Archives of Dermatology

Transcrição

Vol. 143 No. 10, pp. 1240-1352, October 2007
This Month in Archives of Dermatology
Arch Dermatol. 2007;143:1244.
Studies
Topical Oxygen Emulsion: A Novel Wound Therapy
Stephen C. Davis; Alejandro L. Cazzaniga; Carlos Ricotti; Paul Zalesky; Li-Chien
Hsu; Jeffrey Creech; William H. Eaglstein; Patricia M. Mertz
Arch Dermatol. 2007;143:1252-1256.
Staphylococcus aureus Virulence Factors Associated With Infected Skin
Lesions: Influence on the Local Immune Response
Patricia M. Mertz; Tatiana C. P. Cardenas; Richard V. Snyder; Megan A. Kinney;
Stephen C. Davis; Lisa R. W. Plano
Arch Dermatol. 2007;143:1259-1263.
Wound Complications Following Diagnostic Skin Biopsies in Dermatology
Inpatients
Shyamal Wahie; Clifford M. Lawrence
Arch Dermatol. 2007;143:1267-1271.
Association Between the Use of -Adrenergic Receptor Agents and the
Development of Venous Leg Ulcers
DavidJ. Margolis; Ole Hoffstad; R. Rivkah Isseroff
Arch Dermatol. 2007;143:1275-1280.
Physical Activity and Adherence to Compression Therapy in Patients With
Venous Leg Ulcers
Maud M. Heinen; Carine van der Vleuten; Michette J. M. de Rooij; Caro J. T. Uden;
Andrea W. M. Evers; Theo van Achterberg
Arch Dermatol. 2007;143:1283-1288.
Observations
Hydroxyurea-Induced Leg Ulcers Treated With a Protease-Modulating Matrix
Marco Romanelli; Valentina Dini; Paolo Romanelli
Arch Dermatol. 2007;143:1310-1313.
Phenylephrine-Induced Microvascular Occlusion Syndrome in a Patient With
a Heterozygous Factor V Leiden Mutation
Andrew H. Kalajian; Klark B. Turpen; Kristin O. Donovan; Janine C. Malone; Jeffrey
P. Callen
Arch Dermatol. 2007;143:1314-1317.
Consensus Statement
Consensus Panel Recommendations for Chronic and Acute Wound Dressings
Michel Vaneau; Guillaume Chaby; Bernard Guillot; Philippe Martel; Patricia Senet;
Luc Téot; Olivier Chosidow
Arch Dermatol. 2007;143:1291-1294.
Reviews
Dressings for Acute and Chronic Wounds: A Systematic Review
Guillaume Chaby; Patricia Senet; Michel Vaneau; Philippe Martel; Jean-Claude
Guillaume; Sylvie Meaume; Luc Téot; Clélia Debure; Anne Dompmartin; Hélène
Bachelet; Hervé Carsin; Véronique Matz; Jean Louis Richard; Jean Michel Rochet;
Nathalie Sales-Aussias; Anne Zagnoli; Catherine Denis; Bernard Guillot; Olivier
Chosidow
Arch Dermatol. 2007;143:1297-1304.
Editorials
Wound Healing
Robert S. Kirsner
Arch Dermatol. 2007;143:1318-1319.
The Archives of Dermatology Web Site: Adding New Dimensions to the
Literature
Ashish C. Bhatia; Murad Alam
Arch Dermatol. 2007;143:1320-1322.
Special Articles
Injection Drug Use: An Understudied Cause of Venous Disease
Barbara Pieper; Robert S. Kirsner; Thomas N. Templin; Thomas J. Birk
Arch Dermatol. 2007;143:1305-1309.
skINsight
Epidermal Langerhans Cell Movement In Situ: A Model for Understanding
Immunologic Function in the Skin
Rachel E. Mohr; Akira Takashima
Off-Center Fold
Subcutaneous Nodule and Diffuse Lymphadenopathy in a 6-Month-Old Boy
From Africa—Quiz Case
Peter C. Friedman; Sameera Husain; David N. Silvers; Maria C. Garzon
Arch Dermatol. 2007;143:1323-1328.
Subcutaneous Nodule and Diffuse Lymphadenopathy in a 6-Month-Old Boy
From Africa—Diagnosis
Arch Dermatol. 2007;143:1323-1328.
Goosefleshlike Lesions and Hypohidrosis—Quiz Case
Naomi Soroosh Dimon; Douglas R. Fullen; Yolanda Rosi Helfrich
Arch Dermatol. 2007;143:1323-1328.
Goosefleshlike Lesions and Hypohidrosis—Diagnosis
Arch Dermatol. 2007;143:1323-1328.
Nodular Lesions on the Arm—Quiz Case
Anette Chrusciak-Talhari; Carolina Talhari; Mônica Nunes de Souza Santos; Luis
Carlos Ferreira; Sinésio Talhari
Arch Dermatol. 2007;143:1323-1328.
Nodular Lesions on the Arm—Diagnosis
Arch Dermatol. 2007;143:1323-1328.
Beefy Red Plaque in the Popliteal Fossa—Quiz Case
Sarah Jane Grekin; Nicole M. Annest; Kathi C. Madison
Arch Dermatol. 2007;143:1323-1328.
Beefy Red Plaque in the Popliteal Fossa—Diagnosis
Arch Dermatol. 2007;143:1323-1328.
The Cutting Edge
Negative Pressure Dressing in the Management of Pyoderma Gangrenosum
Ulcer
Marcelo M. Ghersi; Carlos Ricotti; Carlos H. Nousari; Martin I. Newman
Arch Dermatol. 2007;143:1249-1251.
Archives a Century Ago
Commemorative Medals.
Research Letters
Digital Image Analysis: A Reliable Tool in the Quantitative Evaluation of
Cutaneous Lesions and Beyond
Zakiya M. Pressley; Jovonne K. Foster; Paul Kolm; Liping Zhao; Felicia Warren;
William Weintraub; Bauer E. Sumpio; Suephy C. Chen
Arch Dermatol. 2007;143:1331-1333.
Wound Assessment by 3-Dimensional Laser Scanning
Marco Romanelli; Valentina Dini; Tommaso Bianchi; Paolo Romanelli
Arch Dermatol. 2007;143:1333-1334.
The Diagnostic Yield of Histopathologic Sampling Techniques in PANAssociated Cutaneous Ulcers
Carlos Ricotti; John P. Kowalczyk; Marcelo Ghersi; Carlos H. Nousari
Arch Dermatol. 2007;143:1334-1336.
Correspondence
Sodium Thiosulfate as First-Line Treatment for Calciphylaxis
Felix Ackermann; Annabelle Levy; Eric Daugas; Noel Schartz; Anne Riaux; Christian
Derancourt; Pablo Urena; Celeste Lebbé
Arch Dermatol. 2007;143:1336-1337.
Sodium Thiosulfate as First-Line Treatment for Calciphylaxis—Reply
Maria R. Robinson; Joshua J. Augustine; Neil J. Korman
Skin Cancer Presenting as a Nonhealing Wound: The Association of Polio
and Skin Cancer
Jenny Vu; Scott Bangert; Adelaide A. Hebert
Arch Dermatol. 2007;143:1338-1339.
Delayed Wound Healing Following Treatment With Low-Dose Interferon
Alfa-2b for Cutaneous Melanoma
Alfred F. Ammoury; Fouad El Sayed; Jacques Bazex
Arch Dermatol. 2007;143:1339-1340.
Intractable Wounds From a Herpes Simplex Infection in an
Immunosuppressed Patient With Rheumatoid Arthritis
Takaaki Hanafusa; Yuji Yamaguchi; Shun Kitaba; Ichiro Katayama
Arch Dermatol. 2007;143:1340-1342.
Paraneoplastic Raynaud Phenomenon With Digital Necrosis Associated With
Hyperhomocysteinemia and Antiphospholipid Antibodies
Massimo Carducci; Roberta Calcaterra; Massimo Rinaldi; Anna Mussi; Giuditta Viola;
Irene Venturo; Letizia Perracchio; Gennaro Franco; Massimo Lopez; Aldo Morrone
Arch Dermatol. 2007;143:1342-1343.
Resolution of Chronic Pain and Fingertip Ulceration Due to Hand-Arm
Vibration Syndrome Following Combination Pharmacotherapy
Catherine Buell; Edward Tobinick; Karen Lamp
Arch Dermatol. 2007;143:1343-1344.
Archives Web Quiz Winner
July 2007 Web Quiz Winner
Announcement
Archives Feature
Manuscript Submission
ARCHIVES
OF
DERMATOLOGY
Mission Statement: The Archives of Dermatology publishes information concerning the skin, its diseases, and their treatment. Its mission is to explicate the structure
and function of the skin and its diseases and the art of using this information to deliver optimal medical and surgical care to the patient. We attempt to enhance the
understanding of cutaneous pathophysiology and improve the clinician’s ability to diagnose and treat skin disorders. This journal has a particular interest in publishing clinical and laboratory studies that reveal new information pertinent to the interests and needs of the medical dermatologist, dermatologic surgeon, and all those
concerned with state-of-the-art care of cutaneous disease. We believe that knowledge derived from well-designed clinical trials and studies of cost-effectiveness are
especially important for improving the practice of dermatology. Studies that increase the understanding of the outcome of treatment or the means by which the burden of dermatologic disease can be measured and reduced to promote the health of patients with skin disease will receive special priority. The Archives regularly
publishes reports on clinical investigations, editorials, and reviews. It also features reports and discussions on clinicopathologic correlations; clinical disorders of
unique didactic value; pharmacologic, medical and surgical therapeutics; and ethical, moral, socioeconomic, and political issues.
Editor: June K. Robinson, MD Chicago, Illinois
Associate Editor: Jeffrey P. Callen, MD Louisville, Kentucky
Editorial Assistant: Mark D. Matthews Chicago, Illinois
Editorial Office: Archives of Dermatology
132 E Delaware Pl, #5806
Chicago, IL 60611
Telephone (312) 943-7759; Fax (312) 943-7752
e-mail: [email protected]
Section Editors
Archives a Century Ago: Mark Bernhardt, MD Ft Lauderdale, Florida
The Cutting Edge: George J. Hruza, MD St Louis, Missouri
Assistant Section Editors: Michael P. Heffernan, MD Dayton, Ohio
Christie Ammirati, MD Hershey, Pennsylvania
Evidence-Based Dermatology: Michael Bigby, MD
Boston, Massachusetts
Assistant Section Editors: Damiano Abeni, MD, MPH Rome, Italy
Rosamaria Corona, DSc, MD Rome, Italy
Urbà González, MD, PhD Barcelona, Spain
Abrar A. Qureshi, MD, MPH Boston, Massachusetts
Hywel Williams, MSc, PhD, FRCP Nottingham, England
Feature Editor: Michael J. Sladden, MAE, MRCP(UK)
Launceston, Tasmania
Off-Center Fold: Michael E. Ming, MD, MSCE Philadelphia, Pennsylvania
Assistant Section Editors: Carrie Ann R. Cusack, MD
Philadelphia, Pennsylvania
Senait W. Dyson, MD Irvine, California
Jacqueline M. Junkins-Hopkins, MD Philadelphia, Pennsylvania
Vincent Liu, MD Iowa City, Iowa
Karla S. Rosenman, MD New York, New York
On the Horizon: Gary S. Wood, MD Madison, Wisconsin
Assistant Section Editors: Craig A. Elmets, MD Birmingham, Alabama
Molly A. Hinshaw, MD Madison, Wisconsin
Jay C. Klemme, MD, MPH Wooster, Ohio
Mark R. Pittelkow, MD Rochester, Minnesota
Martin A. Weinstock, MD, PhD Providence, Rhode Island
David T. Woodley, MD Los Angeles, California
Publication Staff
Offices: 515 N State St, Chicago, IL 60610
Catherine D. DeAngelis, MD, MPH
Editor in Chief
Scientific Publications & Multimedia Applications
Cheryl Iverson: Managing Editor
Editorial Processing Department
Department Director: Paula Glitman
Manuscript Editing Manager: Lauren B. Fischer
Senior Manuscript Editors: Dee Egger, John McFadden,
Donald S. Smith
Manuscript Editor: Karen L. Boyd
Freelance Manuscript Editing Manager: Diane L. Cannon
Freelance Manuscript Editing Coordinators: Cheryl Tobey Davidow,
Vickey Golden, Connie Manno
Freelance Copy Editors and Copyreaders:
Catherine A. Alden, Lisa M. Cluver, Mary Coerver-Connolly,
Allison Esposito, GeorgeMary Gardner, Robin Husayko, Laura King,
Mary A. Kingzette, Nicole C. Netter, Beena Rao, Caroline Woods
Editorial Systems Managers: Paul Frank, Monica Mungle
Systems Programmer/Internet Specialist: J.D. Neff
Editorial Assistant: Wanda Hill
Scientific Publications & Multimedia Applications
Executive Assistant to the Editor: Marla A. Hall
Scientific Online Resources
Web Editor: Ashish C. Bhatia, MD Naperville, Illinois
CME Editor: Andrew D. Samel, MD Attleboro, Massachusetts
skINsight: James M. Grichnik, MD, PhD Durham, North Carolina
This Month: Robin L. Travers, MD Boston, Massachusetts
Editorial Board
Murad Alam, MD Chicago, Illinois
Ashish C. Bhatia, MD Naperville, Illinois
Michael Bigby, MD Boston, Massachusetts
Mary-Margaret Chren, MD San Francisco, California
Robert P. Dellavalle, MD, PhD, MSPH Denver, Colorado
Alan B. Fleischer, Jr, MD Winston-Salem, North Carolina
James M. Grichnik, MD, PhD Durham, North Carolina
Thomas D. Horn, MD Little Rock, Arkansas
George J. Hruza, MD St Louis, Missouri
Moise L. Levy, MD Houston, Texas
Michael E. Ming, MD, MSCE Philadelphia, Pennsylvania
Ronald L. Moy, MD Los Angeles, California
Anthony E. Oro, MD, PhD Stanford, California
Darrell S. Rigel, MD New York, New York
Lawrence A. Schachner, MD Miami, Florida
Kathryn Schwarzenberger, MD Burlington, Vermont
Maria L. Chanco Turner, MD Bethesda, Maryland
Gary S. Wood, MD Madison, Wisconsin
Surgical Advisory Board
Murad Alam, MD, Chairman Chicago, Illinois
Daniel Berg, MD Seattle, Washington
Jeffrey S. Dover, MD, FRCP Boston, Massachusetts
Hayes B. Gladstone, MD Palo Alto, California
Dee Anna Glaser, MD St Louis, Missouri
Ken K. Lee, MD Portland, Oregon
International Advisory Committee
Alvaro E. Acosta, MD Bogota, Colombia
Jan Nico Bouwes Bavinck, MD Leiden, the Netherlands
Reuven Bergman, MD Haifa, Israel
Francisco G. Bravo, MD Lima, Peru
Lorenzo Cerroni, MD Graz, Austria
Yahya Dowlati, MD, PhD Tehran, Iran
Reinhard Dummer, MD Zurich, Switzerland
James Ferguson, MD Dundee, Scotland
Miguel Ruben Guarda, MD Santiago, Chile
John L. M. Hawk, MD London, England
Jana Hercogova, MD Prague, Czech Republic
Chung-Hong Hu, MD, FACP Taipei, Taiwan
Abdul-Ghani M. Kibbi, FACP, MD Beirut, Lebanon
Andreas D. Katsambas, MD Athens, Greece
Steven Kossard, MD Sydney, Australia
Margarita M. Larralde, MD Buenos Aires, Argentina
Sungnack Lee, MD Suwon, Korea
Thomas A. Luger, MD Munster, Germany
Gillian Murphy, MD Dublin, Ireland
Oumeish Y. Oumeish, MD Amman, Jordan
Fezal Ozdemir, MD Izmir, Turkey
Jaime Piquero-Martin, MD Caracas, Venezuela
Niwat Polnikorn, MD, FRCP(T) Bangkok, Thailand
Marcia Ramos-e-Silva, MD, PhD Rio de Janeiro, Brazil
Jean E. Revuz, MD Creteil, France
Luis Requena, MD Madrid, Spain
Hiroshi Shimizu, MD Sapporo, Japan
Mohsen Soliman, MD Cairo, Egypt
T. Thirumoorthy, MD Singapore
Antonella Tosti, MD Bologna, Italy
Hans Christian Wulf, MD Copenhagen, Denmark
Wen-Yuan Zhu, MD Nanjing, China
Periodic Publishing & Business Staff
Senior VP & Publisher: Robert A. Musacchio, PhD
Publishing Operations
Advertising Sales & Marketing
Division Director: Vanessa Hayden
Directors: Karen Adams-Taylor, Sue Sherrill
Division Director: Jeffery J. Bonistalli
Manager: Kathy Russell
Staff: Mirna Monal
Sales Representatives: Peter G. Messina, Patricia Quilty
Assistant Publisher, Classified Advertising/
Circulation Promotion: Geoffrey Flick
Manager: Thalia Moss
Staff: Tem Harrier, Kim Jenkins, Allison Kruse
Director, Marketing Support Services: Mark Thornbury
Staff: Nancy Bell, Tricia Leonardis, Dennis Sammartino
Director, Reprints: Mark Kuhns
Staff: Susan Lovenberg
Journal Sales & Online Business
Division Director: Richard Newman
Director, Worldwide Sales: Vida Damijonaitis
Circulation Sales & Marketing:
Managers: Silvana Benzoni, Saskia Bolore, Jeremy Nielsen
Staff: Rebecca Haas, Christine Hearne
Director, Marketing and Product Development:
Michael T. Clarke
Staff: Millette Jackson-Bates, Sara Nicholson
Advertising and Production Services: Karen Allbright,
Bernadette Bauer, Rhonda Bailey Brown, Anna Goins,
Terri Hanley, Euwanaha Joiner-Smith, Brian McCartney,
Sean O’Donnell, Noemi Olmo, Cindy Rendlen,
Denise Steinhauser, Ellen Yoshihara
Circulation Processing: Julie Burton, Michael Deegan,
Rosa Eng, Donovan Hanson, Felicia Kyles,
Lawrence Majkszak, Kathryn Osten
Composition and New Media: Gail Barrett,
Regina Brownlee, Brenda Chandler-Grayer, Scott Curl,
Amy Evers, Teri Hutchison, Mary Ann Kuranda,
Joshua Lampinen, Patricia E. Panek,
La’son Diggs Sledge, George Thomson
Graphics: Joe Amft, Fred Furtner, Carolyn Hall,
Maria Kowalkowski, Ted Piwowar, JoAnne Weiskopf
Proofreading: Carol Joy Farrell, Daniel James,
Judith A. Literskis, Teresa H. Omiotek,
Barbara Wojtowicz, Agnes A. Zarkadas
Director: Margaret Winker, MD
Electronic Media Department Director: Michelle Kurzynski
Associate Web Editors: Christopher Hastings, Peter Kim
Web Administrative Assistant: Reuben Rios
All articles published, including editorials, letters, and book reviews, represent the opinions of the authors
and do not reflect the policy of the American Medical Association, the Editorial Board, or the institution
with which the author is affiliated, unless this is clearly specified.
Copyright 2007 by the American Medical Association. All rights reserved. Reproduction without permission is prohibited.
(REPRINTED) ARCH DERMATOL/ VOL 143 (NO. 10), OCT 2007
1240
Managers: David Antos, Karen Branham,
Suzanne J. Bukovsky, Debbie Camp, Susan Chiara,
Diane Darnell, Susana Eloy de Vitale, Karl Elvin,
Mary Ellen Johnston, Michael McGraw, Chris Meyer,
Phil O’Leary, Ryan Patella, Susan Price, Stacy Tucker
AMA Executives
Michael D. Maves, MD, MBA
Executive Vice President, Chief Executive Officer
Bernard L. Hengesbaugh
Chief Operating Officer
Robert A. Musacchio, PhD
Senior Vice President, Publishing & Business Services
WWW.ARCHDERMATOL.COM
THIS MONTH IN ARCHIVES OF DERMATOLOGY
SECTION EDITOR: ROBIN L. TRAVERS, MD
Injection Drug Use:
An Understudied Cause
of Venous Disease
I
njection drug use (IDU) accounts
for 12% of all illicit drug use in
the United States. Intravenous routes
are often preferred because of the
rapid drug response. Intravenous injecting typically begins in the veins
of the arms and upper body, but as
these sites become more difficult to
find, the veins of the groin, leg, and
feet are used. Complications of IDU
include venous scarring and collapse,
abscess formation, nerve and muscle
damage, and lymphatic blockage. In
addition, IDU augments or intensifies the typical chronic venous disease (CVD) risk factors affecting the
general population. In this review,
Pieper et al point out the importance
of obtaining a substance-abuse history when evaluating for risk of CVD.
See page 1305
Physical Activity and
Adherence to Compression
Therapy in Patients
With Venous Leg Ulcers
V
enous insufficiency causes 70%
of all leg ulcers. Physical activity and adequate compression therapy
are essential noninvasive treatments
for venous leg ulcers. Leg exercises
(particularly walking) stimulate the
calf muscle pump, supporting venous
circulation. Compression therapy improvescalfmusclepumpeffectiveness,
reducesvenousvolume,lowersvenous
pressure, and improves the microcirculation, thus preventing edema and
reducing the development of venous
skin changes. In this descriptive crosssectional study, Heinen et al demonstrate that moderate strenuous activity levels in patients with venous leg
ulcers are quite low and that less than
half of patients report full compliance
withcompressiontherapy.Strictcompliance with these noninvasive treatments provide demonstrable benefit
with respect to wound healing, suggesting that patients should be more
fully educated and urged to follow
these recommendations.
See page 1283
Association Between the Use of ␤-Adrenergic Receptor
Agents and the Development of Venous Leg Ulcers
I
t has been more than 25 years since ␤-adrenergic receptors were first noted
to be expressed in the skin, but their functional importance remains unclear. ␤-Adrenergic receptors may play a role in cutaneous wound repair. Receptor agonists decrease the rate of keratinocyte migration in vitro and impede wound healing in vivo. Receptor antagonists increase cultured keratinocyte
migratory speed and improve wound epithelialization in vivo. In this retrospective cohort study, Margolis et al demonstrate a strong protective association between ␤-adrenergic receptor agonists and venous leg ulcers. These
epidemiologic data are supported by strong laboratory evidence, suggesting
the need for a randomized clinical trial of these agents.
See page 1275
Staphylococcus aureus Virulence Factors Associated
With Infected Skin Lesions: Influence
on the Local Immune Response
Staphylococcus aureus is a major cause of local skin infections. Virulence factors include over 40 secreted proteins, enzymes, and toxins that establish and
maintain infections, sometimes through an effect on the local immune response. In this study, Mertz et al demonstrate a direct association between the
number of white blood cells (WBCs) in a local skin infection and the toxin genes
that S aureus carries. Although the physical appearance did not differ, lesions
with the fewest WBCs were more likely to be infected with S aureus strains capable of producing exfoliative toxins A and B, while the lesions with the most
WBCs were more likely to be infected with a Panton-Valentine leukocidin–
producing organism. These data suggest that the local immune response may
not always offer an accurate estimate of the seriousness of an infection.
See page 1259
Hydroxyurea-Induced Leg Ulcers Treated
With a Protease-Modulating Matrix
H
ydroxyurea is a chemotherapeutic agent that inhibits DNA
synthesis and promotes cell death in
the S phase of the cell cycle. Hydroxyurea is generally well tolerated and has
a low toxicity profile, but painful leg
ulcers may rarely complicate longterm, high-dose use for myeloproliferative disease. In this case series, Romanelli et al describe a pronounced
association between hydroxyurea
therapy and the development of painful leg ulcers unresponsive to standard therapy. These patients were successfully treated with local Promogran
dressing therapy (Johnson & Johnson
Wound Management, Piscataway, New
Jersey) every other day and then twice
weekly. Promogran is a freeze-dried
sponge containing oxidized regenerated cellulose and bovine purified collagen
that may inhibit the degradation of growth factors and tissue destruction, thus
limiting the damage to collagen synthesis due to hydroxyurea.
See page 1310
1244
ARCHIVES A CENTURY AGO
SECTION EDITOR: MARK BERNHARDT, MD
THE JOURNAL OF
CUTANEOUS DISEASES
VOL. XXV
OCTOBER, 1907
NO. 10
NOTICE.
By the initiative of Professor Gaucher, the pupils and friends of Dr. Hallopeau have opened a subscription with the object of offering a medal commemorating Dr. Hallopeau’s twenty-five years’ service at L’Hôpital Saint Louis, of his promotion to the grade of officer of the Legion of Honor and of
his numerous scientific publications. The medal is to be designed by Chaplin, with allegorical reverse and will be presented before the end of the year. The amount of each subscription is not limited. Each subscriber of five dollars (25 francs) becomes entitled to a copy of the medal. Subscription open until November 15, 1907. Send postal orders to J. B. Balliere, 19 Rue Hautefeuille, Paris.
J Cutan Dis.
October 1907;25(10):476.
COMMEMORATIVE MEDALS.
Honor a physician with the honor due unto him. . . .
Ecclesiasticus 38:1
Hallopeau Medal (obverse).
Offered as a limited subscription,
1907.
Hallopeau Medal (reverse).
Alfred Marchionini Medal.
Presented at the World Congress
of Dermatology in recognition of
personal characteristics, dedication
to international communication,
and scientific contributions of
particular importance for
international dermatology.
Stephen Rothman Medal. Awarded
by the Society for Investigative
Dermatology to individuals who
have distinquished themselves by
exceptional contributions to the
field of investigative dermatology.
Sir Archibald Gray Gold Medal.
The most prestigious prize offered
by the British Association of
Dermatologists, honors outstanding
services to dermatology in Britian.
Maria M. Duran Medal. The
International Society of
Dermatology’s recognition of
women leaders in dermatology and
those who have made significant
contributions to dermatologic
conditions affecting women and
children.
Castellani-Reiss Medal. The
International Society of
Dermatology’s award for
outstanding contributor to the
field of tropical dermatology.
Hebra Medal. The Austrian Society
of Dermatology and Venereology’s
honor for a life’s work in
dermatology.
Plenck Medal. Awarded by the
Austrian Society of Dermatology
and Venereology for lifetime
achievements in investigative
dermatology.
Gold Medal. American Academy
of Dermatology’s highest accolade
in recognition of outstanding and
exceptional service to the
specialty of dermatology and
substantial impact on the future of
the science, teaching, and practice
of cutaneous medicine. In
addition, the award honors an
outstanding and exceptional
contribution to the administrative
aspects of the specialty—
nationally or internationally.
1247
THE CUTTING EDGE
SECTION EDITOR: GEORGE J. HRUZA, MD; ASSISTANT SECTION EDITORS: MICHAEL P. HEFFERNAN, MD; CHRISTIE AMMIRATI, MD
Negative Pressure Dressing in the Management
of Pyoderma Gangrenosum Ulcer
Marcelo M. Ghersi, MD; Carlos Ricotti, MD; Carlos H. Nousari, MD; Martin I. Newman, MD; Department of Surgery,
Mount Sinai Medical Center, Miami Beach, Florida (Dr Ghersi); Department of Dermatology, University of Miami, Miami,
Florida (Drs Ricotti and Nousari); and Department of Plastic Surgery, Cleveland Clinic Florida, Weston (Dr Newman)
The Cutting Edge: Challenges in Medical and Surgical Therapeutics
The clinical management of pyoderma gangrenosum (PG)
ulcers has been a challenging practice since the description of these chronic wounds. Advances in biotechnology in the past 2 decades have given us a better understanding of the histopathologic nature of this disease, and
as a result, better therapeutic modalities have evolved.
However, on occasion PG ulcers will present in a refractory manner that will mandate additional strategies to attain wound closure. We present herein the novel use of
negative pressure dressings to effectively treat such a complex wound.
REPORT OF A CASE
A 57-year-old woman with a history of a very slowly healing PG ulcer on the lower part of her left leg for 2 years
presented with increasing pain and ulcer size after more
recent physical trauma. On physical examination, she had
a rounded ulcer (diameter, 10 cm) with central granulation tissue, scant purulent drainage, and erythematousviolaceous undermining borders (Figure, A). No lymphadenopathy, fever, or other constitutional symptoms were
observed. Partial response and intolerance to previous
therapies including intravenous pulses of methylprednisolone, intralesional triamcinolone acetonide, intravenous immunoglobulin, mycophenolate mofetil, and cyclophosphamide was noted.
Routine histological examination of a skin biopsy specimen taken from the erythematous-violaceous border
showed a diffuse interstitial dermal neutrophilic-rich infiltrate, without evidence of vasculitis. The results of special stains for pathogenic mycobacteria or fungi were negative. Tissue cultures obtained for wide spectrum
microorganisms revealed only methicillin-resistant Staphylococcus aureus (MRSA) sensitive to vancomycin. Findings from venous and arterial Doppler studies excluded underlying vascular disease. Results from extensive serological,
coagulation, and hematological studies failed to demonstrate evidence of underlying connective tissue disease, antiphospholipid syndrome, myelodysplastic syndrome, paraproteinemia, or any other hematologic disease.
At the 3-week follow-up examination, after having received intravenous vancomycin and continued local
wound care, the erythematous-violaceous undermining
borders of the ulcer had significantly improved. However, the lesion was still tender and no reduction in ulcer size was appreciated.
THERAPEUTIC CHALLENGE
Immunomodulatory and immunosuppressive therapy are
the mainstay of management of PG ulcers.1-5 The surgical management of active PG ulcers is discouraged owing to risk of pathergy-associated worsening. Unfortunately, some PG ulcers may take months or years to
completely heal, even in patients with adequate medical
therapy. Moreover, open wounds are more susceptible
to infection, which can potentially act as a pathergytriggering factor in PG ulcers.
Because of a history of partial response and intolerance and the potential risk of MRSA reinfection by immunomodulatory and immunosuppressive agents, a new
rapidly acting therapeutic intervention to expedite healing was needed in our patient.
SOLUTION
Negative pressure dressing with the vacuum-assisted closure (VAC) system was concurrently used with intravenous antibiotic therapy to accelerate healing of the ulcer (KCI International, San Antonio, Texas). At the time
of application of the VAC, the ulcer was completely filled
with granulation tissue, there was no evidence of purulent drainage, and there was complete resolution of the
erythematous-violaceous undermining borders. A polyurethane foam dressing was placed on the wound, followed by draping as per the manufacturer’s instructions
to create an airtight seal. Suction tubing was applied and
connected to the therapy unit. Intermittent therapy (5
minutes active and 2 minutes inactive) with 125 mm Hg
of negative pressure was administered, with scheduled
wound dressing changes every 48 hours.
At the time of the first VAC system dressing change,
the wound borders had reepithelialized further into the
wound bed, there was no evidence of erythematousviolaceous undermining borders, and the associated pain
1249
A
C
B
Figure. Pyoderma gangrenosum ulcer at presentation (A), at first vacuum-assisted closure (VAC) dressing change (B), and after 6 weeks of treatment with the
VAC system (C).
had significantly subsided (Figure, B). The VAC system
was well tolerated and was used until complete wound
closure, approximately 6 weeks after initiating therapy
(Figure, C). At the 6-month follow-up examination, the
PG ulcer remained completely healed.
COMMENT
The mainstay of therapy for PG is immunomodulatory
and immunosuppressive medical therapy as well as management of possible underlying associated disease.1-5 Surgical and other invasive modalities are contraindicated
as the primary or sole treatment of active PG ulcers. However, some authors have described a role for adjunctive
surgical management including skin grafts, muscle flaps,
and cultured keratinocyte autografts concomitant with
or preceding primary effective immunopharmacologic
therapy in noninfected and controlled PG ulcers.6-14
In 1997, Argenta and Morykwas15 reported the successful use of the VAC system as a primary treatment of
nonhealing skin ulcers (KCI International). Over
recent years, the VAC system has become an important
tool for the management of large, complex, acute, and
chronic skin ulcers from a wide variety of causes. The
mechanism of action of subatmospheric pressure
therapy includes increased tissue perfusion, increased
granulation tissue formation, reduced bacterial load,
and removal of excess interstitial edema. In addition to
its role in treating ulcers, the VAC system has also been
used to bolster skin grafts and to reepithelialize donor
sites.16,17
The optimal subatmospheric pressure with the VAC
system for wound healing appears to be approximately
125 mm Hg, using an alternating pressure cycle of 5 minutes of suction, followed by 2 minutes off suction. Dressing changes should be made every 48 to 72 hours to prevent growth of granulation tissue into the foam dressing.
The VAC device can be applied over any type of tissue.
Prior to application, the wound should be free of necrotic tissue and well vascularized. Complications with
the VAC system are infrequent and usually yield low morbidity. These complications are typically associated with
inadequate wound bed preparation, infrequent dressing
changes, or inadequate pressures applied. Therapy with
the VAC system has also been associated with local skin
irritation, pain, maceration, tissue necrosis, bleeding, and
infection. Owing to its mechanism of action, ie, through
the application of subatmospheric pressure, the VAC system could be considered a minimally invasive interventional therapy and thus a potential eliciting factor for
pathergy in PG ulcers. However, as shown in this report, the VAC system appears to exert its beneficial effect
on long-term wound healing without the theoretical detrimental effects in a stable PG ulcer.
Negative pressure dressing in the management of PG
was first described by Niezgoda and colleagues14 in 2006.
1250
Contrary to our single modality approach, these authors
used wide surgical debridement, hyperbaric oxygen, and
VAC, followed by skin grafting, to successfully treat a similar patient with a medically stable lower extremity PG ulcer.14 Although optimal outcomes were achieved in both
cases, more studies are necessary to accurately determine
the role each of these modalities have on the healing of this
complex wound. For now, the VAC system has proven to
be a safe tool that should be included in the adjuvant therapeutic armamentarium for the management of controlled
and slow-healing PG ulcers.
Accepted for Publication: April 20, 2007.
Correspondence: Marcelo M. Ghersi, MD, Department
of Surgery, Mount Sinai Medical Center, 4300 Alton Rd,
Ste 2212, Miami Beach, FL 33140 (mmghersi@yahoo
.com).
Author Contributions: Study concept and design: Ghersi,
Ricotti, Nousari, and Newman. Acquisition of data:
Ghersi and Newman. Analysis and interpretation of data:
Ghersi, Ricotti, and Newman. Drafting of the manuscript:
Ghersi, Ricotti, Nousari, and Newman. Critical revision
of the manuscript for important intellectual content:
Ghersi, Ricotti, Nousari, and Newman. Administrative,
technical, and material support: Ghersi, Ricotti, and
Newman. Study supervision: Nousari and Newman.
Financial Disclosure: None reported.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
REFERENCES
1. Holt PJ, Davies MG, Saunders KC, Nuki G. Pyoderma gangrenosum: clinical and
laboratory findings in 15 patients with special reference to polyarthritis. Medicine (Baltimore). 1980;59(2):114-133.
2. Johnson RB, Lazarus GS. Pulse therapy: therapeutic efficacy in the treatment of
pyoderma gangrenosum. Arch Dermatol. 1982;118(2):76-84.
3. Lebbé C, Moulonguet-Michau I, Perrin P, Blanc F, Frija J, Civatte J. Steroidresponsive pyoderma gangrenosum with vulvar and pulmonary involvement.
J Am Acad Dermatol. 1992;27(4):623-625.
4. Bennett ML, Jackson JM, Jorizzo JL, Fleischer AB, White WL, Callen JP. Pyoderma gangrenosum: a comparison of typical and atypical forms with an emphasis on time to remission: case review of 86 patients from 2 institutions. Medicine (Baltimore). 2000;79(1):37-46.
5. Reichrath J, Bens G, Bonowitz A, Tilgen W. Treatment recommendations for pyoderma gangrenosum: an evidence-based review of the literature based on more
than 350 patients. J Am Acad Dermatol. 2005;53(2):273-283.
6. Kaddoura IL, Amm C. A rationale for adjuvant surgical intervention in pyoderma
gangrenosum. Ann Plast Surg. 2001;46(1):23-28.
7. Signs DJ, Wagner DS. Pyoderma gangrenosum complicated by underlying os-
1251
teomyelitis: successful treatment with radical surgical debridement and cyclosporine therapy. Clin Infect Dis. 1995;21(6):1523-1524.
Alam M, Grossman ME, Schneiderman PI, Blume RS, Benvenisty AI. Surgical
management of pyoderma gangrenosum: case report and review. Dermatol Surg.
2000;26(11):1063-1066.
Adam DJ, Nawroz I, Petrie PW. Pyoderma gangrenosum severely affecting both
hands. J Hand Surg [Br]. 1996;21(6):792-794.
Cliff S, Holden CA, Thomas PR, Marsden RA, Harland CC. Split skin grafts in the
treatment of pyoderma gangrenosum: a report of four cases. Dermatol Surg. 1999;
25(4):299-302.
Rozen SM, Nahabedian MY, Manson PN. Management strategies for pyoderma
gangrenosum: case studies and review of literature. Ann Plast Surg. 2001;
47(3):310-315.
Lı́mová M, Mauro T. Treatment of pyoderma gangrenosum with cultured keratinocyte autografts. J Dermatol Surg Oncol. 1994;20(12):833-836.
Davis JC, Landeen JM, Levine RA. Pyoderma gangrenosum: skin grafting after preparation with hyperbaric oxygen. Plast Reconstr Surg. 1987;79(2):200-207.
Niezgoda JA, Cabigas EB, Allen HK, Simanonok JP, Kindwall EP, Krumenauer J.
Managing pyoderma gangrenosum: a synergistic approach combining surgical
debridement, vacuum-assisted closure, and hyperbaric oxygen therapy. Plast Reconstr Surg. 2006;117(2):24e-28e.
Argenta LC, Morykwas MJ. Vacuum-assisted closure: a new method for wound
control and treatment: clinical experience. Ann Plast Surg. 1997;38(6):563-577.
Schneider AM, Morykwas MJ, Argenta LC. A new and reliable method of securing skin grafts to the difficult recipient bed. Plast Reconstr Surg. 1998;102
(4):1195-1198.
Genecov DG, Schneider AM, Morykwas MJ, Parker D, White WL, Argenta LC.
A controlled subatmospheric pressure dressing increases the rate of skin graft
donor site reepithelialization. Ann Plast Surg. 1998;40(3):219-225.
Submissions
Clinicians, residents, and fellows are invited to submit
cases of challenges in management and therapeutics to
this section. Cases should follow the established pattern. Manuscripts should be prepared double-spaced with
right margins nonjustified. Pages should be numbered
consecutively with the title page separated from the text
(see Instructions for Authors [http://archderm.ama-assn
.org/misc/ifora.dtl] for information about preparation of
the title page). Clinical photographs, photomicrographs, and illustrations must be sharply focused and submitted as separate JPG files with each file numbered with
the figure number. Material must be accompanied by the
required copyright transfer statement (see authorship
form [http://archderm.ama-assn.org/misc/auinst_crit
.pdf]). Preliminary inquiries regarding submissions for
this feature may be submitted to George J. Hruza, MD
([email protected]). Manuscripts should be submitted via
our online manuscript submission and review system
(http://manuscripts.archdermatol.com).
STUDY
Topical Oxygen Emulsion
A Novel Wound Therapy
Stephen C. Davis, BS; Alejandro L. Cazzaniga, BS; Carlos Ricotti, MD; Paul Zalesky, PhD;
Li-Chien Hsu, PhD; Jeffrey Creech, PhD; William H. Eaglstein, MD; Patricia M. Mertz, BA
Objective: To investigate the use of a topical oxygen
emulsion (TOE), consisting of a supersaturated oxygen
suspension using perfluorocarbon components, on second-degree burns and partial-thickness wounds.
Results: The TOE was able to significantly (P =.001) enhance the rate of epithelialization compared with both vehicle and untreated control. These data suggest that topical oxygen may be beneficial for acute and burn wounds.
Design: Oxygen is a required substance for various
Conclusions: The results obtained from this doubleblind, control, in vivo study demonstrate that TOE can significantly enhance the rate of epithelialization of partialthickness excisional wounds and second-degree burns.
These findings could have considerable clinical implications for patients with surgical and burn wounds by providing functional skin at an earlier date to act as a barrier
against environmental factors, such as bacteria invasion.
Other types of wounds may also benefit from this therapy
(eg, chronic wounds and surgical incisions). Additional
studies, including clinical studies, are warranted.
aspects of wound repair, and increased oxygen tension
in a wound has been shown to stimulate phagocytosis
and to reduce the incidence of wound infection. Second-degree burns and partial-thickness wounds were
created on the backs of specific pathogen-free pigs.
Wounds were then randomly assigned to 1 of the following treatment groups: TOE, TOE vehicle, or air-exposed control.
Main Outcome Measure: Wounds were assessed for
complete epithelialization using a salt-split technique.
A
Arch Dermatol. 2007;143(10):1252-1256
CONSTANT AND ADEQUATE
oxygen supply is important for cell and tissue homeostasis. It is well documented that oxygen can
play a key role in energy production, cell
membrane maintenance, mitochondrial
function, and cellular repair. Physical injury to skin can compromise the arterial,
venous, or capillary systems of tissue, which
in turn may cause hypoxia and ischemia.
CME available online at
www.archdermatol.com
Author Affiliations:
Department of Dermatology &
Cutaneous Surgery, University
of Miami School of Medicine,
Miami, Florida (Messrs Davis
and Cazzaniga, Drs Ricotti and
Eaglstein, and Ms Mertz); and
TherOx Inc, Irvine, California
(Drs Zalesky, Hsu, and Creech).
The tissue repair process requires an increased metabolic activity of a variety of
cells, resulting in a high oxygen demand.1,2
Recent research has demonstrated that increasedoxygentensioninawoundpromotes
wound healing by stimulating several processes, including phagocytosis (engulfing of
microorganisms, cells, or debris by macrophages or neutrophils),3 degradation of necrotic wound tissue,4 collagen production,5-7
neovascularization,8,9 and neutrophil-mediated oxidative microbial killing.10
Many different treatment modalities
have been attempted to increase local oxy-
1252
gen supply to wounds to accelerate repair.
One potentially successful method is hyperbaric oxygen (HBO) therapy, which is
somewhat controversial because studies
have shown positive and neutral effects.
Clinical research11-16 has demonstrated that
HBO therapy accelerates reepithelialization of chronic leg ulcers. Although HBO
therapy can be effectively applied to treat
wounds, especially in hypoxic tissues, HBO
is not always practical or readily available, and can be relatively costly.
After treatment with HBO therapy, fibroblasts, an essential component of skin
repair, show a dose-dependent increase in
cellular proliferation. Fibroblasts cannot
synthesize collagen in the absence of molecular oxygen, which is required for the
hydroxylation of proline and lysine residues in the nascent procollagen molecule.17 Hyperbaric oxygen therapy depends on the lungs to increase the oxygen
tension in the blood, which is then transported systemically throughout the body
and finally to the wound.
Topical application of gaseous oxygen,
at normal or elevated partial pressures, to
skin wounds and ischemic lesions has been
attempted; however, as a gas, oxygen has
limited ability to penetrate the skin. On exposure to atmospheric pressures, oxygen microbubbles nucleate, coalesce, and effervesce from the topical preparation, thereby
reducing the oxygen content to ambient levels. Peroxidecontaining formulations have been developed, some of
which are available commercially. These formulations can
provide small quantities of oxygen to tissues by either spontaneous breakdown or enzymatic breakdown following tissue contact. Peroxide formulations are mildly bactericidal and are used primarily to remove dirt and debris from
acute traumatic lesions. Unfortunately, peroxides are irritating to raw tissue, have limited capacity to support metabolic oxygen requirements, and are believed to delay wound
healing, thus limiting their use as wound-promoting agents.
The ideal topical oxygen agent would provide sufficient quantities of oxygen to a wound several hours after
application and be nontoxic to the skin to accelerate local
tissue repair. TherOx Inc has developed a technique by
which an emulsion-containing supersaturated oxygen can
be delivered topically to a wound, where it can slowly release additional oxygen over time. This technology is based
on perfluorocarbon droplets being encapsulated within an
aqueous continuous phase. The oxygen solubility of the
perfluorocarbon is relatively high (approximately 20 times
greater than water); therefore, it has a high oxygencarrying capacity. Oxygen is dissolved into the perfluorocarbon emulsion and stored under pressure in a small dispensing bottle. By maintaining pressure on the emulsion,
dissolution and outgassing are prevented during storage and
the maximum oxygen concentration is delivered on dispensation. The topical cream is formulated with biocompatible emulsifying agents to ensure adequate stability of
the dispersed perfluorocarbon droplets. Before dispensation, the dissolved oxygen concentration contained in the
topical emulsion is approximately 2.0 mL of oxygen (standard temperature and pressure) per milliliter of emulsion.
Herein, we report the use of a novel topical oxygen
emulsion (TOE) that promoted wound healing of seconddegree burns and partial-thickness wounds.
METHODS
EXPERIMENTAL ANIMALS
Pigs were used as our experimental animal because they have
skin that is anatomically and physiologically similar to humans and are considered an excellent tool for the evaluation
of therapeutic agents. There is a strong correlation between pig
and human wound-healing studies.18 Sixteen pigs were used
for these studies (8 for partial-thickness wounds and 8 for second-degree burns) using well-defined porcine models.19-24 The
animal protocol used for this study was approved by the University of Miami Institutional Animal Care and Use Committee. Animals were monitored daily, and to help minimize possible discomfort, an analgesic, buprenorphine, 0.03 mg/kg, was
given to each animal the first day while under anesthesia and a
transdermal agent (fentanyl [Duragesic]), 25 µg/h, was used
during the entire experiment.
WOUNDING TECHNIQUE
Three grids were outlined on the dorsum and flanks of each
pig. For the partial-thickness wounds, the injuries
Dermis pulled
back from
epidermis
Back side of
epidermis
Wounded area (not healed)
Figure 1. Epidermal migration assessment (nonhealed wound).
(0.7⫻10.0⫻0.3 mm) were made with an electrokeratome . A
total of 120 partial-thickness wounds were created on each pig.
The burn wounds were made using the following method.
Five specially designed cylindrical brass rods weighing 358 g
each were heated in a boiling water bath to 100°C. A rod was
removed from the water bath and wiped dry before it was applied to the skin surface to prevent water droplets from creating a steam burn on the skin. The brass rod was held at a vertical position on the skin (6 seconds), with all pressure supplied
by gravity, to make a burn wound 8.5 mm in diameter by 0.8
mm deep. Again, 120 burn wounds were made on the anterior
two-thirds of the animal. Burn wounds and partial-thickness
wounds were randomly assigned to 1 of the following treatment groups according to the following experimental design.
TREATMENTS AND EXPERIMENTAL DESIGN
Treatments (active TOE containing oxygen, vehicle without oxygen, or untreated air exposed) were randomly assigned to the
wounds. The treatments were given to the investigators in a
blinded fashion (pressurized containers labeled A and B).
Wounds were treated twice daily for the first 5 days and once
thereafter until all wounds were 100% completely reepithelialized. Treatments were covered with a secondary dressing
(Release nonadherent gauze) and secured in place with Coban
self-wrapping bandages. The experimental design for both the
partial-thickness study and the second-degree burn study included 8 animals, with 120 wounds per animal (for a total of
960 wounds), 40 wounds per treatment group.
EPIDERMAL MIGRATION ASSESSMENT
The partial-thickness wounds were assessed on days 3 to 9 after
wounding (day 0), and the second-degree burns were assessed
on days 7 to 14 after burning. Beginning on the first assessment
day and on each day thereafter until all wounds were 100% reepithelialized, 5 wounds and surrounding normal skin from each
treatment group were excised using a standard-width (22 mm)
electrokeratome blade set at a depth of 0.5 mm. Specimens that
were not excised intact were discarded. Excised skin containing the wound site was incubated in 0.5M sodium bromide at
37°C for 24 hours, allowing for a separation of the dermis from
the epidermis25 (Figure 1). After the separation, the epidermal
sheet was examined macroscopically for defects. Defects were
defined as holes in the epidermal sheet in the area of the wound.
Reepithelialization is considered complete if no defects were present; any defect in the wound area indicates that healing was incomplete, and if no defects were seen, the wound is considered
1253
Dermis
Back side of
epidermis
Wounded area (healed)
Figure 2. Example of a healed wound.
completely epithelialized or healed (Figure 2). The epidermis
must be fairly mature (at least 5-7 cell layers) to withstand the
separation technique. The number of completely healed (reepithelialized) wounds was then divided by the number of wounds
assessed. This gives a percentage of wounds that are completely
reepithelialized (eg, on day 8, [12/40]⫻100%=30% of wounds
completely reepithelialized).
STATISTICAL ANALYSES
After the study is completed, the number of wounds healed
(completely epithelialized) will be divided by the total number of wounds sampled per day and multiplied by 100. The percentage of wounds will be plotted against days after wounding. Analysis by ␹2 4-fold tables was performed on the combined
data to determine any treatment response.
RESULTS
For the partial-thickness wound study, the wound that
received the TOE had a significantly enhanced rate of epithelialization compared with the vehicle and untreated
air-exposed wounds (on days 4, 5, and 6). In the seconddegree burn study, the TOE also had a significantly enhanced rate of epithelialization compared with vehicle
and untreated burn control wounds (on days 7, 8, and 9
after the burn) (Table 1 and Table 2). The vehicle also
showed a significant increase in epithelialization when
compared with untreated control wounds (for partialthickness wounds, on days 5, 6, and 7; and for seconddegree burn wounds, on days 10, 11, and 12).
COMMENT
Following tissue injury, several wound repair mechanisms are sequentially activated. These activities are
grouped into the 3 overlapping phases of wound healing: inflammation, proliferation, and remodeling. All
physiologically active processes involved in these phases
are in need of an adequate supply of oxygen.
After the initial trauma, there is vascular damage followed by hemostatic mechanisms to prevent blood loss. Coagulation and vasoconstriction are physiologic mechanisms of hemostasis in the wound. Oxygen delivery via the
vasculature to the wound at this stage is compromised. The
oxygen supply is limited, and delivery to the wound is dependent on diffusion from the surrounding tissue and atmosphere. In normal wound healing, the decrease in oxygen supply is transient. Schweiki et al26 demonstrated in
vitro that hypoxia leads to an increase in translation of vascular endothelial growth factor. This increase in vascular
endothelial growth factor stimulates angiogenesis, resulting in the reestablishment of the vascular network in the
wound bed.27 Interestingly, for the endothelium to be maximally responsive to vascular endothelial growth factor, it
must first sense hypoxia.26 Hypoxic environments also increase collagen production by fibroblasts and promote fibroblast proliferation.28 These cellular processes (angiogenesis, collagen production, and cell proliferation) are part
of normal tissue and cellular adaptation when their normal environment changes. For normal wound healing, the
initial hypoxic environment may promote the healing process; however, long-term hypoxia impedes wound healing, and oxygen delivery would be beneficial.
Over time, the result of an increase in oxygen demand
by leukocytes and fibroblasts and a reduced oxygen supply in a wound leads to anaerobic metabolism. Extended
anaerobic metabolism leads to an increase in metabolites
and a lack of energy production. Inadequate cell energy
levels impair protein production and cell homeostasis. At
the same time, vascular compromise and loss of blood flow
disable the tissue from eliminating metabolites, such as
lactic acid, from the wound.29 Lactic acid, a byproduct of
anaerobic metabolism, accumulates and acidifies the wound
environment, which may lead to cell death. Long-term hypoxia and loss of the ability for cells to adapt to hypoxia
lead to impaired and pathologic wound healing. Research has focused on increasing oxygen supply to hypoxic and ischemic tissues to promote wound healing.
The administration of external supplemental oxygen may
help in the wound healing process by providing ischemic
tissue cells with the required oxygen tension needed to survive and proliferate, especially in the situation of extended
oxygen limitation.30 When the new vasculature is well established and oxygen molecules can reach the repairing cells
by diffusing throughout the new blood vessels, therapies
such as HBO may prove to be effective. In addition to the
direct effects of oxygen in wound healing and cellular repair, the role of oxygen in controlling infections has been
examined. The open wound bed is a fertile breeding ground
for a broad variety of pathogenic microorganisms. Wounds
that are well perfused and oxygenated have been shown to
be less likely to become infected.31,32
Systemic HBO therapies entail the inhalation of 100%
oxygen under pressures between 2 and 3 atmospheric
pressure. The high pressure, in addition to the high levels of oxygen, considerably increases the dissolved oxygen levels into blood plasma. This therapeutic approach
is indicated to treat acute traumatic ischemias, necrotizing fasciitis, irradiated tissues, refractory osteomyelitis,33 and certain chronic wound conditions.34 However,
as previously mentioned, HBO therapies are effective if
the vascular network is functional in the wounded tissues. Hyperbaric oxygen may not be effective on ischemic chronic leg ulcers and superficial burns. In addition
to the limited research of these therapies on various types
1254
Table 1. Partial-Thickness Epithelialization Results
Time After Wounding, d a
Treatment
3
4
5
6
7
8
9
Active
Vehicle
Untreated
0/40
0/40
0/40
18/40 (45)
4/40 (10)
0/40
34/40 (85)
15/40 (38)
0/40
40/40 (100)
29/40 (72)
3/40 (8)
40/40 (100)
40/40 (100)
25/40 (62)
40/40 (100)
40/40 (100)
40/40 (100)
40/40 (100)
40/40 (100)
40/40 (100)
a Data are given as number of wounds completely epithelialized/total number of wounds assessed (percentage). On days 4 and 5, P ⬍ .001 for the active group
vs the vehicle and untreated groups; on day 5, P ⬍.001 for the vehicle group vs the untreated group; on day 6, P ⬍ .001 for the active group vs the vehicle and
untreated groups and for the vehicle group vs the untreated group; and on day 7, P ⬍ .001 for the active and vehicle groups vs the untreated group.
Table 2. Second-degree Burn Epithelialization Results
Time After the Burn, d a
Treatment
7
8
9
10
11
12
13
14
Active
Vehicle
Untreated
9/40 (22)
0/40
0/40
28/40 (70)
13/40 (32)
0/40
37/40 (92)
28/40 (70)
3/40 (8)
40/40 (100)
38/40 (95)
10/40 (25)
40/40 (100)
40/40 (100)
22/40 (55)
40/40 (100)
40/40 (100)
31/40 (78)
40/40 (100)
40/40 (100)
35/40 (88)
40/40 (100)
40/40 (100)
40/40 (100)
a Data are given as number of burns completely epithelialized/total number of wounds assessed (percentage). On days 7 and 8, P ⬍ .001 for the active group vs
the vehicle and untreated groups; on day 9, P ⬍.02 for the active group vs the vehicle group and P ⬍ .001 for the active group vs the untreated group; on days 10
and 11, P ⬍.001 for the active and vehicle groups vs the untreated group; and on day 12, P ⬍ .01 for the active and vehicle groups vs the untreated group.
of wounds, these hyperbaric therapies require the use of
large and cumbersome machinery. This inconvenience
limits their widespread use in the clinical setting and their
potential use for the military on the battlefield.
Topical HBO therapy is oxygen delivered at slightly
increased atmospheric pressures directly to the surface
of the wound. The name HBO therapy implies that pressures used in treatment are greater than 1 atm. Because
“topical” HBO therapy is applied at pressures barely over
1 atm, the use of the term topical hyperbaric therapy is
not only misleading but a misnomer. One should be wary
of any so-called topical hyperbaric therapies that make
various healing and/or rejuvenation claims, especially
when few or no data are available to support their use.
Hyperbaric oxygen is becoming a more accepted treatment modality, especially as an adjunctive therapy, because of the increase in studies showing potential mechanisms of action. Heng et al35 compared topical HBO
therapy with the standard of treatment for necrotic gangrenous wounds that lack blood supply. Forty patients
were included in the study, and 90% of patient ulcers that
received topical HBO healed compared with 25% of patient ulcers treated with standard wound management
therapy. No oxygen reperfusion damage was noted. The
group also demonstrated that the topical HBO-treated ulcers had an increase in angiogenesis in the wound bed.
One appealing method for oxygen treatment is topical delivery. Many different topical oxygen delivery systems have been attempted for wound healing, but unfortunately most of these therapies have yielded poor
results. One of the major criticisms of topical oxygen
therapies is the inadequate delivery of oxygen deep into
the skin to provide fibroblasts, keratinocytes, and inflammatory cells increased oxygen required for repair.
Recent advancements have allowed the creation of a hy-
peroxygenated emulsion for topical delivery of oxygen
to wounds. Unpublished ex vivo assays performed by our
group determined that our hyperoxygenated emulsion
consistently increased subcutaneous oxygen tension when
compared with vehicle and phosphate-buffered solution. The treated viable tissue also demonstrated an initial peak in PO2 levels with a decrease over time. Treated
nonviable tissue results show an increase in PO2 levels
without the decrease over time. This suggests that the
cells in the viable tissue may be using the supplied oxygen from the topical emulsion in metabolic pathways.
Once we established that the vehicle was able to carry
the oxygen deep into skin, we set out to study this TOE
on wounds. The fact that the vehicle also enhanced the
rate of epithelialization in the porcine wound models is
not surprising because it has previously been shown that
vehicles are not inert and can either adversely or beneficially affect the healing process.36 In both of these studies (burns and acute partial-thickness wounds), we found
the TOE to have a significant effect over vehicle alone.
Interestingly, the use of a TOE not only stimulated epithelialization of ischemic second-degree burns but also of
well-vascularized acute wounds. Using the same porcine
models, we have also evaluated possible mechanisms of
topical oxygen and found an up-regulation of vascular endothelial growth factor, collagens I and III, and matrix metalloproteinase levels after treatment with the TOE. These
findings will be the subject of a subsequent article that will
document possible mechanisms of this therapy. Although hypoxia and hypoxemia have been shown to influence either keratinocyte proliferation or differentiation and collagen synthesis in vitro.28,37,38 These studies
simply suggest that an external factor, such as low oxygen
levels, which may be present during tissue repair, can influence various specific cellular processes. Purposefully in-
1255
ducing hypoxic environments to wounds clinically would
most likely lead to necrosis and impaired healing.
The results obtained from this double-blind, control,
in vivo study demonstrate that the TOE can significantly enhance epithelialization of partial-thickness acute
wounds and second-degree burns. We believe that the
oxygen supplied by the emulsion to the wound environment directly promotes cellular repair and the local immune response to speed wound healing. Our findings may
have important clinical implications for patients with
wounds by providing functional skin at an earlier date
to act as a barrier against environmental factors, such as
water loss and bacteria invasion. Other types of wounds
may also benefit from this therapy (eg, ischemic and
chronic wounds), and more studies, including clinical
studies, are warranted.
Accepted for Publication: May 15, 2007.
Correspondence: Stephen C. Davis, BS, Department of
Dermatology & Cutaneous Surgery, University of Miami School of Medicine, 1600 NW 10th Ave, Room 2089,
Miami, FL 33136 ([email protected]).
Author Contributions: Mr Davis had full access to all the
data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study
concept and design: Davis, Ricotti, Zalesky, Hsu, Creech,
and Mertz. Acquisition of data: Davis, Cazzaniga, Ricotti,
Hsu, and Mertz. Analysis and interpretation of data: Davis,
Cazzaniga, Ricotti, Eaglstein, and Mertz. Drafting of the
manuscript: Davis, Ricotti, and Creech. Critical revision
of the manuscript for important intellectual content: Davis,
Cazzaniga, Ricotti, Zalesky, Hsu, Eaglstein, and Mertz.
Statistical analysis: Ricotti. Obtained funding: Davis, Ricotti,
Hsu, and Mertz. Administrative, technical, and material support: Davis, Cazzaniga, Hsu, and Creech. Study supervision: Davis, Zalesky, Eaglstein, and Mertz.
Funding/Support: This study was supported by a small
business innovative research grant from TherOx Inc/
Defense Advanced Research Projects Agency.
Role of the Sponsor: The funding bodies had no role in
the design and conduct of the study and in the collection, analysis, and interpretation of the data; however,
they did help review the final manuscript and gave some
background information regarding the test article.
Additional Contributions: Kurt Henry, MD, LCDR (US
Navy), and Matt Healy, PhD (Booze Allen Hamilton Inc),
provided help and support with this project.
REFERENCES
1. LaVan FB, Hunt TK. Oxygen and wound healing. Clin Plast Surg. 1990;17(3):463-470.
2. Niinikoski J, Hunt TK, Dunphy JE. Oxygen supply in healing tissue. Am J Surg.
1972;123(3):247-252.
3. Hohn DC, MacKay RD, Halliday B, Hunt TK. The effect of O2 Surg Forum. 1976;
27(62):18-20.
4. Dalton SJ, Whiting CV, Bailey JR, Mitchell DC, Tarlton JF. Mechanism of chronic
skin ulceration linking lactate, transforming growth factor-␤, vascular endothelial growth factor, collagen remodeling, collagen stability, and defective
angiogenesis. J Invest Dermatol. 2007;127(4):958-968.
5. Niinikoski J. Effect of oxygen supply on wound healing and formation of experimental granulation tissue. Acta Physiol Scand Suppl. 1969;334:1-72.
6. Hunt TK, Pai MP. The effect of varying ambient oxygen tensions on wound metabolism and collagen synthesis. Surg Gynecol Obstet. 1972;135(4):561-567.
7. Hsu RW, Hsu WH, Tai CL, Lee KF. Effect of hyperbaric oxygen therapy on patellar tendinopathy in a rabbit model. J Trauma. 2004;57(5):1060-1064.
8. Meltzer T, Myers B. The effect of hyperbaric oxygen on the bursting strength and
the rate of vascularization of skin wounds in the rat. Am Surg. 1986;52(12):
659-662.
9. Knighton DR, Silver IA, Hunt TK. Regulation of wound-healing angiogenesis.
Surgery. 1981;90(2):262-270.
10. Mader JT, Brown GL, Guckian JC, Reinarz JA. A mechanism for the amelioration
by hyperbaric oxygen of experimental staphylococcal osteomyelitis in rabbits.
J Infect Dis. 1980;142(6):915-922.
11. Cianci P, Hunt TK. Adjunctive hyperbaric oxygen therapy in treatment of diabetic foot wounds. In: Levin ME, O’Neal LW, Bowker JH, eds. The Diabetic Foot.
5th ed. St Louis, MO: Mosby–Year Book Inc; 1993:305-319.
12. Hammarlund C, Sundberg T. Hyperbaric oxygen reduced size of chronic leg ulcers:
a randomized double-blind study. Plast Reconstr Surg. 1994;93(4):829-833.
13. Doctor N, Pandya S, Supe A. Hyperbaric oxygen therapy in diabetic foot. J Postgrad Med. 1992;38(3):112-114.
14. Cianci P. Advances in the treatment of the diabetic foot: is there a role for adjunctive hyperbaric oxygen therapy? Wound Repair Regen. 2004;12(1):2-10.
15. Stone J, Cianci P. The adjunctive role of hyperbaric oxygen therapy in the treatment of lower extremity wounds in patients with diabetes. Diabetes Spectrum.
1997;10:118-123.
16. Fife CE, Buyukcakir C, Otto G, Sheffield P, Love T, Warriner R. Factors influencing the outcome of lower-extremity diabetic ulcers treated with hyperbaric oxygen therapy. Wound Repair Regen. 2007;15(3):322-331.
17. Jeffrey JJ. Collagen degradation. In: Cohen IK, Diegelmann RF, Lindblad WJ, eds.
Wound Healing: Biochemical and Clinical Aspects. Philadelphia, PA: WB Saunders Co; 1992:177-194.
18. Sullivan TP, Eaglstein WH, Davis SC, Mertz PM. The pig as a model for human
wound healing. Wound Repair Regen. 2001;9(2):66-76.
19. Eaglstein WH, Davis SC, Mehle AL, Mertz PM. Optimal use of an occlusive dressing to enhance healing. Arch Dermatol. 1988;124(3):392-395.
20. Sauder DN, Kilian PL, McLane JA, et al. Interleukin-1 enhances epidermal wound
healing. Lymphokine Res. 1990;9(4):465-473.
21. Mertz PM, Davis SC, Franzén L, et al. Effect of an RGD peptide-containing artificial matrix on epithelial sheet migration and experimental second-degree burn
wound healing. J Burn Care Rehabil. 1996;17(3):199-206.
22. Davis SC, Bilevich ED, Cazzaniga AL, Mertz PM. Early debridement of seconddegree burn wounds enhances the rate of epithelization: an animal model to evaluate burn wound therapies. J Burn Care Rehabil. 1996;17(6, pt 1):558-561.
23. Davis SC, Eaglstein WH, Cazzaniga AL, Mertz PM. An octyl-2-canoacrylate formulation speeds healing of partial thickness wounds. Dermatol Surg. 2001;
27(9):783-788.
24. Davis SC, Mertz PM, Eaglstein WH. Second-degree burn healing: the effect of
occlusive dressings and a cream. J Surg Res. 1990;48(3):245-248.
25. Eaglstein WH, Mertz PM. New method for assessing epidermal wound healing.
J Invest Dermatol. 1978;71(6):382-384.
26. Shweiki D, Itin A, Soffer D, Keshet E. Vascular endothelial growth factor induced
by hypoxia may mediate hypoxia-initiated angiogenesis. Nature. 1992;359(6398):
843-845.
27. Li J, Zhang YP, Kirsner R. Angiogenesis in wound repair: angiogenic growth factors and the extracellular matrix. Microsc Res Tech. 2003;60(1):107-114.
28. Falanga V, Zhou L, Yufit T. Low oxygen tension stimulates collagen synthesis
and COL1A1 transcription through the action of TGF-␤1. J Cell Physiol. 2002;
191(1):42-50.
29. Zamboni WA, Browder LK, Martinez J. Hyperbaric oxygen and wound healing.
Clin Plast Surg. 2003;30(1):67-75.
30. Marx RE, Ehler WJ, Tayapongsak P, Pierce LW. Relationship of oxygen dose to
angiogenesis induction in irradiated tissue. Am J Surg. 1990;160(5):519-524.
31. Kurz A, Sessler DI, Lenhardt R. Perioperative normothermia to reduce the incidence of surgical-wound infection and shorten hospitalization: Study of Wound
Infection and Temperature Group. N Engl J Med. 1996;334(19):1209-1215.
32. Hopf HW, Hunt TK, West JM, et al. Wound tissue oxygen tension predicts the
risk of wound infection in surgical patients. Arch Surg. 1997;132(9):997-1004.
33. Strauss MB. Refractory osteomyelitis. J Hyperbar Med. 1987;2:146-159.
34. Grim PS, Gottlieb LJ, Boddie A, Batson E. Hyperbaric oxygen therapy. JAMA.
1990;263(16):2216-2220.
35. Heng MC, Harker J, Csathy G, et al. Angiogenesis in necrotic ulcers treated with
hyperbaric oxygen. Ostomy Wound Manage. 2000;46(9):18-28, 30-32.
36. Eaglstein WH, Mertz PM. “Inert” vehicles do affect wound healing. J Invest Dermatol.
1980;74(2):90-91.
37. Dimitrijevich SD, Paranjape S, Wilson JR, Gracy RW, Mills JG. Effect of hyperbaric oxygen on human skin cells in culture and in human dermal and skin
equivalents. Wound Repair Regen. 1999;7(1):53-64.
38. Hollander DA, Hakimi MY, Hartmann A, Wilhelm K, Windolf J. The influence of
hyperbaric oxygenation (HBO) on proliferation and differentiation of human keratinocyte cultures in vitro. Cell Tissue Bank. 2000;1(4):261-269.
1256
STUDY
Staphylococcus aureus Virulence Factors
Associated With Infected Skin Lesions
Influence on the Local Immune Response
Patricia M. Mertz, BA; Tatiana C. P. Cardenas, BS; Richard V. Snyder, PhD;
Megan A. Kinney, BS; Stephen C. Davis, BS; Lisa R. W. Plano, MD, PhD
Objectives: To evaluate Staphylococcus aureus isolates
Patients: Samples were obtained from patients at a single
from infected skin lesions for their potential to produce
immune system–modulating toxins and to correlate these
with white blood cell (WBC) counts associated with these
lesions.
geographic location.
Design: Specimens were obtained for bacterial culture
and gram staining from 105 infected skin lesions, and
the number of WBCs per low-power field (LPF) was
determined. Chromosomal DNA was prepared from
84 bacterial isolates and subjected to real-time polymerase chain reaction analysis to determine the presence of genes encoding potential immunomodulating
toxins. Bacterial populations were divided into 2
groups: those associated with low WBC counts (0-5
WBCs/LPF) and those with high WBC counts (⬎ 5
WBCs/LPF). We applied ␹2 statistical analyses to compare the toxin gene profiles associated with WBC
counts on initial swab for culture.
S
Author Affiliations: Miami
Dermatology Research Institute
(Ms Mertz), Miami, Florida;
Departments of Pediatrics
(Ms Cardenas and Drs Snyder
and Plano), Dermatology
(Mr Davis), and Microbiology
and Immunology (Dr Plano),
University of Miami, Leonard
M. Miller School of Medicine,
Miami; and Rosalind Franklin
University of Medicine and
Science, Chicago Medical
School, North Chicago, Illinois
(Ms Kinney).
Results: A higher than expected percentage of bacteria
capable of producing the exfoliative toxins A and/or B
(ETA and/or ETB) and Panton-Valentine leukocidin (PVL)
was seen in all skin lesions infected with S aureus without regard to WBC count with initial cultures. Comparison of the toxins associated with the low WBC group vs
the high WBC group showed that low WBC counts were
associated with ETA and ETB, while high WBC counts
were associated with PVL and toxic shock syndrome toxin.
There were no differences in the clinical appearance of
the lesions between groups.
Conclusions: Staphylococcus aureus virulence factors
ETA, ETB, and PVL are associated with WBC counts from
infected skin lesions. The exact role they play in affecting the WBC counts remains to be determined.
Arch Dermatol. 2007;143(10):1259-1263
TAPHYLOCOCCUS AUREUS IS A
major cause of multiple types
of infections both in and outside of the hospital setting.
These infections range from
superficial skin infections to deeper infections of hair follicles, abscesses, and deep
tissue infections, and even to systemic infections including those of the heart, lungs,
bones, and blood.1 Staphylococcus aureus
carries a large repertoire of virulence factors, including over 40 secreted proteins and
enzymes that it uses to establish and maintain infections.2,3 Some of these virulence
factors are know to cause or be associated
with specific diseases, for example, toxic
shock syndrome toxin (TSST) and toxic
shock syndrome; Panton-Valentine leukocidin (PVL) and necrotizing pneumonia and
skin diseases4,5; the exfoliative toxins A and
B (ETA and ETB) and scalded skin syndrome, impetigo, skin infections, and atopic
dermatitis6,7; and the family of staphylococcal enterotoxins A and B (SEA and SEB) and
food poisoning.3
1259
Also among these virulence factors are
several toxins that have the potential to
manipulate components of the immune response. These include leukotoxins that
specifically affect white blood cells (WBC)
(PVL and leukocidin D-E [LukD-E]); toxins that function as superantigens that can
manipulate the immune system by hyperstimulating the release of cytokines (SEA,
SEB, and TSST); and hemolysins that are
active to lyse red blood cells and WBCs as
well as other cell types, as described by
Foster.8
To our knowledge, an association of
WBCs in infected skin lesions and the presence of bacteria capable of producing potentially immunomodulating toxins has
not been reported. Our hypothesis is that
the presence of immunomodulating or cytotoxic virulence factors produced by certain bacterial pathogens in infected skin
lesions will have an effect on the number
of WBCs associated with secondarily infected skin lesions. In the present study,
S aureus cultures isolated from second-
arily infected skin lesions were evaluated for their potential ability to produce immune system–modulating toxins by identification of the encoding genes using
polymerase chain reaction (PCR). The association of these
virulence factors with the level of localized WBC response was determined.
METHODS
BACTERIAL COLLECTION
Swab specimens of infected skin lesions were obtained for bacterial culture and gram staining, and photographs were taken
from 105 patients at a single geographical location after institutional review board approval and appropriate informed patient consent were obtained. Specimens were processed by a
centralized laboratory. Slides were prepared for light microscopy, and bacterial and WBC counts per low-power field (LPF)
were determined. Bacterial isolates including S aureus and Streptococcus species were obtained from 85 of 105 lesions. Seventytwo isolates were determined to be S aureus by standard identification methods and PCR detection of S aureus–specific gyrA
gene. These 72 isolates were considered in the analysis of virulence factors associated with S aureus from infected skin lesions. Sixty-one of the 72 bacteria were isolated without coinfecting streptococci and were divided into 2 groups according
to corresponding WBC count in the lesions and considered in
the analysis of the effect of S aureus infection on the presence
of localized WBCs.
DNA ISOLATION
Chromosomal DNA samples were obtained from each of the
84 bacterial isolates collected. DNA was prepared using a DNeasy
tissue kit (Qiagen, Valencia, California) according to the manufacturer’s recommendations and with the addition of lysostaphin to aid in the lysis of Staphylococcus species. The DNA
was collected in 10mM Tris–hydrochloric acid. Concentrations of DNA were determined using a Quant-iT dsDNA BR or
HS Assay Kit and Qubit Fluorometer (Invitrogen, Carlsbad, California). The quality of the chromosomal DNA was confirmed
by agarose gel electrophoresis using 0.8% gels, with ethidium
bromide staining. Samples of DNA were diluted for consistent
template amounts for each PCR reaction, aliquoted to prevent
contamination, and stored at −20°C.
REAL-TIME PCR REACTIONS
FOR IDENTIFICATION OF
S AUREUS–SPECIFIC GENES
Real-time PCR analyses were preformed on all bacterial isolates to determine the presence or absence of selected virulence or control genes. Seventy-two isolates were determined
to be S aureus by standard identification methods and PCR detection of the S aureus–specific gyrA gene. The selected genes
encoding ␣-hemolysin (hla), PVL (pvl), LukD-E (lukD-E), SEA
(sea), SEB (seb), TSST (tst), ETA (eta), ETB (etb), and methicillin resistance (mecA) and chemotaxis-inhibiting protein
(CHIP) (chs) were determined using real-time PCR with confirming melt curves and agarose gel visualization of selected
DNA products for confirmation. The gene encoding S aureus
DNA gyrase A (gyrA) was included as a positive control for PCR
reactions. Oligonucleotide primer pairs used were either those
used currently in our laboratory or were designed for this study
using the Beacon Designer for Real-Time PCR Assay Design (BioRad Laboratories, Hercules, California) (eTable 1; available at
http://www.archdermatol.com).9-12 Individual reaction conditions were optimized for each oligonucleotide primer pair with
gradient control templates to establish best reaction conditions. Real-time PCR reactions were carried out in a 96-well
plate format using iCycler iQ PCR plates with Microseal “B”
Film optically clear adhesives (Bio-Rad Laboratories). Thermal cycling was done in an iCycler, and detection was performed by an iCycler iQ Optical Module. Each unknown sample
reaction plate contained duplicate samples and appropriate positive and negative controls for each toxin gene. The PCR reactions were done in 25-µL volumes containing iQ SYBR Green
Supermix (Bio-Rad Laboratories), appropriate forward and reverse primers at a final 0.2µM concentration each with 1 to 10
ng of DNA template and nuclease-free water. Cycling reaction
conditions were those optimized for each individual toxin primer
pair. The real-time cycle threshold (Ct) curves were monitored, and data were collected at the end of each run. Corresponding melting temperature curves were determined for each
sample for PCR product confirmation. The test for the presence of toxin genes was considered positive for an isolate with
a Ct within 6 cycles of control Ct and an appropriate melting
curve. Selected samples were further confirmed by agarose gel
electrophoresis on 4% agarose gels. Control chromosomal DNA
samples were obtained from our standard laboratory controls
(CLP001-eta, CLP007-etb, and CPM003-seb) or strains provided by the Network on Microbial Resistance in S aureus
(NRS384-pvl, -mecA, and -chs [CHIP]; NRS385-hla; NRS383sea and -gyrA; and NRS178-lukD-E).
STATISTICAL ANALYSIS
The prevalence of specific toxin genes associated with the 72
total S aureus isolates from infected skin lesions was calculated without regard to associated WBC counts determined at
the time of culture. The prevalence of the toxin genes carried
by the 61 bacterial isolates from the S aureus only–infected lesions was determined in the low (ⱕ5 WBCs/LPF) and high (⬎5
WBCs/LPF) WBC groups and compared using ␹2 analysis. Significance was defined as P⬍.05.
RESULTS
Staphylococcus aureus, either exclusively or in combination with Streptococcus pyogenes (Lansfield group A streptococci [GAS]), group G streptococci (GGS), or group
C streptococci (GCS) was isolated from 72 of 105 skin
lesions determined to be infected by clinical evaluation
(69%). Sixty-one of these lesions were determined to be
infected with S aureus as a single causative organism
(58%). White blood cell counts on the initial swab specimen taken for culture were determined per LPF for each
lesion. Bacterial isolates were collected and correlated with
the respective WBC count and separated into 2 groups,
those associated with a low WBC count (0-5 WBCs/
LPF) and those associated with a high WBC count (⬎5
WBCs/LPF). The presence or absence of S aureus genes
associated with virulence and with the potential to modulate the host’s immune response were determined by realtime PCR using oligonucleotide primers specific for the
genes of interest, and the results for all S aureus isolates
are reported in eTable 2 (available at http://www
.archdermatol.com). All 72 isolates were analyzed for the
presence of S aureus virulence factor genes associated with
skin infections without consideration of a localized immune response. The numbers of S aureus carrying the
1260
Table. Prevalence of Virulence Factors of Staphylococcus aureus Isolated From Infected Skin Lesions Compared
With Community Prevalence
Prevalence
Source
Larsen et al14 and Dancer and Noble15
Larsen et al14 and Dancer and Noble15
Becker et al16
Prevost et al17
Peacock et al18
Peacock et al18
de Haas et al13
Virulence
Factor
Community,
%
Study, % (No.)
(N = 72)
P
Value
ETA
ETB
SEB
PVL
SEA
TSST
CHIP
5
5
7
2
17
25
62
43 (31)
39 (28)
13 (9)
11 (8)
3 (2)
4 (3)
75 (54)
ⱕ.001
ⱕ.001
.26
.049
.005
ⱕ.001
.11
Abbreviations: CHIP, chemotaxis-inhibiting protein; ETA, exfoliative toxin A; ETB, exfoliative toxin B; PVL, Panton-Valentine leukocidin; SEA, staphylococcal
enterotoxin A; SEB, staphylococcal enterotoxin B; TSST, toxic shock syndrome toxin.
A
Low WBC count
High WBC count
100
90
80
Positive, %
70
60
∗
∗
50
40
∗
30
20
10
0
ETA
ETB
SEB
PVL
SEA
TSST
CHIP
B
Community
Low WBC count
100
90
80
Positive, %
70
60
∗
∗
50
40
30
∗
20
10
0
ETA
ETB
SEB
PVL
SEA
TSST
CHIP
C
100
Community
High WBC count
90
80
70
Positive, %
genes for the exfoliative toxins ETA and ETB and PVL
were increased (P ⬍ .001 for ETA and ETB and P =.049
for PVL) compared with the expected community prevalence, while the numbers of isolates encoding TSST
(P ⬍ .001) and SEA (P = .005) were significantly decreased (Table).13-18 Coding for all other genes showed
no significant difference in prevalence vs that previously reported for each. These data indicate that S aureus associated with skin lesions are more likely to carry
the genes for ETA, ETB, and PVL and less likely to carry
the genes for SEA and TSST.
To determine if an association exists between S aureus virulence factors and the local immune response as
indicated by the number of WBCs in an infected skin lesion, the 61 bacterial isolates from S aureus only–
infected lesions were divided into 2 groups, those associated with low WBC counts and those associated with
high WBC counts and compared. Comparison of the presence of virulence genes carried by the bacteria isolated
from the lesions in the low WBC vs the high WBC group
demonstrated a difference in these bacterial populations (Figure 1A). Staphylococcus aureus capable of producing ETA (P = .006) and ETB (P = .002) were significantly associated with infections with low WBC counts
in the lesions, while those organisms capable of producing PVL (P=.03) were associated with infections with high
WBC counts on initial gram stain of swabs for culture.
Analysis of the low WBC population alone (44 isolates)
showed that the number of S aureus carrying the genes
for ETA and ETB were significantly increased (P⬍.001
for both) in this subset, while the number of isolates encoding SEA (P= .03) were significantly decreased compared with the expected community prevalence Figure 1B.
Similar analysis of the high WBC population alone (17
isolates) revealed no statistically significant differences
in the prevalence of virulence factors in this population
compared with the expected prevalence Figure 1C.
Comparisons of the clinical appearance of individual
skin lesions associated with each WBC subset showed
no apparent differences between the low and high WBC
groups (Figure 2) despite the significant difference in
associated infecting bacterial populations. Physical examination findings of all lesions were consistent with a
significant bacterial skin infection, and so all lesions were
60
50
40
30
20
10
0
ETA
ETB
SEB
PVL
SEA
TSST
CHIP
Virulence Factor
Figure 1. Prevalence of virulence factor genes in Staphylococcus aureus
isolated from infected skin lesions as determined by real-time polymerase chain
reaction analysis for 61 total bacterial isolates and divided into 44 isolates
associated with low white blood cell (WBC) count and 17 isolates associated
with high WBC count on initial culture. A, Prevalence for low WBC count group
vs high WBC count group. B, Prevalence for low WBC count group vs
community. C, Prevalence for high WBC count group vs community. *P⬍.05.
1261
COMMENT
A
CPM010
B
CPM044
C
CPM015
Figure 2. Representative Staphylococcus aureus–infected skin lesions.
A, Lesion infected with isolate CPM010 contained no white blood cells (WBCs)
in the low-power field (LPF) and was positive for exfoliative toxins A and B (ETA
and ETB). B, Lesion infected with isolate CPM044 contained more than 100
WBCs/LPF and was negative for ETA, ETB, and Panton-Valentine leukocidin
(PVL). C, Lesion infected with isolate CPM015 contained more than 100
WBCs/LPF and was positive for PVL and toxic shock syndrome toxin.
selected for culture and gram staining. Of the 105 total
lesions sampled, 21 (20%) failed to have any associated
bacteria by culture. Of the 80% of bacteria-positive lesions, 85% grew S aureus either alone or in combination
with a Streptococcus species. Overall, of the skin lesions
identified clinically as infected, 69% (n = 72) were associated with growth of any S aureus, and 58% (n=61) were
infected exclusively with S aureus.
Staphylococcus aureus is a common cause of local skin infections as well as many other serious infections. Infections caused by S aureus have been linked to a number of
potential virulence factors made by the organism. These
associations range from superficial skin infections such as
bullous impetigo, associated with ETA and ETB, to the multiple-organ system failure associated with toxic shock syndrome and the organisms capable of making TSST. Many
of the toxins and virulence factors of S aureus are known
to have effects on the immune response, either directly by
lysing WBCs (as in the actions of leukotoxins such as PVL)
or indirectly by the actions of superantigens (such as TSST
and several enterotoxins) stimulating the release of abnormally high concentrations of cytokines and chemokines and
potentially leading to multiple-organ system failure. Other
virulence factors (eg, CHIP and Staphylococcus complement inhibitor13,19) function to prevent the influx of WBCs
into an infected site.8
In the present study we describe for the first time to our
knowledge a direct association between the number of
WBCs in a local skin infection and the toxin genes that the
infecting S aureus carry. In this population taken as a whole,
and as has been previously reported,6,7 there is a significant association of exfoliative toxin genes and pvl with skin
infections. In addition, we demonstrate for the first time
to our knowledge that this association can be categorized
into 2 distinct infection groups: those with few to no WBCs
in the skin lesions at the time the bacterial cultures were
obtained (ⱕ5 WBCs/LPF) and those with many WBCs associated with the lesions. We determined that the lesions
with the fewest WBCs were more likely to be infected with
S aureus capable of producing ETA or ETB, while the lesions with the most WBCs were more likely to be infected
with an organism capable of producing PVL.
Comparisons of the physical appearance of the lesions
associated with each WBC subset showed no apparent differences between the low WBC and high WBC groups. The
appearances of all lesions were determined to be consistent with significant infections when the initial lesions were
chosen for obtaining swabs for culture, and therefore appearance alone is not a good indicator of inflammatory cell
involvement. Common dogma holds that for a superficial
bacterial skin infection to be deemed significant it must be
associated with a high WBC count from the lesion at the
time the bacterial cultures are obtained.20 Findings of the
present study indicate that the particular bacterial population involved in an infection might contribute greatly to
the severity and quality of the local immune response and
that the population of infecting bacteria with its associated repertoire of potential virulence factors contributes to
the robustness of the immune response.
The relationship between the genes encoding ETA and
ETB and the lack of WBCs in some of the lesions is not
understood, and the exact mechanisms by which these toxins may be acting to either eliminate WBCs from the lesions or prevent their accumulation is likewise not known.
The action of the exfoliative toxins to cause exfoliation of
the skin by the cleavage of the cadherin family member
protein desmoglein 1,21 thereby disrupting the desmosome
1262
and destroying the cell-cell integrity in the upper epidermis, does not directly explain these findings. However, cadherin family member proteins are involved in a variety of
cell signaling processes.22-24 It is possible that the cleavage of desmoglein 1 is directly or indirectly involved in
modifying the signaling pathways that affect the local immune response. It has also been shown that ETA is capable
of stimulating a specific population of murine T cells,25
which could also contribute to cytokine release and affect
the local immune response.
An additional possibility is that the associated toxin genes
and their products are not involved at all but serve as genetic markers for other virulence factors that are responsible. Such a situation exists for PVL and its association with
necrotizing infections: under certain conditions it is clearly
a major virulence factor contributing to disease,26 while in
other infections it serves as a genetic marker for other virulence factors or specific bacterial populations.27 Given that
these bacteria have the potential to express a number of
immunomodulating factors,8 we argue that the measurement of the local immune response (WBC count) is not
always an accurate estimate of the seriousness of an infection—a significant infection can exist without local infiltration of large numbers of WBCs. These findings warrant
further testing using well-defined bacterial populations and
controlled animal models.
Accepted for Publication: July 1, 2007.
Corresponding Author: Lisa R. W. Plano, MD, PhD, University of Miami, Leonard M. Miller School of Medicine,
Department of Microbiology and Immunology, RMSB
3066 (R-138), 1600 NW 10th Ave, Miami, FL 33136
([email protected])
Author Contributions: Ms Mertz and Dr Plano had full
access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the
data analysis. Study concept and design: Mertz and Plano.
Acquisition of data: Cardenas, Snyder, Kinney, Davis, and
Plano. Analysis and interpretation of data: Mertz, Cardenas,
Snyder, and Plano. Drafting of the manuscript: Mertz and
Plano. Critical revision of the manuscript for important intellectual content: Davis and Plano. Statistical analysis:
Cardenas and Plano. Obtained funding: Plano. Administrative, technical, or material support: Cardenas. Study supervision: Mertz, Davis, and Plano.
Funding/Support: This study was supported in part by
National Institutes of Health grant AR048882 and the National Institute of Arthritis and Musculoskeletal and Skin
Disease grant R01-AR04882 (Dr Plano).
Additional Information: eTable 1 and eTable 2 are available at http://www.archdermatol.com.
Additional Contributions: Yvette Piovanetti, MD, Maria
D. Ordriozola, MD, Kamara Mertz-Rivera, MS, CCRC,
and Juan B Rivera, AA, collected the clinical samples.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
REFERENCES
1. Lowy FD. Staphylococcus aureus infections. N Engl J Med. 1998;339(8):
520-532.
2. Diep BA, Carleton HA, Chang RF, Sensabaugh GF, Perdreau-Remington F. Roles
of 34 virulence genes in the evolution of hospital- and community-associated
26.
27.
1263
strains of methicillin-resistant Staphylococcus aureus. J Infect Dis. 2006;193
(11):1495-1503.
Arbuthnott JP, Coleman DC, de Azavedo JS. Staphylococcal toxins in human
disease. Soc Appl Bacteriol Symp Ser. 1990;19:101S-107S.
Gillet Y, Issartel B, Vanhems P, et al. Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet. 2002;359(9308):
753-759.
Lina G, Piemont Y, Godail-Gamot F, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and
pneumonia. Clin Infect Dis. 1999;29(5):1128-1132.
Capoluongo E, Giglio AA, Lavieri MM, et al. Genotypic and phenotypic characterization of Staphylococcus aureus strains isolated in subjects with atopic dermatitis. Higher prevalence of exfoliative B toxin production in lesional strains and
correlation between the markers of disease intensity and colonization density.
J Dermatol Sci. 2001;26(2):145-155.
Lina G, Gillet Y, Vandenesch F, Jones ME, Floret D, Etienne J. Toxin involvement
in staphylococcal scalded skin syndrome. Clin Infect Dis. 1997;25(6):1369-1373.
Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol. 2005;3(12):
948-958.
Jarraud S, Mougel C, Thioulouse J, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70(2):631-641.
Jarraud S, Cozon G, Vandenesch F, Bes M, Etienne J, Lina G. Involvement of
enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet fever. J Clin Microbiol. 1999;37(8):2446-2449.
Sharma NK, Rees CE, Dodd CE. Development of a single-reaction multiplex PCR
toxin typing assay for Staphylococcus aureus strains. Appl Environ Microbiol.
2000;66(4):1347-1353.
Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of
structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2002;46(7):2155-2161.
de Haas CJ, Veldkamp KE, Peschel A, et al. Chemotaxis inhibitory protein of Staphylococcus aureus, a bacterial antiinflammatory agent. J Exp Med. 2004;199
(5):687-695.
Larsen HD, Aarestrup FM, Jensen NE. Geographical variation in the presence of
genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA. Vet Microbiol.
2002;85(1):61-67.
Dancer SJ, Noble WC. Nasal, axillary, and perineal carriage of Staphylococcus
aureus among women: identification of strains producing epidermolytic toxin.
J Clin Pathol. 1991;44(8):681-684.
Becker K, Friedrich AW, Lubritz G, Weilert M, Peters G, Von Eiff C. Prevalence of
genes encoding pyrogenic toxin superantigens and exfoliative toxins among strains
of Staphylococcus aureus isolated from blood and nasal specimens. J Clin
Microbiol. 2003;41(4):1434-1439.
Prevost G, Bouakham T, Piemont Y, Monteil H. Characterisation of a synergohymenotropic toxin produced by Staphylococcus intermedius. FEBS Lett. 1995;
376(3):135-140.
Peacock SJ, Moore CE, Justice A, et al. Virulent combinations of adhesin and
toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;
70(9):4987-4996.
Rooijakkers SH, Ruyken M, Roos A, et al. Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases. Nat Immunol. 2005;6(9):920-927.
Wagner C, Iking-Konert C, Hug F, et al. Cellular inflammatory response to persistent localized Staphylococcus aureus infection: phenotypical and functional
characterization of polymorphonuclear neutrophils (PMN). Clin Exp Immunol.
2006;143(1):70-77.
Amagai M, Matsuyoshi N, Wang ZH, Andl C, Stanley JR. Toxin in bullous impetigo and staphylococcal scalded-skin syndrome targets desmoglein 1. Nat Med.
2000;6(11):1275-1277.
Dusek RL, Godsel LM, Green KJ. Discriminating roles of desmosomal cadherins: beyond desmosomal adhesion. J Dermatol Sci. 2007;45(1):7-21.
Chernyavsky AI, Arredondo J, Kitajima Y, Sato-Nagai M, Grando SA. Desmoglein versus nondesmoglein signaling in pemphigus acantholysis: characterization of novel signaling pathways downstream of pemphigus vulgaris antigens.
J Biol Chem. 2007;282(18):13804-13812.
Berkowitz P, Hu P, Liu Z, et al. Desmosome signaling: inhibition of p38MAPK
prevents pemphigus vulgaris IgG-induced cytoskeleton reorganization. J Biol Chem.
2005;280(25):23778-23784.
Monday SR, Vath GM, Ferens WA, et al. Unique superantigen activity of staphylococcal exfoliative toxins. J Immunol. 1999;162(8):4550-4559.
Labandeira-Rey M, Couzon F, Boisset S, et al. Staphylococcus aureus PantonValentine leukocidin causes necrotizing pneumonia. Science. 2007;315(5815):
1130-1133.
Voyich JM, Otto M, Mathema B, et al. Is Panton-Valentine leukocidin the major
virulence determinant in community-associated methicillin-resistant Staphylococcus aureus disease? J Infect Dis. 2006;194(12):1761-1770.
WEB-ONLY CONTENT
eTable 1. Virulence Factors With Corresponding Sequences of Oligonucleotide Primers and Melting Temperatures
Used for Real-Time PCR Determination of the Presence of the Corresponding Genes From Staphylococcus aureus
Isolated From Infected Skin Lesions
Factor
Primer Designation
HLA
HLA-F-RT-1
HLA-R-RT-1
LUKS-PV-F-RT-1
LUKS-PV-R-RT-1
LUKD-E-1
LUKD-E-2
ETA-1
ETA-2
ETB-F-RT-1
ETB-R-RT-1
SEA-F-RT-1
SEA-R-RT-1
SA-U-F
SA-B R-seb
TSST-F-RT-1
TSST-R-RT-1
CHIP-RT-R1
CHIP RT-AS
MECA P4
MECA P7
gyrA-F-RT-1
gyrA-R-RT-1
PVL
LukD-E
ETA
ETB
SEA
SEB
TSST
CHIP
mecA
gyrA
Sequence (5ⴕ→3ⴕ)
TCTGATTACTATCCAAGAAATTCG
ATATTTCAGTGTATGACCAATC
TGTGCCAGACAATGAATTACC
ACATCCATATTTCTGCCATACG
TGAAAAAGGTTCAAAGTTGATACGAG
TGTATTCGATAGCAAAAGCAGTGCA
CTAGTGCATTTGTTATTCAA
TGCATTGACACCATAGTACT
TACTGAGGTAGGAAACTCTGG
AAACACTCCTATTGGAAGATTATG
GGAGTTGGATCTTCAAGCAAG
AGGTTCTGTAGAAGTATGAAACAC
TGTATGTATGGAGGTGTAAC
ATAGTGACGAGTTAGGTA
ACCCCTGTTCCCTTATCATC
CTTCACTATTTGTAAAAGTGTCAG
GAAATTAGCAACAACAGTTTTAGC
CTTCATTTGTAGGAAACGGTTC
TCCAGATTACAACTTCACCAGG
CCACTTCATATCTTGTAACG
TGCTGAGTTAATGGAGGATATTG
CACGTCTAATACCACTCTTACC
Melting Temp, °C
Source
55
Present study
53.3
Present study
55
Jarraud et al9
53.3
Jarraud et al10
55
Present study
55
Present study
53.3
Sharma et al11
55
Present study
55
Present study
55
Oliveira and de Lencastre12
50
Present study
Abbreviations: CHIP, chemotaxis-inhibiting protein; ETA, exfoliative toxin A; ETB, exfoliative toxin B; gyrA, gyrase; HLA, ␣-hemolysin; LukD-E, leukocidin D-E;
mecA, methicillin resistance; PCR, polymerase chain reaction; PVL, Panton-Valentine leukocidin; SEA, staphylococcal enterotoxin A; SEB, staphylococcal
enterotoxin B; temp, temperature; TSST, toxic shock syndrome toxin.
E1
WEB-ONLY CONTENT
eTable 2. Gene Distribution in Staphylococcus aureus From Infected Skin Lesions a
CPM
CPM002
CPM003
CPM007
CPM009
CPM010
CPM011
CPM012
CPM017
CPM020
CPM025
CPM028
CPM038
CPM043
CPM049
CPM050
CPM055
CPM056
CPM057
CPM058
CPM061
CPM062
CPM063
CPM069
CPM070
CPM071
CPM072
CPM073
CPM076
CPM084
CPM085
CPM022
CPM024
CPM027
CPM029
CPM030
CPM036
CPM079
CPM031
CPM034
CPM035
CPM039
CPM041
CPM045
CPM048
CPM065
CPM066
CPM081
CPM004
CPM032
CPM042
CPM053
CPM005
CPM021
CPM026
CPM047
CPM067
CPM083
CPM001
CPM033
CPM077
WBC
hla
(HLA)
pvl
(PVL)
luk D-E
(LukD-E)
eta
(ETA)
etb
(ETB)
sea
(SEA)
seb
(SEB)
tst
(TSST)
chs
(CHIP)
mecA
gyrA
Bacteria
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
0-2/LPF
0-2/LPF
0-2/LPF
0-2/LPF
0-2/LPF
0-2/LPF
0-2/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
3-5/LPF
5-10/LPF
5-10/LPF
5-10/LPF
5-10/LPF
10-20/LPF
10-20/LPF
10-20/LPF
10-20/LPF
10-20/LPF
10-20/LPF
20-30/LPF
20-30/LPF
20-30/LPF
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
POS
POS
NEG
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
NEG
NEG
POS
POS
NEG
NEG
POS
POS
POS
POS
NEG
NEG
NEG
POS
NEG
POS
POS
NEG
POS
POS
NEG
POS
POS
POS
POS
POS
NEG
POS
NEG
NEG
POS
NEG
NEG
NEG
POS
NEG
NEG
POS
POS
POS
POS
POS
POS
NEG
POS
NEG
POS
NEG
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
POS
POS
POS
NEG
NEG
POS
POS
POS
POS
POS
NEG
POS
NEG
NEG
POS
POS
NEG
POS
POS
NEG
POS
NEG
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
POS
POS
POS
POS
NEG
NEG
NEG
POS
POS
POS
POS
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
POS
NEG
NEG
NEG
POS
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
POS
NEG
POS
POS
POS
POS
NEG
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
NEG
NEG
POS
NEG
NEG
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
POS
POS
POS
POS
NEG
NEG
POS
POS
POS
POS
NEG
POS
NEG
NEG
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
POS
NEG
NEG
NEG
POS
NEG
NEG
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
S
S
S
S
S
S
S
S
S
S
S
S
S
S/GGS
S
S
S
S
S
S
MGCS
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
MGGS
S
S
S
S
S
MGAS
S
MGAS
S
S
S
S
S
S
S
MGAS
S
S
(continued)
E1
eTable 2. Gene Distribution in Staphylococcus aureus from Infected Skin Lesions a (cont)
CPM
CPM037
CPM080
CPM013
CPM014
CPM016
CPM018
CPM054
CPM075
CPM015
CPM023
CPM044
CPM051
WBC
hla
(HLA)
pvl
(PVL)
luk D-E
(LukD-E)
eta
(ETA)
etb
(ETB)
sea
(SEA)
seb
(SEB)
tst
(TSST)
chs
(CHIP)
mecA
gyr A
Bacteria
30-40/LPF
30-40/LPF
50-75/LPF
50-75/LPF
50-75/LPF
50-75/LPF
50-75/LPF
50-75/LPF
⬎ 100/LPF
⬎ 100/LPF
⬎ 100/LPF
⬎ 100/LPF
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
POS
NEG
NEG
POS
POS
POS
POS
POS
POS
POS
POS
NEG
POS
POS
NEG
NEG
POS
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
NEG
POS
POS
NEG
NEG
NEG
NEG
NEG
NEG
POS
NEG
POS
NEG
NEG
NEG
NEG
POS
POS
POS
NEG
POS
POS
POS
POS
POS
NEG
POS
NEG
NEG
NEG
NEG
POS
NEG
NEG
NEG
NEG
POS
NEG
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
POS
S
S
MGAS
S
S
S
MGAS
MGAS
MGAS
MGAS
S
S
Abbreviations: CHIP, chemotaxis-inhibiting protein; CPM, letter designation for this bacterial population; ETA, exfoliative toxin A; ETB, exfoliative toxin B;
GGS, group G streptococci; gyrA, gyrase; HLA, ␣-hemolysin; LPF, low-power field; LukD-E, leukocidin D-E; mecA, methicillin resistance; MGAS, multiple
organisms group A streptococci; MGCS, multiple organisms group C streptococci; MGGS, multiple organisms group G streptococci; NEG, negative findings;
POS, positive findings; PVL, Panton-Valentine leukocitlin; S, Staphylococcus aureus; SEA, staphylococcal enterotoxin A; SEB, staphylococcal enterotoxin B; TSST
Toxic shock syndrome toxin; WBC, white blood cell count.
a
Yellow indicates low WBC count; blue, high WBC; green, gene presence; red, gene absence.
E2
STUDY
Wound Complications Following Diagnostic Skin
Biopsies in Dermatology Inpatients
Shyamal Wahie, MB, MRCP; Clifford M. Lawrence, MD, FRCP
Objectives: To prospectively determine the wound complication rate for dermatology inpatients undergoing diagnostic skin biopsies during their admission and to determine significant host and procedural risk factors.
Design: Prospective assessment, by a single observer,
of 100 postdiagnostic skin biopsy wounds in dermatology inpatients. The following data were recorded for each
patient: age and sex, presence of comorbidities, smoking status, dermatologic diagnosis, use of immunosuppressive or antibiotic therapy, place of biopsy (whether
in the operation theater or in the ward), grade of physician performing biopsy, biopsy site on the body, type of
biopsy (whether elliptical incision, punch, shave, or curettage), and wound closure technique.
Main Outcome Measure: Wounds were designated
as having had no complication or as being complicated
by infection, dehiscence, and/or hematoma.
Setting: A dedicated dermatology inpatient ward in a
university teaching hospital.
Results: Wound complications occurred in 29 (29%) bi-
opsies, 27 (93%) of which were the result of wound infection. Complications occurred significantly more frequently when biopsies were performed below the waist
compared with above the waist (P⬍.02), in the ward compared with the outpatient operating theater (P ⬍.001),
in smokers compared with nonsmokers (P⬍.001), and
in those taking corticosteroids compared with those who
were not (P ⬍.001). In addition, elliptical incisional biopsies developed complications more frequently when
subcutaneous sutures were not used compared with when
they had been used (P⬍ .001).
Conclusions: This study has demonstrated a high rate
of wound complications after diagnostic dermatologic surgery on dermatology inpatients with significant host and
procedural risk factors. These findings are relevant for
other centers with inpatient units where diagnostic biopsies are performed.
Arch Dermatol. 2007;143(10):1267-1271
D
Department of Dermatology,
Royal Victoria Infirmary,
Newcastle upon Tyne, England.
ERMATOLOGISTS REGU larly perform diagnostic
skin biopsies on outpatients, inpatients, and
day-case patients.1-9 Multiple risk factors can influence the risk of
postoperative wound complications.5-9 Although published information exists regarding the complications of skin surgery in an outpatient setting,5-9 there is no
information describing the complications of diagnostic skin biopsies for an inpatient population. In our center, it was
noted that wound infection was a common complication among inpatients undergoing skin biopsy as part of their diagnostic workup. The aim of the present
study was to prospectively determine the
wound complication rate for dermatology inpatients undergoing diagnostic skin
biopsies during their admission, and to determine significant host and procedural
risk factors.
1267
METHODS
The study protocol was reviewed and approved by an independent review board and
all study participants gave oral consent.
WARD AND STUDY POPULATION
The prospective study took place in the dermatology ward of the Newcastle-upon-Tyne
Hospitals National Health Service Trust between January 15 and September 15, 2006. The
ward is a 16-bed unit for adult patients with
dermatologic disease, with dedicated cubicles
for those colonized with methicillin-resistant
Staphylococcus aureus (MRSA). Patients are admitted either electively or on an emergency basis after consultation with a dermatologist.
SURVEILLANCE
All dermatology inpatients who underwent diagnostic incisional and excisional skin biopsies during their hospital admission were prospectively assessed for postoperative wound
complications. Diagnostic skin biopsies surveyed included elliptical incisions, punch incisions, shave biopsies, or curettage and cautery.
The following data were recorded by the operating physician for each patient: age and sex, presence of comorbidities
(diabetes mellitus, MRSA, leg edema, obesity), smoking status, dermatologic diagnosis, and the use of immunosuppressive or antibiotic therapy at the time of the biopsy.
The following procedural data were also recorded: place of
biopsy (whether in an examination room in the dermatology
ward or in a dedicated outpatient operation theater), grade of
physician performing biopsy (whether senior house officer, specialist registrar, or consultant), biopsy site on the body, type
of biopsy (whether elliptical incision, punch, shave, or curettage), wound closure technique, and whether senior advice was
given to the operating physician (on the type or site of biopsy
or on wound closure).
One of us (S.W.) inspected and assessed each postoperative wound every 3 days until hospital discharge. Wounds were
designated as having had either no complications or complications classified as wound infection (manifested by erythema, edema, warmth, and discharge of pus), wound dehiscence, and/or hematoma.
Medical notes, microbiology reports, temperature, and treatment charts were also reviewed. At discharge, the dermatologist recorded whether the wound site had reepithelialized or
required ongoing treatment in the community. Wounds were
not routinely surveyed after discharge.
Biopsies were performed in a dedicated examination
room in the dermatology ward using a portable biopsy
kit in 34 cases and in 1 of 3 dedicated outpatient operation theaters in the remaining 66 cases. The grade of physician carrying out the diagnostic biopsy included a senior house officer in the first month of dermatology
training (23 biopsies), a senior house officer in the second to fourth month of dermatology training (55 biopsies), a specialist registrar with more than 24 months’ experience (18 biopsies), and a consultant (4 biopsies). Of
the 100 biopsies, 75 were performed on sites above the
waist (57 on the arm, 10 on the back, 5 on the chest, and
3 on the head and neck) and 25 were performed on sites
below the waist (21 on the leg and 4 on the groin and
genitals).
Fifty-six procedures were punch biopsies, 40 were elliptical incisions, 3 were shave biopsies, and 1 was a curettage. All punch and elliptical incisional biopsies were
closed with interrupted surface sutures, but subcutaneous sutures were only used in 13 (33%) of the elliptical
biopsies. The operating physicians indicated that senior
advice, on either the type or site of biopsy or wound closure technique, was given in 35 of 90 cases. In 10 cases,
these data were missing.
Wound complications occurred in 29 of the 100 diagnostic biopsies performed. Twenty-two wounds demonstrated clinical signs of infection alone, 2 of dehiscence
alone, and 5 had signs of both infection and dehiscence.
No wounds were complicated by hematoma.
In the 27 cases in which infection was clinically evident, positive bacterial isolates from wound swabs were
isolated in 24 (S aureus in 15, Streptococcus species in 4,
and MRSA in 5 cases). Of the 5 patients with MRSA wound
infections, 4 were colonized with MRSA on admission.
Twelve biopsies (6 ellipses and 6 punches) were performed on patients already taking antibiotics, of which
half subsequently developed wound infections.
All 27 patients with wound infections were treated with
topical and oral antibiotics according to the sensitivities
from wound swabs. Consequently, 2 developed abnormal liver function, 2 developed noninfectious diarrhea;
all 4 patients experienced a delay in their discharge. At
discharge, 4 of 29 wounds that had developed a complication after the procedure still required treatment in the
community.
The Table records the univariate analysis findings on
the incidence and characteristics associated with all wound
complications. Wound complications occurred significantly more frequently when biopsies were performed
below the waist compared with above the waist (48% vs
23%, 95% confidence interval [CI] for difference, 36%47%; P ⬍ .02); in the ward compared with the outpatient operation theater (53% vs 17%, 95% CI for difference, 17%-55%; P ⬍ .001); in smokers compared with
nonsmokers (64% vs 12%, 95% CI for difference, 34%70%; P⬍.001); and in those taking corticosteroids compared with those who were not (63% vs 21%, 95% CI for
difference, 19%-66%; P ⬍ .001). In addition, elliptical
incisional biopsies developed complications more fre-
A binomial test of 2 proportions was used to determine if independent variables were significantly associated with the development of wound complication. A multivariate analysis using
binomial logistic regression was performed (using SPSS software version 12 [SPSS Inc, Chicago, Illinois]). All variables were
fitted into a multivariate model and kept if they remained significantly associated with wound complication after adjusting
for other factors in the model.
RESULTS
A total of 301 patients were admitted to the dermatology ward during the 8-month survey period and 75 of
these patients (40 men and 35 women; median age, 62
years; range, 18-94 years) had a total of 100 diagnostic
biopsies.
Twenty of the 100 diagnostic biopsies were performed on patients with diabetes, 22 on individuals colonized with MRSA, 5 on those with leg edema, 4 on obese
individuals, 33 on smokers, and 19 on patients taking
prednisolone at a dosage of more than 0.5 mg/kg/d. Twelve
biopsies were performed on patients taking oral floxacillin or amoxicillin, which had been prescribed by their
general practitioner before admission.
The dermatologic diagnosis was defined at the end of
a patient’s admission. Twenty-eight biopsies were performed on patients with autoimmune blistering diseases, such as bullous pemphigoid (n = 23), pemphigus
(n=3), and linear IgA disease (n = 2). The remainder of
the biopsies were performed for nonblistering conditions, such as eczema (n = 29), psoriasis (n = 25), leukocytoclastic vasculitis (n = 9), drug-induced eruptions
(n=5), skin cancers (n = 3), and lymphoma (n =1).
POSTBIOPSY WOUND COMPLICATIONS
1268
Table. Univariate Analysis of Characteristics Associated With Wound Complications
P Value
Biopsy Sample
Biopsy site
Below waist
Above waist
Biopsy location
In ward
In outpatient operation theater
Grade of physician
Senior house officer (1st month of training)
Senior house officer (2nd to 4th month of training)
Senior house officer (all)
Specialist registrar and consultant
Elliptical biopsy
Without subcutaneous sutures
With subcutaneous sutures
Smoking status
Smoker
Nonsmoker
Corticosteroid therapy
Yes
No
Advice to operator
No senior advice
Senior advice
Age, y
ⱖ60
⬍60
MRSA
Positive
Negative
Diabetes mellitus
Yes
No
Blistering disease
Yes
No
Obese
Yes
No
Antibiotic therapy
Yes
No
Sex
Male
Female
Leg edema
Present
Absent
95%
Confidence
Interval for
Difference
Test for
Difference
Fisher
Exact Test
(for Small
Samples)
0.48
0.23
0.04 to 0.47
.02
NA
34
66
0.53
0.17
0.17 to 0.55
⬍.001
NA
11
15
23
55
0.48
0.27
−0.03 to 0.44
.09
NA
26
3
78
22
0.33
0.14
0.02 to 0.37
.03
.11
19
2
27
13
0.70
0.15
0.29 to 0.81
⬍.001
.002
21
8
33
67
0.64
0.12
0.34 to 0.70
⬍.001
NA
12
17
19
81
0.63
0.21
0.19 to 0.66
⬍.001
NA
19
9
55
35
0.35
0.26
−0.10 to 0.28
.37
NA
25
4
80
20
0.31
0.20
−0.09 to 0.32
.28
.42
5
4
22
78
0.23
0.31
−0.28 to 0.12
.44
NA
3
26
20
80
0.15
0.33
−0.36 to 0.01
.07
.17
11
18
28
72
0.39
0.25
−0.07 to 0.35
.20
NA
2
27
4
96
0.50
0.28
−0.28 to 0.72
.39
.58
6
23
12
88
0.50
0.26
−0.06 to 0.54
.12
NA
15
14
45
55
0.33
0.26
−0.10 to 0.26
.39
NA
1
28
5
95
0.20
0.30
−0.46 to 0.27
.61
NA
No. of Wound
Complications
(n = 29)
No. of
Biopsies
(n= 100)
12
17
25
75
18
11
Sample
Proportions
Abbreviations: MRSA, methicillin-resistant Staphylococcus aureus; NA, not available.
quently when subcutaneous sutures were not used compared with when they had been used (70% vs 15%, 95%
CI for difference, 29%-81%; P ⬍ .001). Biopsies performed by senior house officers developed wound complications more frequently than those performed by specialist registrars and consultants (33% vs 14%, 95% CI
for difference, 19%-37%) but the Fisher exact test did
not show this difference to be statistically significant
(P=.11).
No statistically significant correlations were demonstrated between wound complication and the age or sex
of the patient, comorbidities (ie, MRSA, diabetes, leg
edema, obesity) or dermatologic diagnosis. Similarly,
no links were established between complications occurring and the provision of senior advice or the use of
antibiotics.
Multivariate analysis by logistic regression did not demonstrate any single variable that was a significant risk fac-
1269
tor for wound complications. This is likely to be explained by the low number of trial events (n=29) and the
large number of variables being investigated.
COMMENT
To our knowledge, this is the first study describing the
incidence and risk factors for wound complications after diagnostic skin biopsies in a dermatology inpatient
population.
We have shown that 29 (29%) diagnostic biopsies performed on inpatients resulted in a postoperative complication, 27 (93%) of which were due to wound infection. All the infections resulted in the need for antibiotics
and their use led to a delay in discharge in 4 (15%) treated
patients.
Univariate analysis demonstrated that cigarette smoking and the use of corticosteroids appeared to be the most
significant host risk factors contributing to the development of wound complications. The most significant procedural risk factors for wound complication were biopsy sites below the waist, performing the biopsy in the
ward rather than in the operation theater, and not using
subcutaneous sutures after elliptical procedures.
Logistic regression analysis showed no single significant risk factor, possibly because only 29 wound complications were identified. A larger study including more
complications might have increased the power of the
analysis.
Data were not collected on the duration of the biopsy
procedure or on the use of antiplatelet or anticoagulant
therapy; these factors may have also been relevant to the
development of wound complications.6
Smoking has been shown to be an important risk factor for wound complications after mastectomy,10 abdominoplasty,11 and full-thickness skin grafts,12 with heavy
smokers being most at risk. Nicotine in cigarette smoke
is a vasoconstrictor that causes tissue ischemia and impairs healing of injured tissue.13 Amici et al6 noted a significant association between immunosuppressants and
wound complications after excisional dermatologic surgery, but did not specify which immunosuppressant drugs
were involved.
Our study investigated wound complications solely associated with diagnostic skin biopsies. Previous authors have
concentrated predominantly on the complications of excisional surgery (eg, for melanomas and nonmelanoma skin
cancers) performed in an outpatient department setting.5,7-9,14 Dermatology inpatients differ significantly from
outpatients in that inpatients are more likely to have widespread skin disease possibly colonized with S aureus to be
systemically unwell, and to require intensive topical therapy
and observation.2 It is, therefore, not surprising that the rate
of infectious complications in these studies of excisional
surgery is far lower than in our present study.5 The preoperative state of the skin is clearly important. Weatherhead and Lawrence8 previously demonstrated (in a prospective case-control study of day-case patients) that 17%
developed wound infection after excisional surgery when
the overlying skin was ulcerated before surgery compared
with 4% when the skin was intact.
Dettenkofer et al15 surveyed nosocomial infections in
dermatology inpatients. Although their study did not describe any inpatients having diagnostic procedures, 7.6%
of the inpatients who underwent basal cell carcinoma excision (in an operation theater setting) developed a wound
infection. In the present study, 17% of inpatients (11 of
66) developed a wound infection when the biopsy was
performed in an outpatient theater setting compared with
53% of inpatients (18 of 34) who had their biopsies in
the ward.
There is still no universal consensus regarding recommendations for antibiotic prophylaxis to prevent
wound infection in dermatologic surgery.16 In our study,
50% of procedures (6 of 12) performed with the administration of penicillin were still complicated with clinical and microbiologic evidence of infection. This suggests that the use of antibiotics was not fully effective in
preventing wound infection.
Dermatologists aim to provide high-quality care for
their patients, which includes the ability to perform diagnostic skin biopsies with minimal complications.17
Consequently, our findings have altered diagnostic biopsy practices in our own department. We now recommend that diagnostic biopsies on inpatients be performed on sites above the waist and in an outpatient
department wherever possible. Smokers and those taking oral corticosteroids should be warned about an increased risk of postbiopsy complications. Consideration
for the use of subcutaneous sutures in wound closure is
important.
CONCLUSIONS
Our study has demonstrated a high rate of wound complications after diagnostic dermatologic surgery performed on inpatients with significant host and procedural risk factors. These findings may be relevant for other
regional centers with inpatient units in which diagnostic biopsies are frequently performed by junior physicians. Further larger studies will be necessary to confirm these results and establish local (and possibly even
national) guidelines regarding diagnostic biopsies in dermatology inpatients.
Correspondence: Shyamal Wahie, MB, MRCP, Department of Dermatology, Royal Victoria Infirmary, Queen
Victoria Road, Newcastle upon Tyne NE1 4LP, England
([email protected]).
Author Contributions: Study concept and design: Wahie
and Lawrence. Acquisition of data: Wahie. Analysis and
interpretation of data: Wahie and Lawrence. Drafting of
the manuscript: Wahie and Lawrence. Critical revision of
the manuscript for important intellectual content: Wahie and
Lawrence. Statistical analysis: Wahie. Study supervision:
Lawrence.
Additional Contributions: Tom Chadwick, PhD, Institute of Health and Society, Newcastle University, gave
advice on analysis of data.
1270
REFERENCES
1. Ayyalaraju RS, Finlay AY, Dykes PJ, Trent JT, Kirsner RS, Kerdel FA. Hospitalization for severe skin disease improves quality of life in the United Kingdom and
the United States: a comparative study. J Am Acad Dermatol. 2003;49(2):249254.
2. Helbling I, Muston HL, Ferguson JE, McKenna M. Audit of admissions to dermatology beds in Greater Manchester. Clin Exp Dermatol. 2002;27(6):519522.
3. Ayyalaraju RS, Finlay AY. Inpatient dermatology: United Kingdom and United States
similarities: moving with the times or being relegated to the back bench? Dermatol Clin. 2000;18(3):397-404.
4. Munro CS, Lowe JG, McLoone P, White MI, Hunter JA. The value of in-patient
dermatology: a survey of in-patients in Scotland and Northern England. Br J
Dermatol. 1999;140(3):474-479.
5. Futoryan T, Grande D. Postoperative wound infection rates in dermatologic surgery.
Dermatol Surg. 1995;21(6):509-514.
6. Amici JM, Rogues AM, Lashera A, et al. A prospective study of the incidence of
complications associated with dermatological surgery. Br J Dermatol. 2005;
153(5):967-971.
7. Fernández-Jorge B, Peña-Penabad C, Vieira V, et al. Outpatient dermatology major surgery: a 1-year experience in a Spanish tertiary hospital. J Eur Acad Dermatol Venereol. 2006;20(10):1271-1276.
8. Weatherhead SC, Lawrence CM. Preoperative skin surface condition as a predictor of postoperative wound infection. Br J Dermatol. 2004;151(suppl 68):92.
9. Cook JL, Perone JB. A prospective evaluation of the incidence of complications
associated with Mohs micrographic surgery. Arch Dermatol. 2003;139(2):
143-152.
10. Sorensen LT, Horby J, Friis E, Pilsgaard B, Jørgensen T. Smoking as a risk factor for wound healing and infection in breast cancer surgery. Eur J Surg Oncol.
2002;28(8):815-820.
11. Manassa EH, Hertl CH, Olbrisch RR. Wound healing problems in smokers and
nonsmokers after 132 abdominoplasties. Plast Reconstr Surg. 2003;111(6):
2082-2087.
12. Goldminz D, Bennett RG. Cigarette smoking and flap and full-thickness graft
necrosis. Arch Dermatol. 1991;127(7):1012-1015.
13. Silverstein P. Smoking and wound healing. Am J Med. 1992;93(1A):22S-24S.
14. Lawrence CM, Comaish JS, Dahl MG. Excision of skin tumours without wound
closure. Br J Dermatol. 1986;115(5):563-571.
15. Dettenkofer M, Wilson C, Ebner W, Norgauer J, Rüden H, Daschner FD. Surveillance of nosocomial infections in dermatology patients in a German university
hospital. Br J Dermatol. 2003;149(3):620-623.
16. Messingham MJ, Arpey CJ. Update on the use of antibiotics in cutaneous surgery.
Dermatol Surg. 2005;31(8, pt 2):1068-1078.
17. O’Cathain A, Brazier JE, Milner PC, Fall M. Cost effectiveness of minor surgery
in general practice: a prospective comparison with hospital practice. Br J Gen
Pract. 1992;42(360):302-303.
Archives Web Quiz Winner
C
ongratulations to the winner of our July quiz,
Johann E. Gudjonsson, MD, PhD, Department of
Dermatology, University of Michigan, Ann Arbor. The
correct answer to our July challenge was verruciform xanthoma. For a complete discussion of this case, see the OffCenter Fold section in the August Archives (Borer M,
Smith J, White B, Sheehan D. A scaly plaque on the scalp.
Arch Dermatol. 2007;143[8]:1067-1072).
Be sure to visit the Archives of Dermatology Web site
(http://www.archdermatol.com) to try your hand at the
interactive quiz. We invite visitors to make a diagnosis
based on selected information from a case report or other
feature scheduled to be published in the following month’s
print edition of the Archives. The first visitor to e-mail
our Web editors with the correct answer will be recognized in the print journal and on our Web site and will
also receive a free copy of The Art of JAMA II.
1271
STUDY
Association Between the Use of ␤-Adrenergic
Receptor Agents and the Development
of Venous Leg Ulcers
David J. Margolis, MD, PhD; Ole Hoffstad, MA; R. Rivkah Isseroff, MD
Objective: To explore an association between the use
of ␤-adrenergic receptor agonists or antagonists and the
onset of venous leg ulcers (VLUs).
Design: Retrospective cohort study.
Setting: Ambulatory setting of general practice in the
United Kingdom.
Patients: Patients followed by participating physi-
cians.
Main Outcome Measure: Onset of VLU.
Results: A total of 414 887 patients registered in the Gen-
eral Practice Research Database met our study criteria for
eligibility. Of these individuals, 62 886 were exposed to
a ␤-adrenergic receptor agonist and 54 861 were exposed to a ␤-adrenergic receptor antagonist (6620 used
both ␤-adrenergic receptor antagonists and agonists). Of
those exposed to a ␤-adrenergic receptor agonist, 15.5%
developed a VLU, whereas 18.4% of those who were not
exposed developed a VLU. Of those exposed to a ␤-adrenergic receptor antagonist, 18.2% developed a VLU,
Department of Dermatology
(Dr Margolis) and Center for
Epidemiology and Biostatistics
(Dr Margolis and Mr Hoffstad),
University of Pennsylvania
School of Medicine,
Philadelphia; Department of
Dermatology, University of
California, Davis (Dr Isseroff );
and Dermatology Service,
Department of Veterans Affairs,
Northern California Health
Care System, Mather
(Dr Isseroff ).
A
whereas 19.9% of those not exposed developed a VLU.
The odds ratio (OR) of association between ␤-adrenergic receptor antagonist and VLUs was 1.02 (95% confidence interval [CI], 0.99-1.04); for the association between ␤-adrenergic receptor agonist and VLUs, 0.84 (95%
CI, 0.82-0.86). The fully adjusted ORs were 1.04 (95%
CI, 0.98-1.11) and 0.44 (95% CI, 0.42-0.45), respectively. Furthermore, using propensity score models, we
were able to confirm the association for ␤-adrenergic receptor agonist users. In addition, ␤-adrenergic receptor
antagonist users in many of the propensity score quintiles were also protected from developing VLUs.
Conclusions: A protective association between ␤-adrenergic receptor agonists and perhaps ␤-adrenergic receptor antagonists and VLUs exists. There is strong laboratory evidence to support these epidemiologic findings.
The evidence in this study should not be used as a rationale for treatment of VLUs with ␤-adrenergic receptor agents but should be compelling for the consideration of a randomized clinical trial.
Arch Dermatol. 2007;143(10):1275-1280
LTHOUGH IT HAS BEEN MORE
than 25 years since ␤-adrenergic receptors were
first noted to be expressed
in the skin, their functional significance in this tissue has remained unclear. These receptors are expressed in keratinocytes, fibroblasts, and
melanocytes of the skin, yet few diseases
have been ascribed to their malfunction.1
The few examples include atopic dermatitis and vitiligo, which are both reported
to be associated with a local increase in
synthesis and release of the ␤-adrenergic
receptor catecholamine agonists.1 In addition, in psoriasis, decreased expression
of the ␤2-adrenergic receptor in keratinocytes is thought to lead to a decrease in in-
1275
tracellular cAMP (cyclic adenosine monophosphate) and a concomitant increase in
cell proliferation.2 Likewise, few cutaneous clinical effects have been reported as
a consequence of the systemic administration of pharmacologic agents that either
activate or block these receptors. Two wellrecognized associations are the ␤-adrenergic antagonist exacerbation of psoriasis
and the historically important oculomucocutaneous syndrome.3,4 The current understanding of the mechanism by which
␤-adrenergic antagonism is associated with
exacerbation of psoriasis is that the systemic antagonist blocks endogenous ␤-adrenergic receptor agonists in the skin, thus
resulting in an increase in keratinocyte proliferation.5
Recent laboratory work has provided evidence to support a role for the ␤-adrenergic receptor in cutaneous
wound repair. Specifically, ␤-adrenergic receptor agonists decrease the rate of keratinocyte migration in vitro,
impair the ability of cultured keratinocytes to repair a
scratch wound in a confluent monolayer, delay wound
epithelialization in organ-cultured human skin wounds,
and inhibit wound healing in vivo in a murine wound
model.6-8 ␤-Adrenergic receptor antagonists, however, increase cultured keratinocytes’ migratory speed and their
ability to heal a scratch wound in vitro, speed up wound
healing in organ-cultured human skin, and improve
wound epithelialization in vivo in murine wounds.9,10
Thus, one might anticipate that in patients who use
␤-adrenergic receptor agonists, there might be a deleterious effect on the propensity of those patients to heal
wounds and, therefore, an increased incidence of chronic,
nonhealing wounds. However, complicating the assumed association is the additional finding that although ␤-adrenergic receptor agonists impair many aspects that contribute to wound epithelialization, they can
improve fibroblast function in the healing wound by increasing both fibroblast proliferation and migratory rates.
Essentially, agonists have opposite effects on keratinocytes and dermal fibroblasts.11 Thus, one could also reasonably envision a clinical scenario, like lipodermatosclerosis, which is a skin sign associated with VLUs and
is likely caused by chronic inflammation, destruction,
wounding, and scarring of the dermis and fat layer, where
wound repair is mostly dependent on fibroblast function. In this scenario, by virtue of their fibroblast stimulatory effects, administration of ␤-adrenergic receptor
agonists might improve wound repair or prevent lipodermatosclerosis, thereby preventing the onset of a VLU.
And, one would thus reasonably propose that systemic
administration of either ␤-adrenergic receptor antagonists or agonists as commonly administered for the treatment of asthma, hypertension, or after a myocardial infarction might have an effect on the onset of nonhealing
wounds, such as VLUs. In fact, in an earlier study12 on
the incidence and prevalence of VLUs, we did notice unexplainable associations between patients with VLUs and
those with asthma or congestive heart failure, angina, or
myocardial infarction (diseases classically treated with
␤-adrenergic receptor agonists or antagonists) and the
onset of a VLU.
Venous leg ulcers occur in about 1% of the population older than 45 years.12,13 Most are preceded by varicosities, leg edema, and lipodermatosclerosis.14 For those
with lipodermatosclerosis, it is therefore likely that a VLU
is really the outcome of repetitive wounding of the dermis that ultimately penetrates the epidermis. We have
previously used this logic to demonstrate that estrogens, which have been shown in the laboratory to enhance wound repair, likely clinically promote healing too
because those who use them are less likely to develop a
VLU.15
Our current study was, therefore, undertaken to determine whether an epidemiologic association could be
established in patients using ␤-adrenergic receptor agonists or antagonists and the incidence of chronic
wounds.
METHODS
STUDY POPULATION
This was a retrospective cohort study consisting of individuals registered in a large patient-record database called the General Practice Research Database (GPRD). Established in the
United Kingdom in 1987, the GPRD is a medical records database used by general practitioners (GPs) as their primary means
of tracking patient clinical information. We were provided access to the GPRD by the Epidemiology and Pharmacology Information Core (London, England). The GPRD GPs receive both
financial inducements and penalties to ensure compliance with
providing information in this electronic record. Approximately 1500 GPs representing 500 practices across the United
Kingdom participated in the GPRD between 1987 and 2002.
Patients were eligible to enroll in our study if they had been
registered with a GPRD GP during this period. The total GPRD
population available exceeds 9 million patients with over 35
million person-years of follow-up.
PATIENT ELIGIBILITY
A GPRD-registered patient was eligible for our study if (1) they
received care from a GP who is a member of the GPRD, (2)
they had at least 2 consultations with the GP while they were
40 to 95 years of age, and (3) they did not have a diagnosis of
a VLU for the first 6 months after the commencement of their
database record. The 6-month period was based on several lines
of clinical evidence and was previously evaluated by us.12,13 Participants maintained their eligibility until they died or transferred out of the practice, or if the practice stopped contributing data to the GPRD.
DEFINITION OF OUTCOME, EXPOSURES,
AND CONFOUNDERS
Diseases are classified in the GPRD database using a hierarchical coding system called Read codes. For this study, an eligible patient was considered to have a diagnosis of VLU using
an explicit and previously evaluated (by direct query of the GP)
algorithm consistent with the clinical diagnosis of VLU.12 This
algorithm also excludes those with lower extremity peripheral
arterial disease. For a VLU to be termed associated with the use
of a ␤-adrenergic receptor agent, it must have occurred in an
eligible study participant at least 90 days after exposure to the
agent, and for a VLU to be an outcome in those who did not
use a ␤-adrenergic receptor agent, once eligible, the participant had to have been followed for at least 120 days (minimum time between receipt of 2 prescriptions and 90-day period of association).13
A participant’s use of ␤-adrenergic receptor agonist or antagonist therapy was determined using the British National Formulary coding system. Separate variables were created for exposure to ␤-blocking antagonists and ␤-adrenergic receptor
agonists. All individuals needed to have received at least 2 prescriptions separated by at least 30 days to be deemed exposed.
All medications dispensed by a GPRD GP are coded in this system because GPs need to be compliant with NHS electronic prescription regulations.
␤-Adrenergic receptor agents may be used to treat or prevent many medical conditions, and their use may vary by sex
and age. These ailments and other illnesses were evaluated as
potential confounders. As a result, the following variables were
captured as potential confounders: age; sex; and history of angina, asthma, congestive heart failure, diabetes mellitus, emphysema, glaucoma, hypertension, or myocardial infarction.
1276
Confounders were selected for use in our adjusted models based
on their potential clinical importance or if they changed the
point estimates by more than 10%.
Table 1. Exposure to ␤-Adrenergic Receptor Agents
and Venous Leg Ulcers (VLUs) a
To separately assess the magnitude of the effect of the association between ␤-adrenergic receptor antagonists and ␤-adrenergic receptor agonists, single-variable and multivariable logistic regression models were used to estimate odds ratios (ORs).
Both unadjusted (from a single-variable logistic model) and fully
adjusted (from a multivariate logistic model) ORs are reported with 95% confidence intervals (CIs). Fully adjusted ORs
were calculated by including confounders that were a priori considered to be clinically important or statistically important variables (based on a P value of ⬍.10 in the single-variable model)
in a logistic model. Age was evaluated both as a continuous variable and in deciles. The effects on the OR were identical, and
for simplicity they are reported only as a continuous variable.
Two-way interaction terms were also evaluated and were considered to be statistically significant at P ⬍.10. Reported P values are for the Wald statistic or z statistic, calculated as the estimated coefficient divided by its standard error. We used
Mantel-Haenszel models to estimate relative risks (RRs).
Evaluation of the appropriateness of the fully adjusted model
included analyses for outliers, colinearity, tolerance and covariance, goodness-of-fit, and discrimination. In all cases, the
appropriateness of the logistic regression model was confirmed.
PROPENSITY SCORE
To further explore our observations and to attempt to control
for treatment selection bias, we also used propensity score methods. Basically, because treatment selection in cohort studies is
not random but rather determined by the GP, selection bias could
arise if the choice of therapy depends on patient factors related to the probability that a wound will occur. For example,
if clinically everyone with asthma who has leg edema uses drug
A and leg edema is associated with a VLU, then treatment selection for drug A would be biased toward those with leg edema
and also a VLU. One of the important reasons for performing
a randomized controlled trial is that it can essentially eliminate treatment selection bias because selection is determined
by the randomization procedure. The propensity score technique can be used to statistically model treatment selection,
thereby minimizing selection bias attributable to observed covariates. Propensity score techniques mimic the random assignment of a randomized controlled trial by balancing important variables involved in the selection of a therapy between
those who received and those who did not receive a therapy.16,17
For the current study, separate covariates were included if
they were hypothesized to affect the selection of a patient to
receive either of the ␤-adrenergic receptor agents. All of the covariates listed in the “Definition of Outcome, Exposures, and
Confounders” subsection as potential confounders were included in these models. The ability of the model to discriminate between those who received 1 of the 2 agents and those
who did not was estimated by the area under the receiver operating characteristic curve.
Patients were stratified into quintiles based on the distribution of propensity scores. Quintile-specific rates for the development of a VLU were calculated for those who used a ␤-adrenergic receptor agents and those who did not. An overall
estimate of the association of the agent with the onset of a VLU
was then calculated by summarizing the stratum (quintile) specific RRs using a Mantel-Haenszel technique. Before combin-
Exposure
No VLUs, No.
VLUs, No. (%)
Total
Not exposed
Exposed
Total
␤-Adrenergic Receptor Agonist
287 365
64 636 (18.4)
53 130
9756 (15.5)
340 495
74 392
352 001
62 886
414 887
Not exposed
Exposed
Total
␤-Adrenergic Receptor Antagonist
295 594
64 432 (17.7)
44 901
9960 (18.2)
340 495
74 392
360 026
54 861
414 887
a Data are given as the number of individuals, exposed vs not exposed to
␤-adrenergic receptor agents, who did not develop VLUs and those who did.
The percentages of those who developed VLUs are given in parentheses.
ing the quintile-specific data into a summary score, we used
the Q-statistic for heterogeneity to determine whether the size
of the treatment effect varied across quintiles. Finally, to estimate the summary of effectiveness in the setting of confounding and effect modification, multivariable logistic regression
models were used.
Statistical analyses were conducted using Stata statistical software for Windows XP (version 9.2; StataCorp, College Station, Texas). This study was reviewed by the institutional review board of the University of Pennsylvania and previously
reviewed by the Scientific and Ethical Advisory Group of the
United Kingdom.
RESULTS
A total of 414 887 GPRD-registered patients met our study
criteria for eligibility (Table 1). Their mean (SD) age
was 61.8 (14.1) years (95% CI, 61.8-61.9) and the median age was 61 years (range, 49-73 years). With respect to sex, 240 592 (58%) were female, and 174 295
(42%) were male. Of these individuals, 62 886 were exposed to a ␤-adrenergic receptor agonist and 54 861 were
exposed to a ␤-adrenergic receptor antagonist (6620 used
both ␤-adrenergic receptor antagonists and agonists). Of
those exposed to a ␤-adrenergic receptor agonist, 15.5%
developed a VLU, whereas 18.4% of those not exposed
developed a VLU (Table 1). Of those exposed to a ␤-adrenergic receptor antagonist, 18.2% developed a VLU,
whereas 19.9% of those not exposed developed a VLU
(Table 1). The OR of association between ␤-adrenergic
receptor antagonist use and VLUs was 1.02 (95% CI, 0.991.04). The OR of association between ␤-adrenergic receptor agonist and VLUs was 0.84 (95% CI, 0.82-0.86).
As has been previously shown,12 those who developed a
VLU were more likely to be older (the percentage with a
VLU increased from younger to older age groups; P⬍.001)
and female (P⬍ .001).
Several multivariate analyses were conducted
(Table 2). The relationship between ␤-adrenergic receptor antagonist use and VLUs was not notably confounded by (ie, altered point estimate by more than 10%)
other covariates (Table 2) (see the “Definition of Outcome, Exposures, and Confounders” subsection in the
“Methods” section for the listing of potential confounders). Indeed, the fully adjusted OR (adjusted for sex; age;
1277
Table 2. Odds Ratios (ORs) for the Association
Between the ␤-Adrenergic Receptor Agent
and the Onset of a Venous Leg Ulcer a
Type of OR
Unadjusted
Fully adjusted
␤-Adrenergic
Receptor Agonist b
␤-Adrenergic
Receptor Antagonist c
0.84 (0.82-0.86)
0.44 (0.42-0.45)
1.02 (0.99-1.04)
1.04 (0.98-1.11)
a Data are given as OR (95% confidence interval); ORs were estimated
using logistic regression.
b The fully adjusted OR for ␤-adrenergic receptor agonist use includes sex,
age, and history of asthma and glucocorticoid use.
c The fully adjusted OR for ␤-adrenergic receptor antagonist use includes
sex; age; and history of myocardial infarction, hypertension, angina, or
congestive heart failure.
However, there is notable heterogeneity in this estimate
in that individuals in propensity quintile subgroups 1 to
4 did seem to have a protective association with respect
to drug exposure and VLUs (Table 3) (eg, group 4: RR,
0.39 [95% CI, 0.35-0.43]). In group 5, which comprises
those most likely to receive a ␤-adrenergic receptor antagonist, those who used a ␤-adrenergic antagonist were
at increased risk for developing a VLU. For ␤-adrenergic receptor agonist use, our propensity score for the selection of exposure to a ␤-adrenergic receptor agonist had
an area under the receiver operating characteristic curve
of 0.83. Using the Mantel-Haenszel technique to combine the quintiles, the propensity score RR summary for
␤-adrenergic receptor agonist use was 0.76 (95% CI, 0.750.78). Clinically important heterogeneity was not noted.
For both of our models, important covariates were evenly
balanced between groups within each quintile.
Table 3. Relative Risk (RR) of Developing a Venous Leg
Ulcer After Exposure to ␤-Adrenergic Receptor Agent a
Propensity Score
Quintile
1
2
3
4
5
Unadjusted RR b
Mantel-Haenszel
combined RRs c
␤-Adrenergic
Receptor Agonist
␤-Adrenergic
Receptor Antagonist
0.59 (0.55-0.64)
0.71 (0.65-0.78)
0.50 (0.46-0.54)
0.50 (0.45-0.56)
0.87 (0.85-0.89)
0.84 (0.82-0.86)
0.76 (0.74-0.78)
0.93 (0.87-0.99)
0.61 (0.56-0.66)
0.64 (0.58-0.71)
0.39 (0.35-0.43)
1.52 (1.48-1.55)
1.02 (0.99-1.04)
1.11 (1.09-1.14)
a Data are given as RR (95% confidence interval).
b The unadjusted RR is based on the full data set without
grouping by
propensity score strata.
c The Mantel-Haenszel technique to combine the RRs across strata.
and history of myocardial infarction, hypertension, angina, or congestive heart failure) was 1.04 (95% CI, 0.981.11). The relationship between ␤-adrenergic receptor
agonist use and VLUs was confounded (changed the point
estimate of the unadjusted model by more than 10%) by
asthma and prior oral or inhaled glucocorticoid use. The
adjusted OR (adjusted by sex, age, and history of asthma
and glucocorticoid use) was 0.44 (95% CI, 0.42-0.45),
meaning that those who used ␤-adrenergic receptor agonists were about 66% less likely to develop a VLU. This
indicates that the use of glucocorticoids and a history of
asthma masked the protective association of ␤-adrenergic receptor agonists use on the onset of a VLU. Finally,
the most frequently used ␤-adrenergic receptor agonist
in our data set was salbutamol (also known as albuterol). The fully adjusted OR for comparing users of
salbutamol with those who did not use it was 0.40 (95%
CI, 0.39-0.41), with respect to the onset of a VLU.
We further defined our associations by conducting a
propensity score study (Table 2 and Table 3). Our propensity score for the selection of exposure to a ␤-adrenergic receptor antagonist had an area under the receiver
operating characteristic curve of 0.78. We estimated an
RR of 1.11 (95% CI, 1.09-1.14) for the association between use of ␤-adrenergic receptor antagonist and VLUs.
COMMENT
Laboratory investigations have suggested that ␤-adrenergic receptors may be involved in cutaneous wound repair. ␤-Adrenergic receptors are present on keratinocytes and fibroblasts of the skin; however, their effects
on keratinocytes and fibroblasts differ.9,11 In our current
study, we have shown that those exposed to ␤-adrenergic receptor agonists are less likely to develop a VLU. This
effect was noted in a propensity score model as well. We
were unable to find a consistent association between the
use of ␤-adrenergic receptor antagonist using multivariable logistic regression and the onset of a VLU. However, in our propensity score model we were able to demonstrate that a protective effect was noted in many of the
propensity deciles (Table 2). This suggests that in a subset of patients, ␤-adrenergic receptor antagonists may also
provide some protective effect.
Previous work9,10 in our laboratory has shown that
␤-adrenergic receptor antagonists increase cultured keratinocyte migratory speed and their ability to heal a
scratch wound in vitro, speed up wound healing in organcultured human skin, and improve wound epithelialization in vivo in murine skin wounds. Although we were
able to show in our propensity score study that some individuals who received ␤-adrenergic receptor antagonists were less likely to develop a VLU (Table 3; 2, 3, and
4), our adjusted estimate does not show a protective effect.
This apparent heterogeneity may have 2 simple clinical
explanations. First, we and others13,18,19 have previously
shown that subtle peripheral vascular (arterial) disease
of the lower extremity (eg, a lower limb ankle-brachial
index of 0.7-0.9) is a risk factor for the development and
healing of a VLU. As noted, the individuals in group 5
were the ones most likely to use ␤-adrenergic receptor
antagonists, which means that they are also most likely
to have hypertension and atherosclerotic vascular disease of the heart. These are also, therefore, individuals
at highest risk for peripheral vascular disease, which, when
subtle, we know from experience cannot be properly ascertained in this database.12 As a result, the RRs that we
note in group 5 may be caused by residual confounding.
Second, genetic polymorphisms commonly exist for ␤-ad-
1278
renergic receptor agents.20 These polymorphisms have
been shown to have an effect on the regulation of the receptor itself.20 It is entirely possible that the effects of this
agent depend on the genetic polymorphism that is present and that our heterogeneity has a genetic basis.
However, ␤-adrenergic receptor agonists increase both
the migration and proliferative rate of dermal fibroblasts, and it is likely that this cell type is the one that is
initially damaged in patients with lipodermatosclerosis.11,14 Thus, ␤-adrenergic receptor agonists could be predicted to enhance the repair process of the woundlike
environment of early lipodermatosclerotic lesions and thus
prevent overlying ulceration. There is also evidence that
implicates ␤-adrenergic receptor activation with enhancement of angiogenesis.21,22 Thus, in addition to their function on dermal fibroblasts, ␤-adrenergic receptor agonists could improve chronic wounds by up-regulating
their vascularization. Furthermore, inflammation plays
an important part in the pathogenesis of lipodermatosclerosis and chronic VLUs.23-25 There are many examples in the literature (reviewed by Miyamoto et al26)
demonstrating the anti-inflammatory effects of ␤-adrenergic receptor agonists, which includes the fact that neutrophils express the ␤2-adrenergic receptor and synthesize catecholamines. In addition, ␤-adrenergic receptor
agonists decrease many aspects of neutrophil function,
including their chemotaxis and recruitment, their ability to adhere to the endothelium, and their ability to generate reactive oxygen species and cytokine inflammatory mediators.27 Therefore, either by its effects on dermal
fibroblasts, angiogenesis, or on the inflammatory process, the systemic administration of ␤-adrenergic receptor agonists may decrease the individual’s propensity to
develop a nonhealing venous ulcer.
All observational studies may be limited by bias and
confounding. Treatment selection bias is a critical concern when evaluating the efficacy of a medication in a
study that does not randomly allocate treatment. Although the ultimate proof of the effectiveness of ␤-adrenergic receptor agents in wound repair will require a
randomized clinical trial, we feel that treatment selection bias is less likely an issue in our study than in most
observational studies. First, during the period of patient
observation in this study (1987-2002), no one suspected that ␤-adrenergic receptor agents were likely to
have clinically important effects on wound repair. More
important, no one suspected that they had clinical activity with respect to the treatment of VLUs. Treatment
selection with respect to these agents is likely based on
the illnesses for which they are treatment options (eg,
asthma, glaucoma, hypertension, myocardial infarction, and congestive heart failure). Second, with respect
to ␤-adrenergic receptor agonists, the association of these
agents and the association of asthma with respect to VLUs
are in opposite directions. Although a decreased association with VLUs was noted in our unadjusted model,
this effect was unmasked (more protective) once our models were adjusted for history of asthma and systemic glucocorticoid use. This effect was also noted across all strata
using a propensity score model, which attempts to adjust for treatment selection bias. In essence, we have 2
different models that show that the use of ␤-adrenergic
receptor agonists protects against the onset of VLUs. Finally, it is possible that our results are biased owing to
confounding by indication. However, there are multiple
different diseases associated with the use of these medications; our propensity scores, which are based on treatment selection, revealed similar results; and ␤-adrenergic receptor agents are used for illnesses both with an
increased and decreased association with VLUs.12
Information bias is also problematic for observational studies. We have previously demonstrated our ability to use the GPRD to determine whether an individual
has developed a VLU.12 Although we do not know if our
participants actually used ␤-adrenergic receptor agents,
we do know that they were prescribed more than once.
Our definition of exposure to ␤-adrenergic receptor agents
was based on at least 2 prescriptions to the agent, and
for an outcome to be associated with 1 of these agents it
must have occurred 90 days after receipt of the agent. In
any event, if individuals received these agents and did
not use them, then the direction of the information bias
should have biased our results toward the null (no association). It is very unlikely that anyone would have used
␤-adrenergic receptor agents without knowledge of the
participant’s GP, but again, if this did occur then the bias
would have been toward the null (fewer unexposed individuals would have developed a VLU), and therefore
our true effect estimate would have been even more protective.
In summary, we have shown a protective association
between ␤-adrenergic receptor agonists and VLUs. There
is strong laboratory evidence to support ␤-adrenergic receptor agonist–mediated modulation of dermal fibroblast function as the mechanism underpinning this epidemiologic finding. It is, however, possible that the benefit
noted in our study is caused by another mechanism, such
as local changes in arterial perfusion, and we encourage
others to investigate this possibility. Although we were
unable to find consistent evidence of an association between ␤-adrenergic receptor antagonist and VLUs, there
was, however, a subgroup of patients who benefited from
the use of these agents too. It may also be possible that
individuals with specific illnesses, such as diabetes mellitus or congestive heart failure, might benefit more from
these agents. This needs further study. It is important to
realize that the evidence in this study should not be used
as a rationale for treatment of VLUs with ␤-adrenergic
receptor agents but rather should be compelling data for
the consideration of a randomized clinical trial.
Accepted for Publication: November 9, 2006.
Correspondence: David J. Margolis, MD, PhD, 815 Blockley Hall, 423 Guardian Dr, University of Pennsylvania,
Philadelphia, PA 19104 ([email protected]
.edu).
Author Contributions: Dr Margolis had full access to all
of the data in the study and takes responsibility for the
integrity of the data and the accuracy of the data analysis. Study concept and design: Margolis, Hoffstad, and
Isseroff. Acquisition of data: Margolis and Hoffstad. Analysis and interpretation of data: Margolis, Hoffstad, and
Isseroff. Drafting of the manuscript: Margolis, Hoffstad,
and Isseroff. Critical revision of the manuscript for impor-
1279
tant intellectual content: Margolis, Hoffstad, and Isseroff.
Statistical analysis: Margolis and Hoffstad. Obtained funding: Margolis and Isseroff. Administrative, technical, or material support: Margolis, Hoffstad, and Isseroff. Study supervision: Margolis, Hoffstad, and Isseroff.
Financial Disclosures: Dr Isseroff has a patent application on the use of adrenergic agents in wound repair that
both she and the University of California, Davis, are currently preparing.
Funding/Support: This study was funded in part by National Institutes of Health grants AR02212 and AR44695
(Dr Margolis) and by AR44518 and Shriners Hospitals
for Children grant No. 8550 (Dr Isseroff).
Role of the Sponsors: The sponsors had no role in the
design and conduct of the study; in the collection, analysis, and interpretation of data; or in the preparation, review, or approval of the manuscript.
REFERENCES
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
1. Grando SA, Pittelkow MR, Schallreuter KU. Adrenergic and cholinergic control
in the biology of epidermis: physiological and clinical significance. J Invest Dermatol.
2006;126(9):1948-1965.
2. Mahrle G, Orfanos CE. Lack of beta-adrenergic stimulation of membrane bound
adenyl cyclase in psoriasis as compared to normal epidermis [author’s transl]
[in German]. Arch Dermatol Res. 1975;253(2):195-202.
3. Venning GR. Identification of adverse reactions to new drugs. Br Med J (Clin Res
Ed). 1983;286(6361):289-292.
4. Gold MH, Holy AK, Roenigk HH Jr. Beta-blocking drugs and psoriasis: a review
of cutaneous side effects and retrospective analysis of their effects on psoriasis.
J Am Acad Dermatol. 1988;19(5, pt 1):837-841.
5. O’Brien M, Koo J. The mechanism of lithium and beta-blocking agents in inducing and exacerbating psoriasis. J Drugs Dermatol. 2006;5(5):426-432.
6. Pullar CE, Grahn JC, Liu W. Beta2-adrenergic receptor activation delays wound
healing. FASEB J. 2006;20(1):76-86.
7. Pullar CE, Chen J, Isseroff RR. PP2A activation by beta2-adrenergic receptor agonists: novel regulatory mechanism of keratinocyte migration. J Biol Chem. 2003;
278(25):22555-22562.
8. Chen J, Hoffman BB, Isseroff RR. Beta-adrenergic receptor activation inhibits
keratinocyte migration via a cyclic adenosine monophosphate-independent
mechanism. J Invest Dermatol. 2002;119(6):1261-1268.
9. Pullar CE, Rizzo A, Isseroff RR. Beta-adrenergic receptor antagonists accelerate
20.
21.
22.
23.
24.
25.
26.
27.
1280
skin wound healing: evidence for a catecholamine synthesis network in the
epidermis. J Biol Chem. 2006;281(30):21225-21235.
Sivamani RK, Pullar CE, Griffths B, Isseroff RR. Beta-2-adrenergic receptor blockade accelerates burn wound healing. J Invest Dermatol. 2006;126:59.
Pullar CE, Isseroff RR. The beta 2-adrenergic receptor activates pro-migratory
and pro-proliferative pathways in dermal fibroblasts via divergent mechanisms.
J Cell Sci. 2006;119(pt 3):592-602.
Margolis DJ, Knauss J, Bilker W. Medical conditions associated with venous leg
ulcers in an outpatient. Br J Dermatol. 2004;150(2):267-273.
Margolis DJ, Bilker W, Santanna J, Baumgartern M. Venous leg ulcer: incidence
and prevalence in the elderly. J Am Acad Dermatol. 2002;46(3):381-386.
Kirsner RS, Pardes JB, Eaglstein WH, Falanga V. The clinical spectrum of
lipodermatosclerosis. J Am Acad Dermatol. 1993;28(4):623-627.
Margolis DJ, Knauss J, Bilker W. Hormone replacement therapy and prevention
of pressure ulcers and venous leg ulcers. Lancet. 2002;359(9307):675-677.
Margolis DJ, Bartus C, Hofstad O, Malay S, Berlin JA. Effectiveness of recombinant human platelet-derived growth factor for the treatment of diabetic neuropathic foot ulcers. Wound Repair Regen. 2005;13(6):531-536.
D’Agostino RB Jr. Propensity score methods for bias reduction in the comparison of a treatment to a non-randomized control group. Stat Med. 1998;17(19):
2265-2281.
Skene AI, Smith JM, Dore CJ, Charlett A, Lewis JD. Venous leg ulcers: a prognostic index to predict time to healing. BMJ. 1992;305(6862):1119-1121.
Margolis DJ, Berlin JA, Strom BL. Risk factors associated with the failure of a
venous leg ulcer to heal. Arch Dermatol. 1999;135(8):920-926.
Small KM, McGraw DW, Liggett SB. Pharmacology and physiology of human
adrenergic receptor polymorphisms. Annu Rev Pharmacol Toxicol. 2003;43:
381-411.
Thaker PH, Han LY, Kamat AA, et al. Chronic stress promotes tumor growth and
angiogenesis in a mouse model of ovarian carcinoma. Nat Med. 2006;12(8):
939-944.
Chalothorn D, Zhang H, Clayton JA, Thomas SA, Faber JE. Catecholamines augment collateral vessel growth and angiogenesis in hindlimb ischemia. Am J Physiol
Heart Circ Physiol. 2005;289(2):H947-H959.
Smith PC. The causes of skin damage and leg ulceration in chronic venous disease.
Int J Low Extrem Wounds. 2006;5(3):160-168.
Nicolaides AN. Chronic venous disease and the leukocyte-endothelium interaction: from symptoms to ulceration. Angiology. 2005;56(suppl 1):S11-S19.
Trent JT, Falabella A, Eaglstein WH, Kirsner RS. Venous ulcers: pathophysiology and treatment options. Ostomy Wound Manage. 2005;51(5):38-54.
Miyamoto M, Tomaki M, Lotvall J, Linden A. Beta-adrenoceptor stimulation and
neutrophil accumulation in mouse airways. Eur Respir J. 2004;24(2):231-237.
Perkins GD, McAuley DF, Richter A, Thickett DR, Gao F. Bench-to-bedside review: beta2-Agonists and the acute respiratory distress syndrome. Crit Care. 2004;
8(1):25-32.
STUDY
Physical Activity and Adherence to Compression
Therapy in Patients With Venous Leg Ulcers
Maud M. Heinen, PhD, RN; Carine van der Vleuten, MD, PhD; Michette J. M. de Rooij, MD, PhD;
Caro J. T. Uden, PhD; Andrea W. M. Evers, PhD; Theo van Achterberg, PhD, RN
Objective: To assess levels of physical activity, particu-
Results: In this study, 39% of the patients interviewed
larly walking and leg exercises, among patients with venous leg ulcers and the extent to which patients adhere
to compression therapy.
displayed adherence to compression therapy. Selfreported data validated by the use of an accelerometer
indicated that the amount of moderately strenuous activity in the study group was low compared with that of
the general Dutch population; 35% of the patients did
not have a 10-minute walk even once a week.
Design: Descriptive cross-sectional study.
Setting: Patients from 12 outpatient dermatology clin-
ics were invited to participate in this study. When they
agreed, they were asked to wear an accelerometer for a
week and were then interviewed at the outpatient clinic.
Patients: A total of 150 patients with leg ulcers caused
mainly by venous insufficiency.
Main Outcome Measures: The amount of moderately strenuous physical activity, the amount of walking, and adherence to compression therapy.
I
Author Affiliations: Centre
for Quality of Care Research
(Drs Heinen and
van Achterberg),
Departments of Dermatology
(Dr van der Vleuten) and
Medical Psychology (Dr Evers),
Radboud University Nijmegen
Medical Centre, Nijmegen,
the Netherlands; Department of
Dermatology, VieCuri Hospital,
Venlo, the Netherlands
(Dr de Rooij); and Department
of Surgery, University Hospital
Maastricht, Maastricht,
the Netherlands (Dr Uden).
Conclusions: Low levels of physical activity were es-
tablished in a group of 150 patients with venous leg ulcers. Full adherence to compression therapy was reported in about 40% of the patients. Patients should be
educated and encouraged to (1) enhance physical activity through walking and leg exercises and (2) increase
adherence to compression therapy.
Arch Dermatol. 2007;143(10):1283-1288
N 70% OF ALL PATIENTS WITH LEG
ulcers, ulceration is caused by venous insufficiency.1 Physical activity and adherence to compression therapy are 2 vital factors in
decreasing wound healing time and preventing wound recurrence. Leg exercises
and physical activity stimulate the calf
muscle pump, which supports venous circulation. Walking is particularly beneficial because it causes the calf muscles to
contract and expand. This in turn results
in increased pumping of blood from the
lower leg upward toward the heart.1,2 A diminished pump function, or absence of the
calf muscle pump, can contribute considerably to the development of edema in the
lower legs and other chronic venous insufficiency symptoms. As a result, patients with leg ulcers should be encouraged to enhance calf muscle activity and
to prevent the occurrence of edema by
walking.3
1283
Exercises for the lower legs efficiently
supplement daily physical activities and
walking, especially when the opportunities to walk or engage in other physical activity are limited. Several studies4-6 show
the positive effects of leg exercises on the
calf muscle pump function. The tip-toe exercise in the standing position, as well as
flexing and stretching of the feet in the sitting position, effectively stimulates the calf
muscle and enhances venous return.5-7
To effectively treat venous leg ulceration, compression therapy of the lower
legs is essential. Patient adherence to compression therapy improves the effectiveness of the calf muscle pump, reduces venous volume, lowers venous pressure (only
with high external pressure), increases current velocity, and improves the microcirculation.1 It also prevents the occurrence
of edema and reduces the development of
skin changes, especially after deep venous thrombosis.8 In addition, activation
Instructions for the Interviewer and Questions to Determine Adherence
With Compression
Instructions: Ask the following questions to learn about the actual behavior of the
patient. Ask about a period of 6 months prior to the interview. Be sure not to judge or
correct the answers of the patient. Make sure that you give the patient the
impression that nobody is perfect and that it is all right to talk about nonadherence.
Try to determine precisely when the patient does not wear the therapeutic stockings
(and/or bandages).
1. When do you normally put on your therapeutic elastic stockings and when you take
them off again? (Let the patient describe the day and try to find out at what
moment the patient puts on and takes off the therapeutic elastic stocking.)
2. We all forget things sometimes. Do you sometimes forget to put on your stockings
in the morning?
3. Do you sometimes take off your stockings early, perhaps because they are
hindering you?
4. Do you have the same routine every day or do weekdays differ from weekends?
5. Does it ever happen that you do not wear your stockings for a whole day?
6. Do you find it difficult to wear your stockings on special days (think of holidays,
very warm days, a day on which you are going to swim or sit in the sun)?
The interviewer was instructed to translate the given answers to the questions above
into prestructured adherence categories. The following categories were used.
Scoring Categories, Adherence With Therapeutic Elastic Stockings
and/or Bandages
The patient did wear the therapeutic elastic stockings and/or bandages:
• Every day, all day
• Occasionally, for a somewhat shorter period (< 2 hours shorter) than the
recommended time period (all day, from the moment one arises until the moment
one goes to bed), less than once a week
• Regularly, for somewhat shorter period (< 2 hours), at least once a week
• Occasionally, for a considerably shorter period (> 2 hours shorter), once a week
• Regularly, for considerably shorter period (> 2 hours shorter), at least once a week
• Not wearing compression (for a whole day) occasionally (less often than once a
month in the past 6 months)
• Not wearing compression (for a whole day) on a regular basis, more often than once
a month
• Not wearing compression for several days in a row in the past 6 months
The patient had no experience (yet) with therapeutic elastic stockings and/or bandages
Figure. Questions and scoring list to determine adherence with compression
therapy.
of the calf muscle in patients with chronic venous insufficiency is less effective when compression is not used.9
Compression therapy is applied by means of bandages
or therapeutic elastic stockings. It is important that therapeutic elastic stockings be replaced regularly to ensure
adequate compression. Evidently, inadequate compression or poor adherence to compression therapy can result in the recurrence of venous leg ulcers.10-13 Reduced
adherence to dermatological treatment has been noted
in 34% to 45% of patients, as reported in a review by
Serup et al.14 Adherence to long-term therapy is defined
by the World Health Organization15 as the extent to which
a person’s behavior (eg, taking medication, following a
diet, and/or executing lifestyle changes) corresponds with
recommendations from physicians, nurses, and physiotherapists.
In sum, physical activity through walking and leg exercises, combined with an adequate use of compression
therapy, is essential in the treatment of venous leg ulcers. However, little is known about (1) the levels of physical activity, walking, and leg exercises among patients
with venous leg ulcers and (2) their adherence to compression therapy.
We assessed the physical activity levels in patients with
venous leg ulcers, with a specific focus on walking and
lower leg exercises and on establishing levels of patient
adherence to compression therapy. As a result, the following research questions were formulated: (1) How
much time do patients with leg ulcers spend on moderately strenuous physical activities? (2) How much time
do patients spend walking during a 7-day period? (3) To
what extent do patients conduct lower leg exercises? (4)
To what extent do patients adhere to compression therapy
by means of therapeutic elastic stockings or bandages?
METHODS
PATIENTS AND PROCEDURE
Interviews of 150 patients were conducted by a team of 3 trained
interviewers (1 of whom was M.M.H.). Patients from 12 hospitalbased outpatient dermatology clinics in the Netherlands were
included. The study was approved by the medical ethics committees of all participating hospitals.
Patients with leg ulcers who had received treatment at outpatient dermatology clinics during the 9-month inclusion period of the study were asked to participate (at the start of the
study, patients who had been treated within the preceding month
were also invited to participate). Only patients with leg ulceration based on venous etiology or a mixed etiology of venous
and arterial or venous and arteriolar insufficiency were invited
to participate. To be included in the study, patients had to be
able to speak and understand the Dutch language. In addition,
participants were required to provide written informed consent
after they received written and oral information about the study.
Exclusion criteria included arterial insufficiency with an anklebrachial pressure index of less than 0.8 or full immobility.
Patients were interviewed at the outpatient dermatology clinic
where they were being treated. All participants were initially
approached by dermatology nurses and/or dermatologists and
asked if they would be willing to participate in this study. Patients were asked to wear an accelerometer (hereinafter, PAM
[physical activity monitor]) during the week prior to interview and were given instructions for its use.
ASSESSMENTS AND OBSERVATIONS
Data on wound characteristics and etiology and comorbidity
were provided by the dermatologist or dermatology nurse. Patients were also asked to report comorbidity, the duration of
the current wound, and the date of the first wound.
In addition, patients were asked to report whether they conducted leg exercises, the type of exercises, and how often they
conducted these exercises. Six questions on adherence to compression therapy were presented to determine actual treatment adherence behavior. Answers were registered in prestructured categories. The questions and categories are displayed in
the Figure. Additional remarks from the patients concerning
their experiences with compression therapy were reported at
the end of the interviews.
Footwear was observed by the interviewer, and patients were
questioned at to whether their footwear on that day was the footwear they usually wore. The interviewer judged the quality of
the footwear and paid special attention to the height of the heels
(whether height was ⬍4 cm) and the supportive capacity of the
shoe. Dermatology nurses were asked to report if they had an
indication for nonadherence to treatment regimen through observation of the compression bandages or therapeutic elastic stockings or the amount of edema in the lower legs.
QUESTIONNAIRES AND PAM
All patients completed the 7-day Physical Activity Recall questionnaire (PAR),16,17 which asks respondents to recall and report all physical activity in which they had engaged during the
previous 7 days. A distinction was made between weekdays and
weekends. The PAR requires respondents to report any moderately strenuous activities in the past week and the amount of
time spent on these activities. To increase understanding of what
1284
kinds of activities are considered moderately strenuous, examples were provided on the back of the questionnaire. Furthermore, the amount of walking the patient had done in the
week prior to the interview was investigated using a question
derived from the International Physical Activity Questionnaire.18 This question asked patients how often in the previous week they had walked for a minimum of 10 minutes.
To measure actual physical activity, a PAM was used.19-21
The PAM is a small device that can be attached to the waistband of trousers or a skirt and contains a display that shows 2
different scores of physical activity, namely, a daily score and
a mean weekly score. The PAM was used as a control device
for overreporting of physical activity.
We used descriptive analysis to analyze the data in this study.
Scores for self-reported physical activity were combined with
PAM scores to validate self-reported activity. Self-reported adherence to compression was combined with dermatology nurses’
observations.
Table 1. Characteristics of 150 Patients,
Wound Characteristics, and Comorbidity a
Characteristic
Patient Characteristics
Age, mean, median (range), y
Female
Education, highest completed level
Elementary school
Lower secondary school
Vocational education
Higher educational level b
Paid outdoor occupation
BMI, mean, median (range)
19-25 (normal)
25-30 (overweight)
⬎ 30 (obese)
Wound Characteristics
Etiology
Venous
Mixed
Edema (considerable)
Duration, mean, median (range), mo
First wound, mean, median (range), No. of
years ago
Frequency
1
2
3-10
⬎ 10
Professional wound care, mean, median
(range), frequency per month
Compression d
Bandages, short stretch
Bandages, long stretch
Therapeutic elastic stocking(s)
Other
RESULTS
In total, 227 patients were invited to participate in our
study. Of these, 77 (34%) chose not to participate for the
following reasons: (1) 29 patients considered participation in this study to be too much trouble (many of these
patients were dependent on others for transportation to
the hospital), (2) 16 patients were unable to participate
because they or their partners were unwell, and (3) 11
did not have time to participate because of work commitments or other activities. (Twenty-one patients did
not provide a specific reason for not participating.)
PATIENT CHARACTERISTICS
Table 1 presents patient characteristics, wound characteristics, and comorbidity. In 60% of the patients, the
leg ulcer was the result of a mixed etiology of venous and
arterial or arteriolar insufficiency. All patients with diabetes mellitus, heart failure, hypertension, or intermittent claudication were also classified as patients with a
mixed etiology. Patients who had a leg ulcer based on a
pure venous etiology comprised 40% of the sample. Almost three-quarters of the patients had varicose veins
(71%), and more than one-third had a history of deep
venous thrombosis (35%). At the time of the interviews,
103 patients had a wound (69%). Forty-seven patients
had had a wound in the month prior to the interview
(31%). Almost one-fifth of the patients had had wounds
on more than 10 occasions (19%). The median duration
of the wound was 4 months (range, 2 weeks to 5 years).
Compression therapy was applied by short or long stretch
bandages or therapeutic elastic stockings. Some patients had both because they had different types of compression on each leg.
PHYSICAL ACTIVITY
In Table 2, the data for physical activity, walking, and
leg exercises are displayed. The results of the PAR, corrected for overreporting, showed that 56% of the patients had less than 2.5 hours of physical activity a week
and about half of these patients (26%) did not have any
moderately strenuous physical activity in the week prior
Comorbidity
Varicose veins
Hypertension
Deep venous thrombosis
Cardiac problem
Diabetes mellitus
Intermittent claudication
Erysipelas
Eczema
Arthritis or arthrosis
Hip, back, or knee pain and/or surgery
Value
67, 68 (27-91)
93 (62)
37 (25)
72 (48)
18 (12)
21 (14)
30 (20)
30, 29 (20-53)
34 (23)
57 (38)
59 (39)
60 (40)
90 (60)
49 (32)
7.9, 4.0 (0.5-60.0)
23, 20 (1-76) c
41 (27)
27 (18)
53 (36)
29 (19)
8 (1-29)
69 (46)
6 (4)
89 (59)
23 (15)
106 (71)
59 (39)
53 (35)
29 (19)
30 (20)
12 (8)
26 (17)
10 (6)
35 (23)
24 (16)
Abbreviation: BMI, body mass index (calculated as weight in kilograms
divided by height in meters squared).
a Unless indicated otherwise, data are given as number (percentage).
b Includes college and university and higher levels of secondary education.
c One-hundred nine patients with previous wound(s).
d Patients can have both a therapeutic elastic stocking on one leg and
compression bandages on the other.
to the interview. The PAM scores of 17 patients (11%)
were corrected for the amount of physical activity per
week, and 12 (8%) were corrected for the amount of walking in the week previous to the interview. Patients who
reported more than 2.5 hours on the PAR and had a score
higher than 9 on the PAM were classified as the moderately strenuous activity group.
Only 13% of the patients had walked for 30 minutes
on at least 5 days of the week. The percentage of patients who did not walk for 10 minutes at least once in
1285
Patients,
No. (%)
reported wearing their stockings everyday from the time
they awoke until they went to bed at night. With respect to the use of bandages, 78 of the 97 patients who
had experience with them (80%) reported being completely adherent to therapy.
66 (44) b
39 (26)
COMMENT
Table 2. Amount of Moderately Strenuous Activity,
Walking, and Leg Exercises in 150 Patients a
Physical Activity, PAR
MSA, ⱖ2.5 h
No MSA
Walking
ⱖ30 min on ⱖ5 d
⬍ 10 min on ⱖ1 d
Don’t know
Leg and foot exercises
Leg exercises
Flexing and stretching the feet
Rotating the feet
Tip-toe exercise
19 (13) b,c
52 (35)
11 (7)
53 (35)
30 (20)
35 (23)
11 (7)
Abbreviations: MSA, moderately strenuous activity; PAR, Physical Activity
Recall Questionnaire.
a Defined as at least 2.5 hours per week.
b Self-reported data corrected for physical activity monitor (PAM) scores.
The PAM corrections explained that at least 30 minutes of walking on at least
5 days per week, or at least 2.5 h of MSA, are not possible when the mean
daily PAM score is 9 or less.
c A total of 26 patients with self-reported 2.5 hours or more of MSA per
week had a mean weekly score on the PAM of less than 10, but 9 patients
reported bicycling as MSA, so only 17 patients were corrected for PAM in
their physical activity score because PAM scores are known to underestimate
activity during bicycling.
Table 3. Adherence by 150 Patients to Compression Therapy
Using Therapeutic Elastic Stockings and/or Bandages a
Type of Therapy
Level of Adherence
Fully adherent (on a daily basis,
according to guidelines)
Moderately adherent
(occasionally to regularly; a
period ⬍2 h shorter rather
than all day)
Nonadherent (occasionally,
considerably shorter; a
period ⬎2 h shorter rather
than all day)
Stockings or
Short
Long Stretch Stretch
All
Bandages Bandages Patients b
(n = 119)
(n = 97) (n = 150)
40 (33)
78 (80)
59 (39)
46 (38)
14 (15)
54 (36)
35 (29)
5 (5)
37 (25)
a Data are given as number (percentage) of
b Regardless of the kind of compression.
patients.
the week prior to the interview was 35%. Only 35% of
the patients did the exercises for the lower legs.
In Table 3, data for adherence to compression therapy
are given. Of 150 patients, 119 had therapeutic compression stockings at the time of the interview or had had experience with them within the past 6 months. Ninetyseven patients had compression bandages or had had
experience with them in the past 6 months. With respect to treatment adherence, 39% of all 150 patients were
fully adherent to the use of therapeutic elastic stockings
as well as compression bandages. Of the 119 patients who
had experience with therapeutic elastic stockings, 33%
Activation of the calf muscle pump function combined
with compression therapy is the most effective noninvasive component of venous leg ulceration treatment.2,22,23 This study provides insight into levels of physical activity among patients with venous leg ulcers,
particularly walking and leg exercises, and patient adherence to compression therapy. The results of this
study show that moderately strenuous activity levels in
patients with venous leg ulcer are low. A substantial number of patients do not engage in even 10 minutes of walking per week. In addition, this study shows that only onethird of the patients conducted leg exercises. The rate of
adherence to compression therapy was also low, with less
than half of the patients reporting full adherence to
therapy.
To our knowledge, there are no studies in the international literature that report on the physical activity and
walking behavior of patients with venous leg ulcers. There
was, however, a study24 in the Netherlands (where our
patient sample was obtained) in which 8000 members
of the general population were questioned about their
physical activity. The patients in our sample showed lower
physical activity levels compared with the sample surveyed among the general Dutch population,24 thereby indicating that our sample was comparatively more inactive. In the Dutch adult population, more than 50% were
sufficiently physically active compared with 44% of the
patients in our sample. Furthermore, in the Dutch study,
only 8% of the sample were completely inactive compared with 26% of the patients in our sample.
Clearly, patients with venous leg ulcers have low levels of physical activity and spend little time walking even
though walking activates the calf muscle pump and reduces venous hypertension when combined with compression therapy. There are, however, no guidelines that
indicate the amount of walking necessary to improve venous insufficiency. In the study reported herein, the actual amount of walking was assessed using reports of 10minute walking periods, because 10-minute walking periods
ensure that the calf muscle is sufficiently activated. A study
by Uden et al4 established that walking faster is more effective in promoting venous circulation of the lower legs.
The amount of walking to achieve beneficial effects with
respect to decreasing venous leg ulceration needs to be further established by future research.
Most patients in our study were classified as moderately adherent to compression therapy. A smaller group
was categorized as nonadherent. In a study by Mayberry
et al,12 nonadherence was established for only 9.7% of
the patients. However, at follow-up, this number increased to 20.5%. Erickson et al10 showed that strict adherence was established in 32% of the cases in their study,
which is more on par with the results of our study. Ob-
1286
viously, adherence or adherence rates are influenced by
the methods used to obtain results. The patients in the
studies by Mayberry et al12 and Erickson et al10 were considered to be adherent to therapy when they did not consistently refuse to use ambulatory elastic compression or
when they kept 100% of their appointments, adhered completely to prescribed compression therapy, and followed all instructions for wound and extremity care. Kjaer
et al13 stated that the indicator used to determine adherence is susceptible to bias. In our study, adherence was
assessed by questioning the patients on their daily habits concerning compression therapy. Patients were invited and encouraged to tell the interviewer about their
experiences with their compression bandages and stockings. In many cases, when the interviewer asked patients specifically about their habits concerning compression therapy, many reported a lower adherence level
than what they had initially reported. Evidently, by discussing experiences and habits concerning compression in a nonjudgmental way, the provision of socially
desirable answers was diminished.
Several studies10-13 have concluded that patients who
display strict adherence with their treatment regimen show
considerably faster healing rates and fewer recurrences
compared with patients who are less adherent or nonadherent. A high level of adherence is, according to the
World Health Organization review (Sabate25), associated
with more severe symptoms or illness, knowledge about
and belief in efficacy of treatment, adequate social support, and trust in the physician.14 Renzi et al,26 in a study
of patients being treated for dermatologic concerns, concluded that dissatisfaction with care was associated with
poor adherence to treatment. Unfortunately, few studies
report on the determinants of nonadherence with compression therapy. A study by Edwards27 concluded that
many patients do not have a clear understanding of their
condition or the treatment regimes prescribed. In addition, Edwards27 indicated that concurrent problems associated with compression bandaging (eg, pain, leakage of
exudates, and skin irritation) contribute to nonadherence. In a study by Kiev et al,28 socioeconomic factors, cosmetic reasons, concerns about discomfort, and difficulty
in putting on the stockings were identified as primary reasons for nonadherence.
A limitation of our study is the fact that a relatively
large number of patients declined participation. It is possible that this created a selection bias. Another limitation is related to the fact that the sample of patients with
venous leg ulcers in our study was obtained from outpatient dermatology clinics. In the Netherlands, most patients with uncomplicated venous leg ulceration are
treated by general practitioners and/or nurses from home
health care organizations. Patients with poorly healing
wounds, recurrent wounds, or wounds related to more
complicated etiology are referred to outpatient dermatology clinics. As a result, the generalizability of our findings is probably limited to patients with more severe venous leg ulceration concerns. However, generalizability
of our results is likely enlarged because the patients included were recruited from a large number of outpatient dermatology clinics in both academic and general
hospitals in the Netherlands.
The validity of this study is strengthened by the use
of several methods, such as self-reported data, validated
questionnaires, data from the medical files, observational data from dermatology nurses, and interviewers
and the use of a PAM. Using a PAM allowed us to objectively measure actual physical activity along with selfreported physical activity. In our study, the PAM was used
specifically to control for overreporting of physical activity by the patients rather than to measure the total
amount of physical activity.
In conclusion, patients with venous leg ulcers treated
with ambulant compression therapy have low levels of
physical activity and spend little time walking. Levels of
full adherence with compression therapy are low. Physical activity through walking and leg exercise, combined
with compression therapy, is the most effective element
of conservative leg ulceration treatment. Patients should
be encouraged to enhance physical activity that aims to
activate the calf muscle pump. Patients should be stimulated to increase adherence to treatment with compression bandages or stockings. Determinants for enhancing adherence and physical activity levels need to be
further explored and anticipated at as a part of professional care.
Correspondence: Maud M. Heinen, PhD, RN, Centre for
Quality of Care Research, Radboud University Nijmegen Medical Centre, Kwazo 114, PO Box 9101, 6500 BH
Nijmegen, the Netherlands ([email protected]
.nl).
Author Contributions: Study concept and design: Heinen,
de Rooij, Uden, Evers, and van Achterberg. Acquisition
of data: Heinen, van der Vleuten, and de Rooij. Analysis
and interpretation of data: Heinen and van Achterberg.
Drafting of the manuscript: Heinen, de Rooij, and Uden.
Critical revision of the manuscript for important intellectual
content: Heinen, van der Vleuten, Evers, and van Achterberg. Statistical analysis: van Achterberg. Obtained funding: Heinen and van Achterberg. Study supervision: van
der Vleuten, de Rooij, Evers, and van Achterberg.
Funding/Support: This study was funded by a grant from
ZonMw, the Netherlands’ organization for Health Research and Development.
Role of the Sponsor: The funding organization did not
have a role in the design and conduct of the study or in
the approval of this manuscript.
REFERENCES
1. Neumann HAM, Tazelaar DJ, Wittens CHA, Veraart JCJM, Schoevaerdts JC.
Leerboek Flebologie. Utrecht, the Netherlands: Uitgeverij Lemma BV; 2003:2538.
2. Araki CT, Back TL, Padberg FT, et al. The significance of calf muscle pump function in venous ulceration. J Vasc Surg. 1994;20(6):872-879.
3. Padberg FT, Johnston MV, Sisto SA. Structured exercise improves calf muscle
pump function in chronic venous insufficiency: a randomized trial. J Vasc Surg.
2004;39(1):79-87.
4. Uden CJT, Vleuten CJM, van der Kooloos JGM, Haenen JH, Wollersheim H.
Gait and calf muscle endurance in patients with chronic venous insufficiency.
Clin Rehabil. 2005;19(3):339-344.
5. Yang D, Van Dongen YK, Stacey MC. Effect of exercise on calf muscle pump function in patients with chronic venous disease. Br J Surg. 1999;86(3):338-341.
1287
6. Kan YM, Delis KT. Hemodynamic effects of supervised calf muscle exercise in
patients with venous leg ulceration: a prospective controlled study. Arch Surg.
2001;136(12):1364-1369.
7. Orsted HL, Radke L, Gorst R. The impact of musculoskeletal changes on the dynamics of the calf muscle pump. Ostomy Wound Manage. 2001;47(10):18-24.
8. Brandjes DP, Buller HR, Heijboer H, et al. Randomised trial of effect of compression stockings in patients with symptomatic proximal-vein thrombosis. Lancet.
1997;349(9054):759-762.
9. Ibegbuna V, Delis KT, Nicolaides AN, Aina O. Effect of elastic compression stockings on venous hemodynamics during walking. J Vasc Surg. 2003;37(2):420425.
10. Erickson CA, Lanza DJ, Karp DL, et al. Healing of venous ulcers in an ambulatory care program: the roles of chronic venous insufficiency and patient compliance.
J Vasc Surg. 1995;22(5):629-636.
11. Franks PJ, Oldroyd MI, Dickson D, Sharp EJ, Moffatt CJ. Risk factors for leg ulcer recurrence: a randomized trial of two types of compression stocking. Age
Ageing. 1995;24(6):490-494.
12. Mayberry JC, Moneta GL, Taylor LM, Porter JM. Fifteen years of ambulatory compression therapy for chronic venous ulcers. Surgery. 1991;109(5):575-581.
13. Kjaer ML, Jorgensen B, Karlsmark T, Holstein P, Simonsen L, Ottrup F. Does the
pattern of venous insufficiency influence healing of venous leg ulcers after skin
transplantation? Eur J Vasc Endovasc Surg. 2003;25(6):562-567.
14. Serup J, Kettis Lindblad A, Marott M, et al. To follow or not to follow dermatological treatment: a review of the literature. Acta Derm Venereol. 2006;86(3):
193-197.
15. World Health Organization. The World Health Report 2002: Reducing Risks, Promoting Healthy Life. Geneva, Switzerland: World Health Organization; 2002.
16. Blair SN, Haskell WL, Ho P, et al. Assessment of habitual physical activity by a
seven-day recall in a community survey and controlled experiments. Am J
Epidemiol. 1985;122(5):794-804.
17. Sallis JF, Bueno MJ, Roby JJ, Micale FG, Nelson JA. Seven day recall and other
physical activity self reports in children and adolescents. Med Sci Sports Exerc.
1993;25(1):99-108.
18. Craig C, Marshall AL, Sjöstrom M, et al. International physical activity questionnaire: 12-country reliability and validity. Med Sci Sports Exerc. 2003;35(8):
1381-1395.
19. Goris AH, Meijer EP, Kester A, Westerterp KR. Use of a triaxial accelerometer to
validate reported food intakes. Am J Clin Nutr. 2001;73(3):549-553.
20. Westerterp KR. Physical activity assessment with accelerometers. Int J Obes Relat
Metab Disord. 1999;23(3 suppl):S45-S49.
21. Melanson EL, Freedson PS. Physical activity assessment: a review of methods.
Crit Rev Food Sci Nutr. 1996;36(5):385-396.
22. Cullum N, Nelson EA, Fletcher AW, Sheldon TA. Compression for venous leg ulcers.
Cochrane Database Syst Rev. 2001;CD000265(2).
23. Nelson EA, Bell-Syer SEM, Cullum NA. Compression for preventing recurrence
of venous ulcers. Cochrane Database Syst Rev. 2000;CD002303(4).
24. Ooijendijk W, Hildebrandt V, Jacobusse G, Hopman-Rock M. Bewegen in Nederland 2002-2004. The Hague, the Netherlands: Dutch Ministry of Health, Welfare and Sport (VWS); 2006. TNO report.
25. Sabate E. Adherence to Long-Term Therapies: Evidence for Action. Geneva, Switzerland: World Health Organization; 2003:17-39.
26. Renzi C, Picardi A, Abeni D, et al. Association of dissatisfaction with care and
psychiatric morbidity with poor treatment compliance. Arch Dermatol. 2002;
138(3):337-342.
27. Edwards LM. Why patients do not comply with compression bandaging. Br J
Nurs. 2003;12(11 suppl):S5-6,S8,S10.
28. Kiev J, Noyes LD, Rice JC, Kerstein MD. Patient compliance with fitted compression hosiery monitored by photoplethysmography. Arch Phys Med Rehabil. 1990;
71(6):376-379.
ARCHIVES Feature
Free color publication if color illustrations enhance the
didactic value of the article.
1288
CONSENSUS STATEMENT
Consensus Panel Recommendations for Chronic
and Acute Wound Dressings
Michel Vaneau, PharmD; Guillaume Chaby, MD; Bernard Guillot, MD; Philippe Martel, MD;
Patricia Senet, MD; Luc Téot, MD, PhD; Olivier Chosidow, MD, PhD
Objective: To seek a consensus on recommendations
that would help health professionals choose appropriate wound dressings in daily practice, since a systematic
review found only limited evidence to support reported
indications for modern wound dressings.
Participants: A steering committee selected a panel of
27 experts with no declared conflicts of interest from lists
of nursing staff and physicians (specialists or general
practitioners) with long-standing experience of wound
care. The lists were put forward by 15 French learned
societies.
Evidence: The panelists received a recent systematic
review of the literature, a classification of indications
established by a working group, and definitions for the
dressings.
Consensus Process: The steering committee designed
questionnaires on chronic wounds and on acute wounds
including burns for each of the 2 panels. The consensus
Author Affiliations: Haute
Autorité de Santé, Saint Denis,
France (Drs Vaneau and
Martel); Department of
Dermatology, Centre Hospitalier
Universitaire (CHU) d’Amiens,
Amiens, France (Dr Chaby);
CHU de Montpellier,
Montpellier, France
(Dr Guillot); Department of
Geriatrics, Hôpital Charles
Foix, Ivry/Seine, France
(Dr Senet); Department of
Plastic and Reconstructive
Surgery, Hôpital Lapeyronie,
Montpellier (Dr Téot); and
Université Pierre-et-MarieCurie-Paris 6 and Department
of Dermatology and Allergy,
Assistance Publique–Hôpitaux
de Paris, Hôpital Tenon, Paris,
France (Dr Chosidow).
method was derived from the nominal group technique
adapted by RAND/UCLA. Panelists rated the relevance
of each possible dressing-indication combination on the
basis of the published evidence and their own experience. After the first round of rating, they met to discuss
results and propose recommendations before taking part
in a second round of rating. The working group peer reviewed the final recommendations.
Conclusions: A strong consensus was reached for use
of the following combinations: for chronic wounds, (1)
debridement stage, hydrogels; (2) granulation stage, foam
and low-adherence dressings; and (3) epithelialization
stage, hydrocolloid and low-adherence dressings; and for
the epithelialization stage of acute wounds, lowadherence dressings. For specific situations, the following dressings were favored: for fragile skin, lowadherence dressings; for hemorrhagic wounds, alginates;
and for malodorous wounds, activated charcoal.
Arch Dermatol. 2007;143(10):1291-1294
P
UBLISHED SYSTEMATIC RE views of the value of different types of dressing in the
management of acute and
chronic wounds provide only
weak levels of evidence for their clinical
efficacy.1-3 An updated systematic review
by our team has confirmed the lack of highevidence-level data (see companion article [Chaby et al4]).
The best evidence in our review suggests that hydrocolloid dressings and alginate dressings are effective in the treatment of chronic wounds, and foam
dressings and hydrofiber dressings are effective in the treatment of acute wounds,
regardless of healing stage. Alginate dressings are for use at the debridement stage
of chronic wounds. However, it was only
for these 3 types of wound dressing that
the evidence was good enough to reach a
firm conclusion. Evidence is still scant for
the relative efficacy of other types of dress-
1291
ing. This is why we decided to set up a formal consensus process to establish which
dressings are most commonly accepted and
recommended by physicians and nurses
See also page 1297
and to provide recommended indications
for each type of dressing. Our assumption
was that, depending on the kind of wound
and the healing stage, it should be possible to provide appropriate, pragmatic criteria for choosing a particular dressing.
PARTICIPANTS
The consensus process (March-September 2006) was sponsored by Haute Autorité de Santé (HAS), the French National
Authority for Health. In 2004, the sponsor nominated the chairman of a working
group (O.C.), who selected, together with
Working group
Systemic review
Classification of indications for dressings
Chairman selects steering committee
Steering committee
Selection of panelists with help of
learned societies
Design of first-round questionnaires
Two expert panels
(chronic/acute wounds)
First rating round
Meeting of experts
Amendments and proposals
Steering committee
Review of ratings and amendments
Design of second-round questionnaires
Panelists
Second rating round
Working group
Peer review of consensus
• Alginate: alginate main component, supplementation by carboxymethylcellulose
allowed
• Activated charcoal containing dressing
• Corticoid-supplemented paraffin gauze (added to the second questionnaire at the
request of the acute wounds expert panel)
• Collagen: any dressing containing collagen
• Polymer foam dressing
• Hyaluronic acid supplemented: any dressing containing hyaluronic acid
• Hydrofiber: carboxymethylcellulose fiber dressings
• Hydrocolloid: polymer dressings with medium absorption properties and containing
carboxymethylcellulose
• Hydrogel
• Low-adherent or “interface” dressing: with low rate of migration of the impregnating
substance (thus excluding standard paraffin gauzes)
• Polyurethane film
• Silver supplemented: any dressing containing silver (other characteristics and silver
kinetics unspecified)
• Standard paraffin gauze
• Woven gauze
• Unwoven gauze
Figure 2. Types of dressing.
CONSENSUS PROCESS
Final consensus
Figure 1. Flowchart of consensus method.
the sponsor, 20 working group members (pharmacists, dermatologists, and other physicians specializing in wound
care), who were to perform and discuss a systematic review of the literature on dressings for wound care. Because this review found only limited evidence to support
the proposed indications for wound dressings (see Chaby
et al4), the decision was taken to carry out a formal consensus. It was set up and run by a steering committee of 7
members (the authors of the present article) chosen by the
chairman (O.C.) from among the working group members. To select consensus panel participants, the steering
committee asked 15 learned societies to each submit a list
of 4 to 6 experts (nursing staff and physicians and either
specialists or general practitioners) with experience in
wound care. Fourteen societies responded (available in an
eTable [http://www.archdermatol.com]) and proposed the
names of 78 experts. The steering committee ranked these
experts on the basis of their suitability for inclusion in 1
of 2 panels (one on chronic wounds and the other on acute
wounds). If there was no expert with the required experience in a specific field, the steering committee consulted lists of experts with similar experience maintained
by HAS. Written declarations of interest were obtained by
HAS from all participants. Experts declaring any permanent link with industry, ongoing clinical work sponsored
by industry, or who were not available for the panel meeting were excluded. At the end of the selection process, 14
experts were assigned to the chronic wounds panel and
13 to the acute wounds panel.
EVIDENCE
Evidence for the relative efficiency of dressings was from
a systematic review of the literature conducted by the second author (G.C., see Chaby et al4).
We used a consensus method adapted from the RAND/
UCLA nominal group technique method (Figure 1).5,6
The steering committee designed 2 questionnaires (222
items for the chronic wound questionnaire and 263 for
the acute wound questionnaire) and wrote the instructions for completing them. Apart from the relevant questionnaire, the expert panelists received a report describing the findings of the systematic review, a classification
of indications established by the working group, and a
list of the different types of dressing under consideration with explanatory comments (Figure 2). In the questionnaires, indications were listed from the most specific to the least specific (eg, infected before unspecified
chronic wounds) so that panelists would not be tempted
to provide answers relating to specific situations to questions that were of a more general nature. The questionnaire did not address dressing selection in relation to the
amount of exudates or wound area because these factors are highly dependent on the stage of healing and/or
vary considerably over time. Panelists could choose any
dressing appropriate for a particular wound stage (eg, absorbent foam dressings).
Panelists were asked to rank the dressings that were
“most often useful” in any given indication first, followed by the dressings that “may be used in some cases.”
They had to rate the dressing in the light of clinical efficiency as given by the available evidence and their own
experience on a scale from 1 (totally inappropriate) to 9
(totally appropriate). A rating of 5 reflected indecision.
In addition, they had to answer general questions on usefulness criteria in selecting dressings. We made every effort to retrieve any missing ratings.
The panelists met between the 2 rounds of the consensus process. They were informed of the results of the
first round, commented on their own ratings, and suggested amendments to the questionnaires. If the ratings
for a given question were in the 1 to 3 range or in the 7
to 9 range, and there were no missing ratings, this was
considered to be a sign of strong disagreement or of strong
agreement. These proposals were not reassessed in the
1292
Table 1. Results of the 2 Rounds
Table 2. Evidence for and Opinion on Use of Different Types
of Dressing at Different Stages of Care for Chronic
and Acute Wounds
Chronic
Acute
Wound
Wound
Questionnaire Questionnaire
Round
First
Strong agreement at issue of
first round
Strong disagreement at issue of
first round
Total of strong agreements or
disagreements in the first round
Second
No missing responses
A single missing response
More than 1 missing response
Strong agreement at issue of
second round
Strong disagreement at issue of
second round
Total of strong agreements or
disagreements in second round
222 items
17
263 items
6
9
1
26
7
196 Items
190
4
2
14
255 Items a
238
10
7
22
36
31
50
53
Variable
second round. For all the other proposals, the steering
committee used all the information from the first round
and from the between-round discussion to design a second set of questionnaires for submission to the panelists in the second round (196 items for chronic wounds
and 255 items for acute wounds). We applied the same
decision rules in the second round, after deleting the highest and the lowest ratings (whenever there were no missing data), to discard incongruent responses.
The questionnaires for the first round were sent out
on June 1, 2006, and for the second round, on July 11,
2006. All panelists completed both rounds (1 firstround questionnaire was retrieved after the panel meeting). The acute wounds panel meeting ( June 19, 2006)
was attended by12 of 13 panelists, and the chronic wounds
panel meeting (June 26, 2006), by 12 of 14 panelists. Data
retrieval was complete on September 20, 2006. Results
are given in Table 1. There was no agreement in the
second round on any of the proposals with missing responses. However, even if the missing rating had always
been a maximum of 9, none of these proposals would have
fallen in the strong agreement category. The steering group
only reported proposals on which there was strong or relatively strong agreement in favor of a given indicationdressing combination to the working group, which met
on September 27, 2006, to review and approve the final
consensus statements.
CONCLUSIONS
The consensus statements on which there was strong
agreement on the “most often useful” dressing type for
a given indication are summarized in Table 2. The most
suitable dressings for chronic wounds were considered
to be hydrogel dressings at the debridement stage, foam
and low-adherent dressings at the granulation stage, and
hydrocolloid and low-adherent dressings at the epithe-
Wound Type a
or Cause
Stage of healing
None in particular Chronic
Acute
Granulation c
Chronic
Acute
Chronic
Hydrocolloid
Foam, hydrofiber
dressings
Alginate
None
None
Epithelialization d
Acute
Chronic
None
None
Acute
None
Debridement b
Specific cases
Fragile skin
Prevention of
infection
Infected wound
Hemorrhagic
wound
Malodorous
wound
a There were 255 instead of 256 items because 6 items considered to be
irrelevant by the panel were deleted and 5 new items were added.
Level B
Evidence
(Literature
Review)
Strong
Agreement
(Formal
Consensus)
None
None
Hydrogel
None
Low adherence,
foam
None
Low adherence,
hydrocolloid
Low adherence
Epidermolysis None
bullosa
Any cause
None
Low adherence
None
Any cause
Any cause
None
None
None
Alginate
Carcinoma
None
Activated
charcoal
a Chronic wounds were defined as wounds expected to take time to heal
because of 1 or more factors delaying healing. Depending on the cause of the
wound, wounds taking more than 4 to 6 weeks to heal were considered to be
chronic. They included venous leg ulcers, pressure ulcers, diabetic foot ulcers,
extended burns, and amputation wounds. Acute wounds were defined as
wounds expected to heal in the usual time with no local or general factor
delaying healing (eg, burns, split-skin donor grafts, skin graft donor site,
sacrococcygeal cysts, bites, frostbites, deep dermabrasions, and postoperative
guided tissue regeneration).
b Debridement stage is defined as the wound stage at which debridement is
required.7
c Granulation stage is defined as the wound stage at which the wound is
recovered by a newly formed tissue of pink granular appearance (granulation
tissue).8
d Epithelialization stage is defined as the wound stage at which migration of
the keratinocytes across the wound surface occurs.8
lialization stage (see dressing definitions in Figure 2). Lowadherent dressings were favored at the epithelialization
stage of acute wounds. Certain dressings were appropriate for specific situations: low-adherent dressings for fragile skin, alginates for hemorrhagic wounds, and activated charcoal for malodorous wounds. The amount of
wound exudates was not investigated. However, both panels agreed that the following criteria were useful when
choosing a dressing: pain on application and removal,
management of exudates, and dressing tolerance.
Interestingly, the consensus statements giving rise to
strong agreement did not confirm the highest level (level
B) evidence from the literature,9,10 maybe because the indications defined in published clinical trials are only of
limited relevance to real-life situations in which considerations such as the stage of the healing process or the
specific nature of the case (eg, hemorrhagic or malodorous wounds) tend to prevail.
There was no evidence nor consensus for claims that
certain dressings (eg, silver-containing antibacterial dress-
1293
ings) are best suited to specified indications, such as care
of infected wounds or prevention of infection. Nor was any
consensus reached on classic paraffin gauzes despite their
widespread use. Paradoxically, many panelists used paraffin gauzes, often combined with other topical agents,
either in their routine daily practice or in specialized treatment protocols (eg, specific surgical procedures or care
of extensive burns), even though they could not come to
any agreement on their clinical value. Cost may be a factor to be taken into consideration here. Our questionnaires did not address highly specialized treatment protocols. Exploring such indications would require more
detailed descriptions of wounds that include a consideration of their cause and healing stage and would need the
contribution of experts in wound etiology.
Accepted for Publication: June 14, 2007.
Correspondence: Olivier Chosidow, MD, PhD, Department of Dermatology and Allergy, Hôpital Tenon, 4 rue
de la Chine, 75970 Paris, CEDEX 20, France (olivier
[email protected]).
Author Contributions: Study concept and design: Vaneau, Senet, Téot, and Chosidow. Acquisition of data: Vaneau, Guillot, Martel, and Chosidow. Analysis and interpretation of data: Vaneau, Chaby, Guillot, Martel, Senet,
and Chosidow. Drafting of the manuscript: Vaneau. Critical revision of the manuscript for important intellectual content: Chaby, Guillot, Martel, Senet, Téot, and Chosidow.
Statistical analysis: Martel. Obtained funding: Vaneau.
Administrative, technical, and material support: Vaneau and
Martel. Study supervision: Vaneau, Guillot, Senet, and
Chosidow.
Financial Disclosure: Drs Chosidow and Senet are presently involved in building a protocol using Dermagen, a
dermal substitute (a cell therapy product) in diabetic foot
ulcers. Dermagen is developed by Genevrier (Sophia
Antipolis, France), which also sells hyaluronic acid–
associated dressings. Dr Téot is involved in the following collaborations and partnerships: scientific collaboration on wound dressings with Braun (randomized trial
on Calgitrol [a silver alginate wound dressing] [Magnus
Bio-Medical Technologies] vs alginate in infected wounds)
and Kinetic Concepts Inc (KCI) (and the French Ministry of Health) on a medical-economic study of the effects of vacuum-assisted closure (KCI); editorial collaboration with Mölnlycke Products (pain and dressing
changes for acute wounds), KCI (on technical considerations on vacuum-assisted closure [World Union of
Wound Healing Societies statement]), and Coloplast (on
pain management of wounds); and educational partnerships with Smith & Nephew, Johnson & Johnson, and
Urgo.
Additional Information: The eTable is available at http:
//www.archdermatol.com.
Additional Contributions: The authors were all members of the steering committee. The working group who
participated in peer reviewing the consensus statements
included Hélène Bachelet, pharmacist, Lille; Hervé Carsin, burns specialist, Clamart; Clélia Debure, dermatologist, Paris; Catherine Denis, endocrinologist and gynecologist, Saint Denis; Anne Dompmartin, dermatologist,
Caen; Serge Grau-Ortiz, general practitioner, Auterive;
Jean-Claude Guillaume, dermatologist, Colmar; Véronique Matz, pharmacist, Bar-le-Duc; Sylvie Meaume, geriatrician, Ivry sur Seine; Jean-Louis Richard, diabetologist, Le Grau du Roi; Jean-Michel Rochet, specialist in
physical and rehabilitation medicine, Coubert; Nathalie
Sales-Ausias, pharmacist, Marseille; and Anne Zagnoli,
dermatologist, Brest; France. The members of the chronic
wounds expert panel included Francis Ane, general practitioner, Montpellier; Hermine Arzt, specialist in physical and rehabilitation medicine, Amiens; Sophie Beyrand, nurse, Panazol; Sophie Blaise, dermatologist and
specialist in vascular medicine, Grenoble; Maxime Chahim, phlebologist and angiologist, Paris; Catherine Gilbert, nurse, Paris; Georges Ha Van, specialist in physical and rehabilitation medicine, Paris; Chantal Le Goff,
nursing manager (geriatrics), Le Mans; Laurent Machet, dermatologist, Tours; Philippe Nicolini, vascular surgeon, Lyon; Vincent Ould-Aoudia, geriatrician, Nantes;
Nathalie Salles, geriatrician, Pessac; François Truchetet,
dermatologist, Thionville; and Loı̈c Vaillant, dermatologist and lymphologist, Tours; France. The members of
the acute wounds expert panel included Serge Baux, burns
specialist, Paris; Françoise Blech, hygiene specialist,
Nancy; Fabienne Braye, burns specialist, Lyon; José
Clavero, general practitioner, Paris; Nadine Favier, nurse,
Montpellier; Ciprien Isacu, burns specialist, Bordeaux;
Eric Jehle, emergency physician, Clermont-Ferrand; Laurent Lantieri, specialist in plastic and reconstructive surgery, Créteil; Jean-Louis Lorin, gastrointestinal surgeon, Bourg-de-Péage; Denis Pouchain, general
practitioner, Vincennes; Michel Scepi, emergency physician, Poitiers; Claude Soulier, nurse, Nı̂mes; and JeanPaul Viand, general practitioner, Paris; France. Fréderic
De Bels, pharmacist, Haute Autorité de Santé, Saint Denis, France, contributed to the design of the consensus
process and questionnaires.
REFERENCES
1. Bradley M, Cullum N, Nelson EA, Petticrew M, Sheldon T, Torgerson D. Systematic reviews of wound care management, 2: dressings and topical agents used
in the healing of chronic wounds. Health Technol Assess. 1999;3(17, pt 2):
1-35.
2. Vermeulen H, Ubbink D, Goossens A, Vos R, Legemate D. Dressings and topical
agents for surgical wounds healing by secondary intention. Cochrane Database
Syst Rev. 2004;(2):CD003554. doi:10.1002/14651858.CD003554.pub2.
3. Palfreyman SJ, Nelson EA, Lochiel R, Michaels JA. Dressings for healing venous leg ulcers. Cochrane Database Syst Rev. 2006;(3):CD001103.
doi:10.1002/14651858.CD001103.pub2.
4. Chaby G, Senet P, Vaneau M, et al. Dressings for acute and chronic wounds: a
systematic review. Arch Dermatol. 2007;143(10):1297-1304.
5. Fitch K, Bernstein SJ, Aguilar MD, et al. The RAND/UCLA Appropriateness Method
User’s Manual. Santa Monica, CA: RAND; 2001.
6. Haute Autorité de Santé. Bases méthodologiques pour l’élaboration de recommandations professionnelles par consensus formalisé. 2006. http://www.has-sante
.fr/portail/upload/docs/application/pdf/base_methodo_CFE.pdf. Accessed January 2, 2007.
7. Falanga V. Cutaneous Wound Healing. London, England: Martin Dunitz; 2001.
8. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med. 1999;341(10):738746.
9. Sackett DL. Rules of evidence and clinical recommendations on the use of antithrombotic agents. Chest. 1989;95(2)(suppl):2S-4S.
10. Sackett DL. A science for the art of consensus. J Natl Cancer Inst. 1997;89(14):
1003-1005.
1294
WEB-ONLY CONTENT
eTable. Collaborating Learned Societies
Expertise
Name
Angiology
Burns
Société Française d’Angéiologie (SFA)
Société Française d’Etude et de
Traitement de la Brûlure (SFETB)
Société Française de Dermatologie (SFD)
Société Française de Médecine Générale
(SFMG)
Société Française de Gériatrie et de
Gérontologie (SFGG)
Société Française de Lymphologie (SFL)
Fédération Nationale des Infirmiers (FNI)
Société Française de Médecine Physique
et de Réadaptation (SFMPR)
Société Française de Phlébologie (SFP)
Société de Chirurgie Vasculaire de
Langue Française (SCVLF);
Société Française de Médecine
Vasculaire (SFMV)
Société Française et Francophone des
Plaies et Cicatrisations (SFFPC)
Société Française d’Hygiène Hospitalière
(SFHH)
Société Francophone de Médecine
d’Urgence (SFMU)
Dermatology
General practice
Gerontology
Lymphology
Nursing
Physical and rehabilitation
medicine
Phlebology
Vascular surgery
Wound care
Hygiene
Emergency medicine
E1
REVIEW
Dressings for Acute and Chronic Wounds
A Systematic Review
Guillaume Chaby, MD; Patricia Senet, MD; Michel Vaneau, PharmD; Philippe Martel, MD;
Jean-Claude Guillaume, MD; Sylvie Meaume, MD; Luc Téot, MD, PhD; Clélia Debure, MD;
Anne Dompmartin, MD; Hélène Bachelet, PharmD; Hervé Carsin, MD; Véronique Matz, PharmD;
Jean Louis Richard, MD; Jean Michel Rochet, MD; Nathalie Sales-Aussias, PharmD;
Anne Zagnoli, MD; Catherine Denis, MD; Bernard Guillot, MD; Olivier Chosidow, MD, PhD
Objective: To critically review the literature on the efficacy of modern dressings in healing chronic and acute
wounds by secondary intention.
a modification of Sackett’s 1989 criteria. Ninety-three articles were finally graded.
Data Synthesis: We found no level A studies, 14 level
Data Sources: Search of 3 databases (MEDLINE,
EMBASE, and the Cochrane Controlled Clinical Trials
Register) from January 1990 to June 2006, completed by
manual research, for articles in English and in French.
Study Selection: The end points for selecting studies
were the rate of complete healing, time to complete healing, rate of change in wound area, and general performance criteria (eg, pain, ease of use, avoidance of wound
trauma on dressing removal, ability to absorb and contain exudates). Studies were selected by a single reviewer. Overall, 99 studies met the selection criteria (89
randomized controlled trials [RCTs], 3 meta-analyses [1
of which came from 1 of the selected systematic reviews],
7 systematic reviews, and 1 cost-effectiveness study).
Data Extraction: The RCTs, meta-analyses, and costeffectiveness studies were critically appraised by 2 reviewers to assess the clinical evidence level according to
W
B studies (11 RCTs and 3 meta-analyses), and 79 level C
studies. Hydrocolloid dressings proved superior to saline gauze or paraffin gauze dressings for the complete
healing of chronic wounds, and alginates were better than
other modern dressings for debriding necrotic wounds.
Hydrofiber and foam dressings, when compared with
other traditional dressings or a silver-coated dressing, respectively, reduced time to healing of acute wounds.
Conclusions: Our systematic review provided only weak
levels of evidence on the clinical efficacy of modern dressings compared with saline or paraffin gauze in terms of
healing, with the exception of hydrocolloids. There was
no evidence that any of the modern dressings was better
than another, or better than saline or paraffin gauze, in
terms of general performance criteria. More wound care
research providing level A evidence is needed.
Arch Dermatol. 2007;143(10):1297-1304
OUNDS ARE A MAJOR
cause of morbidity
and impaired quality of life and take up
substantial health
care resources in developed countries.1 Each
year in the United States, over 1.25 million
people experience burns, and 6.5 million
See also page 1291
Author Affiliations are listed at
the end of this article.
have chronic skin ulcers caused by pressure, venous stasis, or diabetes mellitus.2
Since the 1960s, it has been accepted
that wound healing is optimal when the
wound is kept in a moist environment
rather than air dried.3,4 Occlusive or semi-
1297
occlusive dressings that promote reepithelialization and wound closure have been
developed for chronic and acute wounds
to reduce pain and healing time, absorb
blood and tissue fluids, and to be painless on application and removal.5 The main
occlusive or semi-occlusive dressings are
hydrocolloid dressings (HCDs), alginates, hydrogels, foam dressings (FDs), hydrofiber dressings (HFDs), and paraffin
gauze and nonadherent dressings. Recent products that are reported to induce
angiogenesis or reduce infection are hyaluronic acid (HA) cream or dressings and
dressings supplemented with activated
charcoal or silver.
Current clinical practice guidelines on
the treatment of pressure ulcers, leg ul-
Table 1. Keywords and Selection Criteria
Key Words
MEDLINE
EMBASE
Selection Criteria
Randomized controlled trials, or meta-analysis, or review,
or review-literature, or guidelines, or consensus, or
consensus-development-conferences or congresses or
recommendation(s) in combination with bandages,
including hydrocolloid dressings, hydrocellular or
polyurethane foams, alginate dressings, hydrogels,
hydrofiber dressings, dextranomer, paraffin dressing,
nonadherent dressings, dressings containing
hyaluronic acid, silver-coated dressing or activated
charcoal dressing, protease-modulating matrix
(Promogran a) in combination with wound healing or
vacuum or vacuum-assisted closure or negative
pressure wound therapy, or topical negative pressure
or leg ulcer or therapy, drug therapy, nursing, surgery
or decubitus ulcer or therapy, drug therapy, nursing
and surgery or chronic disease or therapy, drug
therapy, nursing and surgery or surgical-wounddehiscence or therapy, drug therapy, nursing and
surgery or surgical wound infection or therapy, drug
therapy, nursing and surgery or skin transplantation or
therapy, drug therapy, nursing and surgery or skin
diseases vesiculobullous or therapy, drug therapy,
nursing, and surgery or nursing or surgery or burns or
skin graft or donor site or skin ulcer or pressure or
diabetic with ulcer or trauma(tism)and wound(ing) or
drug therapy or therapy or nursing
Review or systematic review or meta-analysis
or practice guideline or consensus or
conference-paper or recommendation(s)
or randomized-controlled-trial in
combination with bandages-anddressings, or wound-dressing or colloid or
hydrogel or calcium-alginate or
polyurethane or charcoal or silver or
hyaluronic-acid in combination with
leg-ulcer or decubitus or skin-ulcer or
donor-site or bullous-skin-disease or
trauma(tism) with wound(ing) or pressure
or diabetic with ulcer or surgery or drug
therapy or nursing or therapy
Complete healing measured by an
objective method: rate of complete
healing or time to complete healing or
rate of change in wound area and/or
volume; pain or ease of use or
avoidance of wound trauma on
dressing removal or ability to absorb
and contain exudates or prevention of
infection or cost
a Johnson
& Johnson, Issy-les-Moulineaux, France.
cers, and diabetic foot lesions and available systematic
reviews on the treatment of arterial leg ulcers or surgical
wounds have not established a care strategy for each type
of wound.6-12 The choice of ideal dressing remains controversial. We assessed the level of published clinical evidence in support of the efficacy of modern dressings for
the care of chronic and acute wounds in terms of complete healing or aspects such as pain, ease of use, avoidance of wound trauma on dressing removal, ability to absorb and contain exudates, and prevention of infection.
METHODS
DATA SOURCES AND SELECTION CRITERIA
Three bibliographic databases were searched from January 1990
to June 2006: MEDLINE, EMBASE, and the Cochrane Controlled Clinical Trials Register. The search was restricted to publications in English and in French. Keywords and selection criteria are given in Table 1. From the list of retrieved titles and
abstracts, 1 reviewer (G.C.) selected the studies that used these
selection criteria to compare dressings. Case reports and case
series were excluded. The reviewer checked study relevance and
design using the full versions of the articles. Additional references were retrieved by manual searches.
Wounds were considered to be chronic if time to healing
was delayed as a result of impaired tissue repair due to poor
oxygenation, malnutrition, or infection.13 Chronic wounds include leg ulcers, pressure sores, and diabetic foot ulcers. Acute
wounds, however, tend to undergo an orderly and timely repair process that results in sustained restoration of anatomic
and functional integrity.14 They include skin graft donor sites,
partial-thickness burns, and posttraumatic and surgical wounds
that heal by secondary intention. Studies on deep partial- and
full-thickness burns were excluded.
CRITICAL APPRAISAL
OF SELECTED STUDIES
Selected studies were distributed among 19 reviewers who were
asked to grade trials using a checklist of items for methodological quality based on a modified version of Sackett’s criteria for
clinical evidence.15,16 Each trial was graded by 2 reviewers (G.C.
and 1 other reviewer). The 2 modifications to Sackett’s criteria15,16 were as follows: (1) meta-analyses that included level C
randomized controlled trials (RCTs) were downgraded from
level A to level B, and (2) RCTs were as graded level C if they
had 1 or more of the following methodological shortcomings:
evaluation of primary outcome was not blind, randomization
method was performed incorrectly when it was described, primary and secondary objectives were not clearly defined, objective or subjective measures of dressing performance were not described, and patient groups were not comparable at baseline.17
The criteria we used for clinical evidence are given in Table 2.
RESULTS
Overall, 2330 studies were retrieved by electronic (n=2305)
and manual (n=25) searching (Figure). Of these, 141 were
considered relevant on the basis of title and/or abstract.
However, only 99 full-text articles met our selection criteria (89 RCTs, 3 meta-analyses [1 of the meta-analyses
came from 1 of the selected systematic reviews], 7 systematic reviews, and 1 cost-effectiveness study). The ref-
1298
Table 2. Criteria for Assessing Clinical Evidence a
Level
A
B
C
Table 3. Selected Studies by Type of Dressing a
Clinical Evidence
Level
Criteria
Large, randomized, double-blind, controlled studies with low
false-positive (␣) and low false-negative (␤) errors; MAs
of RCTs
RCTs including a small number of patients, thereby
increasing the likelihood of high false-positive and/or
false-negative errors; MAs that include low-evidence RCTs
(level C) a
Trials that lack 1 or more of the following criteria: evaluation
of primary outcome blind, randomization method
performed correctly when described, primary and
secondary objectives clearly defined, objective or
subjective measures of dressing performance described,
and patient groups comparable at baseline b; case reports;
case series
Type of Dressing
RCTs
18-54
Hydrocolloids
34⫹ 3
MAs
Hydrocellular or polyurethane
foam18,20,30-37,55-68
22⫹ 2
MAs
Alginate38-40,59,60,69-84
Hydrogels52,85-92
Hydrofiber77,78,93-95
Dextranomer80,91,93,96,97
Paraffin gauze21,23,27,29,57,69,71,73,74,92
Nonadherent53,82,98-101
Hyaluronic acid–impregnated97,102,103
Silver-coated65,67,83,84,104,105
Activated charcoal66
Protease-modulating matrix
(Promogran b)101,106,107
Abbreviations: MAs, meta-analyses; RCTs, randomized controlled trials.
a According to the criteria of Bouvenot and Vray.17
b According to modifications to Sackett’s criteria.15,16
21
9
5
5
10
6
3
6
1
2⫹ 1 CES
B
41,53
C
2
32
318-20
257,65
20
218,19
441,73,78,80
0
378,94,95
180
257,73
253,101
1102
165
0
1101
17
9
2
4
8
4
2
5
1
1
1
2305 References came
from electronic
search (MEDLINE,
EMBASE, Cochrane
Controlled Clinical
Trials Register)
Abbreviations: CES, cost-effectiveness study; MAs, meta-analyses;
RCTs, randomized controlled trials.
a Data are given as number of selected studies (we found no level A
studies); n = 99.
b Johnson & Johnson, Issy-les-Moulineaux, France.
141 Potentially relevant
articles (according
to title on abstract)
25 Potentially relevant
articles came from
manual search
99 Selected articles
89 RCTs
3 MAs∗
1 Cost-effectiveness
study
CHRONIC WOUND CARE
7 Systematic reviews,
consensus, and
guidelines
93 Graded articles†
0 Evidence level A
studies
14 Evidence level B
studies
11 RCTs
3 MAs
79 Evidence level C
studies
78 RCTs
1 Cost-effectiveness
study
Figure. Flowchart describing the selection of studies for analysis. MA
indicates meta-analysis; RCTs, randomized controlled trials. The asterisk
indicates that 1 of the MAs came from a selected systematic review. The
dagger indicates that 6 of the 7 systematic reviews, consensus, and
guidelines did not have any RCTs or MAs and were not critically appraised.15
erences, number of studies by type of dressing, and their
level of evidence are given in Tables 3, 4, and 5.18-108
There were no large RCTs with definitive conclusions (level
A trials) for any type of dressing. No level B trials were
found for either hydrogels or activated charcoal.
Treatment with HCD resulted in a statistically significant improvement in the complete healing rate of leg ulcers and pressure sores according to 3 meta-analyses18-20
comparing HCD with paraffin gauze and wet-to-dry gauze
dressings (odds ratio, 2.57 [95% confidence interval, 1.584.18]18; odds ratio, 2.45 [95% confidence interval, 1.185.12], P =.0219; number needed to treat, 7 [95% confidence interval, 4-16]20). However, there was no difference
between the healing rates of HCDs and FDs whether for
pressure sores or leg ulcers.18,20 An RCT101 comparing Promogran ( Johnson & Johnson, Issy-les-Moulineaux,
France) with a nonadherent dressing reported no difference in the complete healing rate of leg ulcers. In brief,
for the complete healing of chronic wounds, HCD seems
to be more effective than paraffin gauze and wet-to-dry
gauze dressings, and there is no difference between FD
and HCD in terms of optimizing complete healing rate.
Alginates considerably reduced chronic wound area in
full-thickness pressure ulcers when used sequentially with
HCD (alginates for the first 4 weeks and HCD for the next
4 weeks compared with HCD alone) and when compared
with dextranomer.41,80 Pain on removal of a dressing, although never evaluated as a primary outcome, was lower
for a nonadherent dressing than for HCD in a study of leg
ulcers.53 Maceration and odor were also less marked.53 Scores
on pain when changing a dressing were lower with an alginate than paraffin dressing in diabetic foot lesions.73
ACUTE WOUND CARE
There was no difference in the efficacy of FD, a paraffin
gauze dressing, polyethane film, or polyurethane film on
1299
Table 4. Level B Clinical Evidence for Chronic Wounds
Study
Design
Source
Bradley et al18
Type of
Dressing
Type of
Wound
Patients
(Wounds),
No.
Primary End Point
and Outcome
P
Value
Area Reduction and/or Others
Secondary Outcomes a
NA
Complete healing, 51%
vs 31%;
complete healing, OR
2.57 (95% CI,
1.58-4.18)
NA
NA
Complete healing, 51%
vs 31%, P = .02; OR,
2.45 (95% CI,
1.18-5.12)
Complete healing, HD⬎
TD; NNT, 7;
complete healing
(95% CI, 4-16)
Complete healing, NS
.02
NA
NA
NA
Review
(included MA
of 5 RCTs);
review
(included
MAs of 2
RCTs)
MA of 12 RCTs
HCD vs SG
or DS;
FD vs
HCD
Pressure sores;
leg ulcers
HCD vs SG,
PGD
Leg ulcers
693 (819)
Bouza et al20
MA of 6 RCTs;
MA of 5 RCTs
RCT
Pressures
sores;
pressure
sores
Leg ulcers
NA
Vin et al101
HCD vs SG,
PGD, CD;
FD vs
HCD
Pr vs ND
Belmin et al41
RCT
Alg and HCD Pressure sores
vs HCD
Sayag et al80
RCT
Alg vs D
Fibrous
pressure
sores
92 (92)
Lalau et al73
RCT
Alg vs PGD
Diabetic foot
lesions
77 (77)
Meaume et al53 RCT
HCD vs ND
Leg ulcers
91 (91)
Singh et al19
73 (73)
110 (110)
.37
Mean (SD) surface decrease:
36.5% (11.4%) (ND) vs
54.4% (10.9%) (Pr),
P ⬍ .001ⱕ 20% surface area
reduction: 42% (ND) vs 19%
(Pr), P = .03;
Ease of use, P = .10;
mean dressing acceptability
score, P = .17 (investigators)
and P= .06 (patients)
.001 Pain during dressing change,
P = .03; ease of use, P = .11
SAR and percentage of
patients with ⱖ40%
SAR at 4 and 8 wk;
mean (SD) SAR:
7.6 (7.1) cm2 vs
3.1 (7.2) cm2 at 8 wk;
SAR 40: 74.4% vs
58.5% at 8 wk
Time to achieve ⱖ40% ⬍.001 Mean surface area reduction per
SAR, plus granulation
week: 2.39 cm2 (Alg) vs 0.27
cm2 (D), P ⬍ .001;
tissue uniformly
minimum 40% reduction in
covering the wound
wound surface: 74% (Alg) vs
bed; median of 4 wk
42% (D), P = .002
vs ⬎8 wk)
Percentage of patients
NA
Pain during dressing change:
with granulation
lower in Alg group, P = .047
tissue over 75% of
wound area and 40%
SAR at 6 wk, NS
SAR at 8 wk, NS
NA
Pain during dressing removal,
maceration and odor: better
acceptability of ND, P ⬍ .001
Abbreviations: Alg, alginate; CD, cotton dressing; CI, confidence interval; D, dextranomer; FD, foam dressing; HCD, hydrocolloid dressing; MA, meta-analysis;
NA, not available; ND, nonadherent dressing; NNT, number needed to treat; NS, not significant; OR, odds ratio; PGD, paraffin gauze dressing; Pr, Promogran
( Johnson & Johnson, Issy-les-Moulineaux, France); RCT, randomized control trial; SAR, surface area reduction; SG, saline gauze; WDG, wet-to-dry gauze.
a Level B studies were defined as (1) RCTs including few patients but with primary outcomes evaluated blindly, randomization method performed correctly,
primary and secondary objectives clearly defined, and patient groups comparable at baseline or (2) meta-analyses including level C RCTs.
b General performance criteria are pain, ease of use, avoidance of wound trauma on dressing removal, and ability to absorb and contain exudates.
donor sites of split-thickness skin grafts.57 However, the
time to complete healing of these sites was lower with
the FD than a silver-coated dressing (SCD), and with an
HFD than with paraffin gauze.65,94 There was no difference in the complete healing rates of HFD and wet-todry gauze for surgical wounds.95 The HA-impregnated
dressings delayed time to complete healing of skin graft
donor sites when compared with a glycerine-impregnated dressing.102 In brief, FD seems to be more effec-
tive than an SCD in hastening complete healing of acute
wounds, and HFD seems more effective than paraffin
gauze.
Pain on dressing change was the primary outcome in
1 study only, which compared HFDs and alginates in surgical wound care and found no difference between these
2 types of dressing.78 When pain was a secondary outcome, HFD was superior to paraffin gauze for pain scores
in split-thickness skin graft donor sites.94 No difference
1300
Table 5. Level B Clinical Evidence for Acute Wounds a
Type of
Dressing
Type of
Wound
Patients
(Wounds),
No.
Persson and
Salemark57
Innes et al65
FD vs PGD vs
PF vs PUF
FD vs SD
SGDS
80 (80)
Complete healing at 14 d,
.30
SGDS
17 (34)
.004
Barnea et al95
HFD vs PGD
SGDS
23 (46)
Mean (SD) time to complete healing
(⬎ 90% reepithelialized),
9.1 (1.6) d vs 14.5 (6.7) d
Mean time to complete healing,
7-10 d vs 10-14 d
Cohn et al94
HFD vs WDG
SW
50 (50)
.08
Bettinger102
HA vs GD
SGDS
11 (22)
Foster et al78
HFD vs Alg
SW
Mean (SD) rate of healing (10.3
[2.0] d vs 9.1 [1.6] d)
Mean (SD) time to complete
healing, 10.3 (2) d vs 9.1 (1.6) d
Pain on dressing change, ease of
use
Source
100 (100)
Primary End Point
and Outcome
P
Value
.02
⬍.05
Area Reduction and/or Other
Secondary Outcomes b
PUF more comfortable (14 d after
surgery), P = .01
NA
Pain during dressing change: lower
for HFD, P ⬍ .001
Ease of use greater for HF,
P = .003
Ability to absorb and contain
exudates, P not calculated
NA
NA
NA
Abbreviations: Alg, alginate; FD, foam dressing; GD, glycerine-impregnated dressing; HA, hyaluronic acid–impregnated dressing; HFD, hydrofiber dressing;
NA, not available; PF, polyethane film; PUF, polyurethane film; PGD, paraffin gauze dressing; SGDS, skin graft donor site; SW, surgical wound;
WDG, wet-to-dry gauze.
a All of these studies were randomized controlled trials (RCTs). Level B studies were defined as (1) RCTs including few patients but with primary outcomes
evaluated blindly, randomization method performed correctly, primary and secondary objectives clearly defined, and patient groups comparable at baseline or (2)
meta-analyses including level C RCTs.
b Pain, ease of use, avoidance of wound trauma on dressing removal, and ability to absorb and contain exudates.
between SCD and FD was found in the incidence of positive bacterial cultures.65
COMMENT
According to our systematic review, the methodological
quality of most studies of wound dressings is poor (level
C). There is little evidence to indicate which dressings are
the most effective in chronic and acute local wound care
in terms of complete healing, comfort, and prevention of
infection. Most studies had several of the following limitations: (1) the number of patients was not based on a
sample size calculation performed beforehand; (2) the randomization method was not described; (3) assessment of
outcomes was not blinded to treatment or was not completely objective; (4) an intention-to-treat analysis was not
always used; (5) assessment of objective or subjective measures of dressing performance was not always clearly described; (6) the study population was heterogeneous, particularly in studies of leg ulcers; (7) whether adjuvant
treatments, such as pressure-relieving surfaces for pressure sores or off-loading devices for neuropathic diabetic
foot ulcers, were used in each treatment group was not
specified; and (8) a small sample size was combined with
multiple outcome measures. There is, however, good (level
B) evidence to suggest that, for chronic wounds, HCD dressings are better than saline gauze or paraffin gauze for complete healing and that alginates, used either singly or in
sequential treatment, are better than other modern dressings in reducing wound area, perhaps because they cause
debridement of necrotic tissue. There was no difference
between HCDs and FDs in terms of an optimizing complete healing rate, but this does not mean that the products are equivalent because no noninferiority trial has been
performed. Only 1 level B study73 found a statistically sig-
nificant difference for pain reduction in chronic wounds.
However, pain was a secondary outcome measure in this
study, and the result was statistically significant (P =.047).
In the case of acute wounds, the studies (level B) provided little useful information. Only 1 study reported a
notable difference in healing rate between modern dressings (an HFD) and paraffin gauze or wet-to-dry gauze
dressings (modern dressings included alginate, FD, and
HCD).95 An HA or SCD, when compared with a glycerineimpregnated dressing or an FD, respectively, delayed
healing.
No scientific evidence was found for the use of specific dressings in the following cases: hemorrhagic
wounds, malodorous wounds, fragile skin, and prevention and treatment of infection. Nor was the evidence sufficient to show a benefit of modern dressings on pain or
other performance factors in the dressing of acute or
chronic wounds when compared with saline or paraffin
gauze dressings (eg, ease of use, avoidance of wound
trauma on dressing removal, ability to absorb and contain exudates). In fact, dressing selection by physicians
is more about matching criteria such as absence of pain,
ease of use, avoidance of wound trauma on dressing removal, and ability to absorb and contain exudates rather
than healing properties. Future trials should use validated and standardized tools to measure pain, quality of
life, and comfort of use. They should assess healing using
clinically relevant objectives, especially the rate of complete healing and time to heal rather than reduction in
wound area. Other performance factors should be evaluated independently of any potential effect on healing. Intermediate goals in wound management strategy (ie, primary end points such as complete wound debridement for
hydrogel dressings and lowering of systemic infection and
prescription of antibiotics for SCDs) might be worth test-
1301
ing. Other end points could be evaluated in specific situations (eg, when there is a need to control bleeding in hemorrhagic wounds or avoid trauma in cases of fragile skin).
In conclusion, available systematic reviews of the value
of different types of dressing in the management of acute
and chronic wounds provide only weak levels of evidence on clinical efficacy.10-12,18 The review by Palfreyman et al12 identified 42 RCTs that evaluated dressings for
the treatment of venous leg ulcers but found that no dressing was better than any other in terms of number of ulcers healed.12 In our review, the studies with the best level
of evidence underline the potential interest of some modern dressings (ie, use of HCDs and FDs) in optimizing the
complete healing rate of chronic wounds, of alginates for
the debridement of necrotic tissue from chronic wounds,
and of HFDs for hastening the healing of acute wounds.
However, our review also stresses the need for more wound
care research providing level A evidence. Health care professionals require more detailed recommendations on the
use of dressings. A discussion of our review by an expert
panel would be useful in achieving professional agreement on the recommended use of dressings.
Accepted for Publication: June 14, 2007.
Author Affiliations: Department of Dermatology, Centre Hospitalier Universitaire d’Amiens, Amiens, France
(Dr Chaby); Department of Geriatrics, Assistance Publique–Hôpitaux de Paris, Hôpital Charles Foix, Ivry-surSeine, France (Drs Senet and Meaume); Dermatology Consultations, Assistance Publique–Hôpitaux de Paris, Hôpital
Rothschild, Paris, France (Dr Senet); Haute Autorité de
Santé, Saint Denis, France (Drs Vaneau, Martel, and
Denis); Department of Dermatology, Centre Hospital Général de Colmar, Colmar, France (Dr Guillaume); Department of Orthopedic Surgery and Burn and Plastic Surgery Center, Hôpital Lapeyronie, Montpellier, France
(Dr Téot); Department of Vascular Rehabilitation, Assistance Publique–Hôpitaux de Paris, Hôpital Broussais, Paris (Dr Debure); Department of Dermatology, Centre Hospitalier Universitaire de Caen, Caen, France
(Dr Dompmartin); Department of Pharmacology, Centre Hospitalier Régional Universitaire Lille, Lille, France
(Dr Bachelet); Department of Burns, Hôpital d’Instruction
des Armées Percy, Clamart, France (Dr Carsin); Department of Pharmacology, Centre Hospitalier Bar le Duc,
Bar le Duc, France (Dr Matz); Department of Nutritional Diseases and Diabetology, Centre Medical, Le Grau
du Roi, Centre Hospitalier Universitaire Nı̂mes, France
(Dr Richard); Department of Physical and Rehabilitation
Medicine, Centre de Rééducation de Coubert, Coubert,
France (Dr Rochet); Department of Pharmacology, Assistance Publique-Hôpitaux de Marseille, Marseille, France
(Dr Sales-Aussias); Department of Dermatology, Hôpitaux d’Instruction des Armées Clermont Tonnerre, Brest,
France (Dr Zagnoli); Department of Dermatology, Centre Hospitalier Universitaire de Montpellier, Montpellier
(Dr Guillot); and Université Pierre-et-Marie-Curie–Paris
VI, and Department of Dermatology and Allergy, Assistance Publique–Hôpitaux de Paris, Hôpital Tenon, Paris
(Dr Chosidow).
Correspondence: Olivier Chosidow, MD, PhD, Department of Dermatology and Allergy, Hôpital Tenon, 4 rue
de la Chine, 75970 Paris, CEDEX 20, France (olivier
[email protected]).
Author Contributions: Study concept and design: Chaby,
Senet, Vaneau, Meaume, Téot, Dompmartin, Denis, and
Chosidow. Acquisition of data: Chaby, Martel, Guillaume,
Meaume, Debure, Dompmartin, Guillot, and Chosidow.
Analysis and interpretation of data: Chaby, Senet, Martel,
Guillaume, Meaume, Téot, Dompmartin, Bachelet, Carsin, Matz, Richard, Rochet, Sales-Aussias, Zagnoli, Guillot, and Chosidow. Drafting of the manuscript: Chaby,
Senet, Vaneau, and Guillaume. Critical revision of the
manuscript for important intellectual content: Senet, Vaneau, Martel, Guillaume, Meaume, Téot, Debure,
Dompmartin, Bachelet, Carsin, Matz, Richard, Rochet,
Sales-Aussias, Zagnoli, Denis, Guillot, and Chosidow. Statistical analysis: Chaby. Obtained funding: Chaby and Vaneau. Administrative, technical, and material support: Vaneau, Martel, and Sales-Aussias. Study supervision: Chaby,
Senet, Vaneau, Guillaume, Debure, Dompmartin, Richard,
Rochet, Denis, Guillot, and Chosidow.
Financial Disclosure. Dr Meaume participates in educational programs on Profore multilayer bandaging manufactured by Smith & Nephew and is a co-organizer for
an international study on the epidemiology of pain and
wounds for Mölnlycke Products. Dr Téot is involved in
the following collaborations and partnerships: scientific
collaboration of wound dressings with Braun (randomized trial on calgitrol vs alginate in infected wounds) and
Kinetic Concepts Inc (KCI) (and the French Ministry of
Health) on a medical-economic study of the effects of
vacuum-assisted closure (KCI); editorial collaboration
with Mölnlycke Products (pain and dressing changes for
acute wounds), KCI (on technical considerations of
vacuum-assisted closure [World Union of Wound Healing Societies statement]), and Coloplast (on pain management of wounds); and educational partnerships with
Smith & Nephew, Johnson & Johnson, and Urgo. Drs
Senet and Chosidow are presently involved in building
a protocol using Dermagen to treat diabetic foot ulcers;
Dermagen is manufactured by Genevrier, a French company that also sells HA-associated dressings.
REFERENCES
1. Franks PJ, Moffatt CJ. Quality of life in patients with chronic wounds. Wounds.
1998;10(suppl E):1E-9E.
2. Singer AJ, Clark RAF. Cutaneous wound healing. N Engl J Med. 1999;341(10):
738-746.
3. Winter GD. Formation of the scab and the rate of epithelialisation of superficial
wounds in the skin of the young domestic pig. Nature. 1962;193:293-294.
4. Hinman CD, Maibach H. Effect of air exposure and occlusion on experimental
human skin wounds. Nature. 1963;200:377-378.
5. O’Toole EA, Marinkovich MP, Peavey CL, et al. Hyoxia increases human keratinocyte mobility on connective tissue. J Clin Invest. 1997;100(11):28812891.
6. Clinical Practice Guideline Number 15: Treatment of Pressures Ulcers. Rockville, MD: US Dept of Health and Human Services, Agency for Health Care Policy
and Research; 1994. AHCPR Publication 95-0652.
7. Valencia IC, Falabella A, Kirsner RS, Eaglstein WH. Chronic venous insufficiency and venous leg ulceration. J Am Acad Dermatol. 2001;44(3):
401-421.
8. Consensus development conference on diabetic foot wound care: 7-8 April 1999,
Boston, MA: American Diabetes Association. Adv Wound Care. 1999;12
(7):353-361.
9. Apelqvist J, Bakker K, van Houtom WH, Nabuurs-Franssen MH, Schaper NC;
1302
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
International Working Group on the Diabetic Foot. International consensus and
practical guidelines on the management and the prevention of the diabetic foot.
Diabetes Metab Res Rev. 2000;(suppl 1):S84-S92.
Nelson EA, Bradley MD. Dressings and topical agents for arterial leg ulcers (review) [Update of: Cochrane Database Syst Rev. 2007;(1):CD001836]. Cochrane Database Syst Rev. 2003;(1):CD001836.
Vemeulen H, Ubbink D, Goossens A, Vos R, Legemate D. Dressings and topical agents for surgical wounds healing by secondary intention (review). Cochrane Database Syst Rev. 2004;(1):CD0003554.
Palfreyman SJ, Nelson EA, Lochiel R, Michaels JA. Dressings for healing venous ulcers. Cochrane Database Syst Rev. 2006;(3):CD001103.
Falanga V. Cutaneous Wound Healing. London, England: Martin Dunitz; 2001:
155-164.
Lazarus GS, Cooper DM, Knighton DR, et al. Definitions and guidelines for assessment of wounds and evaluation of healing. Arch Dermatol. 1994;130
(4):489-493.
Sackett DL. Rules of evidence and clinical recommendations on the use of antithrombotic agents. Chest. 1989;95(2)(suppl 2):2S-4S.
Moher D, Schultz KF, Altman DG; for CONSORT Group. The CONSORT statement: revised recommendations for improving the quality of reports of parallelgroup randomised trials. Lancet. 2001;357(9263):1191-1194.
Bouvenot G, Vray M. Essais cliniques: théorie, pratique et critique. Paris, France:
Flammarion Médecine-Sciences; 1996.
Bradley M, Cullum N, Nelson EA, Petticrew M, Sheldon T, Torgerson D. Systematic
reviews of wound care management, II: dressings and topical agents used in the
healing of chronic wounds. Health Technol Assess. 1999;3(17, pt 2):1-35.
Singh A, Halder S, Menon GR, et al. Meta-analysis of randomized controlled
trials on hydrocolloid occlusive dressing versus conventional gauze dressing
in the healing of chronic wounds. Asian J Surg. 2004;27(4):326-332.
Bouza C, Saz Z, Munoz A, Amate JM. Efficacy of advanced dressings in the treatment of pressure ulcers: a systematic review. J Wound Care. 2005;14(5):
193-199.
Demetriades D, Psaras G. Occlusive versus semi-open dressings in the management of skin graft donor sites. S Afr J Surg. 1992;30(2):40-41.
Xakellis GC, Chrischilles EA. Hydrocolloid versus saline-gauze dressing in treating pressure ulcers: a cost effectiveness analysis. Arch Phys Med Rehabil. 1992;
73(5):463-469.
Hickerson WL, Kealey GP, Smith DJ, Thomson PD. A prospective comparison
of a new, synthetic donor site dressing versus an impregnated gauze dressing.
J Burn Care Rehabil. 1994;15(4):359-363.
Arnold TE, Stanley JC, Fellows EP, et al. Prospective, multicenter study of managing lower extremity venous ulcers. Ann Vasc Surg. 1994;8(4):356-362.
Ohlsson P, Larsson K, Lindholm C, Möller M. A cost-effectiveness study of leg
ulcer treatment in primary care. Scand J Prim Health Care. 1994;12(4):
295-299.
Kim YC, Shin JC, Park C, Oh SH, Choi SM, Kim YS. Efficacy of a hydrocolloid
occlusive dressing technique in decubitus ulcer treatment: a comparative study.
Yonsei Med J. 1996;37(3):181-185.
Cadier MA, Clarke JA. Dermasorb versus Jelonet in patients with burns skin
graft donor sites. J Burn Care Rehabil. 1996;17(3):246-251.
Chang KW, Alsagoff S, Ong KT, Sim PH. Pressure ulcers randomised controlled trial comparing hydrocolloid and saline gauze dressings. Med J Malaysia.
1998;53(4):428-431.
Hansson C. The effects of cadexomer iodine paste in the treatment of venous
leg ulcers compared with hydrocolloid dressing and paraffin gauze dressing.
Int J Dermatol. 1998;37(5):390-396.
Collier J. A moist, odour-free environment: a multicentred trial of a foamed gel
and a hydrocolloid dressing. Prof Nurse. 1992;7(12):804, 806, 808.
Zuccarelli F. Etude comparative du pansement hydrocellulaire Allevyn et du pansement hydrocolloide Duoderm dans le traitement local des ulcères de jambe.
Phlebologie. 1992;45(4):529-533.
Bowszyc J, Silny W, Bowszyc-Dmochowska M, Kazmierowski M, Ben-Am HM,
Garbowska T. Comparison of two dressings in the treatment of venous leg ulcers.
J Wound Care. 1995;4(3):106-110.
Thomas S, Banks V, Fear-Price M, et al. A comparison of two dressings in the
management of chronic wounds. J Wound Care. 1997;6(8):383-386.
Bale S, Squires D, Varnon T, Walker A, Benbow M, Harding KG. A comparison
of two dressings in pressure sore management. J Wound Care. 1997;6(10):
463-466.
Bale S, Hagelstein S, Banks V, Harding KG. Costs of dressings in the community.
J Wound Care. 1998;7(7):327-330.
Seeley J, Jensen JL, Hutcherson J. A randomized clinical study comparing a
hydrocellular dressing to a hydrocolloid dressing in the management of pressure ulcers. Ostomy Wound Manage. 1999;45(6):39-47.
Charles H, Callicot C, Mathurin D, Ballard K, Hart J. Randomised, comparative
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
1303
study of three primary dressings for the treatment of venous ulcers. Br J Community Nurs. 2002;7(6)(suppl):48-54.
Porter JM. A comparative investigation of re-epithelialisation of split graft donor areas after application of hydrocolloid and alginate dressings. Br J Plast
Surg. 1991;44(5):333-337.
Scurr JH, Wilson LA, Coleridge Smith PD. A comparison of calcium alginate
and hydrocolloid dressings in the management of chronic venous ulcers. Wounds.
1994;6(1):1-8.
Smith BA. The dressing makes the difference: trial of two modern dressings on
venous ulcers. Prof Nurse. 1994;9(5):348,350-352.
Belmin J, Meaume S, Rabus MT, Bohbot S. Sequential treatment with calcium
alginate dressings and hydrocolloid dressings accelerates pressure ulcer healing in older subjects: a multicenter randomized trial of sequential versus non
sequential treatment with hydrocolloid dressings alone. J Am Geriatr Soc. 2002;
50(2):269-274.
Day A, Dombranski S, Farkas C, et al. Managing sacral pressure ulcers with
hydrocolloid dressings: results of a controlled, clinical study. Ostomy Wound
Manage. 1995;41(2):52-54, 56, 58, 60, 62-65.
Routkovsky-Norval C, Meaume S, Goldfarb JM, Le Provost C, Préauchat A.
Etude comparative randomisée de deux pansements hydrocolloı̈des dans le traitement des escarres. Rev Gériatrie. 1996;21(3):213-218.
Viciano V, Castera JE, Medrano J, et al. Effect of hydrocolloid dressings on healing by second intention after excision of pilonidal sinus. Eur J Surg. 2000;
166(3):229-232.
Lı́mová M, Troyer-Caudle J. Controlled, randomized clinical trial of 2 hydrocolloid dressings in the management of venous insufficiency ulcers. J Vasc Nurs.
2002;20(1):22-34.
Wyatt D, McGowan DN, Najarian MP. Comparison of a hydrocolloid dressing
and silver sulfadiazine cream in the outpatient management of second-degree
burns. J Trauma. 1990;30(7):857-865.
Nemeth AJ, Eaglstein WH, Taylor JR, Peerson LJ, Falanga V. Faster healing and
less pain in skin biopsy sites treated with an occlusive dressing. Arch Dermatol.
1991;127(11):1679-1683.
Afilalo M, Dankoff J, Guttman A, Lloyd J. Duoderm hydroactive dressing versus silver sulfadiazine/Bactigras in the emergency treatment of partial skin thickness burns. Burns. 1992;18(4):313-316.
Goetze S, Ziemer M, Kaatz M, Lipman RD, Elsner P. Treatment of superficial
surgical wounds after removal of seborrheic keratoses: a single-blinded randomized-controlled clinical study. Dermatol Surg. 2006;32(5):661-668.
Cordts PR, Hanrahan LM, Rodriguez AA, Woodson J, LaMorte WW, Menzozian JO. A prospective, randomized trial of Unna’s boot versus Duoderm CGF
hydroactive dressing plus compression in the management of venous leg ulcers.
J Vasc Surg. 1992;15(3):480-486.
Koksal C, Bozkurt AK. Combination of hydrocolloid dressing and medical compression stocking versus Unna’s boot for the treatment of venous leg ulcers.
Swiss Med Wkly. 2003;133(25-26):364-368.
Darkovich SL, Brown-Etris M, Spencer M. Biofilm hydrogel dressing: a clinical
evaluation in the treatment of pressure sores. Ostomy Wound Manage. 1990;
29:47-60.
Meaume S, Ourabah Z, Cartier H, et al. Evaluation of lipidocolloid wound dressing in the local management of leg ulcers. J Wound Care. 2005;14(7):
329-334.
Moffatt CJ, Oldroyd MI, Dickson D. A trial of a hydrocolloid dressing in the management of indolent ulceration. J Wound Care. 1992;1(3):20-22.
Weber RS, Hankins P, Limitone E, et al. Split-thickness skin graft donor site
management. Arch Otolaryngol Head Neck Surg. 1995;121(10):1145-1149.
Martini L, Reali UM, Borgognoni L, Brandani P, Andriessen A. Comparison of
two dressings in the management of partial-thickness donor sites. J Wound
Care. 1999;8(9):457-460.
Persson K, Salemark L. How to dress donor sites of split thickness skin grafts:
a prospective randomised study of four dressings. Scand J Plast Reconstr Surg
Hand Surg. 2000;34(1):55-59.
Norkus A, Dargis V, Thomsen JK, et al. Use of a hydrocapillary dressing in the
management of highly exuding ulcers: a comparative study. J Wound Care. 2005;
14(9):429-432.
Dmochowska M, Prokop J, Bielecka S, et al. A randomized, controlled, parallel
group clinical trial of a polyurethane foam dressing versus a calcium alginate
dressing in the treatment of moderately heavily exuding venous leg ulcers.
Wounds. 1999;11(1):21-28.
Schulze HJ, Lane C, Charles H, Ballard K, Hampton S, Moll I. Evaluating a superabsorbent hydropolymer dressing for exuding venous leg ulcers. J Wound
Care. 2001;10(1):511-518.
Rubin JR, Alexander J, Plecha EJ, Marman C. Unna’s boot vs polyurethane foam
dressings for the treatment of venous ulceration. Arch Surg. 1990;125(4):
489-490.
62. Callam MJ, Harper DR, Dale JJ, et al. Lothian and Forth Valley Leg Ulcer Healing Trial, part 2: knitted viscose dressing versus a hydrocellular dressing in the
treatment of chronic leg ulceration. Phlebology. 1992;7(4):142-145.
63. Vanscheidt W, Sibbald RG, Eager CA. Comparing a foam composite to hydrocellular foam dressing in the management of venous leg ulcers: a controlled
clinical study. Ostomy Wound Manage. 2004;50(11):42-55.
64. Thomas DR, Goode PS, LaMaster K, Tennyson T, Parnell LKS. A comparison
of an opaque foam dressing versus a transparent film dressing in the management of skin tears in institutionalized subjects. Ostomy Wound Manage. 1999;
45(6):22-28.
65. Innes ME, Umraw N, Fish JS, Gomez M, Cartotto RC. The use of silver coated
dressings on donor site wounds: a prospective, controlled matched pair study.
Burns. 2001;27(6):621-627.
66. Verdú Soriano J, Rueda Lopez J, Martinez Cuervo F, Soldevilla Agreda J. Effects of an activated charcoal silver dressing on chronic wounds with no clinical signs of infection. J Wound Care. 2004;13(10):419, 421-423.
67. Jørgensen B, Price P, Andersen KE, et al. The silver-releasing foam dressing,
Contreet Foam, promotes faster healing of critically colonised venous leg ulcers: a randomised, controlled trial. Int Wound J. 2005;2(1):64-73.
68. Phillips TJ, Kappor V, Provan A, Ellerin T. A randomized prospective study of a
hydroactive dressing vs conventional treatment after shave biopsy excision. Arch
Dermatol. 1993;129(7):859-860.
69. O’Donoghue JM, O’Sullivan ST, Beausang ES, Panchal JI, O’Shaughnessy M,
O’Connor TPF. Calcium alginate dressings promote healing of split skin graft
donor sites. Acta Chir Plast. 1997;39(2):53-55.
70. Cannavo M, Fairbrother G, Owen D, Ingle J, Lumley T. A comparison of dressings in the management of surgical abdominal wounds. J Wound Care. 1998;
7(2):57-62.
71. Steenfos HH, Agren MS. A fire-free alginate dressing in the treatment of split
thickness skin graft donor sites. J Eur Acad Dermatol Venereol. 1998;11
(3):252-256.
72. Donaghue VM, Chrzan JS, Rosenblum BI, Giurini JM, Habershaw GM, Veves
A. Evaluation of collagen-alginate wound dressing in the management of diabetic foot ulcers. Adv Wound Care. 1998;11(3):114-119.
73. Lalau JD, Bresson R, Charpentier P, et al. Efficacy and tolerance of calcium alginate versus Vaseline gauze dressings in the treatment of diabetic foot lesions.
Diabetes Metab. 2002;28(3):223-229.
74. Pannier M, Martinot V, Castède JC, et al. Efficacy and tolerance of Algosteril
(calcium alginate) versus Jelonet (paraffin gauze) in the treatment of scalp graft
donor sites in children: results of a randomized study [in French]. Ann Chir Plast
Esth. 2002;47(4):285-290.
75. Williams P, Howells REJ, Miller E, Foster ME. A comparison of two alginate dressings used in surgical wounds. J Wound Care. 1995;4(4):170-172.
76. Limová M. Evaluation of two calcium alginate dressings in the management of
venous ulcers. Ostomy Wound Manage. 2003;49(9):26-33.
77. Armstrong SH, Ruckley CV. Use of a fibrous dressing in exuding leg ulcers.
J Wound Care. 1997;6(7):322-324.
78. Foster L, Moore P, Clark S. A comparison of hydrofibre and alginate dressings
on open acute surgical wounds. J Wound Care. 2000;9(9):442-445.
79. Hormbrey E, Pandya A, Giele H. Adhesive retention dressings are more comfortable than alginate dressings on split-skin-graft donor sites. Br J Plast Surg.
2003;56(5):498-503.
80. Sayag J, Meaume S, Bohbot S. Healing properties of calcium alginate dressings.
J Wound Care. 1996;5(8):357-362.
81. Stacey MC, Jopp-Mckay AG, Rashid P, Hoskin SE, Thompson PJ. The influence of dressings on venous ulcer healing: a randomised trial. Eur J Vasc Endovasc Surg. 1997;13(2):174-179.
82. O’Donoghue JM, O’Sullivan ST, O’Shaughnessy M, O’Connor TPF. Effects of a
silicone-coated polyamide net dressing and calcium alginate on the healing of
split skin graft donor sites: a prospective randomised trial. Acta Chir Plast. 2000;
42(1):3-6.
83. Meaume S, Vallet D, Morere MN, Teot L. Evaluation of silver-releasing hydroalginate dressing in chronic wounds with signs of local infection. J Wound Care.
2005;14(9):411-419.
84. Humbert P, Zuccarelli F, Debure C, et al. Leg ulcers presenting local signs of
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
107.
108.
1304
infection: interest of Biatain姞 Argent wound dressing [in French]. J Plaies Cicatrisations (JPC ). 2006;XI(52):41-47.
Gupta R, Foster ME, Miller E. Calcium alginate in the management of acute surgical wounds and abscesses. J Tissue Viab. 1991;1(4):115-116.
Thomas DR, Goode PS, LaMaster K, Tennyson T. Acemannan hydrogel dressing versus saline dressing for pressure ulcers. Adv Wound Care. 1998;11
(6):273-276.
Matzen S, Peschardt A, Alsbjørn B. A new amorphous hydrocolloid for the treatment of pressure sores. Scand J Plast Reconstr Surg Hand Surg. 1999;
33(1):13-15.
Dovison R, Keenan AM. Wound healing and infection in nail matrix phenolization wounds. J Am Podiatr Med Assoc. 2001;91(5):230-233.
Kaya AZ, Turani N, Akyüz M. The effectiveness of a hydrogel dressing compared with standard management of pressure ulcers. J Wound Care. 2005;
14(1):42-44.
Thomas S. Comparing two dressings for wound debridement. J Wound Care.
1993;2(5):272-274.
Colin D, Kurring PA, Yvon C. Managing sloughy pressure sores. J Wound Care.
1996;5(10):444-446.
Thomas SS, Lawrence JC, Thomas A. Evaluation of hydrocolloids and topical
medication in minor burns. J Wound Care. 1995;4(5):218-220.
Piaggesi A, Baccetti F, Rizzo L, Romanelli M, Navalesi R, Benzi L. Sodium carboxylmethyl-cellulose dressings in the management of deep ulcerations of diabetic
foot. Diabet Med. 2001;18(4):320-324.
Cohn SM, Lopez PP, Brown M, et al. Open surgical wounds: how does Aquacel
compare with wet-to-dry gauze? J Wound Care. 2004;13(1):10-12.
Barnea Y, Amir A, Leshem D, et al. Clinical comparative study of Aquacel and
paraffin gauze dressing for split-skin donor site treatment. Ann Plast Surg. 2004;
53(2):132-136.
Ljungberg S. Comparison of dextranomer paste and saline dressings for management of decubital ulcers. Clin Ther. 1998;20(4):737-743.
Ortonne JP. A controlled study of the activity of hyaluronic acid in the treatment of venous leg ulcers. J Dermatol Treat. 1996;7(2):75-81.
Maume S, Van De Looverbosch D, Heyman H, Romanelli M, Ciangherotti A,
Charpin S. A study to compare a new self-adherent soft silicone dressing with
a self-adherent polymer dressing in stage II pressure ulcers. Ostomy Wound
Manage. 2003;49(9):44-51.
Gotschall CS, Morrison MIS, Eichelberger MR. Prospective randomized study
of efficacy of Mepitel on children with partial-thickness scalds. J Burn Care Rehabil.
1998;19(4):279-283.
Dahlstrom KK. A new silicone rubber dressing used as a temporary dressing
before delayed split skin grafting. Scand J Plast Reconstr Surg Hand Surg. 1994;
29(4):325-327.
Vin F, Teot L, Meaume S. The healing properties of Promogran in venous leg
ulcers. J Wound Care. 2002;11(9):335-341.
Bettinger DA, Mast B, Gore D. Hyaluronic acid impedes reepithelialization of
skin graft donor sites. J Burn Care Rehabil. 1996;17(4):302-304.
Taddeucci P, Pianigiani E, Colletta V, Torasso F, Andreassi L, Andreassi A.
An evaluation of Hyalofill-F plus compression bandaging in the treatment of
chronic venous ulcers. J Wound Care. 2004;13(5):202-204.
Caruso DM, Foster KN, Blome-Eberwein SA, et al. Randomized clinical study
of hydrofibre dressing with silver or silver sulfadiazine in the management of
partial-thickness burns. J Burn Care Res. 2006;27(3):298-309.
Münter KC, Beele H, Russell L, et al. Effect of sustained silver-releasing dressing on ulcers with delayed healing: the CONTOP study. J Wound Care. 2006;
15(5):199-206.
Veves A, Sheehan P, Pham HT. A randomized, controlled trial of Promogran
(a collagen/oxidized regenerated cellulose dressing) vs standard treatment
in the management of diabetic foot ulcers. Arch Surg. 2002;137(7):822827.
Ghatnekar O, Willis M, Persson U. Cost-effectiveness of treating deep diabetic
foot ulcers with Promogran in four European countries. J Wound Care. 2002;
11(2):70-74.
Bale S, Banks V, Harding KG. A comparison of two amorphous hydrogels in
the debridement of pressure sores. J Wound Care. 1998;7(2):65-68.
SPECIAL ARTICLE
Injection Drug Use
An Understudied Cause of Venous Disease
Barbara Pieper, PhD, APRN, BC, CWOCN; Robert S. Kirsner, MD, PhD;
Thomas N. Templin, PhD; Thomas J. Birk, PhD, MPT
I
njection drug use has devastating effects on the veins, skin, muscles, and joints of the lower
extremities, thus increasing the risk of chronic venous disease (CVD). We examined the
following risk factors for CVD in persons who injected drugs: health and drug use history,
ankle mobility, pain, and skin and wound assessment. Because of deep venous thrombosis
and injury and immobility to the calf muscle pump from injected drugs, CVD occurs at a young
age. Decreased ankle joint movement, decreased walking, and increased pain are associated with
worsening CVD clinical classification. Associated venous ulcers tend to be multiple and large by
the time wound care is sought. Cellulitis and abscesses may also be present. Injection drug users
serve as a model for the multifactorial nature of CVD including vein damage, diminished ankle
range of motion, and decreased calf muscle strength. Persons who inject drugs need to have their
lower extremities assessed for CVD on a routine basis.
Arch Dermatol. 2007;143(10):1305-1309
Injected drugs, heroin being the most common, account for 12% of all illicit drug use
in the United States.1 The term injection
drug use (IDU) encompasses the 3 routes
of injecting (ie, intravenous, subcutaneous, and intramuscular). The intravenous route is preferred because of the rapid
drug response. Intravenous injecting generally begins in the veins of the arms and
upper part of the body, but as these sites
become more difficult to find, the veins of
the groin, legs, and feet are used. Because
of such factors as substances mixed (“cut”)
with the drug, injection technique, and frequency of injecting, IDU leads to venous
scarring and collapse, abscess formation and
other infections, nerve and muscle damage, and lymphatic blockage.2 While IDU
is often considered in terms of acute complications, it has long-term, deleterious effects even after stopping. Among these longterm effects is the development of chronic
venous disease (CVD). Previously, we reported CVD as a complication of IDU in a
Author Affiliations: College of Nursing (Drs Pieper and Templin), Center for
Health Research, and Department of Health Care Sciences, Eugene Applebaum
College of Pharmacy and Health Sciences (Dr Birk), Wayne State University,
Detroit, Michigan; and Department of Dermatology and Cutaneous Surgery,
University of Miami Miller School of Medicine, Miami, Florida (Dr Kirsner).
1305
large sample of persons receiving methadone treatment, with a point prevalence of
87% and more than half (52%) being in the
most advanced stages (classes 4 through 6
of the Clinical-Etiology-AnatomyPathophysiology [CEAP] classification3).4
We discuss risk factors, health and drug use
history, ankle mobility, pain, and wound
assessment for persons who injected drugs
in terms of CVD.
PATHOPHYSIOLOGIC FEATURES
OF VENOUS DISEASE
Pathophysiologic features of CVD involve abnormalities of the venous system
or other parts of the calf muscle pump of
the lower extremities. Anatomically, the
venous system of the legs consists of the
deep, superficial, and communicating/
perforator veins. The deep venous system is surrounded by muscle and fascia for
support. In contrast, the superficial system is not well supported but is protected from the higher pressures in the
deep system by 1-way valves in the perforating system. Valves throughout the venous system allow for unidirectional blood
flow to the heart. The most common
Table. The Clinical-EtiologyAnatomy-Pathophysiology Clinical
Classification3
Class
Description
0
No visible or palpable signs of
venous disease
Telangiectases or reticular veins
Varicose veins, distinguished from
reticular veins by a diameter of
ⱖ 3 mm
Edema
Pigmentation or eczema
Lipodermatosclerosis or atrophie
blanche
Healed venous ulcers
Active venous ulcer
1
2
3
4a
4b
5
6
causes of CVD are superficial vein
regurgitation and deep vein obstruction. Superficial vein regurgitation
results from dysfunctional valves in
the superficial or communicating
veins that permit the high pressure
generated in the deep venous system during calf pump contraction to
be transmitted to the superficial system. Deep vein obstruction is primarily caused by deep venous
thrombosis (DVT).
Contraction of the leg muscles activate the calf muscle pump, leading
to emptying the deep veins in a cephalic direction. The muscle joint
unit and intact venous valves of the
lower part of the leg work in a delicate balance. Normal ankle mobility
and painless calf muscle action are required for normal calf pump function. Changes to the musculoskeletal system of the leg adversely affect
the dynamics of the calf muscle pump
and can result in the clinical manifestations of venous disease (Table).
RISK FACTORS
Injection drug use “augments or intensifies” the typical CVD risk factors affecting the general population. As a result, persons who inject
drugs have an increased prevalence
of DVT.5 McColl and colleagues6 reported that the association of IDU
with DVT is as high as 21.4% for all
cases of DVT and increases to 52.4%
for women younger than 40 years.
We have also found a high prevalence of DVT, with 27% of our participants in one study reporting DVT.4
Thrombi, while extending centrally
within the vein lumen, may par-
tially or completely occlude it and are
often silent without a person ever
knowing they occurred.2 A history of
DVT increases the risk of CVD by
25.7-fold.7
Immobility as a risk factor has implications for IDU. In a stuporous
drug state, the muscles of the lower
extremities are inactive, and diminished venous return occurs. Nerve
and muscle damage from injecting
drugs may impair function of the calf
muscle and ankle joint. Whether
damage occurs directly from injections or from events related to the
stuporous state, serious leg injury
may occur, increasing the risk of
CVD by 2.4-fold.7 After injury, to
control pain in their legs and feet,
injection drug users often do not
move their feet or ankle joints while
walking, thus negatively affecting the
calf pumping mechanism.
Increasing age is a risk factor for
CVD. Injection drug use typically begins around age 19.5 years1; thus, venous damage begins at a young age.
At present, persons born between the
late 1940s and early 1960s have the
highest prevalence of IDU.8 Unlike
the general population that reports
problems with CVD in the sixth and
seventh decade of life, persons who
inject drugs have venous ulcers in
their 30s and 40s.9 As an example,
the mean age of participants in our
studies is 46 to 48 years.4,10
HEALTH AND
DRUG USE HISTORY
As health and psychosocial histories may play a critical role in understanding CVD and wound care,
they need to be carefully examined. Injection drug users have complex medical histories often reporting 2 to 3 health problems.4,10 Among
the most frequent health problems
reported are arthritis, hepatitis C, hypertension, heart disease, mental illness, human immunodeficiency virus, stomach ulcer, and diabetes
mellitus.11-13
While substance abuse might be
thought to affect a specific demography, in fact, it may occur at any
age, in either sex, in any race, or in
any socioeconomic group; therefore, its history should be assessed
for all patients. Substance use questions will provide information about
1306
cigarette, alcohol, and illicit drug use.
Tobacco use, as a comorbidity, is
common and associated with arterial disease and may negatively affect
wound healing.14 While arterial disease commonly affects one-quarter
of patients with CVD,15 whether the
incidence of arterial disease is higher
in injection drug users with CVD is
not known. Alcohol should be examined in terms of amount and frequency of use; it may be heavily consumed by some. Although a person
often has a drug preference, most use
more than 1 substance. We found
that among our participants, injecting heroin ranged from 83% to 99%
and cocaine, a vasoconstrictor that
is associated with cardiovascular
problems, by various routes ranged
from 62% to 81%.4,10,16 Besides the
type of substance, the route of use
(eg, inhaled, smoked, injected), years
of use, and location of injecting are
critical. The mechanism of CVD development may occur for a variety
of reasons in persons who use illicit
substances. We have hypothesized
that the site of injection is one such
critical factor, and for injected drugs,
we found that injecting in the groin,
legs, and feet was correlated with
CVD (␳ =0.47, P⬍ .001).4,16
Self-reported information of illicit drug users appears to be reliable.16 Although blood, urine, and
sputum analysis may document current drug use, drug use of past years
does not have a chemical analysis and
is dependent on self-report. The reliability of self-report of health and
drug use histories is high (r=0.710.95).17,18 We also found similarly
high reliability of health and drug
history questions (ie, interclass correlations for youngest and oldest ages
of injecting, years not injecting, and
total injecting years ranged from
0.90-0.98).16
ANKLE MOBILITY
Normal ankle mobility and painless calf muscle action are required
for normal calf pump function.19 In
the absence of normal function, the
muscle vein pump of the leg can be
especially impaired by restriction of
ankle joint mobility. Weight bearing and dorsiflexion of the upper
ankle joint have been suggested as
the key mechanisms for the calf
A
B
4
12
Rating of Pain and Difficulty Using Legs
Miles Walked/Hours Sitting per Day
Hours sitting (per 4 hours at work)
Miles walked (per day)
3
2
1
Leg pain
Difficulty using legs
10
8
6
4
2
0
–2
0
0
1
2
3
4
5
0
6
CEAP Classification
1
2
3
4
5
6
CEAP Classification
Figure. A, Mean amount of time spent sitting during work and the distance walked per day (A) and ratings of leg pain and difficulty in using the legs (B) according
to the Clinical-Etiology-Anatomy-Pathophysiology (CEAP) clinical classification, with 95% confidence intervals.
muscle pump.20 Decreased ankle
range of motion is associated with
and may contribute to poor calf
pump function.21,22
A simple way to measure calf
muscle function is the standing heel
rise test. This is a noninvasive measure of strength and endurance of the
calf muscle pump and consists of eccentric-concentric muscle action of
plantar flexion.23 Ankle plantar flexion strength has an important role
in standing balance, walking, and
most activities of daily living.24 The
heel rise test is the ability to lift the
heel 5 cm off the ground while holding the opposite foot off the floor and
only lightly touching a surface with
a hand.25 Participants with venous
disease classes 5 and 6 performed
significantly (P = .003) fewer heel
rises (mean ± SD, 14.6 ± 7.34) than
the healthy controls (23.5 ± 6.54).26
We are also currently examining
psychometric properties and use of
the heel rise test with injection drug
users.
Another simple method to measure calf muscle function indirectly
is by measuring ankle range of motion. Using goniometry, one can measure joint angles including dorsiflexion (upward foot movement), plantar
flexion (downward foot movement), inversion (inward foot movement), and eversion (outward foot
movement). Goniometry uses a
hinged tool designed to measure such
joint angles. As an example, in persons positive for human immunode-
ficiency virus with (n=46) and without (n=27) a history of IDU, CVD in
each leg correlated significantly
(P ⬍ .001) with goniometric measurements of dorsiflexion-plantar
flexion (right and left, r=−0.43 and
−0.43, respectively) and inversioneversion (right and left, r=−0.45 and
−0.45, respectively).27 Thus, severity of CVD was associated with reduced ankle joint motion. Others
have reported that ankle range of motion and calf pump function worsened with worsening CVD.21,22
PAIN
Pain is associated with CVD, and
while it may be present before leg ulcers develop, it is worse with more
advanced CVD.10 Pain appears to be
common in injection drug users with
CVD. Using an 11-point scale (0, no
pain, to 10, worst pain), persons who
injected drugs rated their CVDrelated leg pain. Interestingly, the
more severe the CVD, the more severe the leg pain.10 The most painful activities identified by persons
who injected drugs were working,
walking outside, standing, and stair
climbing.10,28 In those who had ulcers, ulcer size was a predictor of
pain, and larger venous ulcer area
was significantly related to greater
current pain (r=0.44, P=.02), worst
pain in 24 hours (r =0.41, P =.02),
and higher pain intensity (r =0.44,
P = .02) for persons who injected
drugs.28,29
1307
ONGOING RESEARCH
ABOUT IDU AND CVD
Our present study is designed to examine the causal relations among the
variables of IDU, CVD, mobility, and
leg pain. The initial reliability phase
has been completed using the first
104 participants (the sample is described elsewhere16). Preliminary
findings support the proposed association between CVD, mobility,
and pain are shown in the Figure.
Figure, A, shows that as the venous
disease advances (using the venous
disease CEAP clinical classification), the amount of time spent sitting during work increased (r=0.33,
P=.001) and the distance walked per
day decreased (r = −0.25, P = .009).
From this and the evidence reviewed in this article, we concluded that CVD affected mobility.
Figure, B, shows leg pain and difficulty in using the legs as a consequence of CVD. In Figure, B, the difficulty score was a composite
computed by taking the mean rating for difficulty walking, standing,
stair climbing, and working, as rated
on a scale from 0 (no difficulty) to
10 (great difficulty). As the CVD
worsened, leg pain (r=0.27, P=.006)
increased and difficulty using the
legs increased (r=0.23, P =.02).
While these associations exist,
whether the relationship among mobility, pain, and CVD are unidirectional or bidirectional is not known.
Nor is it known whether pain is only
a consequence of CVD or causally involved. A larger, ongoing study is designed to address these types of etiological questions. We hypothesize
that mobility and leg pain will mediate the relationship between injection in lower extremities and CVD.
SKIN AND WOUND
ASSESSMENT
Skin and soft tissue infections, which
may occur along with venous ulcers, are common reasons for hospitalization of persons who inject
drugs.30 The mechanism for the development of infection usually includes tissue trauma, direct effect of
the drugs, tissue ischemia, and bacteria.30 The most frequent presenting symptoms of an abscess for persons who inject drugs are pain and
tenderness (100%), erythema (93%),
wound fluctuance (74%), leukocytosis (54%), lymphadenopathy
(48%), and fever (42%).31 Infections that are deep may not present
with the typical manifestations. Microorganisms tend to be flora from
the skin and oropharynx because of
injecting practices. With incision and
drainage, these areas should be cultured and the appropriate antibiotic selected.30
Injection drug use does not change
the need for careful wound assessment—location, size, depth, color,
drainage, odor, pain, infection, causative factors, and self-care. Unfortunately, persons who injected drugs frequently have multiple, large leg ulcers
when they present for care. We previously examined medical records of
172 injection drug users who had venous ulcers.9 These patients had leg
ulcers for a mean ± SD of 5.4 ± 4.7
years. Venous ulcers were present on
both legs in 42% and on 1 leg in 58%.
Patients often had multiple ulcers, up
to 6 per leg. The total area of ulceration was often large, up to 485 cm2.
Persons who healed tended to have a
shorter duration of leg ulcer history
(P=.06) and had significantly smaller
ulcers (P=.01) than those unavailable for follow-up or those continuing treatment.9 A larger wound area
was associated with greater illnessinduced difficulties in the home,
greater psychological distress, and
poor quality of life.29 These persons
should be encouraged to seek medi-
cal care early for the treatment of venous ulcers.
IMPLICATIONS
FOR WOUND CARE
Considerations when providing
wound care to a patient who has a
history of drug use are summarized
below.
v Substance use history is critical and must include cigarette use,
alcohol, and illicit drugs. For illicit
drugs, the drug, route of use, and location of injecting are important.
v Clinicians need to be aware of
the increased risk for CVD in persons who have injected drugs, assess for it, and encourage these persons to seek professional wound care
when leg ulcers are small.
v Persons who inject drugs often have additional chronic illness
that may affect skin and wounds on
the lower extremities.
v Pain assessment and pain treatment need to be done for persons
with IDU. Pain is associated with
CVD and wound area. Patients need
to be educated in the use of analgesic medications.
v Prevention or delayed advanced stages of CVD is important.
Discourage injecting in the groin,
legs, and feet. Encourage leg elevation and the use of compression hose.
v Ankle mobility is affected by
IDU and CVD. Encourage ankle mobility and staying active. Discourage shuffling gait or walking on the
side of the foot. This may necessitate a detailed physical therapy assessment and management plan.
v Living arrangements affect
wound care. Odor is a great problem in group living. Dressings that
are associated with odor need to be
avoided.
v Lack of transportation, drug
treatment, legal issues, and mental
health problems affect psychosocial functioning and the person’s
ability to follow long-term wound
care treatment.
Even at a young age, CVD needs to
be considered in persons who have
injected drugs, especially when injecting occurs in the lower extremities. The health and surgical histories provide information about
health conditions that affect wound
1308
healing. The psychosocial history
helps focus the impact of factors
such as housing, transportation, and
mental health on receiving care.
Homelessness has a high association with drug dependency.32 Depression and anxiety are commonly reported disorders among
substance abusers.33 Living arrangements, economics, mental status,
and dental status affect nutrition.
Drug treatment programs, court
mandated programs, employment,
and family commitments affect when
a person can receive wound care. Because venous ulcer care is often administered weekly, transportation
difficulties affect the person’s return visits to the clinic.34 We found
that the education level of our participants tended to be between the
11th and 12th grade.10 Since reading ability, on average, is 3 to 5 grade
levels below the number of grades
of school completed,35 education and
literacy levels have an impact on the
patient teaching of CVD.
All patients should be asked questions about substance use. Tobacco
use is assessed for current use and
years of use. The National Institute
on Alcohol Abuse and Alcoholism
provides recommendations for the
assessment of alcohol use and helping patients.36 Asking about street
drug use in terms of type, route,
body sites of use, and years of use
will give information about the risk
of CVD. The skin and wounds need
to be carefully assessed and a treatment plan developed. Because CVD
is a chronic condition, patient teaching is critical, and they should be encouraged to adhere to the treatment plan. These patients need to
understand their role of self-care in
terms of nutrition, protecting their
legs such as with leg elevation, leg
and ankle exercises, compression
therapy, and pain management. Leg
pain and decreased functioning occur with worsening CVD state. Leg
ulcers are frequently hidden under
clothing and may be large when the
person seeks care; thus, both legs
must be examined on each clinic
visit. Large wounds require special
consideration in terms of the amount
of wound drainage, odor, time to
heal, and pain. These persons are
able to learn dressing protocols. Patients must feel comfortable with the
clinician and be encouraged to actively participate in wound care. Clinicians must understand that substance abuse can be long-term, with
periods of abstinence and periods of
active use.
CONCLUSIONS
Chronic venous disease has a high
point prevalence in persons who
have injected drugs. Vein, nerve, and
muscle-joint damage to the lower
extremities affects the physiologic
characteristics of normal venous
function. This damage continues to
evolve even after drug use has ceased.
These persons are also at high risk for
DVT. Lower extremity changes may
occur at a young age; thus, these persons may exhibit advanced CVD in
early adulthood. Substance abuse history is critical to obtain when evaluating for the risk of CVD. Chronic venous disease increases pain in the legs
and decreases mobility, affecting one’s
quality of life and activity involvement. Recognition of CVD as a complication of IDU is crucial.
Accepted for Publication: May 22,
2007.
Corresponding Author: Barbara
Pieper, PhD, APRN, BC, CWOCN,
College of Nursing, Wayne State
University, 5557 Cass Ave, Detroit,
MI 48202 ([email protected]).
Author Contributions: Dr Pieper had
full access to all data in studies she
conducted and takes responsibility
for the integrity of the data and the
accuracy of data analyses. Dr Templin was the statistician and coinvestigator with Dr Pieper; Dr Kirsner was
the medical advisor and coinvestigator; and Dr Birk was the physical
medicine advisor and coinvestigator. Study concept and design: Pieper,
Kirsner, Templin, and Birk. Acquisition of data: Pieper and Birk. Analysis and interpretation of data: Pieper,
Kirsner, Templin, and Birk. Drafting of the manuscript: Pieper, Kirsner,
and Templin. Critical revision of the
manuscript for important intellectual
content: Pieper, Kirsner, Templin, and
Birk. Statistical analysis: Pieper and
Templin. Obtained funding: Pieper,
Kirsner, Templin, and Birk. Administrative, technical, and material support: Pieper, Kirsner, Templin, and
Birk. Study supervision: Pieper.
Funding/Support: This study was
funded by the National Institute of
Nursing Research/National Institute of Health (grant RO1 NR009264,
Effect of Drug Use on the Legs:
Chronic Venous Insufficiency, Mobility, and Pain).
Additional Contributions: Joyce
Peck, BSN, RN, Terri Gibbons, and
Cynthia Birk, BA, CET, assisted in
research, and Edwin Frank Thompson performed data entry.
18.
19.
20.
21.
22.
REFERENCES
1. Schoener EP, Hopper JA, Pierre JD. Injection drug
use in North America. Infect Dis Clin North Am.
2002;16(3):535-551.
2. Kirchenbaum SE, Midenberg ML. Pedal and lower
extremity complications of substance abuse. J Am
Podiatry Assoc. 1982;72(8):380-387.
3. Eklöf B, Rutherford RB, Bergan JJ, et al. Revision of the CEAP classification for chronic venous disorders: consensus statement. J Vasc Surg.
2004;40(6):1248-1252.
4. Pieper B, Templin T. Chronic venous insufficiency in persons with a history of injection drug
use. Res Nurs Health. 2001;24(5):423-432.
5. Mackenzie AR, Laing RB, Douglas JG, Greaves
M, Smith CC. High prevalence of iliofemoral venous thrombosis with severe groin infection
among injecting drug users in North East Scotland: successful use of low molecular weight heparin with antibiotics. Postgrad Med J. 2000;
76(899):561-565.
6. McColl MD, Tait RC, Greer IA, Walker ID. Injecting drug use is a risk factor for deep vein thrombosis in women in Glasgow. Br J Haematol. 2001;
112(3):641-643.
7. Scott TE, LaMort WW, Gorin DR, Menzoian JO.
Risk factors for chronic venous insufficiency: a
dual case-control study. J Vasc Surg. 1995;
22(5):622-628.
8. Armstrong GL. Injection drug users in the United
States, 1979-2002. Arch Intern Med. 2007;167
(2):166-173.
9. Pieper B. A retrospective analysis of venous ulcer healing in current and former users of injected drugs. J Wound Ostomy Continence Nurs.
1996;23(6):291-296.
10. Pieper B, Templin T. Lower extremity changes, pain,
and function in injection drug users. J Subst Abuse
Treat. 2003;25(2):91-97.
11. O’Connor PG, Selwyn PA, Schottenfeld RS. Medical care for injection drug users with human immunodeficiency virus infection. N Engl J Med.
1994;331(7):450-459.
12. Stein MD. Medical consequences of substance
abuse. Psychiatr Clin North Am. 1999;22(2):
351-370.
13. Cherubin CE, Sapira JD. The medical complications of drug addiction and the medical assessment of the intravenous drug user: 25 years later.
Ann Intern Med. 1993;119(10):1017-1028.
14. Silverstein P. Smoking and wound healing. Am J
Med. 1992;93(1A):22S-24S.
15. Valencia IC, Falabella A, Kirsner RS, Eaglstein WH.
Chronic venous insufficiency and venous leg
ulceration. J Am Acad Dermatol. 2001;44(3):
401-421.
16. Pieper B, Templin TN, Birk TJ, Kirsner R. Assess-
1309
17.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
ment of lifetime illicit injection drug use: technique and relation to chronic venous disorders.
Ostomy Wound Manage. In press.
Darke S. Self-reporting among injecting drug users.
Drug Alcohol Depend. 1998;51(3):253-263.
Sobell LC, Kwan E, Sobell MB. Reliability of a drug
history questionnaire (DHQ). Addict Behav. 1995;
20(2):233-241.
Nicolaides AN. Investigation of chronic venous insufficiency: a consensus statement. Circulation.
2000;102(20):E126-E163.
Kügler C, Strunk M, Rudofsky G. Venous pressure dynamics of the healthy human leg: role of
muscle activity, joint mobility, and anthropometric factors. J Vasc Res. 2001;38(1):20-29.
Back TL, Padberg FT, Araki CT, Thompson PN, Hobson RW. Limited range of motion is a significant
factor in venous ulceration. J Vasc Surg. 1995;
22(5):519-523.
Dix FP, Brooke R, McCollum CN. Venous disease
is associated with an impaired range of ankle
movement. Eur J Vasc Endovasc Surg. 2003;
25(6):556-561.
Österberg U, Svantesson U, Takahashi H, Grimby
G. Torque, work and EMG development in a heelrise test. Clin Biomech (Bristol, Avon). 1998;
13(4-5):344-350.
Jan M-H, Chai H-M, Lin Y-F, et al. Effect of age and
sex on the results of an ankle plantar-flexor manual
muscle test. Phys Ther. 2005;85(10):1078-1084.
Lunsford BR, Perry J. The standing heel-rise test
for ankle plantar flexion: criterion for normal. Phys
Ther. 1995;75(8):694-698.
van Uden CJT, van der Vieuten CJM, Kooloos JGM,
Haenen JH, Wollersheim H. Gait and calf muscle
endurance in patients with chronic venous
insufficiency. Clin Rehabil. 2005;19(3):339-344.
Pieper BA, Templin T, Ebright JR. Ankle mobility
in relation to chronic venous insufficiency in HIVpositive persons with and without a history of injection drug use. J Assoc Nurses AIDS Care. 2006;
17(4):30-38.
Pieper B, Rossi R, Templin T. Pain associated with
venous ulcers in injecting drug use. Ostomy
Wound Manage. 1998;44(11):54-67.
Pieper B, Szczepaniak K, Templin T. Psychosocial adjustment, coping, and quality of life in persons with venous ulcers and a history of intravenous drug use. J Wound Ostomy Continence Nurs.
2000;27(4):227-239.
Ebright JR, Pieper B. Skin and soft tissue infections in injection drug users. Infect Dis Clin North
Am. 2002;16(3):697-712.
Bergstein JM, Baker EJ IV, Aprahamian C, Schein
M, Wittmann DH. Soft tissue abscesses associated with parenteral drug abuse: presentation, microbiology, and treatment. Am Surg. 1995;61
(12):1105-1108.
Finnie A, Nicolson P. Injecting drug use: implications for skin and wound management. Br J Nurs.
2002;11(6)(suppl):S17-S28.
Gossop M, Marsden J, Stewart D, et al. Substance use, health and social problems of service users at 54 drug treatment agencies. Br J
Psychiatry. 1998;173:166-171.
Pieper B, DiNardo E. Reasons for nonattendance
for the treatment of venous ulcers in an innercity clinic. J Wound Ostomy Continence Nurs.
1998;25(4):180-186.
Lee PP. Why literacy matters. Arch Ophthalmol.
1999;117(1):100-103.
National Institute on Alcohol Abuse and Alcoholism. Helping patients who drink too much: a clinician’s guide. Bethesda: MD: National Institute
on Alcohol Abuse and Alcoholism; 2005. http:
//pubs.niaaa.nih.gov/publications/Practitioner
/CliniciansGuide2005/clinicians_guide.htm. Accessed March 13, 2007.
OBSERVATION
Hydroxyurea-Induced Leg Ulcers Treated
With a Protease-Modulating Matrix
Marco Romanelli, MD, PhD; Valentina Dini, MD; Paolo Romanelli, MD
Background: The development of painful leg ulcers in
the ankle area is a rare and only partially described complication in patients receiving high-dose, long-term hydroxyurea treatment for myeloproliferative diseases. Several reports have described treatments for chronic wound
management with this type of lesion.
Observations: We describe 2 patients who were diag-
nosed as having hydroxyurea-induced leg ulcers that were
successfully treated with a freeze-dried sponge containing oxidized regenerated cellulose and bovine purified
H
University of Pisa, Pisa, Italy
(Drs M. Romanelli and Dini);
and Department of
Dermatology and Cutaneous
Surgery, University of Miami,
Miami, Florida
(Dr P. Romanelli).
collagen. This dressing is able to modulate the activity
of proteases such as plasmin, neutrophil-derived elastase, and matrix metalloproteinase by physically entrapping them and thus inhibiting their activity.
Conclusion: This case demonstrates that topical application of a matrix metalloproteinase modulator can be a
successful and safe treatment option for patients with hydroxyurea-induced recalcitrant leg ulcers.
Arch Dermatol. 2007;143(10):1310-1313
YDROXYUREA IS A HYDROX-
ylated derivative of urea
that has been recognized since 1960 as an effective agent for treating
cancer.1 It is an inhibitor of cellular DNA
synthesis and promotes cell death in the
S phase of the cell cycle through its inhibition of the enzyme ribonucleotide reductase.2 The most common indications
for hydroxyurea therapy are chronic myeloid leukemia3 and gastrointestinal malignant melanoma.4 It has also been used
in the management of other myeloproliferative disorders,5 sickle-cell disease,6 polycythemia vera,7 psoriasis,8 and to inhibit
viral replication in human immunodeficiency virus disease.9 While the drug’s
mode of action on bone marrow elements is well established, its effects on actively proliferating epithelial cells remain less well described.10
Most adverse effects of hydroxyurea are
mild and include fatigue, headache, nausea, vomiting, diarrhea, or fever. Rare and
severe adverse effects appear to be linked
to long-term administration and may be
systemic (eg, leukopenia and anemia) or
restricted to skin and mucous membranes (eg, stomatitis and diarrhea). Other
dermatologic adverse effects are commonly reported with long-term daily
therapy and include alopecia, hyperpigmentation, scaling, poikiloderma, atrophy of the skin and subcutaneous tis-
1310
sues, nail changes with multiple pigmented
nail bands or brittleness, erythema and
scaling of the face and acral sites stimulating chronic dermatomyositis, and lichen planus–like lesions or skin tumors
on UV light–exposed areas.11
Another rare and incompletely characterized complication, painful leg ulcers, has
been described in patients with myeloproliferative diseases receiving high-dose, longterm hydroxyurea treatment.12 Poor response to traditional local and systemic
therapy is a typical feature of hydroxyureainduced leg ulcers, and discontinuation of
treatment with the drug is often required
to achieve complete wound healing.
Herein, we describe 2 cases of a pronounced association between hydroxyurea therapy and the development of painful leg ulcers unresponsive to standard
treatment, as well as their successful treatment with local application of a sponge
prepared from bovine collagen and oxidized regenerated cellulose (Promogran;
Johnson & Johnson Wound Management, Piscataway, New Jersey).
REPORT OF CASES
CASE 1
In 1993, a 70-year-old woman was diagnosed as having thrombocythemia. In
1994, she began treatment with oral hy-
droxyurea (500 mg, twice a day) after failure of an anticoagulant therapy. In June 1999, painful ulcers developed in both lateral malleolar regions. Examination
revealed 2 shallow, painful, well-defined ulcers with an
adherent, yellow, fibrinous necrotic base and a livid border. The ulcers showed no signs of healing when treated
with several local therapies such as gauzes impregnated
with hydrogel, local hyperbaric oxygen, fibrinolytic ointment, and silver sulfadiazine cream. A full workup for
venous and arterial assessment produced no abnormal
results. In February 2000, because of high platelet values, hydroxyurea treatment was discontinued and oral
busulfan therapy was started; this was maintained for 1
month. The size and severity of the ulcers partially reduced in 8 weeks with a topical hydrofiber dressing
therapy.
In December 2001, the patient restarted therapy with
oral hydroxyurea (500 mg, twice a day) because of high
platelet values, and in April 2002, painful leg ulcers recurred in both lateral malleolar regions (Figure 1A). We
successfully treated the ulcers by local application of Promogran dressing, which was applied on a wound bed
moistened with isotonic sodium chloride solution and
then covered with a nonadherent secondary dressing. Initially, we treated the ulcers with an application of the
dressing every other day, and then twice weekly
(Figure 1B). The treatment resulted in complete healing
in 8 weeks, and the ulcers had not recurred at 1-year follow-up (Figure 1C).
A
B
C
CASE 2
An 82-year-old woman was diagnosed as having a polycythemia vera of 6 years’ duration. After 2 years of continuous treatment with oral hydroxyurea (1000-1500 mg/
d), she developed a small painful ulcer on her right heel,
distal to the medial malleolus. No preceding trauma was
reported. Clinical examination and color Doppler evaluation showed venous dysfunction, but the patient could
not tolerate any type of compression therapy. Treatment with hydroxyurea was stopped, and subcutaneous
interferon alfa therapy was begun (5⫻106 IU every other
day). The ulcer healed in 4 weeks under treatment with
Promogran dressing twice a week.
Because interferon was not well tolerated, oral hydroxyurea was reinstituted a few weeks later. Within 3
months, 2 painful ulcers had appeared on her right lateral malleolus. Both ulcers were circular and well demarcated at her first visit and became confluent in a single
large lesion with a fibrinoid-necrotic base 48 hours later
(Figure 2A). Topical application of Promogran dressing twice a week was restarted. The ulcers showed a progressive increase in the formation of granulation tissue
after 2 weeks (Figure 2B) and were 85% healed in 6 weeks
(Figure 2C).
COMMENT
Hydroxyurea is usually well tolerated and has a low toxic
effect profile.13 However, cutaneous adverse effects such
as diffuse hyperpigmentation, brown discoloration of nails,
Figure 1. A, Hydroxyurea-induced leg ulcer in the ankle area; B, after
4 weeks of treatment with Promogran dressing ( Johnson & Johnson Wound
Management, Piscataway, New Jersey); and C, at 1-year follow-up. Scales
are in centimeters in all panels.
acral erythema, photosensitization, fixed drug eruption, alopecia, and oral ulceration have been described.3
Painful, difficult-to-heal leg ulcers associated with hydroxyurea therapy have been rarely reported. Montefusco and colleagues10 describe 17 patients who had hydroxyurea-related leg ulcers and achieved complete
resolution or significant improvement after hydroxyurea therapy was discontinued. Another study described 4 patients with hydroxyurea-induced skin ulcers that eventually healed with appropriate wound care.12
Other authors describe the effectiveness of pentoxifylline and prostaglandin E1 in the treatment of leg ulcers
in patients continuing systemic therapy with hydroxyurea.14 There is also a case report concerning the suc-
1311
A
B
C
Figure 2. A, Large chronic wound with fibrinoid and necrotic tissue at
baseline; B, after 2 weeks of treatment with Promogran dressing ( Johnson &
Johnson Wound Management, Piscataway, New Jersey); and C, after 6
weeks of treatment with Promogran.
cessful treatment of these kind of lesions with the local
application of Apligraf (Novartis, East Hanover, New Jersey), a tissue-engineered human skin equivalent.15
Herein we describe 2 patients who developed cutaneous leg ulcers while receiving long-term treatment with
hydroxyurea. Our clinical experience confirms and clarifies the association between hydroxyurea therapy and the
development of chronic leg ulcers, while our observations show that the patients who had hydroxyureainduced leg ulcers developed hard-to-heal ulcers again
when hydroxyurea treatment was resumed. We successfully treated the ulcers with local therapy by using Promogran dressing during the concomitant hydroxyurea
treatment. In the beginning, we treated the ulcers with
an application of the dressing every other day, and then
twice weekly. The treatment resulted in complete healing in the first case and 85% healing in the second after
8 and 6 weeks of dressing application, respectively.
Other common features of these wounds include
round shape and well-defined aspect at an early stage,
high level of pain, and occurrence at the malleolar
region. This localization may be caused by mechanical
injury and trauma, but chronic and progressive cytologic damage is also involved due to the antimetabolic
activity of the drug. The exact mechanisms by which
hydroxyurea may lead to the formation of leg ulcers is
still unclear, but long periods of exposure to the drug,
latency in ulcer formation, chronic and slow ulcer
enlargement, and healing after discontinuation of
hydroxyurea therapy all suggest a chronic cumulative
cytologic toxic effect of the medication.
Hydroxyurea selectively kills cells such as basal keratinocytes and inhibits collagen synthesis, so the drug
itself could be considered a possible etiologic factor. However, platelet-derived inflammatory mediators related to
the myeloproliferative disorders may play a part in the
pathogenetic process. Usually cutaneous wounds develop spontaneously or after local previous trauma, and
healing is possible only through discontinuation of the
hydroxyurea treatment.16
Our study describes the successful treatment of hydroxyurea-induced leg ulcers with a novel material that
modified the wound environment by significantly reducing the activity of proteases present in human chronic
wound fluids. The treatment produced excellent pain relief in both patients, which was unexpected, and the
mechanism of this benefit is unclear.
Promogran is a freeze-dried sponge containing oxidized regenerated cellulose and bovine purified collagen. This dressing lowers the activity of proteases such
as plasmin, neutrophil-derived elastase, and matrix metalloproteinase by physically entrapping them and thus
inhibiting their activity in diabetic foot ulcers.17 An alteration in the amount of these proteases plays a role in
the occurrence of chronic wounds. This dressing inhibits the degradation of growth factors and the destruction of tissue, limiting the damage to collagen synthesis
due to hydroxyurea. We believe that this rebalancing of
the wound environment should hasten the wound repair process, diminish local pain, and consequently provide an efficacious treatment for hard-to-heal leg ulcers
associated with hydroxyurea treatment. Local treatment was well tolerated compared with standard therapy
and showed no adverse events.
In conclusion, we describe 2 patients with hydroxyurea-induced leg ulcers that responded to a proteasemodulating matrix treatment. However, the use of this
advanced dressing in the treatment of this atypical ulcer
requires more evaluation in future studies.
Accepted for Publication: July 3, 2007.
Correspondence: Marco Romanelli, MD, PhD, Department of Dermatology, Santa Chiara Hospital, Via Roma
67, 56126 Pisa, Italy ([email protected]).
Author Contributions: Dr M. Romanelli had full access
to all the data in the study and takes responsibility for
1312
the integrity of the data and the accuracy of the data analysis. Study concept and design: M. Romanelli. Acquisition
of data: M. Romanelli and Dini. Drafting of the manuscript: M. Romanelli and Dini. Critical revision of the manuscript: P. Romanelli. Administrative, technical, and material support: Dini. Study supervision: P. Romanelli.
8.
9.
10.
11.
REFERENCES
12.
1. Stock CC, Clarke DA, Philips FS, Barclay RK. Sarcoma 180 screening data. Cancer Res. 1960;20(2):193-381.
2. Yarbro JW. Mechanism of action of hydroxyurea. Semin Oncol. 1992;19(3)(suppl
9):1-10.
3. Kennedy BJ, Yarbro JW. Metabolic and therapeutic effects of hydroxyurea in chronic
myeloid leukemia. JAMA. 1966;195(12):162-167.
4. Philip PA, Carmichael J, Tonkin K, Ganesan TA, Harris AL. A phase II study of
high-dose hydroxyurea and dacarbazine (DTIC) in the treatment of metastatic
malignant melanoma. Eur J Cancer. 1994;30A(7):1027-1039.
5. Friedhoff FW, Atamer MA, Thelmo WL. Chronic granulocytic leukemia cutis treated
with hydroxyurea. Chemotherapy. 1978;24(5):321-326.
6. Goldberg MA, Brugnara C, Dover GJ, et al. Treatment of sickle cell anemia with
hydroxyurea and erythropoietin. N Engl J Med. 1990;323(6):366-372.
7. West WO. Hydroxyurea in the treatment of polycythemia vera: a prospective
13.
14.
15.
16.
17.
study of 100 patients over a 20 year period. South Med J. 1987;80(3):
323-327.
Layton AM, Sheehan-Dare RA, Goodfield MJD. Hydroxyurea in the management
of therapy resistant psoriasis. Br J Dermatol. 1989;121(5):647-653.
Lori F, Malykh A, Cara A, et al. Hydroxyurea as an inhibitor of human immunodeficiency virus-type 1 replication. Science. 1994;266(5186):801-805.
Montefusco E, Alimena G, Gastaldi R, Carlesimo OA, Valesini G, Mandelli F.
Unusual dermatologic toxicity of long-term therapy with hydroxyurea in chronic
myelogenous leukaemia. Tumori. 1986;72(3):317-321.
Daoud MS, Gibson LE, Pittelkow MR. Hydroxyurea dermopathy: a unique lichenoid eruption complicating long-term therapy with hydroxyurea. J Am Acad
Dermatol. 1997;36(2, pt 1):178-182.
Nguyen TV, Margolis DJ. Hydroxyurea and lower leg ulcers. Cutis. 1993;52(4):
217-219.
Boyd AS, Neldner KH. Hydroxyurea therapy. J Am Acad Dermatol. 1991;25(3):
518-524.
Kido M, Tago O, Fujiwara H, Ito M, Niwano H. Leg ulcer associated with hydroxyurea treatment in a patient with chronic myelogenous leukaemia: successful treatment with prostaglandin E1 and pentoxifylline. Br J Dermatol. 1998;139(6):
1124-1125.
Flores F, Eaglstein WA, Kirsner RS. Hydroxyurea-induced leg ulcers treated with
Apligraf. Ann Intern Med. 2000;132(5):417-418.
Weinlich G, Schuler G, Greil R, Kofler H, Fritsch P. Leg ulcers associated with longterm hydroxyurea therapy. J Am Acad Dermatol. 1998;39(2, pt 2):372-374.
Cullen B, Smith R, McCulloch E, Silcock D, Morrison L. Mechanism of action of
PROMOGRAN, a protease modulating matrix, for the treatment of diabetic foot
ulcers. Wound Repair Regen. 2002;10(1):16-25.
Announcement
Manuscript Submission
v Before preparing a manuscript authors should
review the Instructions for Authors available at http://
www.archdermatol.com.
v Manuscripts are submitted to all sections of
the Archives by Web access at http://manuscripts
.archdermatol.com.
v Authors may check the status of their manuscript
as it proceeds through the review and decision process
by logging into http://manuscripts.archdermatol.com.
v It is important for authors to update their contact
information, especially their e-mail addresses, by logging into http://manuscripts.archdermatol.com. Publication of accepted manuscripts may be delayed by our
inability to locate authors, who need to approve copyedited manuscript proofs.
1313
OBSERVATION
Phenylephrine-Induced Microvascular Occlusion
Syndrome in a Patient With a Heterozygous
Factor V Leiden Mutation
Andrew H. Kalajian, MD; Klark B. Turpen, MD; Kristin O. Donovan, MD;
Janine C. Malone, MD; Jeffrey P. Callen, MD
Background: Cutaneous microvascular occlusion syn-
Conclusions: We propose that phenylephrine-
dromes (MOS) present with noninflammatory retiform
purpura with variable outcomes that are dependent on
the severity, duration, and specific underlying cause. Transient cases are often associated with few sequelae, while
severe forms such as symmetrical peripheral gangrene may
be associated with amputation and death.
mediated vasoconstriction superimposed on an underlying thrombotic predisposition precipitated the transient MOS. The role of vasopressors in the development
of cutaneous MOS is well documented in the critical care
literature; however, it is underrepresented in the dermatologic literature, and, to our knowledge, there are no
reports of phenylephrine use inducing MOS. We hope
to raise awareness of the potential role of vasopressor
medications in causing MOS.
Observations: A middle-aged man developed MOS after
exposure to phenylephrine hydrochloride and experienced
complete resolution when treatment with the vasopressor
was discontinued. Further evaluation detected a previously
subclinical heterozygous factor V Leiden mutation.
Arch Dermatol. 2007;143(10):1314-1317
N
ONINFLAMMATORY RETIform purpura, the clinical manifestation of microvascular occlusion,
has a broad differential
diagnosis that includes disorders of platelet plugging, cold-related agglutination,
vessel-invasive organisms, embolization,
local or systemic coagulopathies, and miscellaneous conditions (eg, calciphylaxis,
Degos disease, and sickle cell anemia).1
The cutaneous manifestations and outcomes are various and often depend on the
severity and duration of the underlying
causative factors.
REPORT OF A CASE
Author Affiliations: Division of
Dermatology, Department of
Medicine, University of
Louisville, Louisville, Kentucky.
A 45-year-old man with diabetes mellitus
and hypertension was admitted to the
neurosurgical intensive care unit after undergoing a C5-C6 vertebrectomy with
postoperative spinal degeneration and infectious complications that required prolonged hospitalization, numerous neurosurgical procedures, and ventilatory and
vasopressive support over a 4-month period. His family history included a pulmonary embolism that had occurred in his
mother at the age of 35 years. We were
asked to evaluate a purple discoloration
1314
of his hands and feet that had begun 4 days
before the consultation. His medications
included intravenous levofloxacin, quinupristin-dalfopristin (Synercid), hydrocortisone succinate, propofol, and midazolam hydrochloride as well as electrolyte
supplementation, furosemide, hydroxyzine hydrochloride, and metoprolol tartrate (Lopressor) as needed. He had received heparin sodium via flushes of his
intravenous access lines and had not received warfarin sodium.
Physical examination revealed an intubated and sedated patient with symmetrical, well-demarcated purpura accompanied by several tense hemorrhagic bullae
on his hands and feet in a “stockingglove” distribution (Figure 1A). Retiform purpura involved his thighs and antecubital fossae (Figure 1B and 1C). His
distal pulses were normal and his extremities were warm. He had previously been
treated with norepinephrine bitartrate for
vasomotor instability resulting from neurosurgical procedures. However, in the past
month, his only vasopressor exposure had
consisted of a 2-day course of phenylephrine hydrochloride (at a dosage titrated to
maintain target mean arterial pressure),
which had been discontinued 1 day before the onset of his rash. It was his first
A
B
Figure 2. Skin biopsy specimen showing fibrin microthrombi in the
superficial and middle dermal vessels, with minimal inflammation and no
vasculitis (hematoxylin-eosin, original magnification ⫻ 200 [inset, ⫻600]).
C
Figure 3. Near-complete resolution 2 weeks after the onset of the patient’s
transient microvascular occlusion syndrome.
Figure 1. Clinical appearance on initial evaluation revealed symmetrical,
well-demarcated retiform purpura associated with several tense hemorrhagic
bullae on the patient’s hands (A), thighs (B), and antecubital fossae (C).
and only exposure to phenylephrine. He had been afebrile and hemodynamically stable since the phenylephrine therapy had been discontinued.
His platelet count had decreased from 220 to
105⫻103/µL over 2 days, and his D-dimer level was elevated at 1.9 mg/L (normal range, 0-1.5 mg/L). The fibrinogen level, prothrombin time, activated partial thromboplastin time, fibrin split product levels, and results of
urinalysis were within normal limits. The leukocyte
count was normal, and blood cultures were sterile. A
skin biopsy specimen revealed fibrin microthrombi in
the superficial and middle dermal vessels, with minimal
inflammation and no vasculitis (Figure 2). A diagnosis of microvascular occlusion syndrome (MOS) was
made.
Spontaneous improvement began on the second day
after the evaluation and was hastened by the addition of
lepiruden (a direct thrombin inhibitor used as an alternative to heparin) to the patient’s therapy, resulting in a
dramatic resolution of the purpura and superficial sloughing and yielding mildly erythematous erosions. He experienced no further thrombotic complications, and his
condition had almost completely resolved 2 weeks later
(Figure 3), with no long-term sequelae.
Further evaluation revealed negative results or normal levels for the following laboratory investigations: heparin-induced thrombocytopenia antibodies, protein C, homocysteine, prothrombin 20210a mutation, antithrombin
III, cryofibrinogens, cryoglobulins, anticardiolipin antibody, lupus anticoagulant, ␤2-glycoprotein 1 antibody, serum protein electrophoresis, antinuclear antibody, rheumatoid factor, hepatitis panel, perinuclear and cytoplasmic
antineutrophil cytoplasmic antibodies, parvovirus titers,
echocardiography, and lower-extremity Doppler ultrasonography. A heterozygous factor V Leiden (FVL) mutation was found; the erythrocyte sedimentation rate was 53
mm/h (reference range, 0-10 mm/h); the C-reactive protein level was 27 mg/L (reference range, 0-9.0 mg/L); and
the functional protein S value (during acute event) was
36% of the normal level. Subsequent functional protein S
testing 2 weeks after resolution revealed a normal level.
1315
COMMENT
The FVL mutation is one of the most common causes of
inherited thrombophilia, with 4% to 6% of the US population manifesting heterozygous replacement of arginine by glutamine at position 506 of factor V. This mutated gene product, FVL, is resistant to normal physiologic
degradation by activated protein C, yielding a hypercoagulable state. The abnormality is transmitted in an autosomal dominant manner, and the risk of thromboembolism is increased 7- and 80-fold, respectively, in
individuals who are heterozygous and homozygous for
FVL.2,3 This baseline-increased susceptibility to thrombotic events is perpetuated by the coexistence of additional genetic or environmental risk factors, including
protein C and S deficiencies, antithrombin deficiency, prothrombin gene mutation, elevated levels of factor VIII,
hyperhomocystinemia, other coagulation disorders, advanced age, smoking, surgery, immobilization, obesity,
pregnancy/postpartum period, or use of oral contraceptives.4,5
Cutaneous MOS presents clinically with noninflammatory retiform purpura, which has a broad differential
diagnosis that includes disorders of platelet plugging, coldrelated agglutination, vessel-invasive organisms, embolization, local or systemic coagulopathies, or miscellaneous conditions (eg, calciphylaxis, Degos disease, and
sickle cell anemia).1 Factors that affect the disease course
include the severity and duration of the specific underlying cause. Transient precipitants can result in reversible MOS, without a significant event; however, considerable morbidity and mortality are associated with
symmetrical peripheral gangrene (SPG). In 1891, Hutchinson6 reported the first case of SPG, which was characterized by acral gangrene occurring in a symmetrical distribution with no evidence of large vessel occlusion or
vasculitis. Symmetrical peripheral gangrene, which has
been described by some authors as a form of purpura fulminans, is considered a severe form of MOS and is most
commonly associated with septic shock and disseminated intravascular coagulation (DIC).7-12 Patients with
preexisting vascular disorders, such as peripheral vascular disease, diabetes mellitus, Raynaud phenomenon,
and prior cold injury, as well as patients who have been
exposed to vasoactive medications, are further predisposed to develop SPG.11-13 Molos and Hall’s8 review of 71
cases of SPG revealed that 48% of the patients required
amputation and 35% cases proved fatal.
Our patient’s heterozygous FVL mutation remained
subclinical before this event. At the age of 35 years, his
mother had experienced a deep venous thrombosis with
pulmonary embolism, which was not further investigated. There was no other known family history of thrombotic events. While there was no evidence of sepsis or
DIC, his risk factors for MOS included heterozygous FVL,
diabetes mellitus, postsurgical status, immobilization, and
obesity. An FVL mutation is highly associated with venous thromboses; however, it rarely manifests with MOS.
Our patient’s underlying neurosurgical issues had required numerous operations and prolonged immobilization over the past 4 months; however, he had only re-
cently developed transient microvascular occlusion. He
required intermittent vasopressor support, and treatment with phenylephrine, a pure ␣-adrenergic agonist
that causes intense vasoconstriction and decreased perfusion to the acral vascular beds, had been discontinued
just 1 day before the onset of his MOS.
Considering the physiologic effects and temporal relationship of phenylephrine therapy to the onset of our
patient’s microvascular occlusion, we propose that phenylephrine-mediated vasoconstriction superimposed on his
thrombotic predisposition precipitated a transient MOS.
Dünser et al14 reported ischemic skin lesions in only onethird of patients receiving vasopressive medications, suggesting that a combination of predisposing factors must
surpass a critical threshold, above which MOS occurs,
with the subsequent clinical course depending on the severity and duration of the threshold breach. This model
would account for the transient and reversible nature of
our patient’s MOS: the short-term intense vasoconstriction mediated by phenylephrine therapy resulted in a lowlevel microvascular occlusion, which spontaneously remitted once the vasoconstrictive effects of phenylephrine
resolved and his cumulative thrombotic tendency returned to below the critical threshold value. It is noteworthy that the patient did not develop MOS from his
numerous prior exposures to norepinephrine. Perhaps
the ␤-adrenergic properties of norepinephrine (augmenting cardiac output and thus peripheral perfusion) counteracted the vasoconstrictive effects, with the cumulative thrombotic tendency remaining below the critical
threshold value.
Few cases of cutaneous MOS have been reported in
patients who are heterozygous for FVL. Patel et al7 described an 81-year-old woman with heterozygous FVL
who developed extensive acral cutaneous necrosis with
no clear precipitant, resulting in septicemia and death.
Jackson and Luplow15 reported 2 cases of heterozygous
FVL that were complicated by sepsis and DIC, both of
which resulted in digital amputations. To our knowledge, this is the first report of transient MOS precipitated by phenylephrine use in a patient with a heterozygous FVL mutation.
While phenylephrine-induced vasoconstriction is the
only identifiable temporally related transient factor associated with our patient’s transient MOS, it is possible
that additional causative factors were involved. Antiphospholipid antibody syndrome manifests arterial or venous thrombosis of small or large vessels, and while our
patient tested negative for anticardiolipin antibodies, lupus anticoagulant, and ␤2-glycoprotein 1 antibodies, these
tests are technically difficult and false-negative results are
not rare.16,17 Cryoproteins, including cryofibrinogens and
cryoglobulins, are other potential contributors in the present case. Again, our patient tested negative for cryofibrinogens and cryoglobulins; however, the sensitivity of these
tests is highly dependent on the method of collection.
In the presence of protein S, activated protein C inhibits
thrombin generation; therefore, a transient deficiency of
protein C or S could trigger a thrombotic event. Proteins C and S are acute-phase reactants and are difficult
to interpret during acute events; therefore, only an abnormally low level of either protein before the throm-
1316
botic event would imply causality. Our patient acutely
manifested a decreased functional protein S level; however, the results of convalescent testing proved normal.
While we cannot definitively exclude the potential contribution of an unidentified antiphospholipid antibody,
cryoprotein, or transient deficiency of functional protein C or S, it is unlikely that any of these conditions played
a key role in this case. Also, we did not previously include methylene tetrahydrofolate reductase mutation
analysis in our thrombophilia evaluation, and we acknowledge the potential contribution of an unidentified
methylene tetrahydrofolate reductase mutation. Finally, we do not currently have tests for numerous unidentified causes of thrombophilia, any of which may have
played a role in our patient’s transient MOS.
The role of vasopressors in the development of transient cutaneous MOS is well documented in the critical
care literature9,12,14,18; however, it is underrepresented in
the dermatologic literature.19 Published reports have associated cutaneous microvascular occlusion with administration of dopamine, epinephrine, norepinephrine, and
vasopressin. We have presented a case of transient MOS
in a patient with a heterozygous FVL mutation, without
active infection, shock, or DIC, and postulate that the transient nature of his MOS was precipitated by phenylephrine-mediated intense vasoconstriction. We hope that this
report will raise awareness of the potential role of vasopressor medications in causing MOS. Cutaneous MOS
should prompt a search to identify the potentially multiple causative factors, with dermatologists paying special attention to current or prior vasopressor medication use when consulting in the intensive care setting.
Correspondence: Andrew H. Kalajian, MD, Division of
Dermatology, Department of Medicine, University of Louisville, 310 E Broadway, Floor 2A, Louisville, KY 40202
Author Contributions: Drs Kalajian, Turpen, Donovan,
Malone, and Callen had full access to all of the data in
the study and take responsibility for the integrity of the
data and the accuracy of the data analysis. Study concept
and design: Kalajian, Donovan, and Callen. Acquisition of
data: Kalajian, Donovan, and Malone. Analysis and interpretation of data: Kalajian, Turpen, Donovan, Malone,
and Callen. Drafting of the manuscript: Kalajian and Tur-
pen. Critical revision of the manuscript for important intellectual content: Kalajian, Donovan, Malone, and Callen.
Administrative, technical, and material support: Kalajian.
Study supervision: Kalajian, Donovan, Malone, and Callen.
REFERENCES
1. Robson KJ, Piette WW. The presentation and differential diagnosis of cutaneous vascular occlusion syndromes. Adv Dermatol. 1999;15:153-182.
2. Koster T, Rosendaal FR, de Ronde H, Briet E, Vandenbroucke JP, Bertina RM.
Venous thrombosis due to poor anticoagulant response to activated protein C:
Leiden Thrombophilia Study. Lancet. 1993;342(8886-8887):1503-1506.
3. Rosendaal FR, Koster T, Vandenbroucke JP, Reitsma PH. High risk of thrombosis in patients homozygous for factor V Leiden (activated protein C resistance).
Blood. 1995;85(6):1504-1508.
4. Price DT, Ridker PM. Factor V leiden mutation and the risks for thromboembolic
disease: a clinical perspective. Ann Intern Med. 1997;127(10):895-903.
5. Lensen RPM, Bertina RM, de Ronde H, Vandenbroucke JP, Rosendaal FR. Venous thrombotic risk in family members of unselected individuals with factor V
Leiden. Thromb Haemost. 2000;83(6):817-821.
6. Hutchinson J. Severe symmetrical gangrene of the extremities. BMJ. 1891;2:89.
7. Patel GK, Morris E, Rashid MR, Anstey AV. Severe digital necrosis in an elderly
patient with heterozygous factor V Leiden mutation. Br J Dermatol. 2000;143
(6):1302-1305.
8. Molos MA, Hall JC. Symmetrical peripheral gangrene and disseminated intravascular coagulation. Arch Dermatol. 1985;121(8):1057-1061.
9. Johansen K, Murphy T, Pavlin E, Ledbetter D. Digital ischemia complicating pneumococcal sepsis: reversal with sympathetic blockade. Crit Care Med. 1991;
19(1):114-116.
10. Davis MP, Byrd J, Lior T, Rooke TW. Symmetrical peripheral gangrene due to
disseminated intravascular coagulation. Arch Dermatol. 2001;137(2):139-140.
11. Park JY, Kanzler M, Swetter SM. Dopamine-associated symmetric peripheral
gangrene. Arch Dermatol. 1997;133(2):247-249.
12. Hayes MA, Yau EHS, Hinds CJ, Watson JD. Symmetrical peripheral gangrene:
association with noradrenaline administration. Intensive Care Med. 1992;18
(7):433-436.
13. Stover MC, Perrone J. Images in clinical medicine: vascular occlusion after intraarterial cocaine injection. N Engl J Med. 2006;355(19):2021.
14. Dünser MW, Mayr AJ, Tür A, et al. Ischemic skin lesions as a complication of
continuous vasopressin infusion in catecholamine-resistant vasodilator shock:
incidence and risk factors. Crit Care Med. 2003;31(5):1394-1398.
15. Jackson RT, Luplow RE. Adult purpura fulminans and digital necrosis associated with sepsis and the factor V Leiden mutation. JAMA. 1998;280(21):18291830.
16. Gibson GE, Su WP, Pittelkow MR. Antiphospholipid syndrome and the skin.
J Am Acad Dermatol. 1997;36(6, pt 1):970-982.
17. Wisloff F, Jacobsen EM, Liestol S. Laboratory diagnosis of the antiphospholipid
syndrome. Thromb Res. 2003;108(5-6):263-271.
18. McAllister SF, Cleary JD. Blue digits: cyanosis resulting from norepinephrine
treatment. Ann Pharmacother. 2005;39(2):383-384.
19. Korenberg RJ, Landau-Price D, Penneys NS. Vasopressin-induced bullous disease and cutaneous necrosis. J Am Acad Dermatol. 1986;15(2, pt 2):393-398.
1317
EDITORIAL
Wound Healing
I
T IS A PLEASURE TO SERVE AS THE GUEST EDITOR
for this special issue of the Archives dedicated
to wound healing. This issue provides the opportunity to appreciate the special relationship
dermatologists have with wound healing and to
highlight dermatology and dermatologists’ role in advancing the science of wound healing and wound care.
In addition, on the 50th anniversary of the Department
of Dermatology and Cutaneous Surgery at the University of Miami, Miami, Florida, it provides an opportunity to recognize the outstanding contributions of the department’s chairman emeritus, William H. Eaglstein, MD,
to the field of wound healing.
Wounds and wound healing intersect medical, surgical, and cosmetic dermatology. Medical conditions as
diverse as pemphigus vulgaris, primary syphilis, lupus
erythematosus, and sarcoidosis all either have or can have
wounds as part of their initial presentation. Dermatologists create more wounds through surgical procedures
and biopsies than any other specialty.1,2 Often, wounds
are treated with surgical procedures such as debridement or grafting.3 Finally, with regard to cosmetic dermatology, its goals and the goals of wound healing are
often the same: to fill a defect or contour, to provide dermal support, and to normalize epithelialization.
See also pages 1267, 1275,
1283, 1305, 1331, and 1333
In 2006, the American Academy of Dermatology, in
collaboration with the Society of Investigative Dermatology, published the results of a joint effort evaluating
the burden of skin disease in the United States.4 The results are that skin care is costly, with the 5 conditions
most expensive to treat combined costing Americans over
$16 billion annually. Second, the conditions that are by
far the most expensive to treat are wounds and ulcers.
Therefore, wounds are common, extremely costly to the
American health care system, and created to a greater extent by dermatologists than by any other specialty; therefore, they should be of interest to all dermatologists.
This issue allows the Archives to celebrate dermatology’s role in advancing the science of wound care. This issue also coincides with the 50th anniversary of the Department of Dermatology and Cutaneous Surgery at the
University of Miami. In March of this year, the department held a 31/2-day academic and social event commemorating scientific and academic advances of the department
and its alumni, faculty, and residents. Among the activities was a full day to honor the accomplishments of Dr
Eaglstein in the field of wound healing. He was the second of only 3 chairmen that the department, founded by
Harvey Blank, MD, has had in its illustrious 50-year his-
tory. Having trained
under Dr Blank, as a resident and faculty member, Dr Eaglstein returned to Miami in 1986
to assume the chairmanship after serving as
chairman of the Department of Dermatology at
the University of Pittsburgh, Pittsburgh, Pennsylvania, for 6 years. He
led the department at the
William H. Eaglstein, MD
University of Miami for
17 years, through 2003.
A founding member of the Wound Healing Society who
was recently awarded the prestigious John Boswick Award
for Lifetime Achievement in Wound Care, Dr Eaglstein
has made seminal contributions to wound care. Working
with colleagues, he has made many contributions, some
of which include the development of the porcine model
for wound healing,5 and the use of this model to study the
effect of steroids on healing,5,6 to study the role of occlusion on healing,5,7-10 and to study the effect of antimicrobial agents on healing.11,12 He, with others, developed the
growth factor trap hypothesis to explain venous ulcer
pathophysiologic characteristics,13 put forth the idea that
skin grafts do not act solely as a tissue replacement but as
pharmacologic agents in healing,14 and influenced his department’s faculty to develop the concept that biofilms play
a role in chronic wound healing.15 This and other work
has led to or popularized the use of occlusive dressings,16-18 tissue-engineered skin,19-23 and cyanoacrylate dressings.24,25 Equally important to his scientific contributions
has been Dr Eaglstein’s mentorship of members of his departments and of the field. His mentees, like wound healing itself, cross interests and include dermatologic surgeons, scientists interested in wounds, and medical and
cosmetic dermatologists. Dr Eaglstein is currently chairman emeritus in the department headed by Lawrence
Schachner, MD. This issue of the Archives celebrates Dr
Eaglstein’s influence on the entire field of wound healing.
Also in this special issue of the Archives, we provide a
wide variety of articles, both in terms of types of wounds
addressed and the aspects of wound healing discussed.
Two articles in the issue explore wound assessment
techniques. Pressley et al26 present data from a recent
randomized control trial demonstrating the benefit
from a digital analysis system, and Romanelli et al27 provide rationale for an easy-to-use 3-dimensional laser
system for wound assessment. Skin biopsy still remains
an important diagnostic and assessment tool. Wahie
and Lawrence28 studied patients undergoing diagnostic
biopsies in the inpatient setting and found a high complication rate (29%), most commonly from infection.
1318
Their data suggest that a biopsy site located below the
waist, a biopsy performed bedside (vs in a operating
suite), comorbid conditions (eg, diabetes mellitus), and
lack of subcutaneous sutures were associated risk factors for wound infection.
Also in this issue, 2 articles are presented that discuss the pathophysiologic characteristics of nonhealing
venous ulcers. Heinen et al,29 from the Netherlands, studied cases of patients with venous leg ulcers from 12 dermatology department–run wound clinics. The standard
of care is multilayered compression dressing, but Heinen
et al29 found that only slightly more than one-third of patients used the compression dressings. Interestingly, exercise levels were low in patients with venous leg ulcers.
Thirty-five percent of patients with venous leg ulcers
walked less than 10 minutes per day. These data are especially interesting in light of an article by Pieper et al,30
who describe a distinct group of patients who have venous disease: those who inject drugs into their legs. Pieper
et al30 review the literature and present data from their
ongoing study, funded by the National Institutes of Health,
evaluating venous disease, mobility, gait, and balance
among this subset of injection drug users compared with
drug users who do not inject and those who inject into
locations other than the legs. It becomes apparent that
these patients with venous disease, perhaps representative of all patients with venous disease, have changes in
gait, mobility, ankle range of motion, and balance. These
2 articles, taken together, suggest the importance of mobility and the ongoing role of physical therapy for patients with venous disease.
A third article in this issue related to venous ulcers
presents new epidemiologic information. Margolis et
al31 study the relationship between ␤-adrenergic receptor agonists and antagonist use and the likelihood of developing venous ulcers. Using a general practice database from the United Kingdom, they demonstrate that
patients taking ␤-adrenergic receptor agonists were less
likely to develop venous ulcers. Interestingly, using
complex analysis called propensity analysis, they also
demonstrate that some subsets of those taking ␤-adrenergic receptor antagonists were also less like to develop
venous ulcers. Taking into account laboratory studies
that suggest a role of ␤-adrenergic receptors in wound
repair, this provides a rationale for considering these
types of agents in clinical trials for the treatment of venous leg ulcers.
It has been a great privilege to serve as the guest editor for this issue. It has been a pleasure to have worked
with June K. Robinson, MD, and the editorial staff of the
Archives. Finally, it is an exceptional and singular honor
to pay tribute to William H. Eaglstein, MD, who has had
a profound influence on my career.
Robert S. Kirsner, MD, PhD
Correspondence: Dr Kirsner, Department of Dermatology, University of Miami, PO Box 016250 (R250), Miami, FL 33101 ([email protected]).
REFERENCES
1. Shaffer CL, Feldman SR, Fleischer AB Jr, Huether MJ, Chen GJ. The cutaneous surgery experience of multiple specialties in the Medicare population. J Am Acad Dermatol.
2005;52(6):1045-1048.
2. Neville JA, Housman TS, Letsinger JA, Fleischer AB Jr, Feldman SR, Williford PM.
Increase in procedures performed at dermatology office visits from 1995 to 2001.
Dermatol Surg. 2005;31(2):160-162.
3. Kirsner RS, Eaglstein WH, Kerdel FA. Split-thickness skin grafting for lower extremity
ulcerations. Dermatol Surg. 1997;23(2):85-91.
4. Bickers DR, Lim HW, Margolis D, et al. The burden of skin diseases: 2004 a joint project
of the American Academy of Dermatology Association and the Society for Investigative Dermatology. J Am Acad Dermatol. 2006;55(3):490-500.
5. Eaglstein WH, Mertz PM. New method for assessing epidermal wound healing: the
effects of triamcinolone acetonide and polyethylene film occlusion. J Invest Dermatol.
1978;71(6):382-384.
6. Alvarez OM, Levendorf KD, Smerbeck RV, Mertz PM, Eaglstein WH. The effect of topically applied steroidal and non-steroidal anti-inflammatory agents on skin repair and
regeneration. Fed Proc. 1984;43(13):2793-2798.
7. Eaglstein WH, Mertz PM. “Inert” vehicles do affect wound healing. J Invest Dermatol.
1980;74(2):90-91.
8. Alvarez OM, Mertz PM, Eaglstein WH. The effect of occlusive dressings on collagen synthesis and re-epithelization in superficial wounds. J Surg Res. 1983;35(2):142-148.
9. Mertz PM, Marshall DA, Eaglstein WH. Occlusive wound dressings to prevent bacterial invasion and wound infection. J Am Acad Dermatol. 1985;12(4):662-668.
10. Eaglstein WH, Davis SC, Mehle AL, Mertz PM. Optimal use of an occlusive dressing
to enhance healing: effect of delayed application and early removal on wound healing.
Arch Dermatol. 1988;124(3):392-395.
11. Geronemus RG, Mertz PM, Eaglstein WH. Wound healing: the effects of topical antimicrobial agents. Arch Dermatol. 1979;115(11):1311-1314.
12. Mertz PM, Alvarez OM, Smerbeck RV, Eaglstein WH. A new in vivo model for the evaluation of topical antiseptics on superficial wounds: the effect of 70% alcohol and povidone iodine solution. Arch Dermatol. 1984;120(1):58-62.
13. Falanga V, Eaglstein WH. The “trap” hypothesis of venous ulceration. Lancet. 1993;341
(8851):1006-1008.
14. Kirsner RS, Falanga V, Eaglstein WH. The biology of skin grafts: skin grafts as pharmacologic agents. Arch Dermatol. 1993;129(4):481-483.
15. Harrison-Balestra C, Cazzaniga AL, Davis SC, Mertz PA. Wound-isolated Pseudomonas aeruginosa grows a biofilm in vitro within 10 hours and is visualized by light
microscopy. Dermatol Surg. 2003;29(6):631-635.
16. Eaglstein WH. Effect of occlusive dressing on wound healing. Clin Dermatol. 1984;2
(3):107-111.
17. Eaglstein WH. Experiences with biosynthetic dressings. J Am Acad Dermatol. 1985;
12(2, pt 2):434-440.
18. Eaglstein WH, Mertz PM, Falanga V. Occlusive dressings. Am Fam Physician. 1987;35
(3):211-216.
19. Eaglstein WH, Iriondo M, Laszlo K. A composite skin substitute (Graftskin) for surgical wounds: a clinical experience. Dermatol Surg. 1995;21(10):839-843.
20. Muhart M, McFalls S, Kirsner R, Kerdel F, Eaglstein WH. Bioengineered skin. Lancet.
1997;350(9085):1142.
21. Eaglstein WH, Alvarez OM, Auletta M, et al. Acute excisional wounds treated with a
tissue-engineered skin (Apligraf ). Dermatol Surg. 1999;25(3):195-201.
22. Muhart M, McFalls S, Kirsner RS, et al. Behavior of tissue-engineered skin: a comparison of a living skin equivalent (LSE), autograft, and occlusive dressing in human
donor sites. Arch Dermatol. 1999;135(8):913-918.
23. Falabella AF, Schachner LA, Valencia IC, Eaglstein WH. The use of tissue-engineered
skin (Apligraf ) to treat a newborn with epidermolysis bullosa. Arch Dermatol. 1999;
135(10):1219-1222.
24. Eaglstein WH, Sullivan TP, Giordano PA, Miskin BM. A liquid adhesive bandage for
the treatment of minor cuts and abrasions. Dermatol Surg. 2002;28(3):263-267.
25. Mertz PM, Davis SC, Cazzaniga AL, Drosou A, Eaglstein WH. Barrier and antibacterial
properties of 2-octyl cyanoacrylate-derived wound treatment films. J Cutan Med Surg.
2003;7(1):1-6.
26. Pressley ZM, Foster JK, Kolm P, et al. Digital image analysis: a reliable tool in the quantitative evaluation of cutaneous lesions and beyond. Arch Dermatol. 2007;143(10):
1331-1333.
27. Romanelli M, Dini V, Bianchi T, Romanelli P. Wound assessment by 3-dimensional
laser scanning. Arch Dermatol. 2007;143(10):1333-1334.
28. Wahie S, Lawrence CM. Wound complications following diagnostic skin biopsies in
dermatology inpatients. Arch Dermatol. 2007;143(10):1267-1271.
29. Heinen MM, van der Vleuten C, de Rooij MJM, Uden CJT, Evers AWM, van Achterberg
T. Physical activity and adherence to compression therapy in patients with venous
leg ulcers. Arch Dermatol. 2007;143(10):1283-1288.
30. Pieper B, Kirsner RS, Templin TN, Birk TJ. Injection drug use: an understudied cause
of venous disease. Arch Dermatol. 2007;143(10):1305-1309.
31. Margolis DJ, Hoffstad O, Isseroff RR. Association between the use of ␤-adrenergic
receptor agents and the development of venous leg ulcers. Arch Dermatol. 2007;
143(10):1275-1280.
1319
EDITORIAL
The Archives of Dermatology Web Site
Adding New Dimensions to the Literature
O
NE OF THE GREATEST MODERN-DAY EXtensions of the power of the printed
word has been the World Wide Web.
Over the past several years, the Archives
has stepped up and implemented many
Web-based features to enrich readers’ experience and help
them use the Archives Web site to the fullest. The latest,
most indispensable, easy-to-use features, and the people
who make them possible, are highlighted herein.
ADDING YET ANOTHER
DIMENSION WITH VIDEO
Dermatology has always been an ideal application for good
clinical photography.1 Essential for establishing diagnosis and monitoring treatment efficacy, accurate photographic reproduction has been indispensable for not only
general dermatology but also pediatric dermatology, dermatopathology, procedural dermatology, and other subfields.
See also page 1352
Still photography, however, seems a needlessly limited medium that does not encompass all the expressive
needs of dermatology research and education. In recent
years, advances in technology have expanded the horizon by bringing high-quality videography within the reach
of every dermatologist. Although video cannot be accommodated in the print version of the Archives, we are
now at a point where Web-based video can be used to
supplement articles appearing in the pages of the journal. This is accomplished superbly for the first time in
this issue of the Archives with the “dancing Langerhans
cells” video complementing the article by Mohr and
Takashima, “Visualization of Epidermal Langerhans Cell
Movement in Situ: A Model for Understanding Immunologic Function in the Skin.”2 We thank James M. Grichnik, MD, PhD, section editor for skINsights, for recruiting this most excellent submission.
The groundwork has been laid. Detailed guidelines
have been developed and posted online to assist authors
who wish to submit video with their manuscripts (http:
//archderm.ama-assn.org/misc/ifora.dtl#Videos). These
guidelines explain the mechanics of the process, including steps required to maintain quality, uniformity, and
usability. We hope that authors and future contributors
take a look at these very specific instructions for authors and consider enhancing the Archives experience for
our readers by providing videos for installation on the
journal Web site.
To be most effective, videos should be brief and designed to enhance understanding of an article. Some
article types that are particularly likely to benefit from
selective use of video include Studies, Observations,
Off-Center Fold, the online Continuing Medical Education (CME) articles, and skINsights. In appropriate cases,
a dynamic process that may require hundreds of words
to describe, or a series of still images to illustrate, may
be best conveyed as a moving picture. For instance, articles that address biological processes or dermatologic
procedures may be especially improved by an appended
video clip. All video submissions will be evaluated by our
video review committee (Ashish C. Bhatia, MD, James
M. Grichnik, MD, PhD, and Murad Alam, MD) and the
appropriate section editor. Furthermore, submissions involving surgical procedures will have the video reviewed by the surgical advisory board (Murad Alam, MD,
Chairman; Daniel Berg, MD; Jeffrey S. Dover, MD, FRCP;
Hayes B. Gladstone, MD; Dee Anna Glasser, MD; Ken K.
Lee, MD).
When a video is found to enhance a submission, it will
be posted on the Web site, and a link will be listed in the
print version of the article. If authors are unsure of whether
a video is right for a given article, we encourage them to
contact the Archives editorial staff for advice. That being
said, we rely on your good judgment and creativity to
best utilize this modality and to pioneer its use in the peerreviewed dermatology literature. Because this is an evolving technology with growing applications, we expect to
periodically revise our instructions for authors to ensure that they remain most useful.
WEB SITE FEATURES THAT ENRICH
THE ARCHIVES EXPERIENCE
In addition to providing a display medium for videography, the Archives Web site offers many useful features
to readers to assist with exploring the content of the journal, assist with research, provide education and CME, as
well as to stay connected to the journal through automated information delivery to one’s e-mail. Accessing the
Online Features is easy: simply go to the Archives homepage (http://www.archderm.com/), click on any article,
and then click on “Online Features” in the upper righthand corner of the page.
Every month, the journal features the Archives Clinical Challenge: You Make the Diagnosis. This is one of
1320
James M. Grichnik, MD, PhD
Ashish C. Bhatia, MD
Murad Alam, MD
Daniel Berg, MD
Jeffrey S. Dover, MD, FRCP
Hayes B. Gladstone, MD
Dee Anna Glasser, MD
Ken K. Lee, MD
Andrew D. Samel, MD
the most popular interactive sections of the Web site,
where readers are presented with a challenging clinical
case from an upcoming Off-Center Fold and are asked
to provide a diagnosis. Readers from all over the world
participate in this challenge, and the first to respond with
the correct answer wins a prize and is recognized in the
print version of the journal. Look for a new Clinical Challenge on the third Monday of every month.
To continue to promote learning and interacting, we
also invite readers to peruse a free CME article and answer questions to earn CME credit online. Future CME
articles will likely be an excellent proving ground for the
benefit of rich media such as videography, adding a new
dimension to the traditional learning pattern. The online CME section is edited by Andrew D. Samel, MD.
Staying connected with the latest content in the print
journal is made easy by the features available on the Web
site in the Stay Connected section. Here, readers can sign
up for e-mail alerts containing the table of contents from
the latest issue, including the titles, author listings, and
links to the full-text articles in each new issue. Readers
can also be the first to browse the latest articles online,
even ahead of the print version, by using the Early Release alerts section of the Web site, complete with links
to full-text articles published online ahead of print. One
can even customize the types of articles delivered through
e-mail by specifying the topics using the Topic Collections alerts section of the Web site.
Another feature available only through the Web site
is the Citation Alert to provide notification via e-mail when
1321
a particular article is cited by another article. Readers can
also set up Search Alert notifications. These provide e-mail
notification when an article matching one’s search criteria is published. This is a very handy way to stay on
top of the literature in a particular subject without manually searching on a regular basis.
In the Research section of the Web site, there are tools
to assist with the most daunting research tasks, making
them much easier to manage. The My Folder feature allows readers to store and organize articles of interest in
their personal storage space. The Citation Manager
complements the My Folder section by helping readers
store the proper citations from published articles of interest and by exporting these lists in a format that is readable by many popular citation management software
packages.
Other resources available on the Web site include a
searchable Dermatology Calendar of Events listing relevant meetings and events, an Evidence-Based Dermatology (EBD) page that provides access to the latest EBD
articles and features, and a PowerPoint Downloads feature, which allows readers to download all of the figures
and tables from an article directly onto their computers
in PowerPoint format. This last feature can be invaluable to any reader wishing to rapidly compose a PowerPoint presentation that includes data from an article.
We are proud to be leading the way for innovations
and standardizations in multimedia enrichment of the dermatology literature as well as to be taking full advantage
of the interactive, customizable power of the Internet. As
these processes and the benefits that they provide our readers around the world evolve, we hope to continue to lead
the way and make available new ways to enrich the literature and expand the methods by which readers interact with it.
Ashish C. Bhatia, MD
Web Editor and Video Review Committee
Murad Alam, MD
Chairman, Surgical Advisory Board
and Video Review Committee
Correspondence: Dr Bhatia, River North Dermatology
and Dermatologic Surgery, 636 Raymond Dr, Suite 304,
Naperville, IL 60563 ([email protected]).
REFERENCES
1. Bhatia AC. The clinical image: archiving clinical processes and an entire specialty.
Arch Dermatol. 2006;142(1):96-98.
2. Mohr RE, Takashima A. Epidermal Langerhans cell movement in situ: a model for
understanding immunologic function in the skin. Arch Dermatol. 2007;143(10):
1352.
1322
OFF-CENTER FOLD
SECTION EDITOR: MICHAEL E. MING, MD, MSCE; ASSISTANT SECTION EDITORS: CARRIE ANN R. CUSACK, MD; SENAIT W. DYSON, MD;
JACQUELINE M. JUNKINS-HOPKINS, MD; VINCENT LIU, MD; KARLA S. ROSENMAN, MD
Subcutaneous Nodule and Diffuse Lymphadenopathy
in a 6-Month-Old Boy From Africa
Peter C. Friedman, MD, PhD; Sameera Husain, MD; David N. Silvers, MD; Maria C. Garzon, MD; Columbia University, New York, New York
REPORT OF A CASE
A 6-month-old boy from Guinea presented with a 4-month
history of a left shoulder nodule at the site of a previous
vaccination of unknown type. The child also had recurrent fevers and upper respiratory tract symptoms. On examination, the patient had a 3.5⫻2-cm, rubbery, freely
moveable subcutaneous nodule on the left shoulder, which
extended into a 6-mm, round, red papule (Figure 1).
A 1-cm rubbery subcutaneous nodule was present on the
right back. He also had lymphadenopathy in the posterior auricular, cervical, inguinal, and axillary regions. The
liver edge was palpable 1 cm below the costal margin.
Biopsy specimens from the left shoulder papule (Figure 2
and Figure 3) and left axillary lymph node were obtained. A chest radiogram showed no abnormalities.
The child’s alkaline phosphatase level was 302 U/L
(range, 33-96 U/L) and the aspartate-aminotransferase
level, 47 U/L (range, 12-38 U/L) (to convert both these
analytes to microkatals per liter, multiply by 0.0167).
Test results for hepatitis B surface antigen, hepatitis B
core antigen, and anti–hepatitis B core antigen were
positive, and the hepatitis B viral load was greater than
250 000 copies.
What is your diagnosis?
Figure 1.
Figure 3.
Figure 2.
Goosefleshlike Lesions and Hypohidrosis
Naomi Soroosh Dimon, MD; Douglas R. Fullen, MD; Yolanda Rosi Helfrich, MD; University of Michigan, Ann Arbor
REPORT OF A CASE
A 15-year-old otherwise healthy boy presented with a recent history of tiny bumps on his trunk and extremities
that appeared during exercise and resolved within 60 minutes. He also noted decreased sweating in affected areas
and increased sweating in uninvolved areas. He felt hot
and occasionally light-headed during episodes. Physical
examination initially revealed normal skin. After he had
jogged in place, his skin had a gooseflesh appearance, with
tiny, nonfollicular, flesh-colored papules covering the
trunk and upper extremities (Figure 1). Hypohidrosis
was noted in involved areas. Hair, nails, and teeth were
normal. A biopsy of involved skin was performed, and
the specimens were stained with hematoxylin-eosin
(Figure 2 and Figure 3).
Figure 2.
Figure 3.
Figure 1.
Nodular Lesions on the Arm
Anette Chrusciak-Talhari, MD; Carolina Talhari, MD; Mônica Nunes de Souza Santos, MsC; Luis Carlos Ferreira, PhD; Sinésio Talhari, PhD;
Institute of Tropical Medicine of the Amazonas (Drs Chrusciak-Talhari, C. Talhari, Ferreira, and S. Talhari and Ms de Souza Santos) and State University of Amazonas
(Dr C. Talhari and Ms de Souza Santos), Manaus, Brazil
REPORT OF A CASE
A healthy 66-year-old Brazilian man presented with a 10year history of an asymptomatic mass of nodules affecting his left arm. The lesion had initially appeared as a
papule and had been slowly enlarging since then. The
patient reported pulling a tick out of the initial lesion.
Figure 1.
For many years he had been a rubber worker in the Amazon region.
Physical examination revealed 4 ill-defined, smooth,
shiny, elastic nodules on the medial aspect of the right
arm (Figure 1). A skin biopsy specimen was obtained
and stained with hematoxylin-eosin (Figure 2) and Grocott methenamine–silver (GMS) (Figure 3).
Figure 2.
Figure 3.
Beefy Red Plaque in the Popliteal Fossa
Sarah Jane Grekin, MD; Nicole M. Annest, MD, MS; Kathi C. Madison, MD; University of Iowa Hospitals and Clinics, Iowa City (Drs Grekin and Madison),
and Scripps Clinic and Research Institute, La Jolla, California (Dr Annest)
REPORT OF A CASE
A 27-year-old woman was evaluated for painful skin lesions present on her right leg for 2 months. They initially appeared as small pustules, then progressively increased in size and developed a purulent surface exudate.
One day prior to presentation she underwent incisional
Figure 1.
biopsy of the right talonavicular joint for suspected osteomyelitis. She had been diagnosed with “walking pneumonia” 2 weeks prior. The patient was healthy and denied immunosuppression.
Physical examination revealed a 4 ⫻ 2-cm beefy red
plaque with creamy exudate in the right popliteal fossa
(Figure 1) and a 5-mm erythematous indurated pap-
ule on the right lateral thigh. There was no lymphadenopathy. A potassium hydroxide touch-preparation smear
was performed, and a shave biopsy specimen from the
right popliteal fossa plaque was stained with hematoxylineosin (Figure 2) and periodic acid–Schiff (Figure 3).
Figure 2.
1323-1328
Figure 3.
©2007 American Medical Association. All rights reserved.
Subcutaneous Nodule and Diffuse Lymphadenopathy
in a 6-Month-Old Boy From Africa
Diagnosis: Disseminated bacillus Calmette-Guérin
(BCG) infection.
MICROSCOPIC FINDINGS AND
CLINICAL COURSE
The cutaneous papule and the lymph node showed the
same pathologic features. The hematoxylin-eosin–
stained sections demonstrated the presence of a granulomatous infiltrate with multinucleated Langerhanstype giant cells and calcified spherules resembling
psammoma bodies or Schaumann bodies (Figure 2 and
Figure 3). Fite-stained sections demonstrated the presence of a few acid-fast bacilli (Figure 4). A mycobacterial culture of the lymph node was negative. On polymerase chain reaction testing, the lymph node was positive
for Mycobacterium bovis BCG. A purified protein D test
result was positive.
One month after the patient started treatment with rifampin and isoniazid, the subcutaneous nodule resolved
and the liver function test results were normal. The patient returned to Guinea and was not available for further follow-up.
DISCUSSION
Live, attenuated BCG vaccination is used to provide immunity against tuberculosis in countries with a high risk
of infection. A review of adverse events of BCG vaccination concluded that the rate of disseminated complications was less than 1 in 1 million vaccinations.1 Most patients with disseminated BCG infection had cellular
Figure 4.
immunodeficiencies,2 although cases were reported in patients without immunodeficiency.3,4
The cutaneous lesions of disseminated BCG are described as erythematous papules and subcutaneous nodules. A study of idiopathic and immunodeficiencyassociated disseminated BCG cases found that there were
2 types of histological patterns. Some biopsy specimens
showed granulomas resembling tuberculoid granulomas with few or no organisms. Others showed a lepromatous inflammationlike pattern with many organisms.
The tuberculoid-type reaction was more common in idiopathic disease and was associated with good outcome.
The lepromatouslike histological pattern was predominant in immunodeficiency-associated cases and had poor
prognosis.5
Our patient had no known immunodeficiency. His biopsy specimen showed tuberculoid granulomas associated with several calcified spherules resembling psammoma bodies or Schaumann bodies, a unique constellation
of histopathological findings that has been reported in 4
cases of BCG-associated reaction. These spherules likely
represent apoptotic cells undergoing dystrophic calcification.6
Our patient was born in Guinea where BCG vaccination is mandatory. He presented with a cutaneous nodule and disseminated lymphadenopathy, which on biopsy showed tuberculoid granulomas with a few acid-
fast bacilli and calcified spherules. Polymerase chain
reaction testing confirmed the presence of M bovis in the
biopsy specimen. The vaccination history, clinical presentation, presence of the organism in the lesions, and
lack of immunodeficiency led to the diagnosis of idiopathic disseminated BCG disease.
The calcified spherules in our biopsy specimen further support the usefulness of this finding to aid in diagnosing disseminated BCG, especially in cases when the
organisms cannot be detected. This case also demonstrates that the diagnosis of disseminated BCG must be
considered in cases of diffuse lymphadenopathy when
there is a history of BCG vaccination.
REFERENCES
1. Lotte A, Wasz-Hockert O, Poisson N, et al. BCG complications: estimates of the
risks among vaccinated subjects and statistical analysis of their main characteristics.
Adv Tuberc Res. 1984;21:107-193.
2. Antaya RJ, Gardner ES, Bettencourt MS, et al. Cutaneous complications of BCG
vaccination in infants with immune disorders: two cases and a review of the literature.
Pediatr Dermatol. 2001;18(3):205-209.
3. Casanova JL, Blanche S, Emile JF, et al. Idiopathic disseminated bacillus CalmetteGuerin infection: a French national retrospective study. Pediatrics. 1996;98(4, pt
1):774-778.
4. Talbot EA, Perkins MD, Silva SF, et al. Disseminated bacille Calmette-Guerin disease after vaccination: case report and review. Clin Infect Dis. 1997;24(6):11391146.
5. Emile JF, Patey N, Altare F, et al. Correlation of granuloma structure with clinical
outcome defines two types of idiopathic disseminated BCG infection. J Pathol.
1997;181(1):25-30.
6. Cohen M, Drut R. Cytologic features of disseminated bacillus Calmette-Guerin (BCG)
infection. Diagn Cytopathol. 2001;25(2):134-137.
Goosefleshlike Lesions and Hypohidrosis
Diagnosis: Miliaria profunda.
CLINICAL COURSE
The histologic sections showed focal lymphocytic inflammation around the insertion of the eccrine duct into
the epidermis. There was slight alteration, with minimal spongiosis, focal perieccrine inflammation, and a
somewhat distorted eccentric eccrine duct. The findings were suggestive of mild chronic miliaria profunda.
We recommended that our patient avoid strenuous exercise for several months. Because he played on his high
school basketball team, he thought avoidance of exercise
was impossible. We recommended application of anhydrous lanolin before exercise, which led to improvement.
DISCUSSION
Miliaria is caused by blockage of the flow of sweat from
the eccrine duct to the skin surface, with subsequent rupture of the duct and leakage of sweat into different levels of the skin. Classification of the type of miliaria is based
on the level of eccrine ductal obstruction. The 3 types of
miliaria are miliaria crystallina (obstruction at the stra-
tum corneum), miliaria rubra (obstruction at the stratum malpighii), and miliaria profunda (obstruction at or
below the dermoepidermal junction [DEJ]). Histologically, miliaria profunda demonstrates rupture of the intradermal eccrine duct below the DEJ, lymphocytic inflammation around the dermal portion of the eccrine duct
and adjacent dermis, and spongiosis of the intraepidermal portion of the duct.1
Mowad et al2 induced miliaria with occlusion and thermal stimulation, inoculating various strains of coagulasenegative staphylococci onto the skin prior to occlusion. They
found that only Staphylococcus epidermidis, capable of producing extracellular polysaccharide substance, was able to
induce miliaria. Extracellular polysaccharide substance is
a sticky substance thought to induce miliaria by occluding the eccrine ducts. In a situation of high humidity and
temperature, resident bacteria expand, leading to inflammation and development of a lymphocytic infiltrate around
the occluded eccrine ducts.2
Miliaria profunda is rare. It was originally described
in tropical countries, where repeated bouts of intense
sweating and miliaria rubra could lead to occlusion of
the eccrine glands at the level of the dermis and the clinical picture of gooseflesh, nonfollicular papules covering
the trunk and extremities after exercising. The symp-
toms usually last less than an hour after overheating or
exercise has ended. Patients report decreased sweating
or complete anhidrosis of affected areas, with compensatory facial hyperhidrosis. The usual course of miliaria
profunda lasts several months and may resolve only if
the patient discontinues activities associated with excessive sweating.
Treatments include application of topical anhydrous
lanolin to affected areas before exercise and short courses
of oral isotretinoin (0.5 mg/kg). Regular bathing to remove salt and bacteria may be helpful. Because of the causative role of S epidermidis in miliaria, antibiotics are another consideration, although to our knowledge, there
are no reports of successful antibiotic treatment of miliaria profunda.3
REFERENCES
1. Wenzel FG, Horn TD. Nonneoplastic disorders of the eccrine glands. J Am Acad
Dermatol. 1998;38(1):1-17.
2. Mowad CM, McGinley KJ, Foglia A, Leyden JJ. The role of extracellular polysaccharide substance produced by Staphylococcus epidermidis in miliaria. J Am Acad
Dermatol. 1995;33(5, pt 1):729-733.
3. Kirk JF, Wilson BB, Chun W, Cooper PH. Miliaria profunda. J Am Acad Dermatol.
1996;35(5, pt 2):854-856.
Nodular Lesions on the Arm
Diagnosis: Lobomycosis.
CLINICAL COURSE
The lesional biopsy specimen revealed numerous and diffuse inflammatory granulomas in the dermis. The granulomas were composed of histiocytes and giant cells containing numerous phagocytosed thick-walled cells. An
asteroid body was also seen. The GMS stain showed the
typical yeasts of lobomycosis in chains of uniform round
to oval cells.
The nodules were completely excised, and the patient was given itraconazole, 200 mg/d, for 6 months as
an attempt to prevent disease relapse.
DISCUSSION
Lobomycosis, also known as Lobo disease, is a chronic
fungal disease that affects the skin and subcutaneous tissue.1 It was first described in Brazil in 1931 by Jorge Lobo.2
The etiologic agent has been named, after much controversy, as Lacazia loboi.3
The disease affects people living in the tropical zone
of the New World.2 It has been described mostly in Brazil,4 but it has also been found in Colombia, Surinam,
Costa Rica, Venezuela, French Guiana, and Panama. The
disease has also been described in dolphins.1
Lobomycosis mainly affects men, and it is most likely
to be related to occupational exposure.2 The high-risk activities include farming, gold mining, fishing, and hunting.1 Patients often reported a bite or sting from an arthropod, snake, or stingray or otherwise trauma from a
cutting instrument.2
The disease is clinically characterized by variably sized
dermal nodules, either lenticular or in plaques. They can
be either hypopigmented or hyperpigmented and occasionally achromic. Although any area of the body is potentially susceptible, since infection usually follows
trauma,2 the most commonly affected areas include the
lower extremities, the ears, and the upper extremities.4
Differential diagnosis includes leprosy, anergic cutaneous leishmaniasis, chromoblastomycosis, paracoccidioidomycosis, Kaposi’s sarcoma, keloids, fibroma, neurofibromas, dermatofibrosarcoma protuberans, and
metastatic lesions.1,2
Diagnosis may be established by skin smear or biopsy.4 Skin smear allows direct visualization of the parasite. Lobomyces are yeastlike, rounded, thick-walled cells
that occur in chains of 2 to 10 cells.2 Histopathologic features are pathognomonic. The epidermis is usually atrophic and the dermis is occupied by a fibrous, diffuse, in-
flammatory granuloma composed of histiocytes and giant
cells containing the typical thick-walled cells. Asteroid
bodies may also be seen in lobomycosis; they are intracytoplasmic eosinophilic star-shaped structures also seen
in sarcoidosis, tuberculosis, and other mycosis. Periodic acid–Schiff, GMS, or Gridley silver stains clearly distinguish the yeastlike cells.1,2,4 Lacazia loboi has not been
cultured in vitro.3
The optimal treatment for localized lesions is wide surgical excision, ensuring that margins are free of infection to avoid recurrence. Disseminated lesions are better treated with chemotherapy. 2 Clofazimine, 4
itraconazole, and a combination of both drugs have been
successfully used in a few cases.5
REFERENCES
1. Brun AM. Lobomycosis in three Venezuelan patients. Int J Dermatol. 1999;38(4):
302-305.
2. Talhari S, Pradinaud R. Topley & Wilson’s Microbiology and Microbial Infections:
Medical Mycology. Washington, DC: Edward Arnold Ltd; 2005:430-435.
3. Taborda PR, Taborda VA, McGinnis MR. Lacazia loboi gen. nov., comb. nov., the
etiologic agent of lobomycosis. J Clin Microbiol. 1999;37(6):2031-2033.
4. Talhari S, Souza MDG, Mendes AP, Talhari A. Deep mycoses in Amazon region.
Int J Dermatol. 1988;27(7):481-484.
5. Fischer M, Chrusciak Talhari A, Reinel D, Talhari S. Successful treatment with clofazimine and itraconazole in a 46 year old patient after 32 years duration of disease.
Hautarzt. 2002;53(10):677-681.
Beefy Red Plaque in the Popliteal Fossa
Diagnosis: Cutaneous Blastomyces dermatitidis
infection.
MICROSCOPIC AND LABORATORY
FINDINGS AND CLINICAL COURSE
At the initial visit, findings from the potassium hydroxide touch-preparation smear from the right popliteal fossa
plaque revealed large 5- to 15-µm-diameter refractile ovoid
to circular yeast forms with occasional broad-based budding. Histologic examination results from the shave biopsy specimen revealed marked pseudoepitheliomatous hyperplasia, scattered intraepidermal and intradermal
neutrophilic microabscesses, marked epidermal spongiosis, and an underlying suppurative chronic inflammatory infiltrate with multinucleated giant and plasma
cells. Scattered broad-based budding yeast forms were seen
within the inflammatory infiltrate. The periodic acid–
Schiff stain was positive for the presence of fungus.
The patient was diagnosed as having systemic blastomycosis, with osteomyelitis of the navicular bone due
to blastomycosis infection, pulmonary scarring in the right
upper lobe consistent with chronic pulmonary blastomycosis, and cutaneous blastomycosis. Treatment with
oral itraconazole, 200 mg twice a day, was initiated.
DISCUSSION
First described by Gilchrist1 in 1894, B dermatitidis is a
thermal dimorphic fungus endemic to the central
United States. In the laboratory, B dermatitidis is initially isolated in the mycelial form at 30°C. Identification is confirmed by converting the mycelial form to
the yeast at 37°C; the converted form is characterized
by single broad-based budding yeast with thick refractile cell walls.
The lungs are the most common primary site of blastomycosis infection in humans. Infection occurs when
inhaled B dermatitidis conidia avoid phagocytosis by neutrophils, monocytes, and alveolar macrophages and then
convert to the more resistant yeast form.2 Most cutaneous blastomycosis is caused by secondary dissemination of primary pulmonary infection; rarely, primary cutaneous inoculation of blastomycosis can occur.3 In
contrast to other dimorphic fungi, B dermatitidis infection is common in nonimmunocompromised patients.
Cellular immunity is the most important acquired defense against B dermatitidis.
The clinical presentation of B dermatitidis infection is
highly variable and may mimic other disease processes. Pulmonary infection typically presents as pneumonia with an
infiltrate on chest radiographs. From the lung, organisms
disseminate hematogenously in 25% of cases.4 Skin and bone
are the most common sites of dissemination. Involvement
of the genitourinary tract and central nervous system occurs less commonly. Cutaneous lesions of B dermatitidis
infection may be ulcerative, verrucous, or, rarely, subcutaneous. Histologic features of cutaneous blastomycosis include papillomatosis, intraepidermal microabscesses, and
inflammatory cells in the dermis.
Diagnosis is made either by direct visualization or culture of the organism from the suspected site of infection.
The yeast can be seen microscopically on direct potassium hydroxide examination.4 In our patient, the use of a
potassium hydroxide touch-preparation smear allowed immediate visualization of the yeast form, expediting diagnosis and treatment. Serologic or skin testing is not helpful in the diagnosis of blastomycosis. Oral itraconazole, 200
mg/d for at least 6 months, is used to treat mild to moderate pulmonary and non–central nervous system infections. For patients with life-threatening disease, central ner-
1323-1328
vous system infection, compromised immunity, or special
circumstances (eg, pregnancy and pediatric cases), amphotericin B is the treatment of choice.5
REFERENCES
1. Gilchrist TC. Protozoan dermatitis. J Cutan Gen Dis. 1894;12:496-499.
2. Bradsher RW, Chapman SW, Pappas PG. Blastomycosis. Infect Dis Clin North Am.
2003;17(1):21-40.
3. Larson DM, Eckman MR, Alber RL, Goldschmidt VG. Primary cutaneous (inoculation) blastomycosis: an occupational hazard to pathologists. Am J Clin Pathol.
1983;79(2):253-255.
4. Chapman SW. Blastomycosis dermatitidis. In: Mandell GL, Bennett JE, Dolin R,
eds. Principles and Practice of Infectious Diseases. 6th ed. Philadelphia, PA: Churchill
Livingstone; 2005:3026-3039.
5. Chapman SW, Bradsher RW, Campbell GD, Pappas PG, Kauffman CA. Practice
guidelines for the management of patients with blastomycosis. Clin Infect Dis. 2000;
30(4):679-683.
©2007 American Medical Association. All rights reserved.
Submissions
Clinicians, local and regional societies, and residents and
fellows in dermatology are invited to submit quiz cases to
this section. Cases should follow the established pattern
of a Report of a Case section of less than 150 words, followed by the Diagnosis, Microscopic Findings, and Discussion. The discussion should be between 285 and 350
words. References are limited to 9. The text should be submitted double-spaced, with the right margin ragged. Photomicrographs and illustrations must be wider than they are
tall (horizontal orientation), sharply focused with good
color balance, and submitted as separate JPG files with each
file numbered with the figure number. Material must be
accompanied by the required copyright transfer statement (see authorship form in Instructions for Authors [http:
//archderm.ama-assn.org/misc/auinst_crit.pdf]). Manuscripts should be submitted via our online manuscript
submission and review system (http://manuscripts
.archdermatol.com). Please indicate in your cover letter that
the manuscript is a submission to Off-Center Fold.
CORRESPONDENCE
RESEARCH LETTERS
Digital Image Analysis: A Reliable Tool
in the Quantitative Evaluation
of Cutaneous Lesions and Beyond
Q
uantitative evaluation of cutaneous lesions in
clinical trials can be problematic for diseases
such as lower extremity ulcers, vitiligo, and
alopecia. Because of the irregular shapes of
these lesions, calculation of their circumference, diameter, and area can be cumbersome using traditional
manual tracings. As a result, most trials using manual
tracings will measure the longest diameter or approximate circumference of a target lesion. To compound the
problem, in some diseases, access to the lesions is difficult. These lesions include erosions of the oral or genital mucosa. New software is now readily available that
incorporates digital technologies and allows for digital
image analysis (DIA) to circumvent these traditional
problems. Digital image analysis provides a means to
calculate desired target diameter and area with ease.
Our objective was to compare the interrater reliability and application feasibility of Image Pro Express (Media Cybernetics, Silver Spring, Maryland) DIA software
with traditional manual tracings to determine the area
of lower extremity ulcers.
Methods. Our study was imbedded in a larger randomized, double-blind, placebo-controlled trial, and inclusion and exclusion criteria was previously described by
Sumpio et al.1 After approval from the respective institutional review boards, participants were recruited from
vascular surgery and podiatry clinics from a total of 16
sites in the United States.
Each site provided both digital images and transparencies with manual tracings of the target ulcers (Figure 1).
Of the 3 possible readers, 2 readers outlined the target ulcers from both the digital images and the transparencies.
At all sites, digital images were obtained using a Nikon (Melville, New York) Coolpix 8800 camera. Furthermore, all
images were obtained using standardized procedures; notably, the target ulcers were positioned 6 inches away from
the camera and facing the light, to avoid any shadows. A
metric ruler was placed on both the digital images and transparencies to allow for measurement calibration. Once the
digital images were obtained, they were uploaded into an
IBM (Chicago, Illinois) desktop computer, and the perimeter of each ulcer was outlined electronically by the 2 readers using a wireless mouse (Figure 2). Concurrently, the
respective transparencies with manual tracings outlined by
the 2 readers were scanned into the computer using a standard IBM flatbed scanner. We then used the Image Pro Express DIA software to determine the diameter and subse-
quent area of the target ulcers for both the digital images
and the manual tracings.
Continuous variables were calculated as means±SDs
and were compared by t test or analysis of variance
where appropriate. Categorical variables were compared by ␹2 analysis. Finally, agreement between raters
was determined by intraclass correlation coefficient.
Reliability of DIA was determined by comparing the
area obtained from DIA to the area obtained from
manual tracings. P ⬍ .05 was considered statistically
significant.
Results. A total of 99 patients with lower extremity ulcers were recruited into the study. The mean ± SD patient age was 66±13 years; 65% were men (n=65), and
64% were white (n=64). In addition, 77% of the lower
extremity ulcers were from participants who were diagnosed as having diabetes mellitus (n=76).
Of the 99 patients in the study, 91 patients had manual
tracings and 91 had digital images; 87 had both. The
mean±SD lower extremity ulcer area measured by reader
1 was 3.27 ± 3.53 cm 2 in the manual tracings and
3.08±3.15 cm2 in the digital images. Similarly, the lower
extremity ulcer mean±SD area measured by reader 2 was
3.28±3.50 cm2 in the manual tracings and 3.11±3.18 cm2
in the digital images. The intraclass correlation coefficient between the 2 readers for manual tracing and digital images was 0.9994 and 0.9978, respectively. There was
no statistically significant differences in areas between
manual tracings and digital images (paired t test P=.12;
95% confidence interval, −0.51 to 0.06 cm2).
Comment. In our study, we demonstrated that area can
be reliably measured across raters using DIA in targeted
lower extremity ulcers. Also, we have shown that the
results from the DIA approach are not significantly different from those of traditional manual tracings.
While traditional manual tracings have been the gold
standard method by which to evaluate lower extremity
ulcer circumference, diameter, and area, manual tracings can be cumbersome given the irregular shapes of these
lesions. However, DIA can provide quantitative evaluation of target lower extremity ulcers with greater ease and
efficiency. Therefore, we propose that if DIA is as reliable as traditional manual tracings, DIA may be used to
estimate the size of lower extremity ulcers when the investigator sees fit.
The use of DIA is not limited to lower extremity
ulcers but also potentially extends to other difficult-tomeasure lesions. Specifically, DIA may serve a vital
role in the quantitative evaluation of other diseases
involving irregular-border cutaneous lesions, such as
vitiligo and alopecia, as well as difficult to access
lesions, such as erosions of the oral or genital mucosa.
In fact, DIA may prove to be not only useful and reliable but also more precise than traditional manual
tracings.
1331
mm
mm
mm
Figure 1. Three digital images with electronic manual tracings (left) and corresponding traditional manual tracings (right). All scales are given in millimeters.
The greatest limitation of the DIA technology is for
use on lesions that cannot be accurately represented in
2 dimensions, such as large ulcers that wrap around
the curvature of the limb. In this circumstance, several
standardized images of the ulcer and complex reconstruction may be necessary. However, In general,
patient positioning, body curvature, or tapering of the
limbs, as well as compromised accessibility can be
1332
Wound Assessment by 3-Dimensional
Laser Scanning
R
Figure 2. Procedure for using the Image Pro Express (Media Cybernetics,
Silver Spring, Maryland) digital image analysis (DIA) software: (1) position
target lesion toward camera at a set distance and toward a light source for
standardization; (2) place ruler for calibration (present scale is in
millimeters); (3) take digital photograph; (4) download image into computer
running DIA software; (5) trace target, as demonstrated in this image; and
(6) query DIA software to perform diameter and area calculations.
sources of measurement error for manual tracings, and
in general, DIA provides a technology that can at least
partially overcome these problems. Finally, it is
important to note that DIA provides information
beyond the quantitative evaluation of traditional
manual tracings. Because DIA involves digital photography, it provides an image and thus a basis for objective evaluation of other end points such as infection,
lesion thickness, granulation status, surrounding
edema, and lesion progression over time, if used at
sequential time points. Overall, additional studies are
needed to further assess the uses of DIA in quantitative evaluation of other cutaneous lesions and beyond.
ecent advances in our understanding of the biology of cutaneous tissue repair have influenced
current therapeutic strategies for chronic wound
management and will continue to influence chronic
wound management strategies into the future.1
An effective and accurate monitoring of skin lesions
should be performed by measuring in an objective, precise, and reproducible way the complete status and evolution of the wound.2 The main goal of current research
projects is to design an easy-to-use technological system that can monitor the qualitative and quantitative evolution of a skin lesion.
This level of monitoring can be achieved by using 3-dimensional scanners: in particular, systems based on active optical approaches.3 There are 2 different areas of
potential applications of such types of devices: in medical treatment (to improve the efficacy of therapeutic regimens)4 and pharmacologic scientific research (to assess
the quality and effectiveness of new chemicals or clinical procedures).5
Correspondence: Dr Chen, Department of Dermatology, Emory University School of Medicine, 101 Woodruff Cir, Atlanta, GA 30322 ([email protected]).
Funding/Support: This project was supported in part by
an unrestricted educational grant from Otsuka Pharmaceuticals; National Institutes of Health (NIH) grant NHLBI
R01-47345 and the Veterans Administration Merit Review Board (Dr Sumpio); and Mentored Patient Oriented Career Development Award K23AR02185-01A1
from the National Institute on Arthritis and Musculoskeletal and Skin Disease, NIH, and the American Skin
Association David Martin Carter Research Scholar Award
(Dr Chen).
Methods. We prospectively examined 15 patients with
venous leg ulcers. The patients who underwent sequential imaging of chronic wounds for this study all attended the leg ulcer clinic of the Wound Healing Research Unit at the University of Pisa, Pisa, Italy.
Our sequential imaging system is equipped with a Vivid
900 laser scanner (Minolta, Osaka, Japan), which is used
for digitizing or scanning the wound shape. With regard
to the calculation of the “external” surface and volume of
a wound, it is necessary to assess its original shape to determine the missing volume virtually. At the time of patient presentation, information on the shape of the skin before the wound occurred is missing, and the technique for
virtual reconstruction of the original wound surface must
be as easy and user-friendly as possible. The system, relying on an analysis of the shape of the surface immediately
outside the wound perimeter, creates an interpolating virtual surface that is continuously connected to the existing
surface outside the wound and to that covering it.
The parameters we studied were the mean wound area
(measured in square centimeters) and mean volume (cubic centimeters). To assess interrater reproducibility, scans
were evaluated by 2 independent investigators. For assessment of intrarater reproducibility, a single investigator performed 2 consecutive measurements 5 minutes apart. Immediately after the first wound assessment
of the first observer, a second observer, blinded to the
findings of the first analysis, measured the same wound.
The means and standard deviations of duplicate determinations for each wound were used for analysis. The
reproducibility of measurements was evaluated by means
of an intraclass correlation coefficient (ICC) and its 95%
confidence interval (CI).
1. Sumpio BE, Chen SC, Moran E, et al. Adjuvant pharmacological therapy in the
management of ischemic foot ulcers: results of the HEALing of Ischemic Foot
Ulcers With Cilostazol Trial (HEAL-IT). Int J Angiol. 2006;15(2):76-82.
Results. The measured total areas and volumes for independent raters and for subsequent measures of 1 rater are
Zakiya M. Pressley, MD
Jovonne K. Foster, MS
Paul Kolm, PhD
Liping Zhao, MS
Felicia Warren, BA
William Weintraub, MD
Bauer E. Sumpio, MD, PhD
Suephy C. Chen, MD, MS
1333
Table 1. The Total Areas and Volumes of the Different
Wounds Measured by the 2 Independent Raters and the 2
Measurements Made by the Single Rater a
Rater 1
Wound
Parameter
Area, cm2
Volume, cm3
a All
Measurement 1 Measurement 2
52.36 ± 8.5
18.3 ± 2.6
51.26 ± 3.6
18.6 ± 3.7
Rater 2
53.36 ± 8.4
19.4 ± 4.6
2. Romanelli M, Gaggio G, Coluccia M, Rizzello F, Piaggesi A. Technological
advances in wound bed measurements Wounds. 2002;14:58-66.
3. Chen F, Brown GM, Song M. Overview of three-dimensional shape measurement using optical methods Opt Eng. 2000;39:10-14.
4. Kantor J, Margolis DJ. A multicentre study of percentage change in venous
leg ulcer area as a prognostic index of healing at 24 weeks. Br J Dermatol. 2000;
142(5):960-964.
5. Moore K, McCallion R, Searle RJ, Stacey MC, Harding KG. Prediction and
monitoring the therapeutic response of chronic dermal wounds. Int Wound J.
2006;3(2):89-96.
6. Mani R. Science of measurements in wound healing. Wound Repair Regen. 1999;
7(5):330-334.
data are reported as mean ± SD.
Table 2. Percentage Relative Error in the Measurements
of Total Areas and Volumes and ICC of the Different Scans
Between 2 Independent Raters and Within a Single Rater a
Wound
Parameter
Area, cm2
Volume, cm3
Intrarater
ICC
Interrater
ICC
1.06 ± 0.66
1.96 ± 1.33
0.9976
0.9832
0.54 ± 0.39
1.44 ± 0.91
0.9936
0.9714
Abbreviation: ICC, intraclass correlation coefficient.
a Unless otherwise indicated, data are reported as mean ± SD percentage
relative error.
reported in Table 1. No statistically significant differences
were found between scans evaluated by the 2 investigators about wound area and volume. The relative errors and
the intraclass correlation coefficients are reported in
Table 2. The ICC values were excellent for both intrarater
and interrater reproducibility with a very low relative error value. The mean ± SD time for a full scan acquisition
on the wound area and volume was 3.6 ± 1.4 minutes.
The Diagnostic Yield of Histopathologic
Sampling Techniques in PAN-Associated
Cutaneous Ulcers
P
olyarteritis nodosa (PAN), a medium-sized vessel (MSV) vasculitis, may result in cutaneous
ulcers.1 There is no specific serologic abnormality associated with PAN; therefore, the mainstay diagnosis consists of histologic evidence of MSV vasculitis
in the context of pertinent clinical findings.2 Several factors may contribute to the potential low diagnostic yield
of tissue biopsy specimens from MSV-vasculitic ulcers.
The present study evaluates the role of tissue sampling
in the histologic evaluation of PAN-associated cutaneous ulcers.
Methods. Retrospective analysis of de-identified archival biopsy specimens taken from skin ulcers and sural
nerves of 29 patients with histologically proven PANassociated MSV vasculitis. Patients met the classifica29 Total cases of PAN-associated
cutaneous ulcers
Comment. The laser scanner system used in this study
enables users to accurately acquire 3-dimensional digital models of various types of skin wounds. Since the final users will be physicians and not computer experts, a
user-friendly system is believed to be a fundamental parameter for its success.
The accuracy of scanning systems has improved in the
past few years, and prices have also decreased, making
these devices affordable for a wider community of potential users.6 The integration into a single system of capabilities that can capture the shape and surface reflection characteristics makes 3-dimensional scanning an
invaluable resource in all those applications where it is
necessary to sample both surface attributes.
Diagnosis on first skin biopsy
17 Positive specimens
contained subcutis
and peripheral and
nearby central areas
of the ulcer (60%)
2 Specimens
lacked subcutis
and nearby
central areas
of ulcer (17%)
10 Specimens contained
subcutis but lacked
nearby central
areas of ulcer
(83%)
Diagnosis on second skin biopsy
Marco Romanelli, MD, PhD
Valentina Dini, MD
Tommaso Bianchi, MD
Paolo Romanelli, MD
9 Positive specimens
contained subcutis
and peripheral and
of the ulcer (75%)
Correspondence: Dr Romanelli, Wound Healing Research Unit, Department of Dermatology, University of
Pisa, Via Roma, 67, 56126 Pisa, Italy (m.romanelli@med
.unipi.it).
1. Schultz G, Mozingo D, Romanelli M, Claxton K. Wound healing and time:
new concepts and scientific applications. Wound Repair Regen. 2005;13(4)
(suppl):S1-S11.
12 Negative (40%)
3 Negative (25%)
1 Biopsy speciman
contained subcutis,
peripheral, and
of ulcer (33%).
Diagnosis was
confirmed with
sural nerve biopsy
2 Specimens
contained subcutis
but lacked nearby
central areas
of ulcer (66%)
Figure 1. Evaluation of the role of sampling technique and site of
polyarteritis nodosa (PAN)-associated cutaneous ulcer in the yield of the
histopathologic diagnosis.
1334
A
B
C
D
Figure 2. Hematoxylin-eosin–stained biopsy specimens from clinically active cutaneous ulcers associated with polyarteritis nodosa (PAN). A, Incisional biopsy
specimen from an ulcer periphery shows a medium-deep to deep dermal medium-sized muscular artery (arrow) with scant perivascular lymphocytic inflammation
and intramural fibrosis but no necrotizing or other histologic feature of medium-sized vessel (MSV) vasculitis. Dense interstitial dermal fibrosis is also present
(original magnification ⫻2.5). B, Greater magnification of the artery indicated by the arrow in panel A (original magnification ⫻40). C, Narrow incisional specimen
containing subcutis and including nearby central tissue. The dermal-subcutaneous junction underlying the nearby central area of the ulcer reveals MSV vasculitis
with necrotizing features, endothelial swelling, and a neutrophil-rich infiltrate with leukocytoclasia. The wedge-shaped area of skin overlying the affected MSV
(arrow) that would normally be its blood supply reveals dermal necrosis (most evident in the upper dermis) and epidermal ulceration (original magnification
⫻2.5). D, Greater magnification of the MSV area indicated by the arrow in panel C (original magnification ⫻40).
tion and definitional criteria of the American College of
Rheumatology3 and Chapel Hill Consensus Conference.4 Specimens were obtained from Johns Hopkins University, University of Pennsylvania, and Ameripath Inc.
Biopsy technique, depth and site within the ulcer, and
histologic findings were evaluated by the same dermatopathologist (C.H.N). Peripheral ulcer areas were defined to include the ulcer edge and surrounding nonulcerated skin, whereas nearby central ulcer areas included
the areas near the ulcer center. Both areas were deter-
mined by the referring physician and histopathologically. Fisher exact and ␹² tests were performed.
Results. Of the 29 biopsy-proven cases of PANassociated cutaneous ulcers, 26 were confirmed with skin
specimens that included subcutaneous tissue and peripheral and nearby central areas of the ulcer (Figure 1).
Sampling techniques ranged from incisional to deep punch
biopsies and included the double trephine method.5 Peripheral and nearby central biopsy specimens were ac-
1335
quired by either a single elliptical incision or by multiple, separate, deep punch biopsies, both techniques
performed along a radial trajectory (perpendicular to the
ulcer edge).
Of the 26 patients with skin biopsy confirmation, 9
had to undergo repeated biopsies for diagnosis to be rendered. For 3 of the 29 patients, dermatopathologic confirmation could not be obtained despite repeated biopsy
specimen evaluation, and histologic confirmation through
sural nerve biopsies was required. Repeated skin biopsy
specimens from only 1 of these 3 patients contained subcutis and were obtained from peripheral and nearby central areas. Specimens from the other 2 patients who underwent repeated skin biopsies contained subcutis but
lacked nearby central ulcer tissue.
Owing to small sample size, Fisher exact and ␹² tests
were performed on 2 variables: (1) specimens containing subcutis and peripheral and nearby central ulcer areas
(n=27) vs (2) specimens with neither subcutis nor nearby
central areas (n = 14), both variables yielding a histologic diagnosis of PAN. The ␹² value (38.07), exceeded
the critical threshold for .05 probability level (3.84); therefore, the difference in diagnostic yield between the 2 variables was significant. The Fisher exact test also yielded
a nondirectional 2-tailed probability of P ⬍.001.
Comment. Histologic evidence of MSV vasculitis in conjunction with pertinent clinical and ancillary study correlation are the gold standard diagnostic pillars for PAN.
The present study shows that subcutis-containing specimens that include not only peripheral ulcer areas but also
nearby central areas offer the best histologic yield for the
diagnosis of PAN-associated ulcers (Figure 2). On the
other hand, all initial and the vast majority of repeated nondiagnostic biopsy specimens were lacking subcutis and/or
were obtained from only the ulcer periphery. Cutaneous
MSVs are located in the dermal-subcutaneous junction,
deep dermis, or subcutis. When MSVs are affected by a
vasoocclusive process, ulcers can result in the wedgeshaped area of skin above the affected MSV that normally
provides that skin’s blood supply. This finding supports
the notion that obtaining subcutis-containing specimens
from nearby central areas of PAN-associated ulcers would
increase diagnostic yield.
Polyarteritis nodosa–associated cutaneous ulcers carry
a worse prognosis that other cutaneous presentations.
Early diagnosis and prompt and effective therapy would
reduce the high PAN-associated morbidity and mortality. The present study underscores the importance of adequate sampling as a factor in the early diagnosis of PANassociated cutaneous ulcers.
Carlos Ricotti, MD
John P. Kowalczyk, BBA
Marcelo Ghersi, MD
Carlos H. Nousari, MD
Correspondence: Dr Nousari, Institute for Immunofluorescence, Dermpath Diagnostics South Florida, 895
SW 30th Avenue, Ste 101, Pompano Beach, FL 33069
1. Daoud MS, Hutton KP, Gibson LE. Cutaneous periarteritis nodosa: a clinicopathological study of 79 cases. Br J Dermatol. 1997;136(5):706-713.
2. Carlson JA, Chen KR. Cutaneous vasculitis update: neutrophilic muscular vessel and eosinophilic, granulomatous, and lymphocytic vasculitis syndromes.
Am J Dermatopathol. 2007;29(1):32-43.
3. Lightfoot RW Jr, Michel BA, Bloch DA, et al. The American College of Rheumatology 1990 criteria for the classification of polyarteritis nodosa. Arthritis
Rheum. 1990;33(8):1088-1093.
4. Jennette JC, Falk RJ, Andrassy K, et al. Nomenclature of systemic vasculitides: proposal of an international consensus conference. Arthritis Rheum. 1994;
37(2):187-192.
5. Ha CT, Nousari HC. Surgical pearl: double-trephine punch biopsy technique
for sampling subcutaneous tissue. J Am Acad Dermatol. 2003;48(4):609-610.
COMMENTS AND OPINIONS
Sodium Thiosulfate as First-Line Treatment
for Calciphylaxis
T
he case report by Robinson et al1 concerning a
woman with a renal transplant whose calciphylaxis was successfully treated with cinacalcet hydrochloride is interesting but must be interpreted with
caution. We present herein our experience with a 45year-old woman who underwent renal transplantation 10
years ago for treatment of nephropathy of undetermined origin.
Report of a Case. The patient’s renal function deteriorated because of chronic allograft nephropathy and uncontrolled diabetes. On her left leg, she developed ulcerations surrounded by livedoid borders that rapidly
became painful and resistant to local wound care. Despite treatment with analgesics and antibiotics, her condition worsened, and she developed septic shock requiring amputation of her left leg. A week later, ulcerations
appeared on the right leg. Serum phosphate and calcium levels were high. A diagnosis of calciphylaxis was
suspected, and treatment was begun with 30 mg/d of cinacalcet hydrochloride (Mimpara; Amgen Inc, Thousand
Oaks, California), a calcimimetic medication, along with
intestinal calcium-free phosphate binders and hemodialysis with normocalcic dialysate (1.50-1.75 mmol/L)
3 times per week.
As ulcerations on the right leg progressed
(Figure 1), we suspected worsening of low bone turnover or an adynamic bone syndrome caused by the calcimimetic therapy. This hypothesis was reinforced by
laboratory tests prior to calcimimetic treatment showing a low serum intact parathyroid hormone level (95.7
pg/mL), which is below the recommended values for
dialysis patients (150-300 pg/mL),2 high calcium and
phosphate levels (10.44 mg/dL and 5.73 mg/dL, respectively) and low plasma osteocalcin level. (To convert
parathyroid hormone to nanograms per liter, multiply
by 0.1053; to convert calcium and phosphate to millimoles per liter, multiply by 0.25.) We stopped cinacalcet treatment and started daily hemodialysis with lowcalcium dialysate (1.25 mmol/L) and, after dialysis,
infusion of 25 g of sodium thiosulfate 3 times per week.
Within 2 weeks, the pain decreased, and the livedo disappeared. Serum calcium and phosphate levels fell to
normal and remained stable. Six weeks later most of
1336
Figure 1. Ulcers of the right leg prior to treatment.
Figure 2. Healed ulcers of the right leg 4 months after treatment.
lesions were healed. After 8 weeks, we stopped sodium
thiosulfate therapy, and the patient has been without
relapse for 4 months (Figure 2).
tion on calciphylaxis lesions related to adynamic bone
syndrome and supports the use of sodium thiosulfate
as a first-line agent in this rare but life-threatening
disease.
Comment. Calciphylaxis treatment is controversial. In
the setting of end-stage renal disease, a major aim is to
decrease the calcium-phosphate product under the saturation threshold (55 mg2/dL2). This is usually done by
controlling an underlying secondary hyperparathyroidism, either by parathyroidectomy3 or alternatively using
calcimimetic agents.4 Sodium thiosulfate therapy can also
be very helpful,5 especially in the absence of hyperparathyroidism.6 This inorganic salt enhances the solubility
of calcium deposits and may restore endothelial cell dysfunction through its antioxidant effect.
For our patient, low serum parathyroid hormone levels and worsening with calcimimetic therapy and normocalcic dialysate hemodialysis led us to suspect a low
bone turnover or an adynamic bone syndrome. We cannot ascertain the relative contribution of each of the 2
interventions (sodium thiosulfate and a low-calcium dialysate hemodialysis) in the healing of the calciphylaxis
lesions. However, it has been claimed that the benefit of
hemodialysis with low-calcium dialysate was limited by
the serum calcium plasma level rebound following the
session,5 reinforcing our impression of sodium thiosulfate effectiveness.
This report illustrates the potential deleterious
effect of excessive serum parathyroid hormone reduc-
Felix Ackermann, MD
Annabelle Levy, MD
Eric Daugas, MD, PhD
Noel Schartz, MD, PhD
Anne Riaux, MD
Christian Derancourt, MD
Pablo Urena, MD
Celeste Lebbé, MD, PhD
Correspondence: Dr Lebbé, Dermatology, Hôpital SaintLouis, 1 avenue Claude Vellefaux, CEDEX 75010, Paris,
France ([email protected]).
1. Robinson MR, Augustine JJ, Korman NJ. Cinacalcet for the treatment of
calciphylaxis. Arch Dermatol. 2007;143(2):152-154.
2. National Kidney Foundation. K/DOQI clinical practice guidelines for bone
metabolism and disease in chronic kidney disease. Am J Kidney Dis. 2003;
42(4)(suppl 3):S1-S201.
3. Weenig RH, Sewell LD. Calciphylaxis: natural history, risk factor analysis,
and outcome. J Am Acad Dermatol. 2007;56(4):569-579.
4. Sharma A, Burkitt-Wright E, Rustom R. Cinacalcet as an adjunct in the successful treatment of calciphylaxis. Br J Dermatol. 2006;155(6):1295-1297.
5. Guerra G, Shah RC. Rapid resolution of calciphylaxis with intravenous sodium thiosulfate and continuous venovenous haemofiltration using low calcium replacement fluid: case report. Nephrol Dial Transplant. 2005;20(6):
1260-1262.
6. Baker BL, Fitzgibbons CA, Buescher LS. Calciphylaxis responding to sodium
thiosulfate therapy. Arch Dermatol. 2007;143(2):269-270.
1337
In reply
We thank Ackermann et al for their comments regarding
our case report of a patient with calciphylaxis and secondary hyperparathyroidism treated with cinacalcet.1 Cinacalcet treatment is indicated for dialysis patients with secondary hyperparathyroidism whose parathyroid hormone level
is greater than 300 pg/mL. Our patient developed severe secondary hyperparathyroidism associated with parathyroid
hormone levels as high as 1080 pg/mL (reference range, 7-53
pg/mL) and with varying calcium and phosphorous levels.
Although not receiving dialysis, he was considered a good
candidate for cinacalcet therapy with close monitoring of
his parathyroid hormone, calcium, and phosphorous levels. Throughout therapy, his lowest measured parathyroid
hormone level was 147 pg/mL, near the National Kidney
Foundation–Kidney Disease Outcomes Quality Initiative
(NKF-K/DOQI)2 recommended range for patients with stage
5 chronic kidney disease (150-300 pg/mL).
Adynamic bone disease is a common form of osteodystrophy in patients receiving dialysis, and excessive suppression of parathyroid hormone level is a principal risk factor
in its development. Adynamic bone disease is a well-known
risk associated with cinacalcet therapy. Parathyroid hormone level should be measured before the initiation of cinacalcet therapy and regularly monitored throughout therapy;
if levels decrease below the recommended range of 150 to
300 pg/mL, the dose of cinacalcet and/or any vitamin D–related drug should be reduced or treatment discontinued.
Calciphylaxis is a poorly understood multifactorial disease, and treatment often aims to minimize suspected risk
factors. Two additional cases of the successful use of cinacalcet in patients with calciphylaxis and secondary hyperparathyroidism have been described in the literature; in both
cases, the parathyroid hormone level was significantly elevated (>190 and 244 pmol/L [>1727 and 2218 pg/mL])
before the initiation of cinacalcet therapy.3,4 Our case report along with these 2 reports suggest that with careful monitoring, cinacalcet could be an efficacious therapy in certain
patients with calciphylaxis and secondary hyperparathyroidism.
However, the case described by Ackermann et al demonstrates that cinacalcet may not be effective in all patients
with calciphylaxis. To our knowledge, all reports of the successful treatment of patients with calciphylaxis are anecdotal, including the use of 0 calcium dialysate (without sodium thiosulfate)5 and other reports of sodium thiosulfate
treatment.6,7 Randomized controlled studies, not anecdotal
cases, are necessary to ascertain the appropriate standard
of care for patients with calciphylaxis. Only then will the
potential therapeutic role of both cinacalcet and sodium thiosulfate be determined.
2. National Kidney Foundation. K/DOQI clinical practice guidelines for bone
metabolism and disease in chronic kidney disease. Am J Kidney Dis. 2003;
42(4)(suppl 3):S1-S201.
3. Sharma A, Burkitt-Wright E, Rustom R. Cinacalcet as an adjunct in the successful treatment of calciphylaxis. Br J Dermatol. 2006;155(6):1295-1297.
4. Velasco N, MacGregor MS, Innes A, MacKay IG. Successful treatment of calciphylaxis with cinacalcet – an alternative to parathyroidectomy? Nephrol Dial
Transplant. 2006;21(7):1999-2004.
5. Llach F. The evolving pattern of calciphylaxis: therapeutic considerations.
Nephrol Dial Transplant. 2001;16(3):448-451.
6. Baker BL, Fitzgibbons CA, Buescher LS. Calciphylaxis responding to sodium
thiosulfate therapy. Arch Dermatol. 2007;143(2):269-270.
7. Cicone JS, Petronis JB, Embert CD, Spector DA. Successful treatment of calciphylaxis with intravenous sodium thiosulfate. Am J Kidney Dis. 2004;43
(6):1104-1108.
VIGNETTES
Skin Cancer Presenting as a Nonhealing
Wound: The Association of Polio
and Skin Cancer
S
urvivors of polio epidemics from the 1940s and
1950s make up a significant proportion of the US
patient population. In addition to morbidity secondary to paralytic polio and postpolio syndrome, an association with malignant neoplasm has been proposed.1
We present a case of skin cancers arising in a patient with
polio to further strengthen this possible association.
Report of a Case. A 54-year-old white woman with paralytic polio since age 2 years was referred to our department with a 2-year-old wound on her right anterior shin.
A 2.5⫻3.5-cm ulcer surrounded by thin and friable skin
was noted (Figure 1). Owing to the nonhealing nature
of the ulcer, a 4-mm punch biopsy was performed, the
findings of which showed sclerosing basal cell carcinoma (Figure 2). The patient subsequently had an amputation of the right lower extremity after discussion of
therapeutic options, including Mohs micrographic
surgery.
Maria R. Robinson, MD
Joshua J. Augustine, MD
Neil J. Korman, MD, PhD
Correspondence: Dr Korman, Department of Dermatology, University Hospitals Case Medical Center, 11100 Euclid Ave, Cleveland, OH 44106 ([email protected]).
1. Robinson MR, Augustine JJ, Korman NJ. Cinacalcet for the treatment of
calciphylaxis. Arch Dermatol. 2007;143(2):152-154.
Figure 1. A 2.5⫻ 3.5-cm ulcer on the right anterior shin.
1338
or to another factor such as chronic infection with the
poliovirus. Further studies are needed to support this association and to ascertain the mechanism of the cutaneous malignant neoplasms and poliomyelitis.
Jenny Vu, MD
Scott Bangert, MD
Adelaide A. Hebert, MD
Correspondence: Dr Hebert, University of Texas Medical School at Houston, 6655 Travis, Ste 600, Houston,
TX 77030 ([email protected]).
Figure 2. Basal cell carcinoma with sclerotic features.
The patient was referred again 6 months later with a
several-month history of a chronic ulcer on her left anterior shin. A 10⫻11-cm annular, scaly, red patch with no
central clearing was present, with a superficial denuded
area measuring 1⫻1 cm. A 4-mm punch biopsy specimen showed squamous cell carcinoma (SCC) in situ with
involved superficial margin and stasis changes. Two years
after surgical resection of the SCC with Mohs surgery, the
patient died due to complications of metastatic SCC.
Comment. The poliovirus is a single-stranded RNA enterovirus that shows preference for the anterior horn cells
of the spinal cord. The resulting cell injury may produce paralytic polio.2 Although poliovirus is extremely
infectious, clinical manifestations of infection are rare,
with 1% to 2% of cases developing paralysis.3
Paralysis is a predisposing factor for chronic ulcer formation and possibly malignant neoplasm. Factors including pressure-induced ischemia, maceration, and local trauma lead to skin breakdown, which becomes
chronic as denervation plays an important role in wound
healing.4 Malignant neoplasms, particularly SCC, arise
in up to 1.7% of chronic wounds, although the mechanism for this transformation is unclear.5 While the ulcerations in our patient were a predisposing factor to the
development of malignant neoplasms, it is possible that
her polio represents a second, important causative agent.
A recent cohort study assessed cancer risk in 5883 patients with poliomyelitis and found that affected women
may be at an increased risk for multiple malignant neoplasms, particularly breast and skin cancer.1 There was
a 66% increased risk of skin cancer, primarily nonmelanoma. Significantly, both paralyzed and nonparalyzed patients were affected equally, and the lesion distribution
in both groups reflected that of the general public, deemphasizing the role of paralysis and associated morbidity such as chronic ulcers as causative factors. To our
knowledge, no other study has evaluated the skin cancer risk among patients with polio.
Our patient’s bilateral skin cancer may be a manifestation of the link between polio and malignant neoplasm suggested in the Danish cohort study.1 This may
be owing to denervation and chronic wound formation
1. Nielsen NM, Wohlfahrt J, Aaby P, et al. Cancer risk in a cohort of polio patients.
Int J Cancer. 2001;92(4):605-608.
2. Farbu E, Gilhus NE, Barnes MP, et al. EFNS guideline on diagnosis and management of post-polio syndrome: report of an EFNS taskforce. Eur J Neurol.
2006;13(8):795-801.
3. Gawne AC, Halstead LS. Postpolio syndrome: pathophysiology and clinical
management. Crit Rev Phys Med Rehab. 1995;7:147-188.
4. Basson MD, Burney RE. Defective wound healing in patients with paraplegia
and quadriplegia. Surg Gynecol Obstet. 1982;155(1):9-12.
5. Kirsner RS, Spencer J, Falanga V, Garland LE, Kerdel FA. Squamous cell carcinoma arising in osteomyelitis and chronic wounds: treatment with Mohs
micrographic surgery vs. amputation. Dermatol Surg. 1996;22(12):10151018.
Delayed Wound Healing Following
Treatment With Low-Dose Interferon
Alfa-2b for Cutaneous Melanoma
A
djuvant therapies for cutaneous melanoma have
been well studied, and to our knowledge only
high-dose interferon alfa-2b shows reproducible benefit.1 Efforts to improve the toxic effects profile
of high-dose regimens have included the use of lower
doses. We report a case of delayed wound healing secondary to treatment with low-dose interferon alfa-2b for
cutaneous melanoma.
Report of a Case. A 23-year-old woman, skin phototype II, presented with a 3-month history of a slowly growing, nodular, achromic lesion on the left calf. Apart from
frequent sunburn, she had been well. Histologic examination revealed an ulcerated superficial spreading melanoma 4.8-mm thick, Clark level 4, without signs of regression. Her treatment consisted of a 3-cm-wide excision
followed by LLL-plasty. Sentinel lymph node dissection
of the left inguinal region revealed 3 nonmetastatic lymph
nodes. The disease was classified as a stage IIC (2002
American Joint Committee on Cancer TNM classification for melanoma).
Unfortunately, a progressive necrosis developed few
weeks later. Therefore, we carried on a secondary wound
healing process. Two months after surgery, she received
low-dose interferon alfa-2b (Intron A; Schering Plough,
Kenilworth, New Jersey) despite an incomplete wound
closure at the site of the tumor excision. The node dissection site was already healed. She was treated at a dose
of 3 million units subcutaneously 3 times per week. She
was taking no drugs other than interferon.
After starting interferon treatment, we noted no further progression in leg wound healing. Within the following 3 months, her condition progressively wors-
1339
The present report suggests that interferon alfa-2b treatment might jeopardize wound healing despite its use at
low doses. Wound contraction is an essential component of wound healing. Interferon treatment for fibroproliferative disorders has been suggested because of its
antifibrotic properties. The fibroblast-populated collagen lattice (FPCL) is an in vitro assay that simulates
wound contraction. Treatment of fibroblasts with interferon has been shown to reduce the rate and extent of
contraction using the in vitro FPCL model.4 Interferon
alfa-2b inhibits wound contraction in vivo, not through
an appreciable alteration in myofibroblast number or cytoskeletal protein expression, but possibly through a reduction in fibroblast cellularity by the induction of
apoptosis.5
After surgical management of cutaneous melanoma,
the physician should delay interferon treatment until complete wound healing. Otherwise, it might jeopardize
wound closure.
Figure 1. Fibrin deposit covering the bottom of the wound with some areas
of budding. The margins are red without signs of epidermization.
Alfred F. Ammoury, MD
Fouad El Sayed, MD
Jacques Bazex, MD
Correspondence: Dr Ammoury, Service de Dermatologie, Hôpital Purpan, CHU de Toulouse, 31059 Toulouse, France ([email protected]).
1. Tsao H, Atkins M, Sober A. Management of cutaneous melanoma. N Engl J
Med. 2004;351(10):998-1012.
2. Guillot B, Blazquez L, Bessis D, Dereure O, Guilhou JJ. A prospective study
of cutaneous adverse events induced by low-dose alpha-interferon treatment
for malignant melanoma. Dermatology. 2004;208(1):49-54.
3. Descamps V. Cutaneous side effects of alpha interferon. Presse Med. 2005;34
(21):1668-1672.
4. Nedelec B, Shen YJ, Ghahary A, Scott PG, Tredget EE. The effect of interferon alpha 2b on the expression of cytoskeletal proteins in an in vitro model
wound. J Lab Clin Med. 1995;126(5):474-484.
5. Nedelec B, Dodd CM, Scott PG, Ghahary A, Tredget EE. Effect of interferonalpha2b on guinea pig wound closure and the expression of cytoskeletal proteins in vivo. Wound Repair Regen. 1998;6(3):202-212.
Figure 2. Complete wound closure 2 months after stopping interferon
treatment. Note the evidence of the initial LLL-plasty.
ened. She developed left calf edema without additional
improvement in wound healing (Figure 1). Doppler
sonography of the lower limbs was normal. Interferon
treatment was discontinued, and wound healing progressed again with complete closure 2 months later
(Figure 2).
Comment. Although low-dose regimens are used to minimize the toxic effect profile of high-dose interferon alfa2b, there are still many adverse effects. Mucocutaneous
adverse reactions to low-dose interferon alfa include hair
loss, hair discoloration, eczematous reactions at injection or remote sites, pruritus, xerostomia, Raynaud phenomenon, or livedo reticularis.2 Other reactions include erythema or induration at injection sites progressing
in rare instances to panniculitis and skin necrosis, atrophie Blanche, and Meyerson phenomenon.3 Some rare
adverse effects have been observed: urticaria or angioedema, worsening seborrheic dermatitis, herpetic recurrence, pityriasis versicolor, recurrent buccal aphthous ulcer, and vitiligo.2
Intractable Wounds From a Herpes Simplex
Infection in an Immunosuppressed Patient
With Rheumatoid Arthritis
H
erpes simplex virus (HSV) infections, characterized by painful grouped vesicles with erythema occurring on perioral and/or pubic areas,
affect over 40 million people in the United States,1 where
1.6 million people are infected annually with HSV-2.2 The
diagnosis of HSV is generally easy, but it becomes difficult in immunosuppressed populations.3
Report of a Case. Our patient was a 76-year-old Japanese woman without human immunodeficiency virus but
with rheumatoid arthritis (RA). She had been treated with
prednisolone (5 mg/d) and methotrexate (4 mg/wk) for
more than 20 years and had also been treated for multiple recurrent ulcers on her lower legs caused by RArelated leukocytoclastic vasculitis. Multiple bullae on her
legs were successfully treated with a prednisolone dose
increase to 20 mg/d. However, multiple painful ulcers appeared on her buttocks and gradually increased in both
1340
number and size (Figure 1) prompting her admission
to our hospital.
Differential diagnoses included autoimmune bullous
disease, rheumatoid vasculitis, necrolytic migratory erythema (glucagonoma), zinc deficiency, erythema multiforme, allergic reactions, pyoderma gangrenosum, traumatic ulcerations, Behçet disease, and Crohn disease, all
of which were ruled out clinically and pathologically.
We began administering levofloxacin (300 mg/d) for
the bacterial infections, tapered the dose of prednisolone, and performed local wound care with difluprednate, a steroidal antedrug, and occlusive dressings. Within
a week after her admission, she experienced respiratory
Figure 1. Buttock ulcers before treatment. A 76-year-old woman with
rheumatoid arthritis (RA) had multiple painful ulcers with a maplike
distribution on her buttocks. The ulcers had large amounts of pus discharge
caused by bacterial infections, including methicillin-sensitive Staphylococcus
aureus, based on swab culture results. She also had several intractable
ulcers on her feet and bilaterally on her lower legs, possibly caused by an
RA-related deformity.
A
failure caused by Pneumocystis carinii pneumonia due to
hypogammaglobulinemia, which was treated with sulfamethoxazole (10 g/d) and immunoglobulin (5 g/d). She
also had an intractable duodenal ulcer, which was treated
with endoscopic hemostasis and frequent transfusions.
Her ulcers increased in size and fused with each other
(Figure 2A). Although we did not detect HSV directly
from a swab or biopsy specimen, we diagnosed her ulcers as HSV infections because (1) findings of polymerase chain reaction analysis for HSV DNA were positive
in a swab obtained from the edge of the ulcers far from
her pubic area; (2) the HSV-IgG titer increased from
41 to 476 in her serum, while a normal HSV-IgM titer
was maintained; (3) treatment with intravenous acyclovir (750 mg/d) for 7 days without changing the local
wound care regimen was effective in treating the ulcers
and severe pain (Figure 2B); and (4) her immunosuppressed status was remarkable enough to indicate P carinii pneumonia. She was ambulatory at the time of discharge, and at a follow-up visit, her ulcers were notably
improved (Figure 3).
Comment. Immunosuppressed populations, including
(1) patients undergoing long-term steroid treatment
and/or immunosuppressant therapy, (2) organ transplant recipients, (3) patients with human immunodeficiency virus, and (4) those with other diseases, including leukemia, manifest varying characteristics HSV
infection eruptions.3 We could not immediately diagnose our patient’s ulcers as being caused by HSV infection because our patient presented with lower leg ulcers
caused by rheumatoid vasculitis, and her biopsy specimens did not show any sign of HSV. Treatment with acyclovir was sufficient to heal the wounds,4,5 but prophylactic therapy could be considered in the future. When
intractable painful erosions and/or ulcers appear on the
B
Figure 2. Buttock ulcers after treatment. A, After antibiotic treatment and local wound care, as the secondary bacterial infections gradually improved, the painful
ulcers became shallower and produced less pus discharge. However, about 2 months after the ulcers first appeared, they increased in size and combined with
each other. B, Treatment with intravenous acyclovir for 7 days without a change in the local wound care regimen of difluprednate and occlusive dressings resulted
in the reepithelialization of the ulcers and complete relief of the pain.
1341
Paraneoplastic Raynaud Phenomenon
With Digital Necrosis Associated
With Hyperhomocysteinemia
and Antiphospholipid Antibodies
Figure 3. Buttock ulcers after patient discharge. Ten weeks after hospital
admission, the patient was transferred to our satellite hospital to continue
her rehabilitation for disuse syndrome and to be treated for her respiratory
failure. Three months thereafter, at the time of this photograph, she was
discharged from our institution. Although slight scarring is evident, no
recurrence of herpes simplex virus was observed.
buttocks of an immunosuppressed patient, an HSV infection should be considered. The fact that HSV-1 infection can occur in a genital area should also be remembered.
Takaaki Hanafusa, MD
Yuji Yamaguchi, MD, PhD
Shun Kitaba, MD
Ichiro Katayama, MD, PhD
Correspondence: Dr Yamaguchi, Department of Geriatric and Environmental Dermatology, Nagoya City
University Graduate School of Medical Sciences, 1-Kawasumi, Mizuho-cho, Misuho-ku, Nagoya-shi, Aichi,
467-8601, Japan ([email protected]).
Funding/Support: Dr Yamaguchi was supported for this
work in part by The Osaka Medical Research Foundation for Incurable Diseases, Osaka, Japan; the Lydia
O’Leary Memorial Foundation, Tokyo, Japan; a Shiseido grant for Science Research, Tokyo; and by grant-inaid 18689028 from the Japanese Ministry of Education,
Culture, Sports, Science, and Technology.
Additional Contributions: Hiroyuki Murota, MD, PhD,
Isao Ishida, MD, PhD, Yukari Nishimura, MD, and Noriko
Umegaki, MD, PhD, provided critical review of this work.
Additional Information: All work for this case report was
done at the Department of Dermatology, Osaka University Graduate School of Medicine, Osaka, Japan, where
Drs Hanafusa, Kitaba, and Katayama still practice.
1. Nadelman CM, Newcomer VD. Herpes simplex virus infections: new treatment approaches make early diagnosis even more important. Postgrad Med.
2000;107(3):189-195, 199-200.
2. Fleming DT, McQuillan GM, Johnson RE, et al. Herpes simplex virus type 2
in the United States, 1976 to 1994. N Engl J Med. 1997;337(16):1105-1111.
3. Vonderheid EC, Milstein HJ, Thompson KD, Wu BC. Chronic herpes simplex infection in cutaneous T-cell lymphomas. Arch Dermatol. 1980;116(9):
1018-1022.
4. Trent JT, Federman D, Kirsner RS. Common viral and fungal skin infections.
Ostomy Wound Manage. 2001;47(6):28-34.
5. Trent JT, Kirsner RS. Herpesvirus infections and herpetic wounds. Adv Skin
Wound Care. 2003;16(5):236-243.
Report of a Case. A 61-year-old man had infiltrative squamous cell carcinoma of the penis and widespread metastasis to the lymph nodes diagnosed 2 months before
he was seen in our department (Figure 1). He had been
treated with fluorouracil and cisplatin.
When he came to our attention, he also had a 3-month
history of Raynaud phenomenon. In the last month, this
condition had become associated with necrotic lesions
on the fingertips of the second and third fingers of the
right hand (Figure 2A). Similar but smaller lesions were
also present on the fingertip of the second finger of the
left hand and on the fourth toe of the left foot (Figure 2B).
The patient had no family or personal history of Raynaud
phenomenon or vascular or connective tissue diseases.
Findings from laboratory tests were negative except for
sideropenic anemia, elevated erythrocyte sedimentation
rate, and an antinuclear antibody titer of 1:40. The ␤2glycoprotein I IgG (␤2GPI) level was 67.1 U/mL (normal
range, 0.0-11.0 U/mL); anticardiolipin antibody IgG (ACA)
level was 44.8 GPL/mL (normal range, 0.0-11.0 GPL/
mL) (“GPL” represents standard anticardiolipin units).
Findings for anti-dsDNA (double-stranded DNA) antibody, antineutrophil cytoplasmic antibody, cryoglobulin, C3, and C4 were all negative. The serum level of homocysteine was 3.7 mg/L (normal range, 0.5-1.6 mg/L);
folate, 1.8 ng/mL (normal range, 2.5-16.9 ng/mL). (To convert homocysteine to micromoles per liter, multiply by
7.397; to convert folate to nanomoles per liter, multiply
by 2.266.) The patient was found to be heterozygous for
5,10 methylenetetrahydrofolate reductase (MTHFR) mutation C677T and A1298C polymorphisms. Findings from
arterial echo color Doppler studies of the superior and inferior arms were unremarkable.
Intravenous treatment with iloprost, 1 ng/kg/d, for 10
days, was started, with initial cutaneous improvement.
After 1 month, serum levels of ␤2GPI, ACA, and homocysteine were still high. A week later, before the second
Figure 1. Keratinizing squamous cell carcinoma involving the perinodal
tissue (hematoxylin-eosin, original magnification ⫻20).
1342
caused by the impaired dietary intake, the chemotherapy, or the neoplasm itself.
Hyperhomocysteinemia, known to cause vascular accident, and presence of ACA and ␤2GPI are important
factors implicated in an altered coagulative status inducing an increased risk of the thrombotic fact.5 In the present case, these 3 factors may be responsible for the
Raynaud phenomenon, the digital necrosis, and the persistence of the digital necrosis after chemotherapy, which
differs from the usual course of the disease in previously reported cases.4
A
Massimo Carducci, MD
Roberta Calcaterra, MD
Massimo Rinaldi, MD
Anna Mussi, MD
Giuditta Viola, MD
Irene Venturo, MD
Letizia Perracchio, MD
Gennaro Franco, MD
Massimo Lopez, MD
Aldo Morrone, MD
B
Correspondence: Dr Calcaterra, Istituto Dermatologico
San Gallicano, Via di San Gallicano 25/a Roma, Italy
Figure 2. Associated digital lesions. A, Distal digital gangrene of the second
and third finger of the left hand. B, Necrotic lesion on the fourth toe of the
left foot.
cycle of iloprost treatment could begin, the general conditions quickly worsened, and the patient died.
Comment. Paraneoplastic Raynaud phenomenon with
digital necrosis is a rare condition that may represent an
unusual manifestation of internal malignant neoplasms
such as neoplasm of the gastrointestinal tract, lung, and
breast; ovarian and uterine carcinomas; renal adenocarcinoma; multiple myeloma; leukemia; and Hodgkin lymphoma.1-4 To our knowledge, the association with squamous cell carcinoma of the penis has never been reported.
The paraneoplastic digital necrosis is considered a vasculitis, even if the pathogenesis is still unclear.2-4 It may
represent the only manifestation of an underlying malignant neoplasm; therefore, malignant disorders should
be carefully searched for in patients with an abrupt onset of Raynaud phenomenon and digital necrosis, even
in the absence of abnormal laboratory findings and negative medical history of thromboembolic disease or connective tissue disorders.
We report herein for the first time to our knowledge
an alteration of the thrombophilic status that may be implicated in the pathogenesis of digital necrosis. Particularly, the presence of ACA and ␤2GPI may be an undiagnosed condition or the consequence of malignant
neoplasm; in fact, the occurrence of ACA, lupus anticoagulant, and ANA in neoplasms is common.4
Our patient was heterozygous for both of the common MTHFR mutations with consequent hyperhomocysteinemia. This condition, usually silent, showed up
because of the folate deficiency that might have been
1. Petri M, Fye KH. Digital necrosis: a paraneoplastic syndrome. J Rheumatol.
1985;12(4):800-802.
2. Taillan B, Castanet J, Garnier G, et al. Paraneoplastic Raynaud’s phenomenon.
Clin Rheumatol. 1993;12(2):281-282.
3. Iamandi C, Dietemann A, Grosshans E, Pauli G, Quoix E. Paraneoplastic digital necrosis in a patient with small-cell lung cancer. J Clin Oncol. 2002;20
(23):4600-4601.
4. Chow SF, McKenna CH. Ovarian cancer and gangrene of the digits: case report and review of the literature. Mayo Clin Proc. 1996;71(3):253-258.
5. Castro R, Riviera I, Blom HJ. Homocysteine metabolism, hyperhomocysteinemia and vascular disease: an overview. J Inherit Metab Dis. 2006;29(1):3-20.
Resolution of Chronic Pain
and Fingertip Ulceration Due to
Hand-Arm Vibration Syndrome
Following Combination Pharmacotherapy
H
and-arm vibration syndrome (HAVS) is a wellrecognized cause of secondary Raynaud phenomenon. We report a percussionist with vibration-induced peripheral vasospasm and nonhealing
fingertip ulceration that responded to combination therapy
with pentoxifylline, extended-release nifedipine, and lowdose aspirin.
Report of Case. A 49-year-old white homeless man presented with an 8-month history of severe bilateral fingertip pain. He regularly awoke at night with cold fingers and pins-and-needles pain radiating up his left arm.
The patient played conga drums for 4 years, averaging 1
to 2 hours, occasionally up to 5 hours daily. He had a 10
pack-year smoking history. Various treatment failures at
outside facilities included cephalexin and trimethoprim/
sulfamethoxazole double strength, acetaminophen/
hydrocodone, topical 2% nitroglycerin ointment, and
naproxen. Hand radiographs revealed preserved bone min-
1343
Figure 1. Left index finger before treatment.
calcitonin gene–related peptide (a vasodilator) and stimulation of ␣2-adrenoreceptors (vasoconstrictors).1 Intravascular factors include platelet and white cell activation.1 Symptoms typically appear after 2000 hours of
vibration exposure.2 The diagnosis of HAVS was favored over thromboangiitis obliterans owing to the improvement despite continued smoking. Raynaud disease was excluded owing to lack of exacerbation by cold
temperature or skin color change.
The goal of treatment was to improve microcirculation and decrease inflammation, platelet activation, and
vasospasm. Pentoxifylline decreases leukocyte deformability and chemotaxis via decreased interleukin-1 and
tumor necrosis factor (TNF) responsiveness; decreases
TNF-␣ production in monocytes and macrophages; decreases platelet aggregation and adhesion; decreases fibroblast response to TNF-␣; and improves red blood cell
deformability.3 Nifedipine, a calcium channel blocker, increases vasodilation and decreases vasospasm.4 Lowdose aspirin has an antiplatelet effect.5 More study of the
relative efficacy of this combination therapy vs monotherapy is warranted.
Hand-arm vibration syndrome is an important industrial occupational disorder that can present with unremitting pain and nonhealing fingertip ulcers. The combination therapy of pentoxifylline, nifedipine, and aspirin
described herein to resolve vibration injury might be useful for other disorders of vasospasm and inflammation
such as thromboangiitis obliterans, scleroderma, and
vasculitis.
Catherine Buell, MD
Edward Tobinick, MD
Karen Lamp, MD
Figure 2. Fingers after treatment.
eralization, no evidence of fracture or dislocation, and
no significant soft tissue swelling.
Physical examination revealed thickened skin and tenderness to palpation at the pads of his second and third
digits bilaterally (Figure 1). Ulcerations were present
at the right middle and left index fingers. His chief complaint was severe and constant fingertip pain. A diagnosis of percussion- or vibration-induced vasospasm was
made and he was prescribed pentoxifylline, 400 mg twice
daily, extended-release nifedipine, 30 mg/d, and aspirin, 81 mg/d, and he was advised to stop smoking and
drumming.
One month later, the patient reported dramatic pain
relief. He noted improvement within 1 to 2 weeks of initiating therapy. By his own initiative, he had decreased
the pentoxifylline dose from 400 mg twice daily to 400
mg/d for 1 week owing to transient nausea. He stopped
smoking for the first week and then restarted. He was only
“occasionally” drumming. Shallow, calloused fissures remained in the right third and left second fingertips
(Figure 2).
Comment. The pathogenesis of HAVS is a complex interplay of vascular, neural, and intravascular effects.1 Vascular pathologic characteristics include fibrosis and vasoconstriction. Neuroendocrine factors include decreased
Correspondence: Dr Buell, University of California, Los
Angeles, 2112 S Beverly Glen Blvd, Los Angeles, CA 90025
Financial Disclosure: The authors have no relevant interest in this article. However, Dr Buell has previously
received funding from the American Federation on Aging Research for research involving Alzheimer disease and
reaction time testing as well as a scholarship from Novo
Nordisk for community outreach in diabetes education;
she also owns stock in Pfizer. Dr Tobinick holds multiple patents that describe novel uses of cytokine antagonists (including biologic TNF-␣ inhibitors and interleukin 1 inhibitors) for the treatment of neurologic,
oncologic, ophthalmologic, and related disorders; he also
owns stock in Amgen.
Additional Contributions: The Venice Family Clinic performed much-appreciated hard work in patient care.
1. Herrick AL. Pathogenesis of Raynaud’s phenomenon. Rheumatology (Oxford).
2005;44(5):587-596.
2. Fridén J. Vibration damage to the hand: clinical presentation, prognosis and
length and severity of vibration required. J Hand Surg(Br). 2001;26(5):
471-474.
3. Samlaska CP, Winfield EA. Pentoxifylline. J Am Acad Dermatol. 1994;30(4):
603-621.
4. Fleckenstein-Grün G. Calcium antagonism in vascular smooth muscle cells.
Pflugers Arch. 1996;432(3)(suppl):R53-R60.
5. Tran H, Anand SS. Oral antiplatelet therapy in cerebrovascular disease, coronary artery disease, and peripheral arterial disease. JAMA. 2004;292(15):18671874.
1344
skINsight
SECTION EDITOR: JAMES M. GRICHNIK, MD, PhD
Epidermal Langerhans Cell Movement In Situ
A Model for Understanding Immunologic Function in the Skin
Rachel E. Mohr, BA; Akira Takashima, MD, PhD; Department of Medical Microbiology and Immunology,
University of Toledo, Toledo, Ohio
E
PIDERMAL LANGERHANS CELLS
(LCS) REPREsent an immature dendritic cell subset at the
environmental interface. They undergo
maturational changes and migrate to draining lymph nodes in response to danger signals, eg, the presence of proinflammatory cytokines and
microbial products (Figure 1). Our research group has
recently developed a system to visualize dynamic behaviors of epidermal LCs by combining time-lapse, intravital, confocal imaging technology and I-A␤–enhanced green
fluorescent protein (EGFP) knock-in mice in which LCs
can be identified by EGFP-associated fluorescence.1 Under the steady state, some LCs exhibited a unique mo-
tion, called the dendrite surveillance extension and retraction cycling habitude (dSEARCH), characterized by rhythmic
extension and retraction of dendritic processes through
intercellular spaces (Figure 2) (supplemental video S1).
Topical application of dinitrofluorobenzene (DNFB) not
only provoked dSEARCH motion but also triggered direct cell-to-cell contact formation among adjacent LCs
(Figure 3) (supplemental video S2). Although functional outcomes of such motile behaviors remain unclear, it is tempting to speculate that dSEARCH motion
may facilitate more efficient and broader antigen sampling by epidermal LCs and that adjacent LCs may exchange the antigens under pathologic conditions.
Video available online at
www.archdermatol.com
LC maturation
Infection
Additional Information: Supplemental videos are reproduced from the article by Nishibu et al1 with permission
from the Journal of Investigative Dermatology.
Immunity
T-cell activation
REFERENCE
LC migration
Figure 1. Maturation and migration of Langerhans cells (LC) from the skin to
lymph nodes.
1. Nishibu A, Ward BR, Jester JV, Ploegh HL, Boes M, Takashima A. Behavioral
responses of epidermal Langerhans cells in situ to local pathological stimuli.
J Invest Dermatol. 2006;126(4):787-796.
Figure 2. Steady state behavior of Langerhans cells (LCs). Panel displays an
overlay of 3 fluorescent images of enhanced green fluorescent protein–positive
LCs recorded at time 0 (pseudo-colored green), 30 minutes (red), and 60
minutes (blue).
Figure 3. Behavior of Langerhans cells (LCs) under pathologic conditions
(30 hours after application of 0.5% dinitrofluorobenzene). Panel displays an
overlay of 3 fluorescent images of enhanced green fluorescent protein–positive
LCs recorded at time 0 (pseudo-colored green), 30 minutes (red), and 60
minutes (blue).
1352

Archives of Dermatology

Transcrição

Documentos relacionados

Wundheilung Studien

Wound Repair/Cosmetic Surgery Healing Enhancement of Skin

PDF - Factormed Produtos Médicos e Hospitalares

Brochure Triticum - L

Factormed - Detalhes de produto

hyperbaric oxygenation in a single oxygen hyperbaric chamber as

PDF - Factormed Produtos Médicos e Hospitalares

Probeseiten - Verlag Handwerk und Technik

W06-Suzuki Samurai angielska - Auto-Hak

Inglês - Colégio Rubem Alves