag ttgattcata gtgactggat atgttgtgtt ttacagtatt
2821 atgtagtctg ttttttatgc aaaatctaat ttaatatatt gatatttata tcattttacg
2881 tttctcgttc agctttcttg tacaaagttg gcattataag aaagcattgc ttatcaattt
2941 gttgcaacga acaggtcact atcagtcaaa ataaaatcat tatttgccat ccagctgata
Bernhard Korn
10.04.2007
19/25
3001 tcccctatag tgagtcgtat tacatggtca tagctgtttc ctggcagctc tggcccgtgt
3061 ctcaaaatct ctgatgttac attgcacaag ataaaataat atcatcatga acaataaaac
3121 tgtctgctta cataaacagt aatacaaggg gtgttatgag ccatattcaa cgggaaacgt
3181 cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg
3241 ataatgtcgg gcaatcaggt gcgacaatct atcgcttgta tgggaagccc gatgcgccag
3301 agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca
3361 gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc
3421 ctgatgatgc atggttactc accactgcga tccccggaaa aacagcattc caggtattag
3481 aagaatatcc tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc ctgcgccggt
3541 tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc
3601 aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta
3661 atggctggcc tgttgaacaa gtctggaaag aaatgcataa acttttgcca ttctcaccgg
3721 attcagtcgt cactcatggt gatttctcac ttgataacct tatttttgac gaggggaaat
3781 taataggttg tattgatgtt ggacgagtcg gaatcgcaga ccgataccag gatcttgcca
3841 tcctatggaa ctgcctcggt gagttttctc cttcattaca gaaacggctt tttcaaaaat
3901 atggtattga taatcctgat atgaataaat tgcagtttca tttgatgctc gatgagtttt
3961 tctaatcaga attggttaat tggttgtaac actggcagag cattacgctg acttgacggg
4021 acggcgcaag ctcatgacca aaatccctta acgtgagtta cgcgtcgttc cactgagcgt
4081 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct
4141 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc
4201 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc
4261 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc
4321 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
4381 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt
4441 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg
4501 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg
4561 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt
4621 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
4681 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt
4741 gctggccttt tgctcacatg tt
Bernhard Korn
10.04.2007
20/25
7. Troubleshooting
Problem
Few or no colonies obtained from
LR reaction after transformation
while the transformation control
gave colonies
Different colony sizes after
transformation and plating
Bernhard Korn
Suggestion
Incorrect antibiotic used for the selection of transformants
- Check antibiotic marker of the destination vector used and
for transformants on new LB/antibiotic plates
If you use the “fast protocol”, the LR reactions are not treated
with Proteinase K. This causes a reduction of transformants.
- Switch to the High Confidence protocol
Clonase™ enzyme mix failure (inactive enzymes or didn’t use
suggested amount)
- Test another aliquot of the LR Clonase
- Ensure storage of Clonase at –80°C
- Do not freeze/thaw Clonase more than 10x
- Use recommended amounts
The destination vector used did not have the correct att sites
- Always use destination vectors with attL1 and attL2
recombination sites
Incorrect Clonase™ enzyme mix
- Always use LR Clonase™ from Invitrogen to perform the
shuttling reaction
Biased vector concentrations, especially too much Gateway
Full ORF Clone DNA
- Ensure equal molar amounts of Gateway Full ORF Clone
and destination vector
Loss of plasmid during bacterial growth
- Re-incubate on selective plates at 30°C
- Control for insert re-arrangements during the experiment
- Use E. coli strains that stabilize unusual DNA structures
and repeat cloning (e.g. SURE from Stratagene)
Small colonies can originate from Gateway Full ORF Clone
plasmid DNA that co-transforms with the destination
construct
- Reduce the amount of Gateway Full ORF Clone to as low
as 25 ng/20 µl LR reaction
Small colonies can originate from depletion of antibiotic on
the plate (‘satellite colonies’ = small colonies surrounding a
large colony)
- Phenomenon seen primarily when using ampicillin
selection, as this antibiotic is consumed by bacteria.
Replace ampicillin by carbenicillin (an analogon that is not
used up by E. coli
10.04.2007
High background in the Gateway
Full ORF Clone reaction
No colonies/less than 10 colonies
after transformation
Bernhard Korn
21/25
LR reaction transformed into an F′ episome E. coli containing
the ccdA gene
- Use E. coli without F′ episome
Inactive ccdB gene on the destination vector
- Always propagate destination vectors in DB3.1 E. coli and
add 25ng/µl chloramphenicol to medium and plates used
- Verify the destination vector before use (by restriction digest
or sequencing)
One of the solutions is contaminated with a second plasmid
- Verify your solutions by doing mock transformations with
the individual solutions
- Make up new solutions
Competent bacteria already carry a plasmid
- Plate mock transformation directly
Problems with
- Transformation
- Competent bacteria
- Insufficient amount of transformation plated
10.04.2007
22/25
8. Literature
8.1. General
Bernard P., and M. Couturier. Cell killing by the F plasmid CcdB protein involves poisoning of
DNA-topoisomerase II complexes. J Mol Biol 1992, 226(3), 735-745.
Bernard P., K.E. Kezdy, L.V. Melderen, J. Steyaert, L. Wyns, M.L. Pato, P.N. Higgins, and M.
Couturier. The F plasmid CcdB protein induces efficient ATP-dependent DNA cleavage by
gyrase. J Mol Biol 1993, 234, 534-541.
Bushman W., J.F. Thompson, L. Vargas, and A. Landy. Control of directionality in lambda sitespecific recombination. Science 1985, 230, 906-911.
Hartley J.L., G.F. Temple, and M.A. Brasch. DNA cloning using in vitro site-specific
recombination. Genome Research 2000, 10, 1788-1795.
Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic
Acids Res 1987, 15, 8125-8148.
Kozak M. Downstream secondary structure facilitates recognition of initiator codons by eukaryotic
ribosomes. Proc Natl Acad Sci USA 1990, 87, 8301-8305.
Kozak M. An analysis of vertebrate mRNA sequences: intimations of translational control. J Cell
Biology 1991, 115, 887-903.
Lander E., et al. Initial sequencing and analysis of the human genome. Nature 2001, 409, 860921.
Landy A. Dynamic, structural, and regulatory aspects of lambda site-specific recombination. Ann
Rev Biochem 1989, 58, 913-949.
Miki T., J.A. Park, K. Nagao, N. Murayama, and T. Horiuchi. Control of segregation of
chromosomal DNA by sex factor F in Escherichia coli. Mutants of DNA gyrase subunit a
suppress letD (ccdB) product growth inhibition. J Mol Biol 1992, 225, 39-52.
Nomura N., T. Nagase, N. Miyajima, T. Sazuka, A. Tanaka, S. Sato, N. Seki, Y. Kawarabayasi, K.
Ishikawa, and S. Tabata. Prediction of the coding sequences of unidentified human genes. II.
The coding sequences of 40 new genes (KIAA0041-KIAA0080) deduced by analysis of cDNA
clones from human cell line KG-1. DNA Res 1994, 1, 251-262.
Orosz A., I. Boros, and P. Venetianer. Analysis of the complex transcription termination region of
the Escherichia coli rrnB Gene. Eur J Biochem 1991, 201, 653-659.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)Molecular Cloning: A Laboratory Manual, 2nd
ed.,Cold Spring Harbor (N.Y.)
Shine J., and L. Dalgarno. Terminal-sequence analysis of bacterial ribosomal RNA. Correlation
between the 3'-terminal-polypyrimidine sequence of 16-S RNA and translational specificity of
the ribosome. Eur J Biochem 1975, 57(1), 221-230.
Straussberg R., et al. Generation and initial analysis of more than 15,000 full-length human and
mouse cDNA sequences. PNAS 2002, 99, 16899-16903.
Venter J.C., et al. The sequence of the human genome. Science 2001, 291, 1304-1351.
Weisberg R.A., and A. Landy. Site-specific recombination in phage lambda. In Lambda II, R.A.
Weisberg, ed. (Cold Spring Harbor, NY: Cold Spring Harbor Press) 1983, pp. 211-250.
Wiemann S., B. Weil, R. Wellenreuther, J. Gassenhuber, S. Glassl, W. Ansorge, M. Bocher, H.
Blocker, S. Bauersachs, H. Blum, J. Lauber, A. Dusterhoft, A. Beyer, K. Kohrer, N. Strack,
H.W. Mewes, B. Ottenwalder, B. Obermaier, J. Tampe, D. Heubner, R. Wambutt, B. Korn, M.
Klein, and A. Poustka. Toward a catalog of human genes and proteins: sequencing and
analysis of 500 novel complete protein coding human cDNAs. Genome Res 2001, 11, 422435.
8.2. Applications
8.2.1. Expression in Bacteria
Braun P., Y. Hu, B. Shen, A. Halleck, M. Koundinya, E. Harlow, and J. LaBaer. Proteome-scale
purification of human proteins from bacteria. Proc Natl Acad Sci USA 2002, 99(5), 2654-2659.
Hammarstrom M., N. Hellgren, S. van Den Berg, H. Berglund, and T. Hard. Rapid screening for
improved solubility of small human proteins produced as fusion proteins in Escherichia coli.
Protein Science 2002, 11, 313-321.
Kulkarni G.V., and D.D. Deobagkar. A cytosolic form of aminopeptidase P from Drosophila
melanogaster: molecular cloning and characterization. J Biochem 2002, 131(3), 445-452.
Bernhard Korn
10.04.2007
23/25
Kuma A., N. Mizushima, N. Ishihara, and Y. Ohsumi. Formation of the approximately 350-kDa
Apg12-Apg5.Apg16 multimeric complex, mediated by Apg16 oligomerization, is essential for
autophagy in yeast. J Biol Chem 2002, 277(21), 18619-18625.
Reina J., E. Lacroix, S.D. Hobson, G. Fernandez-Ballester, V. Rybin, M.S. Schwab, L. Serrano,
C. Gonzalez. Computer-aided design of a PDZ domain to recognize new target sequences.
Nature Structural Biology 2002, 9, 621-627.
Wang Y., J.A. Bruenn, S.F. Queener, and V. Cody. Isolation of rat dihydrofolate reductase gene
and characterization of recombinant enzyme. Antimicrob Agents Chemother 2001, 45(9),
2517-2523.
Way G., N. Morrice, C. Smythe, and A.J. O'Sullivan. Purification and identification of secernin, a
novel cytosolic protein that regulates exocytosis in mast cells. Mol Biol Cell 2002, 13(9), 33443354.
8.2.2. Yeast Expression
Brizuela L., P. Braun, and J. LaBaer. FLEXGene repository: from sequenced genomes to gene
repositories for high-throughput functional biology and proteomics. Mol Biochem Parasitol
2001, 118(2), 155-165.
Courbard J., F. Frederic, J. Adelaide, J. Borg, D. Birnbaum, and V. Ollendorf. Interaction between
two E3 ubiquitin ligases of different classes, CBLC and AIP4/ITCH. J Biol Chem 2002, 277,
45267-45275.
Davy A., P. Bello, N. Thierry-Mieg, P. Vaglio, J. Hitti, L. Doucette-Stamm, D. Thierry-Mieg, J.
Reboul, S. Boulton, A.J. Walhout, O. Coux, and M. Vidal. A protein-protein interaction map of
the Caenorhabditis elegans 26S proteasome. EMBO Rep 2001, 2(9), 821-828.
Finley R.L. Jr., H. Zhang, J. Zhong, and C.A. Stanyon. Regulated expression of proteins in yeast
using the MAL61-62 promoter and a mating scheme to increase dynamic range. Gene 2002,
285(1-2), 49-57.
Funk M., R. Niedenthal, D. Mumberg, K. Brinkmann, V. Ronicke, and T. Henkel. Vector systems
for the heterologous expression of proteins in Saccharomyces cerevisiae. Methods Enzymol
2002, 350, 248-257.
Gavin A.C., M. Bosche, R. Krause, P. Grandi, M. Marzioch, A. Bauer, J. Schultz, J.M. Rick, A.M.
Michon, C.M. Cruciat, M. Remor, C. Hofert, M. Schelder, M. Brajenovic, H. Ruffner, A. Merino,
K. Klein, M. Hudak, D. Dickson, T. Rudi, V. Gnau, A. Bauch, S. Bastuck, B. Huhse, C.
Leutwein, M.A. Heurtier, R.R. Copley, A. Edelmann, E. Querfurth, V. Rybin, G. Drewes, M.
Raida, T. Bouwmeester, P. Bork, B. Seraphin, B. Kuster, G. Neubauer, and G. Superti-Furga.
Functional organization of the yeast proteome by systematic analysis of protein complexes.
Nature 2002, 415, 141-147.
Stelzl, U., U. Worm, M. Lalowski, Chr. Haenig, F. H. Brembeck, H. Goehler, M. Stroedicke, M.
Zenkner, A. Schoenherr, S. Koeppen, J. Timm, S. Mintzlaff, C. Abraham, N. Bock, S.
Kietzmann, A. Goedde, E. Toksöz, A. Droege, S. Krobitsch, B. Korn, W. Birchmeier, H.
Lehrach, and E. E. Wanker . A Human Protein-Protein Interaction Network: A Resource for
Annotating the Proteome. Cell 2005, 122, Sept. 1st.
Walhout A.J., R. Sordella, X. Lu, J.L. Hartley, G.F. Temple, M.A. Brasch, N. Thierry-Mieg, and M.
Vidal. Protein interaction mapping in C. elegans using proteins involved in vulval development.
Science 2000, 287(5450), 116-22.
Walhout A.J., and M. Vidal. High-throughput yeast two-hybrid assays for large-scale protein
interaction mapping. Methods 2001, 24(3), 297-306.
8.2.3. Baculo Virus Expression
Akgoz M., I. Azpiazu, V. Kalyanaraman, and N. Gautam. Role of the G protein gamma subunit in
beta gamma complex modulation of phospholipase Cbeta Function. J Biol Chem 2002,
277(22), 19573-19578.
Giebler H.A., I. Lemasson, and J. Nyborg. p53 Recruitment of CREB binding protein mediated
through phosphorylated CREB: a novel pathway of tumor suppressor regulation. Mol Cell Biol
2000, 20(13), 4849-4858.
Grand-Perret T., A. Bouillot, A. Perrot, S. Commans, M. Walker, and M. Issandou. SCAP ligands
are potent new lipid-lowering drugs. Nature Medicine 2001, 7, 1332-1338.
Iwai T., et al. Molecular cloning and characterization of a Novel UDP-GlcNAc:GalNAc-peptide
b3Gn-T6), an enzyme synthesizing the core 3 structure of O-glycans. J Biol Chem 2002,
277(15), 12802-12809.
Bernhard Korn
10.04.2007
24/25
Katagiri Y., and K.C. Ingham. Enhanced production of green fluorescent fusion proteins in a
baculovirus expression system by addition of secretion signal. BioTechniques 2002, 33(1), 2426.
Wu X., S.R. Webster, and J. Chen. Characterization of tumor-associated Chk2 mutations. J Biol
Chem 2001, 276(4), 2971-2974.
8.2.4. Expression in Plant Cells
Karimi M., D. Inze, and A. Depicker. Gateway® vectors for Agrobacterium-mediated plant
transformation. Trends Plant Sci 2002, 7(5), 193-195.
Kersten B., L. Burkle, E.J. Kuhn, P. Giavalisco, Z. Konthur, A. Lueking, G. Walter, H. Eickhoff,
and U. Schneider. Largescale plant proteomics. Plant Mol Biol 2002, 48, 133-141.
Koiwa H., A.W. Barb, L. Xiong, F. Li, M.G. McCully, B.H. Lee, I. Sokolchik, J. Zhu, Z. Gong, M.
Reddy, A. Sharkhuu, Y. Manabe, S. Yokoi, J.K. Zhu, R.A. Bressan, and P.M. Hasegawa. Cterminal domain phosphatase-like family members (AtCPLs) differentially regulate Arabidopsis
thaliana abiotic stress signaling, growth, and development. Proc Natl Acad Sci USA 2002,
99(16), 10893-10898.
Wolucka B.A., G. Persiau, J. Van Doorsselaere, M.W. Davey, H. Demol, J. Vandekerckhove, M.
Van Montagu, M. Zabeau, and W. Boerjan. Partial purification and identification of GDPmannose 3",5"-epimerase of Arabidopsis thaliana, a key enzyme of the plant vitamin C
pathway. Proc Natl Acad Sci USA 2001, 98(26), 14843-14848.
8.2.5. Mammalian Cell Line Expression
Blin-Wakkach C., F. Lezot, S. Ghoul-Mazgar, D. Hotton, S. Monteiro, C. Teillaud, L. Pibouin, S.
Orestes-Cardoso, P. Papagerakis, M. Macdougall, B. Robert, and A. Berdal. Endogenous
Msx1 antisense transcript: in vivo and in vitro evidences, structure, and potential involvement
in skeleton development in mammals. Proc Natl Acad Sci USA 2001, 98(13), 7336-7341.
Gomes M.D., S.H. Lecker, R.T. Jagoe, A. Navon, and A.L. Goldberg. Atrogin-1, a muscle-specific
F-box protein highly expressed during muscle atrophy. Proc Natl Acad Sci USA 2001, 98(25),
14440-14445.
Kudo T., T. Iwai, T. Kubota, H. Iwasaki, Y. Takayma, T. Hiruma, N. Inaba, Y. Zhang, M. Gotoh, A.
Togayachi, and H. Narimatsu. Molecular cloning and characterization of a covel UDPGal:GalNAc(alpha) peptide beta 1,3-galactosyltransferase (C1Gal-T2), an enzyme
synthesizing a core 1 structure of O-glycan. J Biol Chem 2002, 277(49), 47724-47731.
Lao G., D. Polayes, J.L. Xia, F.R. Bloom, F. Levine, and J. Mansbridge. Overexpression of
trehalose synthase and accumulation of intracellular trehalose in 293H and 293FTetR:Hyg
cells. Cryobiology 2001, 43(2), 106-113.
Liu J., F. Yao, R. Wu, M. Morgan, A. Thorburn, R. Finley, and Y.Q. Chen. Mediation of the DCC
apoptotic signal by DIP13alpha. J Biol Chem 2002, 277(29), 26281-26285.
Loftus S., D. Larson, L. Baxter, A. Antonellis, Y. Chen, X. Wu, Y. Jiang, M. Bittner, J. Hammer,
and W. Pavan. Mutation of melanosome protein RAB38 in chocolate mice. Proc Natl Acad Sci
USA 2002, 99(7), 4471-4476.
Pandey A., N. Ibarrola, I. Kratchmarova, M.M. Fernandez, S.N. Constantinescu, O. Ohara, S.
Sawasdikosol, H.F. Lodish, and M. Mann. A novel Src homology 2 domain-containing
molecule, Src-like adapter protein-2 (SLAP-2), which negatively regulates T cell receptor
signaling. J Biol Chem 2002, 277(21), 19131-19138.
8.2.6. Miscelleaous
Blaszczyk J., J.E. Tropea, M. Bubunenko, K.M. Routzahn, D.S. Waugh, D.L. Court, and X. Ji.
Crystallographic and modeling studies of RNase III suggest a mechanism for double-stranded
RNA cleavage. Structure 2001, 9(12), 1225-1236.
Bloom F.R., P. Price, G. Lao, J.L. Xia, J.H. Crowe, J.R. Battista, R.F. Helm, S. Slaughter, and M.
Potts. Engineering mammalian cells for solidstate sensor applications. Biosens Bioelectron
2001, 16(7-8), 603-608.
Brizuela L., P. Braun, and J. LaBaer. FLEXGene repository: from sequenced genomes to gene
repositories for highthroughput functional biology and proteomics. Mol Biochem Parasitol
2001, 118(2), 155-165.
Bernhard Korn
10.04.2007
25/25
Hammarstrom M., N. Hellgren, S. van Den Berg, H. Berglund, and T. Hard. Rapid screening for
improved solubility of small human proteins produced as fusion proteins in Escherichia coli.
Protein Science 2002, 11(2), 313-321.
Hoover D.M., and J. Lubkowski. DNAWorks: an automated method for designing oligonucleotides
for PCR-based gene synthesis. Nucleic Acids Res 2002, 30(10), e43.
Jakobs A, Koehnke J, Himstedt F, Funk M, Korn B, Gaestel M, Niedenthal R. Ubc9 fusiondirected SUMOylation (UFDS): a method to analyze function of protein SUMOylation. Nat
Methods. 2007, 4, 245-50.
Jhoti H. High-throughput structural proteomics using x-rays. Trends Biotechnology 2001, 19(10),
67-71.
Ko M.S. Embryogenomics: developmental biology meets genomics. Trends Biotechnology 2001,
19(12), 511-518.
Matthews L.R., P. Vaglio, J. Reboul, H. Ge, B.P. Davis, J. Garrels, S. Vincent, and M. Vidal.
Identification of potential interaction networks using sequence-based searches for conserved
protein-protein interactions or "interologs". Genome Res 2001, 11(12), 2120-2126.
Monchois V., R. Vincentelli, C. Deregnaucourt, J. Claverie, and C. Abergel. Proficient target
selection in structural genomics by in-vitro protein expression. Biochemica (Roche) 2002, 1,
22.
Ohara O., and G. Temple. Directional cDNA library construction assisted by the in vitro
recombination reaction. Nucleic Acids Res 2001, 29(4), e22.
Ohara O., T. Nagase, G. Mitsui, H. Kohga, R. Kikuno, S. Hiraoka, Y. Takahashi, S. Kitajima, Y.
Saga, and H. Koseki. Characterization of size-fractionated cDNA libraries generated by the in
vitro recombination-assisted method. DNA Res 2002, 9(2), 47-57.
Reboul J., P. Vaglio, N. Tzellas, N. Thierry-Mieg, T. Moore, C. Jackson, T. Shin-i, Y. Kohara, D.
Thierry-Mieg, J. Thierry-Mieg, H. Lee, J. Hitti, L. Doucette-Stamm, J.L. Hartley, G.F. Temple,
M.A. Brasch, J. Vandenhaute, P.E. Lamesch, D.E. Hill, and M. Vidal. Open-reading-frame
sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nat
Genet 2001, 27(3), 332-336.
Simpson J.C., V.E. Neubrand, S. Wiemann, and R. Pepperkok. Illuminating the human genome.
Histochem Cell Biol 2001, 115(1), 23-29.
Simpson J.C., R. Wellenreuther, A. Poustka, R. Pepperkok, and S. Wiemann. Systematic
subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO
Rep 2000, 1(3), 287-292.
Walter G., K. Bussow, A. Lueking, and J. Glokler. High-throughput protein arrays: prospects for
molecular diagnostics. Trends Mol Med 2002, 8(6), 250-253.
Wiemann S., B. Weil, R. Wellenreuther, J. Gassenhuber, S. Glassl, W. Ansorge, M. Bocher, H.
Blocker, S. Bauersachs, H. Blum, J. Lauber, A. Dusterhoft, A. Beyer, K. Kohrer, N. Strack,
H.W. Mewes, B. Ottenwalder, B. Obermaier, J. Tampe, D. Heubner, R. Wambutt, B. Korn, M.
Klein, and A. Poustka. Toward a catalog of human genes and proteins: sequencing and
analysis of 500 novel complete protein coding human cDNAs. Genome Res 2001, 11(3), 422435.
Bernhard Korn
10.04.2007

Gateway ® Full ORF Clone Manual

Transcrição

Documentos relacionados

Tie ligand homologues