Curso de bioinformática - Instituto de Bioquímica Médica UFRJ

Сomentários

Transcrição

Curso de bioinformática - Instituto de Bioquímica Médica UFRJ
CURSO ON LINE
INTRODUÇÃO À
BIOINFORMÁTICA
Prof. Dr. Francisco Prosdocimi
2007
ÍNDICE
CAPÍTULO 1
CAPÍTULO 2
CAPÍTULO 3
CAPÍTULO 4
CAPÍTULO 5
CAPÍTULO 6
CAPÍTULO 7
CAPÍTULO 8
CAPÍTULO 9
CAPÍTULO 10
UMA VISÃO GLOBAL DA BIOINFORMÁTICA
1.1. O que é a bioinformática?
1.2. O surgimento da bioinformática
1.3. O que preciso saber para ser um bom bioinformata?
1.4. Cursos de pós-graduação em bioinformática no Brasil
1.5. Conversando sobre bioinformática – BIOCHAT
1.6. Referências Bibliográficas e textos complementares
1.7. bRAINsTORM
GENOMA, BIOLOGIA MOLECULAR E COMPUTAÇÃO
2.1. Introdução
2.2. Sequenciamento do DNA
2.3. Genômica
2.4. As ômicas: integrando a bioinformação
2.5. O PERL e outras linguagens de programação
2.6. Referências Bibliográficas e textos complementares
2.7. bRAINsTORM
ALINHAMENTO DE SEQÜÊNCIAS
3.1. Introdução
3.2. Alinhamento Global
3.3. Alinhamento Local
3.4. Alinhamentos ótimos e heurísticos
3.5. Alinhamentos simples e múltiplos
3.6. Matrizes de comparação
3.7. Exemplos reais de alinhamentos
3.8. Referências Bibliográficas
3.9. bRAINsTORM
MONTANDO UM GENOMA
4.1. Sobre genomas eucarióticos e procarióticos
4.2. Base-calling
4.3. Cross-match
4.4. Agrupamento de seqüências
4.5. Sobre a cobertura dos genomas
4.6. Referências Bibliográficas
4.7. bRAINsTORM
ANÁLISE DE TRANSCRIPTOMAS
5.1. As ESTs
5.2. Histórico das ESTs
5.3. Agrupamento de ESTs
5.4. O genoma e o transcriptoma
5.5. SAGE – Serial Analysis of Gene Expression
5.6. Microarrays
5.7. Referências Bibliográficas
5.8. bRAINsTORM
BANCOS DE DADOS EM BIOLOGIA MOLECULAR
6.1. Histórico
6.2. Bancos primários e secundários
6.3. GenBank e GenPept
6.4. RefSeq – O banco de dados de seqüências de referência
6.5. SWISSPROT – O maior banco de dados secundário de seqüências de proteínas
6.6. Gene Ontology – Sistema de classificação de genes de acordo com suas características
6.7. Referências Bibliográficas
6.8. bRAINsTORM
ANOTAÇÃO DE GENOMAS
7.1. Introdução
7.2. Anotação de Nucleotídeos
7.3. Anotação de Proteínas
7.4. Anotação de Processos
7.5. A realização da Anotação Genômica (Sociologia da Anotação)
7.6. Referências Bibliográficas
7.7. bRAINsTORM
BIOINFORMÁTICA EVOLUTIVA E GENOMAS COMPLETOS
8.1. Homologia, Ortologia e Paralogia
8.2. COG
8.3. Trabalhando com genomas completos
8.4. Referências Bibliográficas
8.5. bRAINsTORM
BIOINFORMÁTICA ESTRUTURAL
9.1. Sobre a estrutura das proteínas
9.2. Protein Data Bank: o banco de dados de estruturas de proteínas
9.3. Modelagem molecular por homologia
9.4. Alguns programas de modelagem molecular
9.5. Threading
9.6. CASP – Critical Assessment of Structure Prediction
9.7. Estrutura de um arquivo no formato PDB
9.8. Referências Bibliográficas
9.9. bRAINsTORM
CONCLUSÕES E PENSAMENTOS FILOSÓFICOS SOBRE A BIOINFORMÁTICA
10.1. Sobre bioinformática, genoma e ciência
10.2. Introdução
10.3. Genoma e o método científico
10.4. Um conceito de bioinformática
10.5. Princípios paradigmáticos em bioinformática
10.6. Conclusão
10.7. bRAINsTORM
Pág.
3
3
3
5
6
6
12
12
13
13
13
14
15
15
17
17
18
18
18
19
20
21
22
23
28
28
29
29
30
31
32
34
35
35
36
36
37
38
39
40
40
41
41
42
42
43
43
44
45
46
46
47
49
49
49
50
50
51
52
53
54
54
56
56
57
58
59
59
60
61
63
63
63
64
67
68
69
69
69
70
71
72
74
74
PREFÁCIO
Quando em 2002 realizei, concomitantemente ao meu mestrado em genética pela
UFMG, o excelente curso de especialização em Bioinformática do LNCC, ministrado por
muitos dos maiores especialistas em genômica e bioinformática de nosso país, tive o
privilégio de ser um dos organizadores (e o primeiro autor) de um trabalho entitulado
“Bioinformática: manual do usuário” em que todos os cerca de 20 alunos do curso
se organizaram com o objetivo de gerar uma publicação básica sobre a área de
pesquisa à qual nos estamos aprofundando e formando. Esta publicação foi finalmente
publicada na revista Biotecnologia Ciência e Desenvolvimento alguns meses depois.
Tendo mantido meu contato com a editora da revista Biotecnologia, enquanto
terminava meus estudos de doutoramento em bioinformática, recebi um convite para
elaborar um curso on line a ser ministrado através do portal biotecnologia da
Internet (http://www.biotecnologia.com.br). Este documento que agora vos apresento
gratuitamente pela Internet (http://biotec.icb.ufmg.br/chicopros/Prosdocimi07_Curso
Bioinfo.pdf) consiste exatamente neste curso, produzido em 2006 e ministrado em
2007 para uma turma de 40 alunos. Ainda que navegando por problemas técnicos,
acredito que o curso foi bastante proveitoso e produtivo, sendo que a grande maioria
dos alunos saiu do mesmo tendo adquirido conteúdo e aprendido a compreender muito
sobre a lógica e o pensamento em bioinformática.
Hoje, passados quase 4 anos que ministrei este curso pela Internet, vejo este
documento arquivado entre meus arquivos do período jurássico e tenho pena de deixar
este conhecimento perdido nos meandros digitais do meu disco rígido. Assim, contatei
recentemente a editora da revista que lendo o contrato que fizemos à época e dizendo
serem meus os direitos autorais desta apostila ou “esboço de livro”, informou-me que
tenho o direito de publicar o presente documento na Internet para que se torne
acessível a qualquer indivíduo interessado em aprender a arte e a ciência da
bioinformática. Recomendou-me ainda que eu atualizasse as informações aqui
presentes e publicasse um livro de verdade, a ser vendido nas livrarias. Tenho sim
planos de fazê-lo, mas sei que precisaria reestruturar boa parte do que está aqui
contido e, por falta de tempo para tanto, decido publicar esta versão gratuitamente
pela Internet. Assim, caso haja interesse de leitores, estudantes ou editores, estarei
disposto a atualizar estas informações e produzir uma segunda edição mais completa e
atualizada sobre presentes assuntos.
Brasília, numa quarta-feira de cinzas.
17/02/2010
Chico Prosdocimi
http://biotec.icb.ufmg.br/chicopros
http://chicopros.blogspot.com
Aos meus pais
3
CAPÍTULO 1
Uma visão global da bioinformática
Iniciando nossa Interação
Nesta primeiro capítulo apresentaremos uma visão geral da bioinformática,
vamos conversar sobre as necessidades e oportunidades de capacitação para quem
deseja atuar nessa área.
1.1.
O que é a bioinformática?
Podemos considerar a bioinformática como uma linha de pesquisa que envolve
aspectos multidisciplinares e que surgiu a partir do momento em que se iniciou a
utilização de ferramentas computacionais para a análise de dados genéticos,
bioquímicos e de biologia molecular. A bioinformática envolve a união de diversas
linhas de conhecimento – a ciência da computação, a engenharia de softwares, a
matemática, a estatística e a biologia molecular – e tem como finalidade principal
desvendar a grande quantidade de dados que vem sendo obtida através de seqüências
de DNA e proteínas. Para o desenvolvimento de genomas completos, a informática é
imprescindível e a biologia molecular moderna não estaria tão avançada hoje, não
fossem os recursos computacionais existentes.
1.2.
O surgimento da bioinformática
A bioinformática, apesar de ser uma ciência nova e em desenvolvimento, já
apresenta uma figura clássica que freqüentemente é mostrada em qualquer palestra
ou curso que se vá sobre a área. Essa figura, mostrando o crescimento exponencial do
GenBank nos últimos anos, tenta mostrar que, mais do que uma abstração possível, a
bioinformática é hoje uma necessidade para a análise de dados em biologia molecular.
Desde que os seqüenciadores capilares de DNA em larga escala surgiram, no
fim da década de 90, a quantidade de dados biológicos produzidas simplesmente
alcançou níveis que fizeram com que análises manuais de seqüências de DNA se
tornassem simplesmente alternativas absurdas para o estudo de dados de genoma e
transcriptoma.
Dois desenvolvimentos foram importantes para permitir tanto o surgimento da
bionformática quanto o rápido desenvolvimento da produção de seqüências de DNA. O
primeiro deles foi o sequenciamento capilar. Enquanto no passado as seqüências eram
produzidas em placas enormes que deveriam ser corridas de forma uniforme e com um
grande cuidado, com o desenvolvimento da tecnologia de sequenciamento capilar, a
eletroforese ocorria dentro de tubos com a espessura de um cabelo humano, contendo
uma solução polimérica por onde o DNA deveria passar guiado por uma corrente
elétrica, como uma eletroforese normal. O outro grande desenvolvimento foi a
marcação dos didesoxinucleotídeos necessários para o sequenciamento do DNA com
moléculas fluorescentes. Enquanto as reações tradicionais eram realizadas com
marcadores radioativos, que tornavam a metodologia um tanto quanto trabalhosa e
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
4
até mesmo perigosa, os marcadores fluorescentes permitiam maior segurança e ainda
um novo avanço. Enquanto era preciso correr diferentes reações para cada nucleotídeo
na marcação radioativa, a técnica de marcação fluorescente permitia que cada base
fosse marcada com um diferente fluorocromo que era capaz de emitir luz em um
diferente comprimento de onda se excitado por um laser. Essa luz, lida por um
detector, informava ao sistema qual nucleotídeo passava em diferentes momentos da
eletroforese. E foi exatamente a reunião desses dois desenvolvimentos num só
aparelho que produziu o equipamento que posteriormente ficaria conhecido como “o
seqüenciador que criou a bioinformática”. O primeiro desses aparelhos foi produzido
pela empresa Applied Biosystems e foi chamado de ABI Prism 3700. Apresentava 96
colunas (ou capilares para a eletroforese) e permitia o sequenciamento de cerca de
550 bases em cada coluna, sendo oito vezes mais rápida do que a melhor concorrente
da época e possibilitando o sequenciamento de até 1 milhão de pares de bases por dia.
Além de permitir o rápido desenvolvimento da bioinformática, esse seqüenciador ainda
geraria brigas políticas sobre quem é que deveria sequenciar todo o genoma humano,
uma empresa particular ou o consórcio público, mas isso é outra história.
Figura 1.1. Crescimento do Genbank. Crescimento exponencial do número de
seqüências contidas no GenBank ao longo das duas últimas décadas. Obtido em
http://www.ncbi.nlm.nih.gov/Genbank/genbankstats.html.
O que importa é que, desde 1998, quando o ABI Prism foi lançado, outras
empresas desenvolveram também seus seqüenciadores capilares de larga escala e o
custo dessas máquinas – que antes chegava a trezentos mil dólares – foi aos poucos
caindo e permitindo que mais e mais laboratórios pudessem ter seus próprios
seqüenciadores. Cada vez mais dessas máquinas são vendidas ainda hoje e o número
de seqüências de DNA produzidas vem aumentando exponencialmente até o presente
momento.
Leitura complementar:
http://nextisnowbr.blogspot.com/2009/12/next-generation-sequencing-estado-da.html
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
5
1.3.
O que preciso saber para ser um bom bioinformata?
O profissional em bioinformática é raro no mercado, já que ele necessita saber
e ser familiar a, pelo menos, três áreas distintas do conhecimento: a biologia
molecular, a ciência da computação e a bioinformática per se. Além disso,
conhecimentos em estatística e matemática são altamente recomendáveis. Imagine
um biólogo que não tenha conhecimento de computação: ele será capaz de bolar uma
infinidade de possíveis experimentos em bioinformática que gostaria que fossem
gerados, mas será incapaz de colocá-los em prática. Do outro lado, um cientista da
computação sem conhecimento em biologia e com sua característica ânsia de analisar
dados, será capaz de pegar uma infinidade de dados biológicos e fazer uma grande
quantidade de análises computacionais sem qualquer propósito, gerando resultados de
difícil interpretação, por vezes ininterpretáveis ou sem qualquer sentido biológico. O
trabalho em equipe, para a produção de projetos em bioinformática, pode ser
interessante, desde que os profissionais trabalhem juntos todo o tempo. Reuniões
apenas esporádicas normalmente fazem com que as idéias do trabalho do biólogo e do
cientista da computação se afastem dos ideais iniciais da pesquisa. Isso no caso
médio. É claro que é possível conseguir bons resultados em casos isolados.
Considerando isso, torna-se necessário o desenvolvimento de um novo
profissional, o bioinformata. Um biólogo que tenha tido uma formação parcial como
cientista da computação ou vice-versa. Além disso, é preciso que tal profissional tenha
ainda uma formação em bioinformática e que conheça profundamente as diferenças e
as boas e más qualidades dos principais bancos de dados públicos sobre seqüências e
estruturas de biomoléculas. Como não temos a intenção de ensinar biologia molecular
ou ciência da computação, no presente curso daremos ênfase exatamente a esta
última parte, que consiste na formação do bioinformata per si, que deve conhecer pelo
menos o básico com relação à análise de genomas e as ferramentas e bancos de dados
disponíveis na internet para o estudo dessa nova ciência.
Com relação aos requisitos computacionais que serão apresentados apenas de
passagem no presente curso, um profissional em bioinformática deve ter um bom
conhecimento algum sistema operacional baseado em UNIX, sem qualquer sombra de
dúvida. Quase todos os algoritmos utilizados para a pesquisa em bioinformática
apresentam código aberto e são, freqüentemente, disponíveis apenas para sistema
operacionais como o LINUX e o Solaris. Os programas de código aberto são aqueles
nos quais os programadores disponibilizam todo o código fonte do programa para o
usuário, que pode alterá-lo de acordo com a sua aplicação de interesse. E esse é
também um dos motivos pelos quais os bioinformatas devem ser familiarizados com
linguagens de programação. Um bioinformata que não sabe programar em uma
linguagem qualquer tem dificuldades para se desenvolver e, portanto, o profissional
deve estar ao menos apto a aprender alguma linguagem de programação.
Outro conhecimento que gera um salto qualitativo na atividade do bioinformata
é o conhecimento de bancos de dados e linguagem SQL. A linguagem SQL é a mais
comumente utilizada em uma diversidade de bancos de dados e muitos sites
disponibilizam informações armazenas em tabelas e bancos de dados inteiros. Devido à
sua gratuidade e eficiência, o banco de dados mais utilizado em bioinformática é o
MySQL, mas quaisquer outros podem ser utilizados sem demais inconvenientes. Mas
mais importante ainda do que ser capaz de obter os bancos de dados públicos é o
bioinformata ser capaz de criar seus próprios bancos de dados, organizando as
informações de seu projeto e permitindo tanto um bom armazenamento quanto
organização e fácil acesso aos dados. Além disso, o conhecimento de plataformas para
disponibilizar dados para os pesquisadores é interessante e o bioinformata deve ter
algum conhecimento de linguagem HTML e, de preferência alguma linguagem de
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
6
programação para a internet, como o CGI ou o PHP, sendo que esse último ainda
apresenta a vantagem de permitir fácil conexão com bancos de dados.
É claro que a gama de conhecimento necessária para exercer bem uma
profissão qualquer tende a ser infinita, mas é indispensável ao menos que o
bioinformata seja proficiente em uma linguagem de programação e tenha bons
conhecimentos de biologia molecular, dos bancos de dados e das ferramentas a serem
utilizadas em cada caso. Aqui, iremos passar apenas de leve em programação e
biologia molecular na próxima aula e depois passaremos direto para a parte que
explica e mostra quais são as principais ferramentas utilizadas em análises genômicas
e os principais bancos de dados que devem ser consultados em diferentes aplicações.
1.4.
Cursos de pós-graduação em bioinformática no Brasil
Até o presente momento parecem existir apenas três cursos de pós-graduação
em bioinformática no Brasil. O primeiro e mais tradicional deles é o curso de pósgraduação Lato Sensu em Bioinformática do LNCC, cuja página oficial pode ser vista
em http://www.lncc.br/~biologia/. Três turmas de alunos já graduados de todo o país
já foram formadas por esta pós-graduação, inclusive o presente autor desse curso online, quem vos escreve. Consiste num ótimo curso de especialização, no qual os
maiores expoentes do país na área são chamados para ministrar diferentes aulas nos
campos da genômica, transcriptômica e proteômica. Além desse curso de pósgraduação, que dura cerca de três meses e meio, o LNCC também oferece cursos
esporádicos com duração entre duas semanas e um mês e recomenda-se visitar a
página do LNCC para mais informações (http://www.lncc.br).
Logo a CAPES percebeu a importância de se abrirem cursos nessa área
estratégica e propôs um edital para a formação de cursos de doutorado em
bioinformática. A partir daí dois novos cursos de doutorado em bioinformática foram
criados, um na USP (setembro de 2002) e outro na UFMG (abril de 2003). Para mais
informações, visite o site dos programas http://www.ime.usp.br/posbioinfo/ e
http://www.bioinfo.dout.ufmg.br/.
1.5.
Conversando sobre bioinformática – BIOCHAT
A revista biotecnologia promove esporadicamente o chamado biochat, que
consiste em uma conversa com um pesquisador experimente de uma determinada
área do conhecimento. Abaixo transcrevo um dos biochats realizado com o autor do
presente curso, onde várias dúvidas básicas sobre o assunto podem ser sanadas.
Assunto do Biochat:
Conceitos e Paradigmas em Bioinformática
Pesquisador entrevistado:
Francisco Prosdocimi
Há uma grande confusão com relação ao que seja a bioinformática, sendo que
muitos ainda acreditam que qualquer aplicação da computação à biologia possa ser
referenciada como "bioinformática". Ao observarmos os trabalhos recentemente
publicados na área, podemos dividí-los em três correntes básicas ou princípios
paradigmáticos, chamados metaforicamente de "o tijolo", "a peneira" e "a lupa". Tais
princípios serão apresentados e discutidos durante o BIOCHAT. Além disso, é
interessante discutirmos quais seriam os pré-requisitos básicos para formar um
bioinformata, tanto na área computacional quanto na área biológica. Do que, afinal, é
feito um bioinformata e o que ele precisa conhecer é tema recorrente entre os curiosos
sobre a área.O conceito da bioinformática, seus princípios paradigmáticos e a formação
do bioinformata serão, portanto, os temas a serem discutidos neste BIOCHAT.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
7
Dr. Francisco
Prosdocimi
Vanderson:
Dr. Francisco
Prosdocimi
Adonis:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Francisco:
Dr. Francisco
Prosdocimi
Adonis:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Boa noite a todos! Está aberto nosso biochat sobre bioinformática. Por
favor, enviem suas dúvidas para que possamos discutir e trocar idéias
a respeito do assunto.
Grande Francisco... Afinal, qual o conceito mais aceito para
Bioinformática?
Olá Vanderson. Fico agradecido pela sua presença. Na verdade existem
vários conceitos para bioinformática e muita confusão é feita sobre o
tema. Na minha opinião a bioinformática surgiu com o boom dos
sequenciadores automáticos de DNA e ainda hoje está ligada a análises
de seqüências de biomoléculas.
Biologia computadorizada? Ouvi este termo e queria saber qual é a
diferença disso para Bioinformática?
Pois é, meu prezado Adonis. A biologia computacional diz respeito a
qualquer aplicação da computação na área biológica, enquanto a
bioinformática está freqüentemente associada a analise de seqüências
de genoma, transcriptoma e proteoma. Esses conceitos entretanto são
bastante maleáveis e modificam-se todos os anos.
Boa noite Dr. Francisco. Sou estudante do curso Bacharelado em
Bioquímica, na Universidade Federal de Viçosa e tenho direcionado a
minha formação acadêmica para me tornar...
Com relação aos cursos específicos para bioinformática, eles existem
no Brasil apenas em nível de pós-graduação. Sendo que um deles é o
curso de especialização lato sensu do LNCC, no qual acontece a
formação de especialistas em bioinformática. Na USP e na UFMG
existem cursos de doutorado em bioinformática, onde tais profissionais
são formados. Eu, a propósito, fui aluno do LNCC e fui também o
primeiro aluno a defender o doutorado em bioinformática na UFMG.
Gostaria que vc respondesse o Pedro Marcus pq eu tenho a mesma
dúvida...
Com relação a cursos de graduação, meu prezado xará, ainda não
existem na área e recomendo que vc faça um curso de biologia ou de
computação, se pretende seguir carreira em bioinfo.
então bioinfo está dentro da biologia computacional?
Concordo, Adonis. Na minha opinião a bioinformática é, sim, uma parte
da biologia computacional, sendo essa última uma área bastante ampla
e não necessariamente relacionada com biologia molecular. Embora,
repito, esses conceitos são maleáveis e modificam-se com o
desenvolver das ciências.
Qual a sua experiência com a Bioinformática? O senhor trabalha mais
no meio acadêmico ou se relaciona diretamente com o mercado de
trabalho?
Trabalho com bioinformática desde 2000, tendo tido anteriormente
uma formação como biólogo molecular em bancada. Fiz minha
monografia de bacharelado, minha dissertação de mestrado (em
genética) com análises de transcriptomas do verme Schistosoma
mansoni e fui o primeiro aluno a defender o doutorado em
bioinformática na UFMG trabalhando com análises de qualidade de
seqüências de DNA e genômica comparativa. Sempre trabalhei mais
voltado para o meio acadêmico, mas já fiz também alguns trabalhos
em parceria com uma empresa de Belo Horizonte na área de
bioinformática. A empresa se chama vetta technologies.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
8
Vanderson:
Dr. Francisco
Prosdocimi
Adonis:
Dr. Francisco
Prosdocimi
Paulo:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Marx:
Dr. Francisco
Prosdocimi
Adonis:
Pegando a deixa do Pedro, você acha que há mercado de trabalho para
bioinformatas no Brasil... além das instituições públicas e da Alellyx?
Infelizmente, meu amigo Vanderson, não acredito que haja ainda
mercado de trabalho para bioinformática fora das universidades,
embora o campo na área de biotecnologia tenha crescido e venha
crescendo. A existência de algumas empresas trabalhando em
biotecnologia é muito pequena ainda no Brasil e apenas a Alellyx e a
Scylla têm alguma representatividade no mercado. Ou seja, a
bioinformática ainda é matéria para cientistas financiados pelo
governo.
Qual seria a dica para trabalhar com bioinfo em um lugar onde não se
faça molecular?
A dica é estar em parceria com pesquisadores que tenham perguntas
que só possam ser respondidas através de análise computacional. Eu
mesmo tenho várias colaborações com diferentes laboratórios e produzi
um software recentemente, o TGFinder, que surgiu como uma
necessidade de um pesquisador de encontrar genes controlados por
fatores de transcrição. Além disso, o GenBank possui tantas seqüências
depositadas e tanta informação a ser mineirada que nem todos os
cientistas do mundo seriam capazes de tudo analisar. É claro que a
pesquisa de ponta é normalmente aquele onde se produz e se analisa
um novo dado em biologia molecular, mas há muito ouro a ser
peneirado nos bancos de dados públicos.
Olá Dr. mas como é aplicada a computação ou informática, na
biologia,neste sequenciadores automáticos de DNA?
A computação é aplicada, principalmente, na análise e identificação das
seqüências de DNA que saem dos sequenciadores automáticos. A
seqüência sai de lá como um monte de A, C, T e G... que não querem
dizer nada. O que significa para você isso aqui:
ACATAGGGACATTACAGAGCATTCAGA? Somente com a bioinformática
conseguimos atrelar a informação codificada em informação biológica,
associando A, C, T e G a algum nome de gene com alguma função
especifica...
Aprofundando mais a discussão, a iniciativa privada na bioinformática
está...
O grande problema, Pedro, é que acredito que dificilmente a
bioinformática per se pode dar algum lucro. Por exemplo, a empresa
Alellyx tem, além de um grande know how em bioinfo, um grande
know how em biologia molecular e em genômica. A descoberta de
novos genes 'apenas' por bioinfo é muito difícil e é preciso estar
sempre sequenciando novos organismos. E um sequenciador de DNA é
muito caro para que pequenos empresários possam comprar, o capital
inicial de uma empresa de biotecnologia apresentando bioinformática é
muito alto.
E fora do Brasil, como estão as perspectivas?
Fora do Brasil eu acredito que haja bastante espaço, sim, para
bioinformatas. Assino uma lista de jobs em bioinformática e
freqüentemente vejo pedidos para profissionais da área... o único
problema é que normalmente exige-se grande experiência prévia, o
que não temos ainda no Brasil -- profissionais qualificados.
Dr. Francisco Prosdocimi, fale um pouco sobre mineração de dados já
que esta é o etapa seguinte depois da geração das seqs.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
9
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Paulo:
Dr. Francisco
Prosdocimi
Vanderson:
Dr. Francisco
Prosdocimi
Carla:
Dr. Francisco
Prosdocimi
Adonis:
Dr. Francisco
Prosdocimi
Bem, caro Adonis, isso me remete aos princípios paradigmáticos da
bioinformática que apresentei no texto introdutório. Acredito que os
trabalhos atuais em bioinformática podem ser divididos em três
correntes principais, os trabalhos de tijolo -- onde ferramentas de
bioinformática são produzidas para construir os edifícios genômicos, os
trabalhos de peneira -- onde a mineração da grande massa de dados
em genômica são analisados mais especificamente em vários contextos
-- e os trabalhos de lupa, onde a genômica encontra a ciência e o
método científico de observação, hipótese, experimentação e
resultados são novamente retomados. Escrevi um trabalho sobre isso
para a revista ciência hoje que foi publicado em 2004.
Trabalho atualmente no BIOAGRO-UFV (Instituto de Biotecnologia
Aplicada à Agropecuária) no Laboratório de Bioinformática,
desenvolvendo softwares de análise populacionais (genética de
populações). Você considera válido esse tipo de iniciativa ou seria
melhor eu estar trabalhando mais especificamente com a biologia
molecular?
Considero muito válido seu trabalho. Mas também já tentei produzir
algo relacionado a genética de populações e acho muito difícil produzir
algo melhor do que os já conhecidos programas PAUP, PHYLIP, MEGA,
dentre outros. Boa sorte!
Poderíamos ou podemos, descobrir qual a seqüência para uma
determinada proteína ou característica. Ou para identificar estes pares,
para saber qual proteína ela vai produzir, seria isto?
Podemos sim, saber qual a seqüência de DNA é relativa a uma
determinada proteína e, muitas vezes, uma característica. Existe até
mesmo um projeto conhecido como FENOMA, que tenta identificar os
genes responsáveis por algum fenótipo (característica). O que
acontece, entretanto, é que grande parte das características são
geradas através de um grande número de genes que interagem entre
si e fazem da análise algo complicadíssimo!
Tenho uma opinião a expressar... Um grande problema que eu percebo
na maioria dessas ferramentas de bioinformática é o total descaso com
usuários
Concordo plenamente, Vanderson. Biólogos não estão interessados em
utilizar sistemas linux, linhas de comando e outros artifícios
computacionais de start-up razoavelmente complexo. Interfaces
gráficas e fáceis, de preferência via web e bastante user-friendly são
altamente recomendáveis. Mas é preciso dizer que há também
programas com manuais completos e simples, mas o usuário parece ter
preguiça de lê-los, o que definitivamente é preciso fazer.
Por acaso já se pode analisar um gene pelo computador?
É claro, Carla, os genes são formados por seqüências de nucleotídeos
que são representadas por A, C, G e T, transformando as seqüências
dos genes em letrinhas que são analisadas e comparadas entre
diferentes espécies animais.
É real a migração de perl para java? ou isso só tá ocorrendo no meio
privado? Essa migração seria um preocupação com uma interface mais
amigável?
Caro Adonis, acredito que a migração de PERL para JAVA está
relacionada ao fato de que a linguagem JAVA é multiplataforma, além
de ser nativamente orientada a objetos, o que facilita a criação de
programas mais complexos e de grande porte. Acredito que os scripts
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
10
Carla:
Dr. Francisco
Prosdocimi
Macedo:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Dani:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
freqüentemente utilizados em trabalhos de bioinformática devem
continuar sendo produzidos em PERL, que é uma linguagem onde a
expressão regular é nativa e rápida, sendo mais apropriada para tais
trabalhos. Sim, a migração também pode estar relaciona com uma
interface mais amigável, já pronta em vários objetos JAVA.
Como o Brasil está em relação a outros paises, nesse desenvolvimento?
O nosso país valoriza a bioinformática?
O Brasil anda atrás dos países desenvolvidos quando o assunto é
bioinformática e, apesar de que recentes iniciativas da CAPES e do
CNPq vêm tentando buscar equiparação internacional, a bioinformática
brasileira ainda está em seu berço (esplêndido).
Boa noite Dr. Gostaria de saber sobre o cenário de Software Livre x
Software Proprietário em bioinformática. O Sr. acredita que a adoção
do software livre pode ajudar na redução de gastos em pesquisa e
desenvolvimento e que isso possibilitará o estudo de doenças
negligenciadas? Ou o segmento acadêmico enxerga o software livre
apenas como ª...
No caso da bioinformática posso assegurar que mais de 95% dos
softwares são livres ou de livre acesso (pelo menos para o meio
acadêmico) e cerca de 50% são de livre acesso para todos. Por isso, a
bioinformática exige um custo inicial para pesquisa bem baixo e esse é
mais um dos motivos pelos quais essa ciência deveria ser mais
incentivada em nosso país. Com um computador razoável e boas idéias
é possível fazer boa bioinformática!!!
Uma empresa privada que prestasse suporte em bioinformática
(desenvolvendo softwares sequenciadores para organismos específicos
ou que atendessem alguma demanda de determinada pesquisa, com
uma interface mais amigável com o usuário final) poderia dar certo?
Não estou bem certo, Pedro. O problema é que a idéia para elaboração
de softwares teria de vir da academia e não sei o pessoal das
universidades estaria disposto a dar a idéia para que vc fizesse o
software para eles comprarem, entende? Eles prefeririam pedir no
departamento de computação para ver se algum outro aluno faria o
mesmo software de graça, gerando um trabalho publicável em
conjunto. A menos que vcs produzissem um pacote grande, para uma
ampla gama de aplicações... aí vc poderia dar certo com sua
empresa...
Um profissional em bioinformática deve saber tanto trabalhar com os
softwares de análises de seqüências quanto desenvolver novos
programas? Quais são as linguagens de programação mais utilizadas
para este fim?
Ótima pergunta, Dani. É imprescindível para o profissional de
bioinformática, na minha opinião, ter quatro conhecimentos básicos:
(1) Ele deve entender bem biologia molecular, (2) saber trabalhar com
os bancos de dados disponíveis na internet, (3) saber BEM uma
linguagem de programação e (4) saber manipular bancos de dados.
Estes, na minha opinião, são os principais requisitos para formar um
bioinformata.
Você contrataria uma empresa dessa natureza para dar suporte às suas
pesquisas ou prefere, você mesmo, desenvolver os aplicativos com que
trabalha?
Depende do quanto de trabalho fosse necessário. Se fosse pouco
trabalho, eu mesmo desenvolveria. Se necessitasse de um software
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
11
Fabio:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Dani:
Dr. Francisco
Prosdocimi
Dani:
Dr. Francisco
Prosdocimi
Ricardo:
Dr. Francisco
Prosdocimi
amplo, talvez preferisse pagar... mas dependeria de financiamento
governamental para isso... e o governo não gosta muito do assunto
'comprar softwares de empresas privadas para trabalhos científicos'. No
último edital do CNPq para bioinfo, enviamos um projeto tentando
comprar um software e o projeto não foi aprovado... possivelmente por
este único motivo.
Boa Noite Dr. Francisco, participei da primeira turma de especialização
em bioinformática do LNCC, atualmente estou fazendo doutorado em
microbiologia na UFRJ. Gostaria de saber na sua opinião quais são as
principais diferenças dos cursos de doutorado em Bioinformatica da
USP e da UFMG?
Fala, Fábio. É com receber companheiros por aqui... fui seu sucessor no
LNCC, participando da segunda turma. Não posso dizer muito do curso
de doutorado na USP, o qual conheço pouco. Mas ao que me parece o
curso da USP é muito voltado para as ciências exatas, tendo uma alta
carga de disciplinas de matemática e estatística. Aqui na UFMG a carga
de disciplinas é bem balanceada e leve, de forma que o aluno possa se
preocupar mais com seu projeto de tese.
A quantas anda o desenvolvimento das pesquisas em bioinformática
aqui no estado de Minas Gerais?
Aqui em Minas temos alguns grupos de bioinformática montados. Não
posso dizer que conheço todos eles, mas aqui na UFMG temos ao
menos uns três grupos de bioinformática, trabalhando com genoma de
'Schistosoma mansoni', genômica comparativa e genômica evolutiva,
mas as coisas ainda são um pouco precárias e a infra-estrutura não é
das melhores.
Sou bióloga, especialista em biotecnologia - trabalho com saneamento
- área ambiental - - mas tenho grande interesse em bioinformática.
Quais são os conhecimentos básicos de informática que um biólogo
deve ter para iniciar um mestrado em bioinformática?
Bem, não conheço nenhum mestrado em bioinformática e acho que -se houvesse algum -- o aluno deveria conhecer o básico de sistemas
linux e linguagens de programação. Mas dependendo, se o mestrado
for para biólogos ou para “computólogos”, os conhecimentos a serem
exigidos são diferentes. Se for um mestrado para biólogos é possível
que não seja necessário nenhum conhecimento de informática e todo o
conhecimento pode ser adquirido quando da realização do curso.
Qual é campo de trabalho para um pós-graduado em bioinformática,
além do desenvolvimento de pesquisas em universidades, fundações de
pesquisa Federais,Estaduais e a Licenciatura?
Bem, essa pergunta é um tanto quanto capciosa. Se uma pessoa
formou em bioinformática, imagino que ela queira fazer pesquisa ou
dar aulas. É claro que ela pode também trabalhar em alguma empresa
de biotecnologia ou de bioinformática per si... mas acredito que aí ela
teria que ir pra fora do Brasil...
Quais são os trabalhos que vc está fazendo ultimamente na área?
Olá, Ricardo. Ultimamente tenho trabalhado com análises do software
PHRED, com a montagem de um programa para simular a evolução em
locos de microsatélites, trabalho também com a diferença na utilização
de aminoácidos por proteínas de diferentes organismos, com a origem
do código genético, com famílias de proteínas dedos de zinco, dentre
diversas outras coisas.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
12
Pedro:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
Pedro:
Dr. Francisco
Prosdocimi
1.6.
Então, estarei entrando em contato com o senhor (pois estou na
organização do evento). Mais uma pergunta, ainda é muito cedo para
pensarmos em cursos de graduação em bioinformática no Brasil?
Ok. Acho que um curso de graduação em bioinformática poderia ser
bastante interessante sim, mas acho que é cedo para isso. Ainda não
há, só pra vc ter uma idéia, um conceito amplo do que seja
bioinformática e é preciso que esta disciplina fique mais madura ao
longo dos anos para que esse conceito brote claramente. Acho que os
biólogos moleculares atualmente são os principais candidatos a se
tornarem bioinformatas e não há nem cursos de graduação em biologia
molecular... pelo menos desconheço...
A título de informação: foi criada na grade curricular do Bacharelado
em Bioquímica-UFV a BQI460 (Bioinformática), onde serão abordados
os principais aspectos dessa nova área do conhecimento.
Bem, aqui na UFMG o prof. Miguel Ortega já ministra à mais de dois
anos uma matéria de tópicos em bioquímica e biologia molecular cujo
assunto é a bionformática. É bastante interessante que a universidade
de Viçosa tenha proposto uma disciplina específica sobre o assunto e
mostra como está atualizada com relação aos novos avanços da
biologia molecular.
O que você considera como maior desafio para a consolidação da
Bioinformática no Brasil?
Considero o maior desafio a formação dos profissionais e a montagem
de infra-estrutura adequada e de computadores de alto-desempenho
para as análises mais elaboradas na área.
Referências Bibliográficas e textos complementares
1 Davies, K. (2001). Decifrando o genoma. Companhia das letras.
2. NCBI: A Science Primer - http://www.ncbi.nlm.nih.gov/About/primer/index.html
3. NCBI: A Science Primer – Bioinformatics http://www.ncbi.nlm.nih.gov/About/primer/bioinformatics.html
4. Chico On Line – Bioinformática - http://www.icb.ufmg.br/~franc/cool
5. GenBank Stats - http://www.ncbi.nlm.nih.gov/Genbank/genbankstats.html
1.7
Brainstorm
1. Dê sua opinião sobre o que entende por bioinformática e qual a importância da
área.
2. Vá ao site do NCBI (National Center for Biotechnology Information, o centro
americano para informação biotecnológica, http://www.ncbi.nlm.nih.gov), leia e
navegue um pouco. Encontre algum serviço interessante e reporte sua experiência.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
13
CAPÍTULO 2
Genoma, biologia molecular e computação
2.1.
Introdução
Como já foi dito, o presente curso não tem como função explicar genômica,
biologia molecular ou computação. Ainda assim, alguns conceitos se tornam
importantes para que possamos seguir o curso e neste capítulo estaremos nos
dedicando a eles.
2.2.
Sequenciamento do DNA
Figura 2.1. O dogma central da biologia molecular. Da análise de DNA temos os
projetos genoma, da análise do conteúdo de RNAs mensageiros de uma célula
produzimos estudos de transcriptoma e a partir da análise de conteúdo protéico
geramos os projetos proteoma.
A bioinformática surgiu a partir da biologia molecular e dela ainda é inseparável
(figura 2.1). No capítulo anterior, aprendemos que a bioinformática se desenvolveu
principalmente depois do surgimento dos seqüenciadores de DNA em larga escala,
como o ABI Prism 3700. A reação de sequenciamento de DNA consiste basicamente
em um processo de amplificação da molécula de DNA de interesse. Entretanto, durante
essa amplificação, são utilizados tanto os nucleotídeos normais de DNA, conhecidos
como desoxiribonucleotídeos quanto alguns nucleotídeos especiais, conhecidos como
di-desoxiribonucleotídeos. A diferença entre eles é que os didesoxinucleotídeos
apresentam, como o nome diz, uma molécula de oxigênio a menos, eles não contém
uma extremidade 3’OH livre. Assim, se lembrarmos como é formado o esqueleto de
uma cadeia de DNA, veremos que os nucleotídeos adjacentes são ligados entre si
através de uma ligação com um grupamento fosfato exatamente na posição do
carbono 3’. Isso significa que, um nucleotídeo que não apresente um grupamento OH
nesta
posição
(chamado
di-desoxiribonucleotídeo
ou
simplesmente
didesoxinucleotídeo) impede a ligação de um nucleotídeo em seguida, o que interrompe
a cadeia de DNA naquela posição. Assim, durante a amplificação em que consiste a
reação de sequenciamento do DNA, são produzidas moléculas de diferentes tamanhos,
sendo que cada uma delas possui, na sua extremidade, um didesoxinucleotídeo que
impede a ligação de outros nucleotídeos a seguir. Além disso, dependendo de qual
base ele carrega, cada um desses nucleotídeos sem a extremidade 3’OH livre
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
14
apresenta um pigmento fluorescente diferente adicionado. Após a reação de
sequenciamento – que é realizada num termociclador, assim como um PCR --, as
moléculas resultantes são submetidas a uma eletroforese. Nesse procedimento, o DNA
resultante da amplificação é submetido a um gradiente elétrico dentro de uma matriz
de gel, que permite uma mobilidade diferencial das moléculas. As moléculas pequenas
de DNA movem mais rapidamente para o pólo positivo durante essa eletroforese.
Essas moléculas pequenas foram aquelas que incorporaram didesoxinucleotídeos mais
precocemente do que as outras. E assim, elas vão se movendo na matriz gelatinosa
mais rapidamente, indo em direção ao pólo positivo. Quando chegam próximo ao pólo,
um laser incide sobre essa molécula e, dependendo de qual didesoxinucleotídeo foi
incorporado em sua extremidade final, o laser promove a incidência da fluorescência
num receptor que capta, afinal, qual foi o comprimento de onda daquele fluoróforo
excitado. Assim, conseguimos descobrir qual foi a última base daquela molécula já que
diferentes didesoxinucleotídeos -- com diferentes bases nitrogenadas (A, C, G ou T) --,
produzem fluorescência diferente a ser captada pelo laser e, dessa forma, sabemos se
a última base daquela molécula é uma adenina, uma guanina, uma citosina ou uma
timina. E à medida que as moléculas vão passando pelo gel, cada uma contendo a
diferença de um único nucleotídeo marcado de acordo com sua base, o computador vai
gerando um perfil de fluorescências que posteriormente serão transformadas nas letras
que representam a seqüência de bases da molécula original por algoritmos específicos,
que trataremos posteriormente neste curso.
Não é tarefa fácil explicar na forma de texto como é realizado o
sequenciamento do DNA e, por isso, recomendo aos alunos acessarem o seguinte site
para entenderem melhor como o seqüenciamento do DNA é realizado, passo a passo:
http://www.dnalc.org/shockwave/cycseq.html. Outras animações interessantes em
biologia molecular (como a da técnica de PCR de amplificação do DNA ou técnicas
forenses baseadas em DNA) podem ser obtidas no mesmo site. É preciso, entretanto,
fazer o download gratuito do programa macromedia shockwave.
2.3.
Genômica
Um genoma consiste no conjunto haplóide de informações presentes no DNA de
um determinado organismo. O conjunto é haplóide porque, na verdade, um organismo
diplóide apresenta uma dupla cópia de um mesmo segmento de DNA, presente nos
cromossomos homólogos. Assim, não faz sentido ter essa redundância de informação
e, por isso, considera-se o genoma como sendo o conjunto haplóide de informação
genética. Para obter uma seqüência genômica devemos pegar as células de um
determinado organismo, purificarmos seu DNA e realizarmos a construção da chamada
biblioteca de DNA genômico. Para tal, o DNA do organismo deve ser picotado em
pequenos pedacinhos e ligado nos chamados vetores de clonagem -- que podem ser
plasmídeos, cosmídeos ou vetores que permitem a inserção de segmentos grandes de
DNA, como os BACs ou YACs que são, respectivamente, os cromossomos artificiais de
bactérias e leveduras. A partir desses vetores é que são, freqüentemente,
seqüenciados os segmentos de DNA e cada reação de sequenciamento produz
moléculas apresentando algo entre trezentos e mil pares de bases. Como os genomas
são muito maiores do que esse tamanho, mostra-se necessária a montagem do
genoma utilizando algoritmos de sobreposição de seqüências, que serão apresentados
em aula posterior.
E se o genoma consiste no sequenciamento da molécula de DNA de uma
determinada célula, o transcriptoma consiste no sequenciamento do conteúdo de RNA
mensageiro (mRNA) produzido em uma determinada célula sujeita a determinada
condição. Enquanto uma célula apresenta apenas um genoma estático e imutável, a
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
15
mesma pode apresentar milhares de diferentes conteúdos de transcriptoma, já que a
expressão de genes depende de diversos fatores, como o grau de maturação da célula,
a temperatura à qual ela está sujeita, os nutrientes presentes no meio, a presença de
algum agente mutagênico específico e mais milhares de outros fatores. Assim, os
estudos de transcriptoma podem mostrar a adaptação da célula a determinada
condição e podemos estudar os genes que ficam ativos quando dessa condição. Na
produção de um projeto transcriptoma (ou de genômica funcional, como também é
freqüentemente chamado) deve-se purificar o conteúdo de mRNA da célula da
condição desejada. Como o RNA é uma molécula muito instável, realiza-se sua
transcrição reversa, transformando este RNA numa molécula conhecida como cDNA,
que representa o DNA complementar à seqüência daquele mRNA. Esse cDNA é então
clonado em vetores de clonagem para a produção da biblioteca de cDNA que contém
uma amostra fiel dos mRNAs que foram produzidos pela célula naquela condição. Vale
notar que, enquanto no genoma observa-se normalmente apenas uma cópia de cada
gene, nas análises de transcriptoma, cada um dos genes pode estar amostrado
dezenas de vezes, pois a célula pode estar precisando do mesmo para realizar algum
tipo de processo e ele pode ter sido transcrito centenas de vezes em moléculas de
mRNA.
2.4.
As ômicas: integrando a bioinformação
Veja o artigo publicado na edição 32 da revista biotecnologia:
http://www.biotecnologia.com.br/revista/bio32/omicas_32.pdf.
O pesquisador da Embrapa Soja, Eliseu Binneck, apresenta o status atual da
genômica no mundo e ainda vários conceitos importantes de biologia molecular e
genômica.
Binneck, Eliseu. As ômicas: integrando a bioinformação. Biotec Ci & Des 32: 2837. http://www.biotecnologia.com.br/revista/bio32/omicas_32.pdf
2.5.
O PERL e outras linguagens de programação
No capítulo anterior discutimos sobre os conhecimentos relevantes para um
profissional na área de bioinformática. Nesse momento, portanto, gostaria de falar
mais um pouco sobre a informática utilizada para a análise de seqüências. É
extremamente importante que qualquer pessoa trabalhando na área de bioinformática
conheça alguma linguagem de programação. E a principal linguagem utilizada por
profissionais da bioinformática é o PERL. O PERL é uma linguagem de script que foi
criada em 1987 por um cientista da computação chamado Larry Wall e é uma sigla
para Practical Extraction and Report Language ou, em português, Linguagem Prática
de Extração e Relatório. Segundo a wikipedia (http://pt.wikipedia.org/), a origem do
PERL remonta ao shell scripting, que é a programação em linhas de comando, ao awk,
uma outra linguagem bem simples de programação shell e à linguagem C, uma das
mais utilizadas pelos programadores. Essa linguagem é disponível para praticamente
todos os sistemas operacionais, mas é utilizada mais freqüentemente em sistemas
Unix e compatíveis. E o PERL é freqüentemente utilizado pelos bioinformatas porque é
uma linguagem montada para trabalhar facilmente com o processamento de cadeias
de caracteres (chamadas de strings pelos informatas), permitindo ainda uma fácil
manipulação de arquivos texto e a utilização das chamadas expressões regulares,
muito úteis para se realizar busca em seqüências de caracteres. Como tanto o DNA
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
16
quanto o RNA e as proteínas podem ser facilmente representados por seqüências de
caracteres – nucleotídeos ou aminoácidos, representados por seqüências de uma letra
--, o PERL acabou por permitir, intrinsecamente, uma fácil manipulação dos dados de
biologia molecular.
Um exemplo simples de programa em PERL é apresentado abaixo para
transformar uma seqüência de DNA de entrada em uma nova seqüência de RNA. O
programa considera que a fita de DNA de entrada é a fita codificadora e, portanto, o
programa apenas transforma as letras T, de timina, do DNA em letras U, de uracila,
representando as bases do RNA.
Pequeno script PERL para obter uma fita de RNA a partir de uma fita de DNA.
#!/usr/bin/perl
# Seqüência que se deseja utilizar
$meuDNA= “TTCCGAGCCAATTGTATCAGTTGCCAATAG”;
# Faz com que a seqüência de RNA receba a mesma seqüência do DNA
$meuRNA = $meuDNA;
# Troca as bases produzindo a fita complementar
$meuRNA =~ tr/T/U/;
print “Minha seqüência de RNA é: \n $meuRNA”;
A primeira linha é obrigatória e diz ao programa o caminho onde se encontra o
interpretador PERL para que o programa possa encontrá-lo na hora de sua execução.
Normalmente o PERL está disponível no diretório /usr/bin das distribuições Unix. Vale
notar que, ao contrário da grande maioria das outras linguagens de programação
normalmente utilizadas, um programa PERL não é compilado de forma a gerar um
executável em linguagem de máquina. O script PERL necessita, portanto, de que exista
um interpretador PERL instalado em alguma pasta de trabalho dentro do computador e
é exatamente a pasta onde esse interpretador está localizado que deve aparecer nesta
primeira linha de código. As linhas do script que se começam com o sinal “#”
representam linhas de comentário e servem apenas para facilitar o entendimento do
código, não sendo realmente lidas pelo interpretador. Todas as variáveis em
programação PERL são precedidas do sinal de dólar “$”, elas não têm um tipo prédefinido (como inteiro, booleano, real, etc.) e não precisam ser declaradas
anteriormente, cabe ao programador saber como e em que contexto devem ser
utilizadas. Há também as variáveis do tipo array, que são precedidas do sinal de “@” e
as variáveis do tipo hash, que devem ser precedidas do sinal de “%”. Todos os
comandos terminam sempre com um sinal de ponto-e-vírgula. Neste exemplo, a linha
que realmente faz a tradução de uma seqüência de DNA para uma seqüência de RNA é
a que apresenta o sinal “=~”. Esse sinal está relacionado à utilização de uma
expressão regular que, no caso, faz a tradução de todos as letras T de uma seqüência
de caracteres, transformando-as em letras U.
No fundo, a bioinformática – e, num sentido mais amplo, todo software -- pode
ser desenvolvido utilizando-se qualquer linguagem de programação e há os que ainda
preferem utilizar a linguagem C ou Java para produzir qualquer tipo de programa. No
fundo, essa é uma opção pessoal e por mais que uma ou outra linguagem seja mais
adaptada ou mais rápida para determinado problema, é possível fazer quase qualquer
coisa com quase qualquer linguagem. Entretanto, mesmo essa simples tradução que
fizemos de DNA para RNA com apenas uma linha de código, pode se tornar mais árdua
quando realizada em diferentes linguagens e é exatamente por isso que o PERL é mais
utilizado na área; por facilitar a programação. Para sistemas mais complexos, no
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
17
entanto, parece ser consenso que a utilização de uma linguagem de programação
multi-plataforma, como é o caso do Java, seja mais adequada.
2.6.
Referências Bibliográficas e textos complementares
1. Dolan
DNA
Learning
Center
Biology
Animation
Library
http://www.dnalc.org/resources/BiologyAnimationLibrary.htm
2. Binneck, Eliseu. As ômicas: integrando a bioinformação. Biotec Ci & Des 32: 28-37.
http://www.biotecnologia.com.br/revista/bio32/omicas_32.pdf
3. Perl, Wikipedia. http://pt.wikipedia.org/wiki/Perl
2.7.
Brainstorm
1. Você viu a animação sobre como é feito o sequenciamento do DNA, descreva agora
as etapas através das quais é realizada esta técnica.
2. Descreva como são feitos projetos genoma e transcriptoma.
3. Perguntas sobre o texto escrito por Binneck.
a. Apesar de apresentarem um número de genes bastante similar a outros
organismos, diz-se que os seres humanos apresentam uma diversidade de
proteínas muito maior do que eles. A que se deve tal diversidade?
b. Qual a porcentagem do genoma humano que é responsável pela produção
de genes/proteínas? E o resto, qual seria o motivo – se é que há algum – para
haver tanto DNA não codificante no genoma?
c. Você acredita que genes que alteram seus padrões de expressão em
conjunto possam ter funções parecidas? Por quê?
d. Escolha duas das ciências “ômicas” e descreva-as
e. Discorra sobre o papel da bioinformática na agregação de dados em biologia
4. Com relação a linguagens de programação, por que o PERL é conhecido como a
linguagem dos bioinformatas? Os dados em bioinformática podem ser tratados com
outras linguagens de programação? Cite outra linguagem possível.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
18
CAPÍTULO 3
Alinhamento de Seqüências
3.1. Introdução
O alinhamento de seqüências consiste no processo de comparar duas
seqüências (de nucleotídeos ou proteínas) de forma a se observar seu nível de
identidade. Essa técnica de comparação de seqüências é implementada segundo um
conceito de desenvolvimento de programas conhecido como um algoritmo guloso e é
um dos pilares de toda a bioinformática. Existem centenas de aplicações do
alinhamento de seqüências, tanto na identificação de genes e proteínas desconhecidas,
quanto na comparação da ordem de genes em genomas de organismos proximamente
relacionados (sintenia), no mapeamento de seqüências expressas dentro de um
genoma para identificação de genes, na montagem de genomas e em diversas outras
aplicações.
Por exemplo, podemos alinhar duas seqüências para descobrirmos o grau de
similaridade entre as seqüências de forma que possamos inferir (ou não) a uma delas,
alguma propriedade já conhecida da outra (Prosdocimi et al., 2003). O alinhamento
entre duas seqüências pode ser feito de forma global ou local (Figura 3.1.).
Figura 3.1. Alinhamento global e local. À esquerda vemos um exemplo de como é
feito um alinhamento global das seqüências e à direita vemos um exemplo da
realização de um alinhamento local. Retirado de Prosdocimi et al., 2003.
3.2. Alinhamento Global
O alinhamento global é feito quando comparamos uma seqüência de
aminoácidos ou nucleotídeos com outra, ao longo de toda sua extensão
(http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html).
O
algoritmo
Needleman-Wunsch é o mais conhecido para realizar esse tipo de alinhamento,
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
19
embora
outros
programas,
como
o
MULTALIN
(http://prodes.toulouse.inra.fr/multalin/multalin.html) também o façam (Corpet,
1988). Nesse caso são dados valores em uma matriz de comparação para as
similaridades (matches), diferenças (mismatches) e falhas (gaps) encontrados durante
o alinhamento das seqüências. As somas dos valores do alinhamento, de acordo com
essa matriz de comparação, resulta num valor, que é um escore de similaridade entre
as seqüências (Figura 3.2.). No MULTALIN não é dado escore de similaridade (já que ele
permite o alinhamento de várias seqüências ao mesmo tempo), e a semelhança entre
as seqüências deve ser medida através de inspeção visual.
3.3. Alinhamento Local
O alinhamento local acontece quando a comparação entre duas seqüências não
é feita ao longo de toda sua extensão, mas sim através de pequenas regiões destas
(http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html).
O principal programa utilizado para o alinhamento local de seqüências é o
BLAST (Basic Local Alignment Search Tool ou Ferramenta Básica de Procura por
Alinhamento Local), encontrado em http://www.ncbi.nlm.nih.gov/BLAST/. Esse
software compreende um conjunto de algoritmos de comparação de seqüências
montado de forma a explorar toda a informação contida em bases de dados de DNA e
proteínas (http://www.ncbi.nlm. nih.gov/BLAST/blast_overview.html). Os programas
BLAST foram desenvolvidos de modo a aumentar ao máximo a velocidade da busca
por similaridade -- já que as bases de dados são grandes e vêm crescendo
exponencialmente --, mesmo correndo o risco de perder um pouco na sensibilidade do
resultado (Altschul et al., 1997). A rapidez da busca deve-se ao fato de que o
programa utiliza uma heurística que quebra as seqüências de entrada e das bases de
dados em fragmentos – as palavras (words) – e procura, inicialmente, similaridades
entre elas. A busca é então feita com palavras de tamanho W que devem apresentar
pelo menos um escore T de alinhamento entre si, dado de acordo com uma matriz de
valores. Assim, as palavras que apresentam esse escore T (maior responsável pela
velocidade e sensibilidade da busca) (Altschul et al., 1997) são estendidas em ambas
as direções para ver se geram um alinhamento com um escore maior do que S. Uma
outra vantagem de se utilizar o alinhamento local feito pelo BLAST é que, dessa forma,
é possível identificar relações entre seqüências que apresentam apenas regiões
isoladas
de
similaridade
(http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/similarity.html).
Figura 3.2. Alinhamento de seqüências. O alinhamento de seqüências de DNA é feito
através da procura de uma região de similaridade entre duas seqüências utilizando um
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
20
algoritmo guloso. Quando essa região é encontrada são dados pontos para
similaridades (match), diferenças (mismatches), abertura de falhas (gap opening) e
extensão de falhas (gap extension) que possam ser encontradas no seu alinhamento.
A somatória dos pontos desse alinhamento é chamado de escore do alinhamento e, no
exemplo mostrado, o escore do alinhamento é 3. Tais escores são contabilizados tanto
nos alinhamentos globais quanto locais.
Os resultados do BLAST são então apresentados de acordo com dois
parâmetros: o valor do escore (Score bits) e o valor E (e-value). O valor de escore
depende do tamanho do alinhamento, do número de matches/mismatches/gaps e da
matriz de comparação de seqüências utilizada e é normalizado através de variáveis
estatísticas (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/Blast_output.html). Já
o valor E representa o número de alinhamentos com escores iguais ou melhores que
“S” que seria de se esperar que ocorressem ao acaso numa base de dados do tamanho
da utilizada. Assim, quanto menor o valor E, melhor o alinhamento, de forma que
(num banco de dados de grandes proporções) um valor de E igual a zero significa que
não há chance de que um alinhamento entre as duas seqüências tenha ocorrido por
mero acaso (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html).
O BLAST apresenta diferentes subprogramas que devem ser utilizados de
acordo com o tipo de seqüência de entrada e os bancos de dados que se deseja
pesquisar. A TABELA 3.1 apresenta as possibilidades de entrada, bancos de dados e
programa a ser utilizado.
Formato da
Formato da
Programa
Seqüência de
Banco de dados
seqüência que é
BLAST
Entrada
comparado
adequado
Nucleotídeos
Nucleotídeos
Nucleotídeos
BLASTn
Proteínas
Proteínas
Proteínas
BLASTp
Nucleotídeos
Proteínas
Proteínas
BLASTx
Proteínas
Nucleotídeos
Proteínas
TBLASTn
Nucleotídeos
Nucleotídeos
Proteínas
TBLASTtx
Tabela 3.1: Programas BLAST utilizados de acordo com o formato de entrada de
seqüência
e
banco
de
dados
desejados.
Adaptada
de
http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/query_tutorial.html.
3.4. Alinhamentos ótimos e heurísticos
Algo que deve ser levado em consideração sempre que se deseja fazer
alinhamentos de seqüências é o fato de que o alinhamento desejado seja o melhor
possível de ser obtido através de ferramentas computacionais ou se desejamos apenas
uma aproximação válida desse melhor resultado. É evidente que, em condições
normais, desejaríamos sempre obter o melhor resultado de alinhamento possível e,
portanto, utilizaríamos os algoritmos que produzem resultados ótimos. Entretanto,
algumas vezes precisamos obter uma maior rapidez de busca e, portanto, aceitamos
que o resultado obtido não seja “o melhor possível” e, assim, utilizamos algoritmos
que apresentam algum tipo de heurística. E essa heurística, no caso, normalmente
consiste em uma forma qualquer que o programador utiliza para acelerar a produção
dos resultados, em detrimento da obtenção do melhor resultado possível. Assim
obtém-se um resultado aproximado, mas rápido. A tabela 3.2 apresenta os principais
algoritmos utilizados em bioinformática para o alinhamento de seqüências.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
21
Tipo de
Precisão do Número de seqüências
Alinhamento Alinhamento
a serem alinhadas
BLAST2Sequences
Local
Heurístico
2
SWAT (Smith-Waterman)
Local
Ótimo
2
ClustalW
Global
Heurístico
N
Multalin
Global
Heurístico
N
Needleman-Wunsch
Global
Ótimo
2
Tabela 3.2:Principais programas de alinhamento de seqüências e suas características.
Programa
As ferramentas de alinhamento ótimo são aquelas que nos dão como resultado
o melhor alinhamento possível de acordo com a metodologia algorítmica de
comparação de seqüências. Via de regra, a execução desses algoritmos é mais lenta
do que a daqueles algoritmos que não geram o resultado perfeito e, como vimos na
tabela 4.2., existem ferramentas de alinhamento ótimo locais e globais. O maior
problema em utilizar os programas de alinhamento ótimo consiste nos casos onde são
alinhadas múltiplas seqüências entre si. Nesses casos, o alinhamento ótimo pode se
tornar simplesmente impossível de ser feito, pois gastaria uma quantidade de tempo
quase infinita para alinhar otimamente uma quantidade seqüências não muito grande.
Nos outros casos, entretanto, deve-se preferir a utilização de algoritmos que produzam
o alinhamento ótimo em detrimento dos algoritmos de pesquisa heurística.
Algoritmos heurísticos são aqueles que não realizam o alinhamento ótimo entre
seqüências. Esses algoritmos freqüentemente utilizam alguma técnica alternativa para
acelerar o resultado da busca por seqüências similares, no caso. O BLAST, por
exemplo, como vimos no item anterior, parte a seqüência em pedaços para acelerar a
busca e outros algoritmos realizam diferentes maneiras de gerar um resultado que
seja o mais próximo possível do resultado ótimo. Como já comentado, são
principalmente utilizados em alinhamentos múltiplos, onde os algoritmos ótimos
demoram um tempo muito grande para gerar os resultados. São freqüentemente
utilizados também quando da comparação de seqüências contra grandes bancos de
dados, exatamente como faz o BLAST, que procura a similaridade de uma seqüência
de entrada contra milhões de outras presentes em seu banco de dados.
Muitas vezes, os resultados obtidos com programas heurísticos devem ser
confirmados por programas de alinhamento ótimo antes de serem publicados em
revistas especializadas. Entretanto algumas vezes tal procedimento não é necessário e
tudo vai depender do tipo de trabalho que está sendo realizado.
3.5. Alinhamentos simples e múltiplos
Como também já foi comentado na seção anterior, existem dois tipos principais
de alinhamentos de seqüências no que concerne ao número de seqüências que são
comparadas durante o alinhamento. Quando apenas duas seqüências são comparadas
entre si, diz-se que o alinhamento é simples. E, nesses casos, normalmente prefere-se
utilizar alinhamentos ótimos para gerarem os resultados, exceto nos casos onde
milhares de alinhamentos simples devem ser realizados.
De forma contrária, considera-se um alinhamento múltiplo quando três ou mais
seqüências devem ser alinhadas entre si. No fundo, o alinhamento múltiplo é montado
a partir do alinhamento par a par de cada uma das seqüências com todas as outras,
seguido por um outro procedimento que irá gerar o resultado final do alinhamento de
todas contra todas. Assim, se 10 seqüências são comparadas entre si, serão
necessárias 10! (fatorial de 10) comparações de seqüências, o que representam
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
22
3.628.800 comparações. E é exatamente por isso que os programas heurísticos são
preferidos para gerar esse tipo de resultado.
3.6. Matrizes de comparação
Outra coisa de suma importância quando da realização de qualquer alinhamento
de seqüências é a matriz de substituição que é utilizada. Na figura 3.2. é mostrado um
alinhamento e o número de “pontos” dados para coincidências (matches), divergências
(mismatches), abertura de gaps (gap opening) e extensão de gaps (gap extension).
Entretanto, ao utilizarmos matrizes de substituição podemos dar valores diferentes
para coincidências de diferentes nucleotídeos ou aminoácidos. Vale notar que o
resultado de um alinhamento de seqüências pode ser completamente diferente
dependendo da matriz de substituição utilizada.
As matrizes de comparação são principalmente utilizadas durante o alinhamento
de seqüências de proteínas e isso se deve ao fato de que existem aminoácidos que são
mais (ou menos) parecidos entre si do que outros. Há aminoácidos com cargas
polares, apolares ou sem carga e a mudança, em uma proteína, de um aminoácido
apresentando uma determinada característica para outro da mesma característica é
menos drástica do que uma mudança para um aminoácido apresentando característica
diferente. Portanto, as matrizes de substituição são extremamente utilizadas no
alinhamento de seqüências protéicas.
Mesmo no caso de seqüências de nucleotídeos são mais comuns as mutações
conhecidas como transições do que as transversões. Nas transições, a mutação ocorre
entre bases do mesmo tipo, purina para purina (A para G ou G para A) ou pirimidina
para pirimidina (C para T ou T para C), enquanto nas transversões ocorre a mudança
de uma purina para uma pirimidina ou o contrário. Dessa forma, ao utilizarmos
matrizes de substituição, podemos dar mais pesos para as transversões do que para as
transições, o que faria com que o resultado fosse mais relevante e pudesse estar mais
relacionado com a evolução, por exemplo.
As matrizes de substituição mais comuns para seqüências nucleotídicas são a
mat50 e a mat70, enquanto para seqüências protéicas as mais conhecidas são as
matrizes PAM e BLOSUM. As matrizes BLOSUM (Blocks Substitution Matrix), por
exemplo, são baseadas na observação das freqüências de substituição em blocos de
alinhamentos locais de proteínas relacionadas. Existem várias matrizes BLOSUM e elas
devem ser utilizadas para comparar proteínas contendo um determinado valor de
identidade, por exemplo, a matriz mais utilizada pelos programas é a BLOSUM62, que
foi montada para comparar proteínas que apresentem 62% de aminoácidos idênticos.
Abaixo vemos as matrizes de substituição de nucleotídeos mat50 e mat70.
Podemos perceber que a matriz mat70 apresenta valores menores para algumas
substituições. Isso faz com que o valor final do alinhamento entre duas seqüências de
DNA seja menor e, portanto, a matriz mat70 gera um resultado de alinhamento local
de um menor número de bases do que a matriz mat50, que estende o alinhamento um
pouco mais.
Bases
A
C
G
T
Y
R
N
A
2
-2
0
-2
-2
1
0
C
-2
2
-2
0
1
-2
0
G
0
-2
2
-2
-2
1
0
T
-2
0
-2
2
1
-2
0
Y
-2
1
-2
1
1
-2
0
R
1
-2
1
-2
-2
1
0
N
0
0
0
0
0
0
0
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
23
Tabela 3.3: Matriz de substituição de nucleotídeos mat50. O valor dado para cada
troca pode ser visto nas interseções. O Y representa pirimidinas, o R representa
purinas e o N representa qualquer nucleotídeo.
Bases
A
C
G
T
Y
R
N
A
2
-2
-1
-2
-2
0
0
C
-2
2
-2
-1
0
-2
0
G
-1
-2
2
-2
-2
0
0
T
-2
-1
-2
2
0
-2
0
Y
-2
0
-2
0
0
-2
0
R
0
-2
0
-2
-2
0
0
N
0
0
0
0
0
0
0
Tabela 3.4: Matriz de substituição de nucleotídeos mat70. O valor dado para cada
troca pode ser visto nas interseções. O Y representa pirimidinas, o R representa
purinas e o N representa qualquer nucleotídeo.
3.7. Exemplos reais de alinhamentos
a) Alinhamento global simples entre seqüências de DNA, usando o algoritmo
Needleman-Wunsch.
########################################
# Program: needle
# Rundate: Fri Nov 19 15:57:40 2004
# Align_format: srspair
# Report_file: 1x2.needle
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: Seq1
# 2: Seq2
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 736
# Identity:
464/736 (63.0%)
# Similarity:
464/736 (63.0%)
# Gaps:
272/736 (37.0%)
# Score: 2261.0
#
#
#=======================================
Seq1
1
Seq2
1 GCACGAGGACTGTGAACCGAATCGGTTCAGTAAAATGTTCAATTGTGCGC
Seq1
1
Seq2
Seq1
Seq2
Seq1
51 TGGAATCTATTGTGTAGACTATTAACTATGGAATTTTACTTCACATTGAC
1
CTTTCAAGATGAACG
|||||||||||||||
101 TAAAAAGCTGAGCAAATATACCTGGAGCGTTCAGACTTTCAAGATGAACG
16 AACCAACTGGTGTCGGGCCAACATTTGCTGATGCATGCGATGATGGCGAA
||||||||||||||||||||||||||||||||||||||||||||||||||
0
50
0
100
15
150
65
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
24
Seq2
151 AACCAACTGGTGTCGGGCCAACATTTGCTGATGCATGCGATGATGGCGAA
200
Seq1
66 CTTATCAGCATTTGTTGTCTTTGTGGTAAAACGTTTTCAAGTCAGAGTCT
||||||||||||||||||||||||||||||||||||||||||||||||||
201 CTTATCAGCATTTGTTGTCTTTGTGGTAAAACGTTTTCAAGTCAGAGTCT
115
116 TCTACACAAACATTTTGAATTGATGCATGAAGGTACGGAAATAGATACTG
||||||||||||||||||||||||||||||||||||||||||||||||||
251 TCTACACAAACATTTTGAATTGATGCATGAAGGTACGGAAATAGATACTG
165
166 AACAGTATGATCTAAGTGGATTTGCCGCTATGGGGAATGAACAAGGTCGT
||||||||||||||||||||||||||||||||||||||||||||||||||
301 AACAGTATGATCTAAGTGGATTTGCCGCTATGGGGAATGAACAAGGTCGT
215
Seq2
Seq1
Seq2
Seq1
Seq2
Seq1
250
300
350
216 AAAAGTAATGGTGAAGAAGATGCAAATTTCCGAGTTCTGAATTGTGCGTT
||||||||||||||||||||||||||||||||||||||||||||||||||
351 AAAAGTAATGGTGAAGAAGATGCAAATTTCCGAGTTCTGAATTGTGCGTT
265
266 TTGCAACAAAGTATTTACTAAACACTGTAATTTAAACACACATATCAAAG
||||||||||||||||||||||||||||||||||||||||||||||||||
401 TTGCAACAAAGTATTTACTAAACACTGTAATTTAAACACACATATCAAAG
315
325
Seq2
316 CAGTCCATAA---------------------------------------||||||||||
451 CAGTCCATAAAGGTCAGATTCTGTTAATGTAAACAGTTTTTGTATATACA
Seq1
326 --------------------------------------------------
325
Seq2
501 GCGTTCCTATCTTTGTTTTTCTTCAATACTTACCTGTTAGGGTTTTTGGT
550
Seq1
326 ---------AGGTGTAAAACCGTTTGAATGCACTTATTGTTATAAAGGAT
|||||||||||||||||||||||||||||||||||||||||
551 CATTATTTTAGGTGTAAAACCGTTTGAATGCACTTATTGTTATAAAGGAT
366
367 TCACTCGAAATTCTGATCTTCATAAGCACATCGACGCTGTTCACAAAGGT
||||||||||||||||||||||||||||||||||||||||||||||||||
601 TCACTCGAAATTCTGATCTTCATAAGCACATCGACGCTGTTCACAAAGGT
416
464
Seq2
417 CTCAAGCCTTTCGGATGTGAAGTATGCCAGCGAAACTTCTCTCAGAAA
||||||||||||||||||||||||||||||||||||||||||||||||
651 CTCAAGCCTTTCGGATGTGAAGTATGCCAGCGAAACTTCTCTCAGAAATC
Seq1
465
464
Seq2
701 CAGCCTTAAACGACACATAGAAAGCATTCACGAAAG
736
Seq2
Seq1
Seq2
Seq1
Seq2
Seq1
Seq2
Seq1
400
450
500
600
650
700
#--------------------------------------#---------------------------------------
b) Alinhamento local simples entre as mesmas seqüências de DNA, usando o
algoritmo BLAST.
BLASTN 2.2.8 [Jan-05-2004]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Seq1
(464 letters)
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
25
Database: seq2
1 sequences; 736 total letters
Searching.done
Sequences producing significant alignments:
Seq2
Score
E
(bits) Value
652
0.0
>Seq2
Length = 736
Score = 652 bits (329), Expect = 0.0
Identities = 329/329 (100%)
Strand = Plus / Plus
Query: 1
ctttcaagatgaacgaaccaactggtgtcgggccaacatttgctgatgcatgcgatgatg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 136 ctttcaagatgaacgaaccaactggtgtcgggccaacatttgctgatgcatgcgatgatg 195
Query: 61
gcgaacttatcagcatttgttgtctttgtggtaaaacgttttcaagtcagagtcttctac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 196 gcgaacttatcagcatttgttgtctttgtggtaaaacgttttcaagtcagagtcttctac 255
Query: 121 acaaacattttgaattgatgcatgaaggtacggaaatagatactgaacagtatgatctaa 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 256 acaaacattttgaattgatgcatgaaggtacggaaatagatactgaacagtatgatctaa 315
Query: 181 gtggatttgccgctatggggaatgaacaaggtcgtaaaagtaatggtgaagaagatgcaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 316 gtggatttgccgctatggggaatgaacaaggtcgtaaaagtaatggtgaagaagatgcaa 375
Query: 241 atttccgagttctgaattgtgcgttttgcaacaaagtatttactaaacactgtaatttaa 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 376 atttccgagttctgaattgtgcgttttgcaacaaagtatttactaaacactgtaatttaa 435
Query: 301 acacacatatcaaagcagtccataaaggt 329
|||||||||||||||||||||||||||||
Sbjct: 436 acacacatatcaaagcagtccataaaggt 464
Score = 276 bits (139), Expect = 3e-78
Identities = 139/139 (100%)
Strand = Plus / Plus
Query: 326 aggtgtaaaaccgtttgaatgcacttattgttataaaggattcactcgaaattctgatct 385
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 560 aggtgtaaaaccgtttgaatgcacttattgttataaaggattcactcgaaattctgatct 619
Query: 386 tcataagcacatcgacgctgttcacaaaggtctcaagcctttcggatgtgaagtatgcca 445
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 620 tcataagcacatcgacgctgttcacaaaggtctcaagcctttcggatgtgaagtatgcca 679
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
26
Query: 446 gcgaaacttctctcagaaa 464
|||||||||||||||||||
Sbjct: 680 gcgaaacttctctcagaaa 698
Database: seq2
Posted date: Nov 19, 2004 3:58 PM
Number of letters in database: 736
Number of sequences in database: 1
Lambda
1.37
Gapped
Lambda
1.37
K
H
0.711
K
1.31
H
0.711
1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2
Number of Sequences: 1
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 2
length of query: 464
length of database: 736
effective HSP length: 9
effective length of query: 455
effective length of database: 727
effective search space:
330785
effective search space used:
330785
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 8 (16.4 bits)
c) Alinhamento global múltiplo entre as mesmas seqüências de DNA (e outras
duas mais), usando o algoritmo CLUSTALW.
CLUSTAL W (1.81) multiple sequence alignment
Seq1
Seq4
Seq2
Seq3
------------------------------------------------------------GCACGAGGACTGTGA-----ACCGAATCGGTTCAGTAAAATGTTCAATTGTGCGCTGGA
------------------------------GTTCAGTAAAATGTTCAATTGTGCGCTGGA
GGCACGAGGGCTACGACTGTGAACGAATCGGTTCAGTAAAATGTTCAATTGTGCGCTGGA
Seq1
Seq4
Seq2
Seq3
-----------------------------------------------------------ATCTATTGTGTAGACTATTAACTATGGAATTTTACTTCACATTGACTAAAAAGCTGAGCA
ATCTATTGTGTAGACT-TTAACTATGGAATTTTACTTCACATTGACTAAAAAGCTGAGCA
ATCTATTGTGTAGACTATTAACTATGGAATTTTACTTCACATT-ACTAAAAAGCTGAGCA
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
27
Seq1
Seq4
Seq2
Seq3
---------------------CTTTCAAGATGAACGAACCAACTGGTGTCGGGCCAACAT
AATATACCTGGAGCGTTCAGACTTTCAAGATGAACGAACCAACTGGTGTCGGGCCAACAT
AATATACCTGGAGCGTTCAGACTTTCAAGATGAACGAACCAACTGGTGTCGGGCCAACAT
AATATACCTGGAGCGTTCAGACTTTCAAGATGAACGAACCAACTGGTGTCGGGCCAACAT
***************************************
Seq1
Seq4
Seq2
Seq3
TTGCTGATGCATGCGATGATGGCGAACTTATCAGCATTTGTTGTCTTTGTGGTAAAACGT
TTGCTGATGCATGCGATGATGGCGAACTTATCAGCATTTGTTGTCTTTGTGGTAAAACGT
TTGCTGATGCATGCGATGATGGCGAACTTATCAGCATTTGTTGTCTTTGTGGTAAAACGT
TTGCTGATGCATGCGATGATGGCGAACTTATCAGCATTTGTTGTCTTTGTGGTAAAACGT
************************************************************
Seq1
Seq4
Seq2
Seq3
TTTCAAGTCAGAGTCTTCTACACAAACATTTTGAATTGATGCATGAAGGTACGGAAATAG
TTTCAAGTCAGAGTCTTCTACACAAACATTTTGAATTGATGCATGAAGGTACGGAAATAG
TTTCAAGTCAGAGTCTTCTACACAAACATTTTGAATTGATGCATGAAGGTACGGAAATAG
TTTCAAGTCAGAGTCTTCTACACAAACATTTTGAATTGATGCATGAAGGTACGGAAATAG
************************************************************
Seq1
Seq4
Seq2
Seq3
ATACTGAACAGTATGATCTAAGTGGATTTGCCGCTATGGGGAATGAACAAGGTCGTAAAA
ATACTGAACAGTATGATCTAAGTGGATTTGCCGCTATGGGGAATGAACAAGGTCGTAAAA
ATACTGAACAGTATGATCTAAGTGGATTTGCCGCTATGGGGAATGAACAAGGTCGTAAAA
ATACTGAACAGTATGATCTAAGTGGATTTGCCGCTATGGGGAATGAACAAGGTCGTAAAA
************************************************************
Seq1
Seq4
Seq2
Seq3
GTAATGGTGAAGAAGATGCAAATTTCCGAGTTCTGAATTGTGCGTTTTGCAACAAAGTAT
GTAATGGTGAAGAAGATGCAAATTTCCGAGTTCTGAATTGTGCGTTTTGCAACAAAGTAT
GTAATGGTGAAGAAGATGCAAATTTCCGAGTTCTGAATTGTGCGTTTTGCAACAAAGTAT
GTAATGGTGAAGAAGATGCAAATTTCCGAGTTCTGAATTGTGCGTTTTGCAACAAAGTAT
************************************************************
Seq1
Seq4
Seq2
Seq3
TTACTAAACACTGTAATTTAAACACACATATCAAAGCAGTCCATAAAGGT---------TTACTAAACACTGTAATTTAAACACACATATCAAAGCAGTCCATAAAGGTCAGATTCTGT
TTACTAAACACTGTAATTTAAACACACATATCAAAGCAGTCCATAAAGGT---------TTACTAAACACTGTAATTTAAACACACATATCAAAGCAGTCCATAAAGGT---------**************************************************
Seq1
Seq4
Seq2
Seq3
-----------------------------------------------------------TAATGTAAACAGTTTTTGTATATACAGCGTTCCTATCTTTGTTTTTCTTCAATACTTACC
-----------------------------------------------------------------------------------------------------------------------
Seq1
Seq4
Seq2
Seq3
-----------------------------GTAAAACCGTTTGAATGCACTTATTGTTATA
TGTTAGGGTTTTTGGTCATTATTTTAGGTGTAAAACCGTTTGAATGCACTTATTGTTATA
-----------------------------GTAAAACCGTTTGAATGCACTTATTGTTATA
-----------------------------GTAAAACCGTTTGAATGCACTTATTGTTATA
*******************************
Seq1
Seq4
Seq2
Seq3
AAGGATTCACTCGAAATTCTGATCTTCATAAGCACATCGACGCTGTTCACAAAGGTCTCA
AAGGATTCACTCGAAATTCTGATCTTCATAAGCACATCGACGCTGTTCACAAAGGTCTCA
AAGGATTCACTCGAAATTCTGATCTTCATAAGCACATCGACGCTGTTCACAAAGGTCTCA
AAGGATTCACTCGAAATTCTGATCTTCATAAGCACATCGACGCTGTTCACANAGGTCTCA
*************************************************** ********
Seq1
Seq4
Seq2
Seq3
AGCCTTTC-GGATGTGAAGTATGCCAGCGAAACTTCTCTCAGAAA--------------AGCCTTTC-GGATGTGAAGTATGCCAGCGAAACTTCTCTCAGAAATCCAGCCTTAAACGA
AGCCTTTCCGGATGTGAAGTATGCCAGCGAAACTTCTCTCAGAAATCCAGCCTAAAACGA
AGCCTTTC-GGATGTGAAGTATGCCAGCGAAACTTCTCTCAGAAATCCAGCCTANAACGA
******** ************************************
Seq1
Seq4
Seq2
-----------------------------------------------------------CACATAGAAAGCATTCACGAAAG------------------------------------CACATAGAAGCAATTCACGAAGATCCTCGGCATCGCTGAAGAGAAACCAGATTGTATAAT
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
28
Seq3
CACATAGAAAGCATTCACGAAGATCCTCGGCATCGCTGAAGAGAAACCAGAT-GTATAAT
Seq1
Seq4
Seq2
Seq3
------------------------------------------------------------------------------------------------------------CCTCTCCAATTTTCATATGATTTCATGTTCAAAAATATACATTTATTATTCTTTC
CCTCTCCAATTT-CATATGATTNCATGNTCANAA-TATACATTTATTATTCTTTC
3.8. Referências Bibliográficas
1
2.
3.
4.
NCBI Glossário --http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html
BLAST -- http://www.ncbi.nlm.nih.gov/BLAST/
BLAST Overview -- http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html
BLAST Guide: Deciphering the Output
http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/Blast_output.html
5. BLAST Query Tutorial
http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/query_tutorial.html
6. NCBI Similarity Page
http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/similarity.html
7. Prosdocimi F; Cerqueira GC; Binneck E; Silva AF; Reis AN; Junqueira ACM; Santos
ACF; Nhani-Júnior A; Wust CI; Camargo-Filho F; Kessedjian JL; Petretski JH;
Camargo LP; Ferreira RGM; Lima RP; Pereira RM; Jardim S; Sampaio VS and
Folgueras-Flatschart AV. Bioinformática: manual do usuário. Biotec. Ci. Des.
29: 18-31, 2002.
3.9. Brainstorm
1
2
3
4
5
6
7
Cite duas possíveis utilidades do alinhamento de seqüências no campo da
bioinformática.
Qual a diferença entre alinhamento global e local? Cite o nome de ferramentas que
fazer um ou outro alinhamento. Você é capaz de perceber as diferenças entre os
resultados do alinhamento de duas seqüências idênticas através de diferentes
ferramentas de alinhamento? Explique as diferenças nos resultados mostrados nos
itens 4.7. a) e b)
É possível realizar alinhamentos utilizando uma seqüência de DNA e outra de
proteína? Como você acha que isso poderia ser feito? O BLAST implementa esse
tipo de ferramenta? Qual o(s) programa(s) do BLAST fazem isso?
Qual a diferença entre alinhamentos simples e múltiplos? Quais são as ferramentas
de alinhamento (ótimo ou heurístico) mais indicadas para trabalhar com cada um
desses tipos de alinhamento? Por quê?
Cite as principais aplicações das ferramentas que utilizam heurística para produzir
um alinhamento de seqüências.
Entre no site do NCBI, Nucleotide e obtenha as seqüências de número de acesso
AF117710 e AF181832 (da mesma forma que na aula anterior). Acesse o site do
programa BLAST2Sequences (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.
cgi). Copie a sequencia do primeiro gene na região apropriada, assim como a
sequencia do segundo gene e clique em Align. Classifique o tipo de alinhamento
realizado em todos os aspectos que conseguir? Quais foram as posições que
mostraram diferenças entre as duas seqüências? Houve diferenças na região que
codifica a proteína?
O que são as matrizes de substituição e qual a relevância delas no alinhamento de
seqüências?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
29
CAPÍTULO 4
Montando um genoma
“Seqüenciar o DNA é agora uma das tarefas mais fáceis de realizar, além de servir
hambúrgueres.” Karry Mullis, prêmio Nobel
Iniciando nossa Interação
Nos dias de hoje, a arte de seqüenciar um DNA e até mesmo de montar um
genoma de uma bactéria são tarefas relativamente técnicas. É claro, análise deste
genoma e o entendimento da relação do genoma com as características e a forma
como um organismo vive são tarefas altamente complexas e que exigem um grande
esforço cientifico a ser realizado pelos maiores especialistas em todo o mundo.
4.1.
Sobre genomas eucarióticos e procarióticos
Nos dias de hoje, a arte de seqüenciar um DNA e até mesmo de montar um
genoma de uma bactéria são tarefas relativamente técnicas. É claro, análise deste
genoma e o entendimento da relação do genoma com as características e a forma
como um organismo vive são tarefas altamente complexas e que exigem um grande
esforço cientifico a ser realizado pelos maiores especialistas em todo o mundo.
A montagem de genomas de organismos procariotos (bactérias e
arqueobactérias) consiste num trabalho muito mais simples do que a montagem de
genomas de organismos eucarióticos (protozoários, fungos, plantas e animais). E isso
se deve a várias características freqüentemente comuns aos genomas bacterianos.
Estes são comumente pequenos -- apresentado apenas alguns milhões de pares de
bases --, circulares e contém uma baixa taxa de seqüências repetitivas. Já os genomas
de organismos eucarióticos são grades, normalmente na ordem de bilhões de pares de
bases, apresentam disposição do genoma em diversos cromossomos, que devem ser
montados separadamente e, ainda, apresentam uma grande quantidade de seqüências
repetitivas. Se considerássemos o genoma como um quebra cabeça, os genomas
bacterianos teriam apenas poucas peças e todas seriam facilmente encaixáveis. De
forma contrária, os genomas eucarióticos poderiam ser considerados um conjunto de
diversos quebra-cabeças (representando diferentes cromossomos) com centenas ou
milhares de peças, com todas elas embaralhadas entre os quebra-cabeças e onde
determinadas peças parecessem muito com outras, tanto dentro de um mesmo
quebra-cabeça quanto entre quebra-cabeças diferentes, dificultando de forma drástica
a montagem. Por isso, os genomas eucarióticos são montados aos poucos, sendo que
primeiramente são identificadas as partes mais fáceis, não repetitivas, e assim é
montado um chamado scaffold, ou esqueleto, do genoma. Assim, os genomas
eucarióticos normalmente são montados por equipes bem maiores e mais bem
equipadas de cientistas, apresentando ainda uma plataforma de bioinformática mais
complexa e organizada.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
30
Dessa forma, são utilizadas diferentes técnicas de seqüenciamento para se
obter seqüências de um genoma eucarioto ou procarioto. Em bactérias, normalmente
todo o DNA é quebrado em pedacinhos minúsculos em uma técnica conhecida como
shotgun ou whole genome shotgun. Esses pequenos pedacinhos de genoma (contendo
aproximadamente 2.000 pares de bases) são ligados em vetores de clonagem
bacterianos, os plasmídeos. Assim, cada plasmídeo é seqüenciado uma vez a partir de
cada uma de suas extremidades (direita e esquerda) e as seqüências de DNA
produzidas são posteriormente concatenadas para que o genoma seja montado por
inteiro.
Já no caso dos grandes genomas de organismos eucarióticos, os fragmentos
genômicos são primeiro divididos em grandes vetores de clonagem como BACs
(Bacterial Artifical Chromosome ou, em português, cromossomo artificial de bactéria)
ou YACs (Yeast Artificial Chromosome ou cromossomo artificial de levedura), que
podem abrigar seqüências de DNA de centenas de milhares de bases. No chamado
shotgun hierárquico, essas seqüências presentes nos BACs ou YACs é que são alvo
do chamado shotgun onde, agora sim, essas seqüências são quebradas em outras
contendo aproximadamente 2.000 pares de bases e ligadas em plasmídeos bacterianos
cujas extremidades serão seqüenciadas. Dessa forma, os BACs e YACs são montados
separadamente e, posteriormente, é realizada a montagem do genoma através da
sobreposição das seqüências destes grandes vetores.
Figura 4.1. a) Na estratégia de shotgun, todo o DNA genômico de um organismo é
fragmentado em pequenos pedaços (1), que são clonados em vetores de pequeno
porte, como plasmídeos, para o posterior seqüenciamento. b) Na estratégia de shotgun
hierárquico, normalmente utilizada para grandes genomas, realizam-se dois passos.
(1) Primeiramente fragmenta-se o genoma em grandes pedaços, que são clonados em
vetores de grande porte, como BACs ou YACs. (2) Posteriormente realiza-se uma
segunda etapa de shotgun, onde as seqüências contidas nesses vetores são
fragmentadas em pequenos pedaços e clonadas em vetores de pequeno porte, que
serão seqüenciados. Retirado de Prosdocimi et al., 2003.
4.2.
Base-calling
Uma frase clássica do meu co-orientador de doutorado, o Prof. Miguel Ortega, é
que um mito da genômica é o de que os seqüenciadores de DNA é que seriam
responsáveis por gerar a seqüência de bases da molécula desejada. Conforme vimos
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
31
na animação apresentada na segunda aula, o seqüenciador apenas é responsável pela
leitura das moléculas marcadas com cada um dos fluoróforos durante a eletroforese.
Na verdade, é necessário um programa de computador para pegar esses dados sobre
qual fluoróforo passou a cada instante e transformar esse dado num conjunto de letras
que represente a seqüência de bases do DNA. E um programa que faça isso é
conhecido como um nomeador de bases ou base-caller. Além de gerar a seqüência de
bases que representa a molécula de DNA seqüenciada, o base-caller produz também
um valor de qualidade associado a cada uma das bases. Assim, é possível saber quais
foram as regiões seqüenciadas com maior ou menor qualidade. O algoritmo mais
conhecido e utilizado para realizar a nomeação das bases (ou base-calling) é o PHRED.
O PHRED utiliza um algoritmo baseado na análise de Fourier para reconhecer os dados
brutos gerados pelo seqüenciador e produzir tanto a seqüência de bases quanto a
qualidade de cada uma delas. A qualidade das bases é dada com relação à
probabilidade logarítmica da base estar incorreta e a fórmula utilizada pelo PHRED
para chegar a esta qualidade é dada pela seguinte fórmula:
QUALIDADE PHRED = -10 * log10 (Probabilidade de Erro)
Assim, com os dados brutos do seqüenciador, o PHRED atribui a cada base uma
chance desta estar incorreta e, utilizando a fórmula acima, associa um valor de
qualidade à cada uma delas. Um valor de qualidade de PHRED (ou simplesmente valor
de PHRED, valor de qualidade ou qualidade da base) igual a 10, representa que aquela
base tem uma chance em dez de estar incorreta (10%). Como o valor está em escala
logarítmica, um valor de PHRED 20, significa que aquela base tem uma chance em cem
de estar incorreta (1%) e um valor de 30 representa uma chance em mil (0,1%).
Freqüentemente, aceita-se que um valor de PHRED igual a 20 é suficiente para
aceitar uma base como real ou utiliza-se para aceitar uma região de boa qualidade.
Entretanto, trabalhos recentes têm mostrado que podemos confiar em valores
relativamente mais baixos (Prosdocimi et al., 2004).
Exemplos de arquivos produzidos pelos programas de base-calling: (a) Arquivo de
seqüência no formato FASTA e (b) arquivo .QUAL apresentando a qualidade das bases.
a)
> Seq1
ATCTCGAATTCTCTAACAGAACACGTAATATCAGCACCATCTCGAATCTC
TAACAGAACACGTAATATCAGCACCATCTCGAATTCTCTAACAGAATTCC
b)
> Qual1
10 12 15 15 15 18 20 22 25 18 13 8 5 5 8 10 7 12 18
25 30 30 22 13 12 12 12 11 9 9 10 15 20 20 22 6 6 5
4.3.
Cross-match
Como foi dito no primeiro item desta aula, as seqüências de DNA geradas em
projetos genoma são primeiramente clonadas em moléculas de DNA plasmidial. Dessa
forma, algumas vezes pedaços de seqüências dessa molécula bacteriana acabam
sendo produzidas em conjunto com as moléculas do DNA que se deseja produzir.
Como as moléculas dos vetores de clonagem não representam o genoma que se
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
32
deseja montar, é preciso mascará-las antes de se realizar a montagem do genoma. E,
para isso, utiliza-se um software conhecido como Cross-match. O cross-match é
basicamente um algoritmo que realiza um alinhamento local entre duas seqüências de
nucleotídeos quaisquer e permite a formatação do resultado de diversas maneiras
diferentes.
Normalmente, executa-se o cross-match utilizando dois arquivos de entrada e a
opção –screen. O primeiro arquivo deve apresentar as seqüências geradas no projeto
que se deseja retirar as partes relacionadas às seqüências bacterianas e o segundo
arquivo deve conter uma ou mais seqüências de vetores de clonagem (como
plasmídeos) que se deseja procurar no primeiro arquivo. Basicamente, o cross-match
realiza o alinhamento entre todas as seqüências do primeiro e do segundo arquivo
utilizando o algoritmo SWAT (veja aula 4). Ele apresenta ainda um valor limite para
considerar o alinhamento entre as seqüências como válido. Se o alinhamento entre
uma seqüência do primeiro arquivo e uma outra do segundo arquivo for válido, o
programa mascara a região do primeiro arquivo onde ela foi similar com a do segundo,
colocando letras Xs no local. Isso evita que essas regiões sejam utilizadas para o
agrupamento das seqüências, como será mostrado a seguir.
Exemplo de seqüência que apresentava região inicial contendo partes de vetor de
clonagem. Uma seqüência desse tipo pode ser encontrada no arquivo –screen, obtido
como resultado do algoritmo cross-match:
> Seq1.screen
XXXXXXXXXXXXXXXXXXXXXXXXXXAATATCAGCACCATCTCGAATCTC
TAACAGAACACGTAATATCAGCACCATCTCGAATTCTCTAACAGAATTCC
4.4.
Agrupamento de seqüências
O agrupamento de seqüências (ou sequence assembly) é o procedimento que
gera, realmente, os contigs genômicos e permite a montagem do genoma per si. A
montagem do genoma é importante porque ainda não existe nenhuma técnica que
permita o seqüenciamento de moléculas de DNA de mais de mil pares de bases. Em
uma corrida normal de seqüenciamento, gerada em um seqüenciador em larga escala,
é comum que sejam produzidas cerca de 600 bases da seqüência de DNA desejada.
Com sorte é possível produzir até mil bases da seqüência, mas um seqüenciamento
tão bom não é muito comum. E como as moléculas de DNA genômicas freqüentemente
apresentam milhares ou milhões de pares de bases, é preciso montar os fragmentos,
de seiscentos em seiscentos, até que seja possível gerar toda a seqüência do genoma.
Portanto podemos fazer uma analogia da montagem de genoma como se o
mesmo se constituísse num livro de mil páginas cujas palavras e a ordem delas seja
completamente desconhecida. O que os cientistas fazem é pegar uma grande
quantidade de livros idênticos, digamos trinta deles e picotarem todos os livros em
trechos contendo uma quantidade fixa de palavras -- duas mil, por exemplo -- num
processo de shotgun de palavras. Guarde os números e não se perca. Essas palavras
acabam tendo que ser inseridas num outro livro -- o plasmídeo --, esse já montado e
de frases conhecidas. Então acontece a leitura de seiscentas palavras por vez desse
livro-plasmídeo. E são lidas milhares de seqüências de seiscentas palavras inseridas
em livros-plasmídeos diferentes. Primeiramente, então, é necessário observar essas
palavras lidas dos livros-plasmídeos ligados a uma parte do livro genômico e retirar as
frases que sabemos serem do plasmídeo apenas, e não do livro que estamos tentando
montar. O cross-match é o programa que faz isso. Ele compara as seqüências lidas
com a seqüência do livro-plasmídeo e, onde ele encontrar frases do livro plasmídeo,
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
33
ele troca-as por letras X. Então, depois do cross-match, teremos vários conjuntos de
aproximadamente seiscentas palavras que sabemos ser de nosso livro genômico.
Agora é preciso montá-lo. Para isso teremos que ir lendo todas os conjuntos de frases
e observando onde as frases se sobrepõem para podermos juntá-las e gerar, por
exemplo, um capítulo do livro (que poderia ser uma analogia à montagem de um BAC
ou de um cromossomo inteiro). Veja o exemplo:
A seguir temos uma Fábula Fabulosa do escritor Millôr Fernandes que foi, assim como
um genoma, dividida em partes. Monte as partes e produza a seqüência completa da
fábula.
> Frase 1
sabedoria e calor que fazem os seres humanos - "mas eu não". MORAL DA HISTÓRIA:
NÃO MORRE A PASSARADA QUANDO MORRE UM PÁSSARO.
> Frase 2
ela não pôde resistir e exclamou: "Mas, como, seu marido não morreu há cinco anos?"
"Sim, é verdade" - respondeu então a outra, cheia daquela compreensão, sabedoria e
> Frase 3
Quando a amiga lhe apresentou o garotinho lindo dizendo que era seu filho mais novo,
ela não pôde resistir e exclamou: "Mas, como, seu marido não morreu há cinco anos?"
> Frase 4
não morreu há cinco anos?" "Sim, é verdade" - respondeu então a outra, cheia daquela
compreensão, sabedoria e calor que fazem os seres humanos - "mas eu não".
O genoma é montado da mesma maneira que você realizou para montar essa
fábula do Millôr chamada “A viúva”. (Para ler mais fábulas do escritor, acesse
http://www.millor.com.br.) Várias seqüências representando pedaços de genoma são
gerados e observa-se a posição onde elas se sobrepõem. Realizando a sobreposição de
vários trechos de seqüência é possível montar todo o genoma. Entretanto, como já foi
dito, um genoma apresenta milhões ou bilhões de seqüências de nucleotídeos e,
portanto, não é possível realizar esta montagem à mão. Para isso existem algoritmos
de montagem de genoma, como o PHRAP, o CAP e o TIGR Assembler. O PHRAP é o
algoritmo mais utilizado e funciona mais ou menos da forma mostrada na figura 5.2.
Figura 4.2. O agrupamento de seqüências é baseado no alinhamento e no escore do
alinhamento de seqüências.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
34
A figura 4.2 é idêntica à figura 3.2, mostrada no capítulo anterior. A diferença é
basicamente o contexto com o qual ela é mostrada agora. A figura mostra o
alinhamento entre duas seqüências de DNA e mostra os escores dados para o
alinhamento das seqüências. O escore total desse alinhamento é igual a três, mostrado
em alaranjado. E é exatamente baseando-se nesse escore que funciona um programa
de montagem de genoma, como o PHRAP. O PHRAP apresenta um parâmetro muito
importante chamado de minscore, que representa o valor mínimo do escore do
alinhamento que ele utiliza para dizer que duas seqüências são parecidas o suficiente e
que podem ser reunidas para gerar uma seqüência maior. Se o alinhamento entre
duas seqüências apresenta um escore menor do que o minscore, as seqüências não
são agrupadas e considera-se que representam partes distintas de um mesmo
genoma. Já se o alinhamento entre duas seqüências apresenta um escore maior do
que o minscore, o PHRAP considera que as seqüências estão na mesma posição e
produz a chamada seqüência consenso, que consiste na concatenação das duas
seqüências entre si, da mesma forma que você fez com a fábula do Millôr.
4.5.
Sobre a cobertura dos genomas
Algo que é interessante de ser notado é a cobertura necessária de
seqüenciamento para se produzir um genoma. Em nossa analogia do livro, pegamos
trinta livros e picotamos todos eles em partes sendo que, posteriormente, lemos várias
partes deles para tentarmos montar um livro inteiro novamente. Se nosso livro
tivesse, por exemplo, seis mil palavras e nossas partes picotadas tivessem pouco mais
de seiscentas palavras cada, teoricamente precisaríamos apenas de cerca de dez
partes para montar um livro inteiro, certo? Errado! Como as dez partes são pegas
aleatoriamente, é de se esperar que haja uma certa redundância nas frases obtidas.
Em nosso exemplo da fábula do Millôr, podemos ver que a frase 2 é totalmente
redundante e que conseguiríamos montar toda a fábula mesmo sem ela. Entretanto,
qualquer outra combinação de três frases (exceto pelas frases 1, 3 e 4), impediria que
a montagem da fábula fosse feita de forma completa, ainda que o número de palavras
somadas entre as três frases produza um número maior do que o da fábula completa.
Voltando à análise de genomas, isso significa que certas vezes damos o “azar
estatístico” de não conseguirmos obter toda a seqüência do genoma e, assim, temos
que seqüenciar mais moléculas para conseguirmos fechar nosso genoma. E,
considerando o grande tamanho dos genomas, normalmente considera-se necessário
produzir um número de bases que seja de 8 a 10 vezes maior do que a seqüência
completa do genoma inteiro para que seja possível montar esse genoma
completamente! E, ainda assim, muitas vezes é preciso utilizar outras técnicas mais
complexas para que o genoma seja efetivamente terminado. E isso se deve ao fato de
que algumas regiões do DNA parecem apresentar uma maior dificuldade de serem
cortadas em partes ou clonadas nos vetores bacterianos (plasmídeos). Assim, a parte
mais complexa de toda a montagem do genoma consiste no fechamento da seqüência
completa do mesmo. E, depois de completo, cada uma de suas partes deve ser
identificada, no processo de anotação genômica, que será tema do capítulo 7.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
35
4.6.
Referências Bibliográficas
1. PHRED, PHRAP, CONSED -- http://www.phrap.org
2. Ewing B, Hillier L, Wendl MC, Green P. Base-calling of automated sequencer traces
using phred. I. Accuracy assessment. Genome Res. 1998 Mar;8(3):175-85.
3. Ewing B, Green P. Base-calling of automated sequencer traces using phred. II.
Error probabilities. Genome Res. 1998 Mar;8(3):186-94.
4. CAP3 - http://genome.cs.mtu.edu/cap/cap3.html
5. Prosdocimi F; Cerqueira GC; Binneck E; Silva AF; Reis AN; Junqueira ACM; Santos
ACF; Nhani-Júnior A; Wust CI; Camargo-Filho F; Kessedjian JL; Petretski JH;
Camargo LP; Ferreira RGM; Lima RP; Pereira RM; Jardim S; Sampaio VS and
Folgueras-Flatschart AV. Bioinformática: manual do usuário. Biotec. Ci. Des.
29: 18-31, 2002.
4.7.
Brainstorm
1. Por que quando sequenciamos o genoma de um organismo temos que levar em
consideração se ele é eucarioto ou procarioto? Quais são as diferentes estratégias
de sequenciamento desses genomas?
2. Qual a importância dos algoritmos de base calling? Se uma determinada base tem
um valor de qualidade igual a 40, qual a chance dela estar incorreta?
3. Por que o software cross-match é importante na montagem de genomas?
4. Qual o principal parâmetro utilizado pelo programa PHRAP para realizar o
agrupamento das seqüências de DNA? Como ele funciona?
5. Apresente a fábula do Millôr totalmente montada.
6. Digamos que o valor de minscore do nosso programa fosse igual a 2 e apresente
uma das possíveis seqüências consensos que seria gerada a partir da concatenação
das duas seqüências da figura 4.2. O que você faria para escolher qual base estaria
no consenso no caso de gaps e mismatches?
7. Por que não é suficiente seqüenciar apenas seis mil bases para montar um genoma
deste tamanho (seis mil bases)?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
36
CAPÍTULO 5
Análise de Transcriptomas
5.1.
As ESTs
As ESTs (Expressed Sequence Tags, ou Etiquetas de Seqüências Expressas)
correspondem a pedaços de genes expressos, derivados dos RNAs mensageiros, que
são utilizados na análise de transcriptomas de organismos. São chamadas etiquetas
porque correspondem apenas a pedaços dos genes que um organismo expressa em
uma determinada situação. Essas etiquetas, entretanto, permitem que saibamos quais
genes estão sendo produzidos por uma célula numa determinada condição e permitem
também que estudos comparativos possam ser feitos. Um estudo clássico feito com
ESTs está relacionado a células tumorais, onde se compara os genes expressos em
uma célula normal e em uma célula cancerosa e, dessa forma, pode-se tentar
compreender como o processo tumoral leva à expressão diferenciada de genes.
Figura 5.1. Produção de ESTs e ORESTES. As etiquetas de seqüências expressas
(ESTs) são obtidas através, primeiramente, da transcrição reversa de um conjunto de
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
37
mRNAs expressos numa célula, produzindo as fitas de DNA complementar (cDNA).
Após esse procedimento, utiliza-se uma RNAse H para digerir as seqüências de RNA
inicial e é produzida a segunda fita de DNA, gerando a molécula de cDNA fita dupla.
Essa molécula é normalmente ligada em vetores de clonagem (como plasmídeos) e são
utilizados iniciadores para o seqüenciamento das extremidades 5’ ou 3’ do cDNA em
apenas uma “rodada” de seqüenciamento. As seqüências obtidas são as chamadas
ESTs. A técnica de ORESTES é uma alternativa à produção de ESTs onde, ao contrário
destas, pega-se preferencialmente a parte central das seqüências gênicas.
5.2. Histórico das ESTs
O seguinte trecho foi adaptado do livro “Desvendando o Genoma” da editora
Companhia das Letras, escrito por Kevin Davies (2001, capítulo 3) e apresenta um
interessante histórico de como foram redescobertas as seqüências de ESTs e como isso
gerou um grande impacto na ciência da época.
Em junho de 1991, o pesquisador J. Craig Venter e colaboradores apresentou
um artigo na revista americana Science que revolucionaria as estratégias de
sequenciamento de transcriptomas em todo o mundo. O artigo era intitulado
“Sequenciamento de DNA Complementar: Etiquetas de Seqüências Expressas e o
Projeto Genoma Humano” e identificava a seqüência de mais de 300 novos genes
humanos ativos no cérebro, obtidos aleatoriamente a partir de cerca de 600 clones de
cDNA. De todas as seqüências produzidas, Venter havia conseguido identificar tanto
genes humanos já conhecidos quanto genes novos e outros que apresentavam
similaridades com genes identificados de outros organismos; um deles, por exemplo,
apresentou uma identidade significativa com o gene NOTCH, uma importante molécula
de sinalização intracelular conhecida na mosca-das-frutas. E essa alta similaridade
entre genes presentes em espécies separadas há milhões de anos indicava que
possivelmente eles apresentavam funções importantes no metabolismo celular, como
foi posteriormente comprovado através de estudos experimentais.
O impacto causado na comunidade científica por este artigo que publicava o
primeiro estudo de genoma em “larga-escala” foi maior do que a soma de suas partes
– através da analse de cada um dos genes identificados. O sequenciamento dessas
etiquetas, as ESTs, consistia em algo redundante e tecnicamente sujo, devido a
presença de vários erros nas seqüências. Apesar disso, em uma única publicação,
Venter havia identificado mais de 10% dos genes que toda a comunidade produzira em
quase duas décadas, sendo que o GenBank, à época, possuía menos de 3 mil
seqüências de genes humanos. Um novo tipo de diálogo científico, que viria a se tornar
comum na era da genômica, anos mais tarde, era inaugurado por aquele artigo
revolucionário. Venter havia conseguido bolar uma técnica que possibilitava a produção
de centenas de seqüências de cDNAs de uma forma rápida e inteligente e previa que,
com esta abordagem, conseguiria sequenciar a maioria dos cDNAs humanos em alguns
anos. Além disso, previa também que em breve alguns “melhoramentos nas
tecnologias de sequenciamento do DNA tornariam exeqüível o exame essencialmente
completo do conjunto de genes expressos de um organismo”.
E essas novidades abalavam as opiniões dos principais responsáveis naquele
momento pelo sequenciamento do genoma humano, algo que questiona suas
autoridades. O principal argumento destes, no entanto, era o de que a abordagem de
sequenciamento de ESTs não considerava as informações do DNA que não eram
transcritas em RNA. Assim o ganhador do prêmio Nobel e co-descobrir da estrutura do
DNA, James Watson, à época diretor do Projeto Genoma do NIH, sustentava
corretamente que a técnica popularizada por Venter não substituía a análise genômica,
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
38
no que este concordava e argumentava que o sequenciamento de ESTs deveria não
substituir mas complementar as análises de genoma.
Oito meses depois, Venter publicava um artigo na Nature descrevendo as
seqüências parciais de cDNA de mais 2375 genes expressos no cérebro, mostrando
que seu grupo de trabalho era capaz de gerar, sozinho, um volume monstruoso de
dados de seqüências de ESTs. Em menos de um ano o laboratório de Venter tinha sido
capaz de sequenciar duas vezes o total de genes já conhecidos até então. Além disso,
seu laboratório continuava gerando cada vez mais seqüências, ininterruptamente.
Críticas surgiam sobre as contaminações de algumas seqüências e sobre os erros que
estas apresentavam, mas nada que derrubasse o status que Venter já havia alcançado.
E, ainda que este pesquisador já tivesse concordado do fato de que o sequenciamento
de ESTs não era alternativa para o projeto genoma, o editor da Nature John Maddox
ainda ressaltava no editorial da mesma revista onde fora publicado o segundo artigo
de Venter: “Na esteira da saída de James Watson do Projeto Genoma Humano dos
Estados Unidos, existe o perigo de que a abordagem de cDNA seja apresentada como
uma alternativa mais barata para completar o sequenciamento [do genoma], o que ela
não é”.
5.3.
Agrupamento de ESTs
Como as ESTs representam o genoma expresso em uma célula num
determinado momento, é comum haver redundância gênica quando do
sequenciamento dessa moléculas. E isso se deve ao fato de que uma célula pode
precisar muito da presença de algum gene num determinado momento e, nesse caso,
ela irá produzir uma grande quantidade de moléculas de mRNA do gene em questão.
Entretanto, quando o pesquisador quer analisar seu transcriptoma, ele deve identificar
os genes expressos e, para ele, é melhor identificar os genes apenas uma vez. Para
isso é feito o agrupamento ou clustering de ESTs. Da mesma forma como é feita a
montagem de genoma, aqui também se utiliza o PHRAP para montar cada um dos
genes seqüenciados. Dessa vez, entretanto, não se espera que sejam formadas
moléculas muito grandes, os genes geralmente apresentam algo em torno de dois mil
pares de bases. E os genes normalmente não apresentam regiões de sobreposição com
outros genes, de forma que cada um dos genes aqui é montado separadamente.
Na análise de clustering ou agrupamento de ESTs, as seqüências dessas
moléculas do organismo em questão são utilizadas como entrada em um programa.
Este deve comparar essas seqüências entre si, de forma a encontrar quais delas são
idênticas ou contêm regiões parecidas o suficiente para que sejam reunidas em uma
só, assim como na análise genômica. Assim, o programa apresenta uma saída
contendo as seqüências que foram agrupadas – chamadas de consensos ou contigs
– e as seqüências que não foram reunidas (por não apresentarem similaridade
suficiente com nenhuma outra) – chamadas de singlets. Cada uma das seqüências
resultantes do agrupamento (seja ela uma singlet ou um contig) é chamada de unique
(figura 5.2), que consiste no conjunto não redundante de moléculas. Considerando
uma análise ideal, cada uma das seqüências unique deve representar um gene
distinto. Entretanto, na prática, a presença de famílias gênicas (apresentando regiões
de similaridade dentro dos genes) e de genes duplicados dificulta a obtenção desse
resultado ideal e, muitas vezes, a seqüência unique pode representar mais de um
gene. Em outras ocasiões, um mesmo gene pode estar representado por mais de um
unique, sendo que um dos uniques pode corresponder, por exemplo, à extremidade 5’
de um determinado gene e outro à extremidade 3’ do mesmo.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
39
Figura 5.2. Agrupamento de seqüências de ESTs. O agrupamento das seqüências
produz as seqüências não-redundantes, chamadas de uniques. As uniques são o
conjunto das seqüências consenso mais as seqüências singlets.
O agrupamento das seqüências é importante devido, principalmente, aos
seguintes fatores: (1) elimina a redundância das seqüências, (2) aumenta o tamanho
das seqüências facilitando a anotação por homologia (Oliveira & Johnston 2001), (3)
aumenta o nível de confiabilidade de cada seqüência (Miller et al., 1999). Diferentes
abordagens têm sido utilizadas para o agrupamento de seqüências de ESTs. O Unigene
do NCBI utiliza comparações de seqüências em vários níveis de rigor para agrupar as
seqüências em consensos (http://www.ncbi.nlm.nih.gov/UniGene/build.html) (Schuler
1997). No TIGR, os índices gênicos são formados utilizando um software desenvolvido
por eles mesmos, o TIGR Assembler, ou o CAP3 (Liang et al., 2000). Já no projeto
genoma humano (HPG) as seqüências são agrupadas utilizando-se o software PHRAP
(International Human Genome Sequencing Consortium 2001).
5.4.
O genoma e o transcriptoma
No final da seção 5.2, vimos que editor da revista Nature, Sir Maddox, dizia que
existia “o perigo de que a abordagem de cDNA seja apresentada como uma alternativa
mais barata para completar o sequenciamento [do genoma], o que ela não é”. Vale a
pena, portanto, neste momento, discutirmos as diferenças entre as análises de
genomas e de transcriptomas. Vale notar primeiramente que nenhuma das duas
análises exclui a outra e são estudos que, apesar de relacionados, provém respostas
para perguntas diferentes. A molécula de DNA é estática e está presente, com a
mesma constituição, em todas as células do organismo. A decifração desse conteúdo
estático de DNA é a tarefa da genômica. Já o conteúdo de RNA de uma determinada
célula depende do tempo e das condições à qual ela está sendo submetida. O
transcriptoma mede a parte do genoma que está sendo utilizada num determinado
momento. E essa parte do genoma expresso é diferente para cada tipo celular.
Existem genes que são expressos apenas na pele, outros no cérebro e alguns nos
testículos. Alguns genes são ainda mais expressos quando a célula está submetida a
um choque térmico, à restrição calórica ou à falta de oxigênio. Enquanto o genoma é
apenas um, existem vários transcriptomas possíveis para uma mesma espécie.
Algumas perguntas, entretanto, só podem ser obtidas quando se observa o
genoma expresso, enquanto outras, apenas quando se observa o genoma estático. Por
exemplo, por mais que se obtenha seqüências de ESTs de vários diferentes tecidos de
um organismo, nunca é possível dizer que ele não apresenta um determinado gene
através de análises transcriptômicas. De forma contrária, quando se obtém toda a
seqüência de genoma do organismo é possível saber todo o repertório de genes que
ele possui para realizar alguma tarefa metabólica. Ao mesmo tempo, através da
análise genômica é impossível saber, por exemplo, qual o repertório gênico que é
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
40
super-expresso numa determinada condição como, por exemplo, quando a célula se
torna cancerígena.
Dessa forma, as análises de genoma e transcriptoma são complementares e
ambas são importantes para responder perguntas específicas. Existem, entretanto,
outras formas de análise do transcriptoma que não sejam através de seqüências de
ESTs, como o SAGE e a análise dos microarranjos de DNA (ou microarrays, os chips de
DNA).
5.5.
SAGE – Serial Analysis of Gene Expression
Enquanto uma EST tem aproximadamente cerca de 600 pares de bases,
permitindo uma identificação quase inequívoca do gene expresso, outras técnicas,
como o SAGE, permitem uma identificação mais exaustiva porém menos precisa do
gene que se deseja obter. Na técnica de SAGE são concatenados fragmentos de
quatorze pares de bases de diversos mRNAs diferentes, formando uma longa molécula
híbrida contendo vários pedaços de diferentes mRNAs. Assim, uma molécula de cerca
de 600 pares de bases é lida no seqüenciador, apresentando uma seqüência
ininterrupta das chamadas “SAGE tags”, cada uma contendo quatorze pares de bases.
Dessa forma, uma única seqüência de SAGE apresenta informação sobre diversos
mRNAs diferentes que podem estar expressos em uma certa célula. Um problema,
entretanto, da técnica, é que muitos genes apresentam fragmentos internos comuns e,
muitas vezes, fica difícil saber ao certo qual gene foi expresso quando se observa uma
etiqueta de SAGE muito comum em diferentes genes. Voltando á analogia do livro,
agora seria como se você quisesse descobrir qual página do livro que seu colega está
lendo, mas ele te dá apenas três palavras consecutivas para que você encontre a
página. É claro que, dependendo do livro, aquela combinação de três palavras vai estar
presente em apenas uma página. Mas pode haver livros onde essa combinação possa
estar presente em dez páginas diferentes. E, dessa forma, fica difícil identificar
precisamente a partir de qual página (ou gene) vieram aquelas palavras (ou a
seqüência de quatorze nucleotídeos).
Apesar disso, a técnica é bastante utilizada e é útil em vários casos. A grande
vantagem da utilização da técnica de SAGE é que ela permite amostrar uma grande
quantidade de genes, cerca de quarenta para cada seqüência produzida, e apresenta
uma contabilidade eficiente de quantas SAGE tags de um determinado gene foram
vistas para cada milhão de etiquetas, permitindo uma análise numérica da expressão
gênica diferencial em cada tecido humano.
5.6. Microarrays
A técnica de microarray é outra das técnicas de análise de transcriptomas e
consiste em na hibridação de ácidos nucléicos, servindo para medir a expressão
absoluta ou diferencial de genes submetidos a condições diferentes. Primeiramente
deve-se montar a lâmina que vai conter os genes que se deseja estudar. Nessa lâmina
são ligados fragmentos de cDNA ou são construídas pequenas seqüências de
oligonucleotídeos que ficam ligadas à lâmina. Posteriormente, duas células são
tratadas em diferentes condições onde o caso mais comum baseia-se no estudo de
células normais contra células tumorais. Assim, os RNAs de cada uma dessas células
são marcados com uma determinada fluorescência e colocados para hibridar contra os
cDNAs ou oligonucleotídeos presentes no chip (ou lâmina) de DNA. Através da
complementaridade de bases, as moléculas de um ou outro tecido vão se ligando às
moléculas do chip e, posteriormente, utiliza-se um laser para realizar a leitura das
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
41
fluorescências das moléculas que hibridaram no chip. Assim, conseguimos observar,
para cada um dos genes do array, quanto eles se ligaram em seqüências da célula do
primeiro tratamento, digamos normal, ou do segundo tratamento, digamos tumoral. A
vantagem da técnica é que ela permite a análise de milhares de genes ao mesmo
tempo, sendo que o chip é montado por um robô capaz de ligar os cDNAs em posições
bem próximas. Entretanto, essa é uma técnica que apresenta uma grande quantidade
de ruído e análises computacionais e estatísticas complexas devem ser realizadas para
se gerar um resultado satisfatório.
5.7. Referências Bibliográficas
1. Davies, K. (2001). Decifrando o genoma. Companhia das letras.
2. PHRAP -- http://www.phrap.org
3. CAP3 - http://genome.cs.mtu.edu/cap/cap3.html
4. Prosdocimi F; Cerqueira GC; Binneck E; Silva AF; Reis AN; Junqueira ACM; Santos
ACF; Nhani-Júnior A; Wust CI; Camargo-Filho F; Kessedjian JL; Petretski JH; Camargo
LP; Ferreira RGM; Lima RP; Pereira RM; Jardim S; Sampaio VS and FolguerasFlatschart AV. Bioinformática: manual do usuário. Biotec. Ci. Des. 29: 18-31,
2002.
5.8. Brainstorm
1. Defina o que é uma seqüência de EST.
2. Por que o trabalho de Venter, em 1991, causou tanto impacto na comunidade
científca?
3. Quais são os motivos pelos quais se realiza o sequenciamento de ESTs?
4. O que são singlets, contigs e uniques?
5. Proponha um experimento no qual a resposta seja produzida em um projeto
genoma e outro experimento cuja resposta só possa ser gerada através de uma
análise de transcriptomas.
6. Em que consiste a técnica de SAGE, qual as suas vantagens e desvantagens?
7. Como é realizado um experimento de microarray? Além da comparação entre
células normais e tumorais, qual outra comparação você poderia propor para ser
estudada em um experimento como esse?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
42
CAPÍTULO 6
Bancos de dados em Biologia Molecular
Neste capítulo vamos tratar das bases de dados em biologia molecular. As bases de
dados em biologia molecular são importantes principalmente para proporcionar à
comunidade científica uma forma de tornar os dados (produzidos em todo o mundo)
acessíveis
de
forma
fácil,
rápida
e
inteligente
(http://www.ncbi.nlm.nih.gov/About/primer/bioinformatics.html).
6.1. Histórico
As bases de dados em biologia molecular são importantes principalmente para
proporcionar à comunidade científica uma forma de tornar os dados (produzidos em
todo
o
mundo)
acessíveis
de
forma
fácil,
rápida
e
inteligente
(http://www.ncbi.nlm.nih.gov/About/primer/bioinformatics.html). A primeira base de
dados de biologia molecular parece ter surgido por volta de 1960, quando Dayhoff e
colaboradores construíram um catálogo contendo todas as seqüências de proteínas
conhecidas até a data. Essas seqüências foram publicadas num livro chamado “Atlas of
Protein Sequences and Structure”, de 1965. É interessante notar que o conteúdo dessa
base de dados não deveria conter mais de 1 megabyte de informação, se transferida
para computadores modernos (Baxevanis & Ouellette 2001).
Com o advento do seqüenciamento do DNA e, principalmente, a partir da
década de 1990, do seqüenciamento em larga escala, foi necessária a construção de
bancos de dados mais robustos para abrigar a explosão no número de seqüências
obtidas pelos pesquisadores (como vimos na primeira aula). O NCBI, por exemplo, foi
criado pelo NIH (National Institutes of Health, os Institutos Nacionais de Saúde dos
Estados Unidos) em 1988 para abrigar esse tipo de informação (Wheller et al., 2002).
Dessa forma, foi criada uma colaboração internacional para montar um banco de dados
de seqüências de nucleotídeos, a INSDC (International Nucleotide Sequence Database
Colaboration). Essa instituição contém o NCBI, o EMBL (European Molecular Biology
Laboratory ou Laboratório Europeu de Biologia Molecular) e o DDBJ (DNA Data Bank of
Japan ou Banco de dados de DNA do Japão) (Tateno et al., 2002). Cada um desses
centros possibilita a submissão individual de seqüências de DNA e trocam informações
entre si diariamente, sendo que todos os três possuem informações atualizadas de
todas as seqüências disponíveis para os pesquisadores (Stoesser et al., 2002). Apesar
disso, cada centro apresenta os dados de forma particular, apesar de bastante
semelhante.
Ultimamente têm surgido uma grande quantidade de novos bancos de dados
em biologia molecular. E são tantos que uma das principais revistas da área, a inglesa
Nucleic Acids Research (http://nar.oupjournals.org/), tem reservado dois números
especiais por ano (os primeiros volumes dos meses de janeiro e julho) apresentando
apenas artigos sobre novos bancos de dados ou de atualizações de bancos já
consagrados pela comunidade. Sempre vale a pena dar uma olhada nessa revista para
descobrirmos se algum novo banco publicado pode ajudar em nossa pesquisa. E, cada
vez mais, torna-se impossível fazer pesquisa em biologia sem estar por dentro dessas
novas atualizações.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
43
6.2. Bancos primários e secundários
Existem basicamente dois tipos de bancos de dados disponíveis para utilização e
pesquisa de genes e proteínas (Baxevanis & Ouellette 2001). Os bancos de dados
primários apresentam resultados de dados experimentais que são publicados com
alguma interpretação, mas não há uma análise cuidadosa desses dados com relação
aos outros publicados anteriormente. Esse é o caso, por exemplo, do GenBank, EMBL e
PDB (Protein Data Bank). Já os secundários são aqueles onde há uma compilação e
interpretação dos dados de entrada por um ou mais grupos de cientistas, de forma que
podem ser obtidos dados mais representativos e interessantes. Esses são os bancos de
dados curados, como o COG, SWISS-PROT e o TrEMBL.
6.3. GenBank e GenPept
O GenBank e o GenPept (a variante do GenBank para seqüências de proteínas)
são os principais bancos de dados primários contendo seqüências de biomoléculas
existentes no mundo e é muito importante que entendamos o funcionamento de seus
principais números identificadores de seqüências: o GI e o AN.
O primeiro identificador de seqüência criado no NCBI foi o LOCUS, que era o
único identificador de um registro no GenBank. O nome do loco era – e ainda é –
definido como uma seqüência de 10 ou menos letras em caixa alta que apresentam um
mnemônico para a função e o organismo de origem da seqüência. Assim o nome
HUMHBB era utilizado para representar a região da β-globina humana (Baxevanis &
Ouellette 2001). Entretanto, com a descoberta de cada vez mais locos e alelos
diferentes, e com o aumento exponencial do número de seqüências no GenBank, ficou
impossível a invenção e a atualização dos nomes de forma controlada. Assim os nomes
de LOCUS, apesar de ainda aparecerem nos arquivos de formato GenBank, não têm
mais nenhuma utilidade prática.
Devido a essas dificuldades de utilização da informação armazenada em LOCUS,
o conselho internacional de colaboradores para seqüências de nucleotídeos (NCBI,
EMBL e DDBJ) introduziu o conceito de accession number (AN) ou número de acesso.
Esse número não carrega, intencionalmente, nenhuma informação biológica, de forma
a permanecer estável. Originalmente consistia de uma letra seguida por cinco
números, sendo que cada letra corresponderia ao centro (NCBI, EMBL ou DDBJ) no
qual a seqüência fora submetida (Baxevanis & Ouellette 2001). Entretanto, logo esse
número também começou a apresentar problemas, já que as seqüências eram
atualizadas contendo o mesmo AN. No arquivo GenBank há um campo chamado
accession, onde há a informação sobre o histórico de uma determinada seqüência; se
ela se juntou a outra, se foi atualizada, etc. Apesar desses problemas, o AN é o índice
mais controlado e confiável dos registros do NCBI/EMBL/DDBJ. Para melhorar a
identificação de seqüências antigas, os membros do INSDC resolveram, em 1999,
acrescentar, ao AN, o número de sua versão (Benson et al., 2002). Dessa forma podese ver o número de acesso, um ponto, e o número de atualizações feitas em uma
determinada seqüência. Por exemplo, o número de acesso A21645.3 é a terceira
atualização da seqüência A21645 e as versões mais velhas permanecem armazenas e
acessíveis através dos números de submissão A21645.1 e A21645.2. Um código
similar de AN.versão é dado também para seqüências de proteínas.
E para criar um índice ainda mais robusto para suas entradas, o NCBI, em
1992, criou um novo identificador, o GenInfo Identifier (GI), um número inteiro
simples. Esse é um identificador único para cada seqüência, independente de
atualizações ou de qualquer outra coisa que possa acontecer com uma seqüência. Toda
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
44
entrada no NCBI possui um GI único da seqüência que não é alterado de forma
alguma, permanecendo na base de dados para o acesso (Benson et al., 2002). Se uma
seqüência difere-se da outra por apenas um par de bases, as duas possuirão diferentes
GIs, apesar de possuírem, por exemplo, o mesmo AN (com diferentes números de
versão). Todos os processos internos do NCBI utilizam o número de GI para sua a
execução.
6.4. RefSeq – O banco de dados de seqüências de referência
O RefSeq é um dos bancos de dados secundários mais utilizados por
biólogos de todo o mundo. Seu objetivo é produzir um conjunto não redundante de
seqüências de DNA genômico, transcritos (cDNA) e de proteínas para diversos
organismos. A vantagem de se utilizar o RefSeq é que, ao contrário dos bancos
primários de seqüências, ele é não redundante. E isso significa que, para cada gene
conhecido de um determinado organismo, o banco possui uma única entrada – ao
contrário da infinidade de entradas para um mesmo gene dos bancos primários, como
o próprio GenBank e GenPept. Além disso, ele apresenta os dados dos genes e
proteínas associados a diversas informações úteis, como sua função, análises de
mutação, polimorfismos conhecidos, etc. Ele é produzido pelo NCBI através de
curadoria manual, ou seja, cada seqüência é analisada por pesquisadores treinados,
uma a uma, e as informações relevantes são adicionadas à entrada RefSeq do banco
de dados. O RefSeq apresenta ainda referências cruzadas com outros bancos de dados,
permitindo que outras informações adicionais sejam relacionados com uma
determinada seqüência de biomolécula. Uma das características mais interessantes do
RefSeq é ser capaz ainda de reunir vários dados divergentes em uma plataforma
consistente e apresentando um conjunto de padrões e convenções comuns. A primeira
versão do RefSeq foi montada em Junho de 2003 e apresentava mais de 785.000
seqüências de proteínas, 210.000 seqüências de RNA e 64.000 seqüências genômicas
de mais de 2005 organismos diferentes. As principais características do RefSeq são as
seguintes:
• Não redundância;
• Apresenta links diretos entre seqüências de nucleotídeos e proteínas;
• Realiza atualizações diárias com relação ao conhecimento biológico da literatura
sobre as seqüências em questão;
• Apresenta números de acesso precisos e bem definidos;
• Possui curadoria especial pelo próprio pessoal do NCBI e colaboradores.
Assim como as entradas para o GenBank, os registros do RefSeq apresentam
ainda um número de acesso, um número de versão e um GI associado. Além disso, os
números de acesso apresentam prefixos definidos para facilitar sua identificação, veja
abaixo:
Prefixo do número de
Molécula
acesso
NC
Molécula completa de genoma
NG
Regiao genômica
NM
MRNA
NP
Proteína
NR
RNA
NT*
Contig Genômico
NW*
Contig Genômico (WGS**)
XM*
MRNA
XP*
Proteína
XR*
RNA
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
45
NZ
Genoma (WGS)
ZP
Proteína gerada por entrada NZ
* Computed from genome annotation pipeline
** Whole Genome Shotgun
Tabela 6.1. Números de acesso do RefSeq e moléculas associadas (Pruitt et al.,
2003).
6.5. SWISSPROT – O maior banco de dados secundário de seqüências de
proteínas
O Swiss-Prot tem sido desenvolvido desde 1986 pelo departamento de
bioquímica médica da universidade de Gênova (agora conhecido como Swiss Intitute of
Bioinformatics) e pela Biblioteca de dados do EMBL. O Swiss-Prot é um banco de
dados secundário que consiste apenas de seqüências de proteínas e apresenta uma
padronização de nomenclatura segundo um formato próprio e conciso. Para cada
seqüência no banco de dados existem os dados da molécula protéica em questão e a
anotação biológica da mesma. A anotação biológica está relacionada ao processo de
agregar informação a uma molécula biológica e uma aula específica sobre isso será
dada posteriormente. A anotação da proteína no Swiss-Prot é bastante completa e
apresenta os seguintes itens: função da proteína, modificações pós-traducionais (como
adição de carboidrados, fosforilação, acetilação, etc), domínios conservados (como
regiões de ligação a cálcio, sítios de ligação a ATP, dedos de zinco, etc.), estrutura
secundária da proteína, estrutura quaternária (homodímero, heterodímero, etc.),
similaridades com outras proteínas, associações com doenças ou deficiências,
seqüências parecidas, variantes de splicing, etc. A idéia dos curadores é adicionar o
maior número possível de informações relativas àquela proteína no Swiss-Prot e, para
isso, os curadores se utilizam principalmente de artigos sobre as proteínas e revisões
sobre o grupo de proteínas em questão. Além disso, algumas vezes são recrutadas
pessoas com maior experiência em determinada proteína para fornecer informações
mais precisas sobre as mesmas e enviar comentários e atualizações com relação a
grupos mais específicos de proteínas. E assim como o RefSeq, o Swiss-Prot também
tem a intenção de produzir a menor redundância possível com relação às entradas de
proteínas presentes no banco, tentando, sempre que possível, incorporar todo o dado
de uma certa proteína em uma única entrada para cada organismo. Além disso, o
Swiss-Prot também apresenta referências cruzadas com cerca de outras sessenta
bases de dados de biomoléculas, facilitando a apreensão de informação sobre a
seqüência de proteína em questão.
Falando de uma forma menos técnica, a grande vantagem de se utilizar o
Swiss-Prot reside no fato do banco apresentar uma nomenclatura bem organizada para
definir as seqüências de proteínas. Enquanto outros bancos apresentam nomenclaturas
um tanto quanto divergentes, mesmo quando tratando de uma mesma molécula em
diferentes organismos, o Swiss-Prot apresenta uma nomenclatura fixa para cada
molécula de uma determinada proteína e mantém essa nomenclatura mesmo em
diferentes espécies, o que facilita e permite uma maior confiança na identificação e
anotação por similaridade desse tipo de molécula, como veremos na aula 7. Além
disso, ele é o banco que normalmente apresenta um maior número de informações
sobre uma molécula de proteína, incluindo modificações pós-traducionais, domínios e
outras informações do interesse de um pesquisador que queira trabalhar com aquela
molécula.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
46
6.6. Gene Ontology – Sistema de classificação de genes de acordo com suas
características
O Gene Ontology em si, não é bem um banco de dados e, por isso, talvez
devesse estar em um capítulo à parte. Entretanto, são disponibilizados bancos de
dados de ontologias organizadas para determinados organismos e parece interessante
abordar esse tópico no presente momento.
O Gene Ontology (popularmente conhecido como GO) é um esforço colaborativo
em reunir descrições consistentes de produtos gênicos em diferentes bancos de dados.
Os participantes do projeto GO desenvolveram três estruturas de vocabulário
controlado, chamadas de ontologias, que descrevem os produtos gênicos em termos
de sua associação com processos biológicos, componentes celulares e função
molecular de maneira não relacionada com qualquer organismo em especial.
Basicamente essas três ontologias estão relacionadas às principais perguntas que os
pesquisadores têm sobre um determinado gene: (1) em quais processos biológicos o
gene está envolvido; (2) qual a sua localização dentro da célula e; (3) como,
molecularmente, o gene realiza sua função. Um determinado gene, por exemplo, pode
realizar a transdução de sinais em uma célula (processo biológico), estar preso à
membrana celular (localização celular) e ter uma função de fosforilar uma outra
proteína (função molecular), sendo classificado no GO de acordo com essas três
características.
Além disso, a utilização de termos precisos de vocabulário do GO ajuda muito
na chamada genômica comparativa, pois dessa forma podemos saber se um
determinado organismo, por exemplo, apresenta um maior número percentual de
genes relacionados a um determinado processo biológico ou não. O mesmo vale pras
outras duas ontologias e podemos testar hipóteses, interessantes, como: será que um
organismo que vive a altas temperaturas possui mais proteínas de choque térmico?,
será que este organismo possui mais proteínas chaperonas, que ajudam no
enovelamento de outras?, será que ele apresenta mais proteínas responsáveis pela
duplicação de seu DNA?
Da mesma forma, a utilização destas ontologias permite que um pesquisador
saiba quais são todas as proteínas quinases de um determinado organismo, ou quais
são todas as proteínas envolvidas com metabolismo de DNA ou, ainda, quais são todas
as proteínas que ficam associadas ao retículo.
Outro ponto importante na análise das ontologias é que elas, assim como a
realidade biológica, não apresentam uma ordem hierárquica bem definida. E ainda que
isso dificulte um pouco a análise, o resultado da ordem e da relação entre as
ontologias fica mais fiel ao conhecimento que se tem sobre a biologia dos organismos.
Ainda assim, as ontologias obedecem a uma certa hierarquia, não muito rígida, de
forma que, por exemplo, a ontologia das “tirosina quinases” é filha da ontologia das
“quinases” e o pesquisador pode escolher observar ou obter todas as quinases de um
organismo de GO anotado ou apenas as “tirosina quinases”, que são um subgrupo das
quinases.
6.7. Referências Bibliográficas
1. Weller DL et al., 2002. Database resources of the National Center for Biotechnology
information: 2002 update. Nucleics Acid Reserch 30(1): 13-16.
2. Benson DA et al., 2002. GenBank. Nucleics Acid Reserch 30(1): 17-20.
3. Stoesser G et al., 2002. The EMBL nucleotide sequence database. Nucleics Acid
Reserch 30(1): 21-26.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
47
4. Tateno Y et al., 2002. The DNA Data Bank of Japan (DDBJ) for genome scale
research in life sciences. Nucleics Acid Reserch 30(1): 27-30.
5. Westbrook J et al., 2002. The Protein Data Bank: unifying the archive. Nucleics Acid
Reserch 30(1): 245-248.
6. Bairoch A & Apweiler R, 2000. The SWISS-PROT protein sequence database and its
supplement TrEMBL in 2000. Nucleics Acid Reserch 28(1): 45-48.
7. Baxevanis AD and Ouellette BFF, 2001. Bioinformatics: A practical guide to the
analysis of genes and proteins. Ed. Wiley-interscience. 2nd ed.
8. Pruitt K., Tatusova T. and Ostell J. The NCBI handbook (Internet): Chapter 17, The
Reference Sequence (RefSeq) Project. Bethesda (MD): National Library of Medicine
(US), National Center for Biotechnology Information; 2002.
Sites:
NCBI Genbank - http://www.ncbi.nih.gov/Genbank/
EMBL Nucleotide Sequence Database - http://www.ebi.ac.uk/embl/
DDJP - DNA Data Bank of Japan - http://www.ddbj.nig.ac.jp/
NCBI Reference Sequences web site - http://www.ncbi.nlm.nih.gov/RefSeq/
The Gene Ontology – http://www.geneontology.org
Swissprot – http://us.expasy.org/sprot/
6.8.
Brainstorm
1 - O que é a INSDC e por quais entidades ela é formada?
2 - Qual a diferença entre bancos de dados primários e secundários? Apresente dois
exemplos de cada um.
3 - Entre no site do NCBI: http://www.ncbi.nlm.nih.gov. Na aba Search altere o valor
para Nucleotide (isso significa que você estará fazendo uma pesquisa por seqüências
de nucleotídeos), copie o AN AF117710 no espaço apropriado e clique em Go. Você
deve observar um resultado dizendo que esse AN está associado ao gene “Homo
sapiens hemoglobin beta chain (HBB) mRNA, complete cds”, clique no link para
AF117710. Dessa forma você estará vendo todas as informações disponíveis no
Genbank para este gene. Explique o que significa cada um dos seguintes campos
LOCUS, DEFINITION, ACCESSION, VERSION, KEYWORDS, SOURCE, ORGANISM,
REFERENCE,
FEATURES,
ORIGIN.
Mais
informações
em
http://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html
4 - Qual a diferença entre o identificador conhecido como GI e o AN? Quais bancos de
dados os utilizam? Por que não existe apenas um número identificador de seqüência?
5 - O que é o projeto RefSeq e quais suas características principais?
6 - Entre no site do BLAST: http://www.ncbi.nlm.nih.gov/BLAST. O BLAST é uma
ferramenta de alinhamento local de seqüências de biomoléculas e entenderemos
melhor sua função e seu funcionamento na próxima aula. Por ora, apenas entre na
página e clique em “Translated query vs. protein database (blastx)”. Uma página
irá abrir com vários campos. No campo Search, escreva novamente o número de
acesso da seqüência da hemoglobina humana, AF117710 e clique no botão “BLAST!”.
Na próxima página que irá se abrir clique em Format! e espere pelo resultado. O
resultado mostrará as proteínas do GenPept mais parecidos com a hemoglobina
humana, guarde este resultado. Entre novamente na página do BLAST - “Translated
query vs. protein database (blastx)”. Nesta página copie novamente o número de
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
48
aceso da hemoglobina AF117710 na aba Search só que, desta vez, clique no nome nr,
na opção Choose database. O nr representa o GenPept e é o banco de dados contra
o qual o BLAST realiza a busca. Selecione, ao invés de nr, a opção swissprot e então
clique no botão “BLAST!”. Espere a próxima página aparecer e clique em Format!
Quando a tela de resultados aparecer, compare esses resultados com aqueles obtidos
contra o banco nr. Responda: O que você pode observar de diferente? Repare como a
nomenclatura utilizada pelo Swissprot é importante e facilita a identificação da
proteína. (Se tiver interesse, volte novamente e execute outras buscas BLAST contra
diferentes bancos de dados e observe os resultados.)
7 - Em que consiste o Gene Ontology? Quais as principais ontologias existentes nas
quais um gene pode ser descrito? Entre no site do http://www.geneontology.org e cole
na caixa de texto o seguinte termo de GO:0006259. A qual ontologia esse GO
pertence? Qual o nome desta ontologia? Quais são as ontologias imediatamente
inferiores a esta?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
49
CAPÍTULO 7
Anotação de Genomas
7.1.
Introdução
As seqüências genômicas são fontes ricas de informações sobre a biologia dos
organismos, mas devem ser traduzidas através de análises computacionais e de
interpretação biológica para que possamos extrair delas a maior quantidade possível
de dados úteis (Lewis et al., 2000). A anotação genômica consiste num processo de
vários passos e Stein (2001) divide-a, em três categorias básicas: a anotação de
nucleotídeos, de proteínas e de processos (Figura 7.1).
A anotação de nucleotídeos é feita quando existem informações sobre o genoma
completo (ou segmentos de DNA) de algum organismo. Assim, procura-se encontrar a
localização física (posição cromossômica) de cada parte da seqüência e descobrir onde
estão os genes (Rouzé 1999), RNAs, elementos repetitivos, etc. Na anotação de
proteínas, que é feita quando existem informações sobre os genes (obtidos por
seqüenciamento genômico ou de cDNA) de algum organismo, procura-se identificar os
genes já descobertos e descobrir sua função. Assim é possível saber quais são aqueles
que determinado organismo possui e quais ele não possui. A anotação de processos
procura identificar as vias e processos nos quais diferentes genes interagem,
montando uma anotação funcional eficiente.
Figura 7.1. Anotação de genomas completos. Esquema representando as fases e as
perguntas que se deseja responder em cada uma das fases da anotação de genomas.
Retirado de Prosdocimi et al., 2003.
7.2. Anotação de Nucleotídeos
A anotação de nucleotídeos começa com a montagem do genoma, a
identificação de onde está cada parte do DNA e qual a relação das partes entre si.
Procura-se quais genes estão no mesmo segmento de DNA, no mesmo cromossomo. E
depois que o genoma está montado, realiza-se buscas para encontrar as partes que
correspondem aos genes expressos, quais partes correspondem a genes de tRNA,
quais correspondem aos clusters de genes de rRNA e assim por diante. Assim,
identifica-se a posição de cada um dos tRNAs com relação ao aminoácido que ele
carrega, identifica-se a posição dos rRNAs e a posição dos genes.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
50
7.3.
Anotação de Proteínas
Nessa etapa da anotação genômica procura-se montar um catálogo das
proteínas e genes presentes nos organismos, nomeá-los e associá-los a prováveis
funções através, principalmente, de buscas por similaridades (Aubourg & Rouzé 2001).
Várias
técnicas
recentes
têm
sido
desenvolvidas
para
identificar
automaticamente as proteínas pertencentes a diferentes grupos isofuncionais
(chamados erroneamente de grupos de ortologia – Jensen 2001, veja na próxima
aula), entretanto muitas dessas técnicas podem gerar classificações ambíguas. Na
prática, o que é normalmente feito é a classificação das proteínas preditas com base
em domínios funcionais, configurações espaciais e presença de padrões conservados,
além de pesquisa ampla de similaridade contra proteínas bem caracterizadas.
Uma forma comum de se realizar a anotação de proteínas é procurar
similaridades das seqüências com proteínas presentes em diferentes bancos de dados,
utilizando ferramentas de alinhamento local como o BLASTp ou PSI-BLAST (Altschul et
al., 1997). As coleções mais valiosas de seqüências de proteínas são os bancos de
dados SWISS-PROT e TrEMBL. O primeiro apresenta uma coleção de seqüências de
proteínas confirmadas e extensivamente anotadas. Ele contém ainda referências para
outros bancos de dados de seqüência e estrutura, referências bibliográficas,
identificação da família protéica e descrições sobre a provável função e papel biológico
da proteína (Bairoch & Apweiler 2000). Entretanto a velocidade do seqüenciamento
genômico é maior que a dos curadores e, por isso, foi criado o banco de dados
TrEMBL, que contém uma tradução automática das seqüências codificadoras (cds)
submetidas aos bancos de dados de nucleotídeos (Lang 1997, Apweiler 2000).
Uma análise complementar seria a procura de domínios funcionais, sendo que
as bases de dados mais utilizadas nesse processo são: PFAM, PRINTS, PROSITE,
ProDom, SMART e BLOCKS. Esses vários bancos de dados de padrões são altamente
sobreponíveis, mas cada um possui seu próprio sistema de nomenclaturas e método de
procura, o que torna difícil a interpretação dos resultados (Stein 2001). Por isso foi
desenvolvido, recentemente, um banco integrado de assinaturas de proteínas,
conhecido como InterPro, que procura integrar as informações dos bancos
anteriormente citados. Cada entrada do InterPro contém uma breve descrição da
família ou domínio, uma lista de proteínas do SWISS-PROT ou TrEMBL que o contém,
referências bibliográficas e links para cada um dos bancos membros (Apweiler et al.,
2001).
O banco InterPro tem sido utilizado para a anotação de diversos genomas,
como o de leveduras, vermes, moscas, mostardas e homens. Desses, cerca de 40% a
50% das proteínas preditas possuem pelo menos uma entrada no InterPro, donde se
conclui que a outra metade das proteínas eucarióticas pertencem a novas famílias
protéicas e que muito ainda precisa ser aprendido (Apweiler et al., 2001).
7.4. Anotação de Processos
A parte mais interessante e desafiadora do processo de anotação gênica é
relacionar, finalmente, a genômica com os processos biológicos. Para isso, como já
vimos, foi criado um consórcio chamado Gene Ontology (GO), que busca criar um
vocabulário padrão para descrever a função dos genes eucarióticos. Só para recordar,
o GO consiste em três divisões: função molecular (atividade específica do gene em
questão, por exemplo: atividade enzimática), processos biológicos (processo no qual o
gene está inserido, como a meiose) e componentes celulares (descreve a estrutura
celular na qual o gene está localizado, como organelas ou ribossomos) (The Gene
Ontology Consortium 2000).
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
51
Para a anotação de processos é necessário mais do que trabalho computacional.
Técnicas biológicas em larga escala, como mutagênese mediada por transposons,
análise de expressão em microarrays, RNA interference, identificação de proteínas por
espectroscopia de massa, ensaios baseados em green-fluorescent-protein para
determinar a localização subcelular e padrões temporais de expressão de proteínas e
estudos de duplo-híbrido em leveduras têm sido de fundamental importância para
identificar o papel de genes e proteínas nos processos biológicos (Stein 2001). Cada
novo experimento adiciona mais informação e permite um melhor entendimento do
genoma. Portanto, a anotação de processos é realizada comparando as informações
genômicas com os dados atuais da literatura, de forma a tentar compreender ao
máximo a biologia do organismo que está sendo estudado.
7.5.
A realização da Anotação Genômica (Sociologia da Anotação)
Stein (2001) propõe alguns modelos bastante pertinentes para explicar como é
realizada, passo a passo, a anotação genômica. Segundo ele, esses processos de
identificação gênica normalmente seguem algum dos seguintes modelos
organizacionais: a fábrica, o museu e a festa. Cada modelo é adequado para alguma
das fases do trabalho de anotação (Stein 2001).
Durante a primeira fase, quando o principal trabalho é encontrar genes e
mapear variações e marcadores, o modelo da fábrica é o mais adequado. Nesse
modelo uma rede de computadores trabalha seguindo uma série de programas de
anotação. A seqüência de entrada é jogada numa série de programas para predição de
genes, procura de similaridades entre seqüências de nucleotídeos e proteínas e
procura de domínios funcionais. Isso permite a geração de grandes quantidades de
dados sobre o genoma.
Então se inicia a fase de museu, quando a ênfase passa da localização dos
dados para a sua interpretação. Nesse modelo um conjunto de curadores deve
classificar e catalogar o genoma de forma sistemática, encontrando e corrigindo erros
gerados pelos programas na primeira etapa. A maior parte dessa etapa é feita à mão e
deve basear-se também na literatura obtida sobre o organismo em questão para uma
melhor integração com os dados genômicos.
Figura 7.2. Um exemplo da sociologia da anotação genômica: etapas de fábrica,
museu e festa.
Após o tédio da curadoria é hora da festa. Nesse modelo, vários biólogos e
bioinformatas são colocados juntos em um mesmo ambiente para discutir, anotar e
realizar o fechamento do genoma. Os biólogos procuram associar os dados de genoma
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
52
à biologia do organismo, montando várias hipóteses de trabalho e os bioinformatas e
cientistas da computação montam as ferramentas e dão o suporte técnico para ajudar
a produzir os resultados desejados. Esse modelo tem sido utilizado com sucesso para a
anotação de diversos genomas, dentre eles o da Drosophila (Adams et al., 2000) e do
camundongo (The RIKEN Genome Exploration Research Group Phase II Team and the
FANTOM Consortium 2001).
É interessante notar que, enquanto o seqüenciamento genômico é uma tarefa
bastante especializada, a anotação genômica é algo bastante multidisciplinar, no qual
toda a comunidade científica (biológica) pode e deve contribuir.
7.6. Referências Bibliográficas
1. Stein, L., 2001. Genome annotation: from sequence to biology. Nature Reviews 2:
493-505
2. Rouzé P.; Pavy, N. and Rombauts, S. (1999). Genome annotation: which tools do
we have for it? Curr Opin Struct Biol 2: 90-95.
3. Lewis, S.; Ashburner, M. and Reese, M. G. (2000). Annotating eukaryote genomes.
Curr Opin Struct Biol 10: 349–354.
4. PHRAP -- http://www.phrap.org
5. CAP3 - http://genome.cs.mtu.edu/cap/cap3.html
6. Prosdocimi F; Cerqueira GC; Binneck E; Silva AF; Reis AN; Junqueira ACM; Santos
ACF; Nhani-Júnior A; Wust CI; Camargo-Filho F; Kessedjian JL; Petretski JH; Camargo
LP; Ferreira RGM; Lima RP; Pereira RM; Jardim S; Sampaio VS and FolguerasFlatschart AV. Bioinformática: manual do usuário. Biotec. Ci. Des. 29: 18-31, 2002.
7. Aubourg, S. and Rouzé P. (2001). Genome annotation. Plant Physiol Biochem 39:
181-193.
8. Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W. and
Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25: 3389-3402.
9. Bairoch, A. and Apweiler, R. (2000). The SWISS-PROT protein sequence database
and its supplement TrEMBL in 2000. Nucleic Acids Res 28: 45-48.
10. Jensen, R. A. (2001). Orthologs and paralogs – we need to get it right. Genome
Biol 2: 1002.1-1002.3.
11. Apweiler, R. (2001). Functional information in SWISS-PROT: The basis for largescale characterisation of protein sequences. Brief Bioinform 2: 9-18.
12. Apweiler, R.; Attwood, T. K.; Bairoch, A.; Bateman, A.; Birney, E.; Biswas, M.;
Bucher, P.; Cerutti, L.; Corpet, F.; Croning, M. D.; Durbin, R.; Falquet, L.;
Fleischmann, W.; Gouzy, J.; Hermjakob, H.; Hulo, N.; Jonassen, I.; Kahn, D.; Kanapin,
A.; Karavidopoulou, Y.; Lopez, R.; Marx, B.; Mulder, N. J.; Oinn, T. M.; Pagni, M.;
Servant, F.; Sigrist, C. J. and Zdobnov, E. M. (2001). The InterPro Database; an
integrated documentation resource for protein families; domains and functional sites.
Nucleics Acid Res 29: 37-40.
13. Lang, F. (1997). TREMBL. Trends Genet 13: 417.
14. The Gene Ontology Consortium (2000). Gene Ontology: tool for the unification of
biology. Nat Genet. 25: 25-29.
15. The RIKEN Genome Exploration Research Group Phase II Team and the FANTOM
Consortium (2001). Functional annotation of a full-length mouse cDNA collection.
Nature 409: 685-690.
16. Adams, M. D.; Kelley, J. M.; Gocayne, J. D.; Dubnick, M.; Polymeropoulos, M. H.;
Xiao, H.; Merril, C. R.; Wu, A.; Olde, B.; Moreno, R. F.; Kerlavage, A. R.; McCombie,
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
53
W. R. and Venter, J. C. (1991). Complementary DNA sequencing: expressed sequence
tags and human genome project. Science 252: 1651-6.
7.7. Brainstorm
1. Em que consiste a anotação de genomas?
2. Quais são as principais etapas durante a anotação dos genomas e qual pergunta
deseja-se responder em cada uma delas?
3. Quais são os objetivos da anotação de nucleotídeos?
4. Quais são os objetivos da anotação de proteínas?
5. Quais são os objetivos da anotação de processos?
6. Como é realizada a anotação de genomas? Descreva os modelos organizacionais e
qual a atividade realizada em cada uma destas etapas.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
54
CAPÍTULO 8
Bioinformática Evolutiva e Genomas Completos
Iniciando nossa Interação
O conceito de homologia é algo que normalmente é utilizado de forma incorreta
por diversos estudantes e pesquisadores. Muitas vezes escuta-se dizer que há
diferentes graus de homologia entre genes ou que o gene A é mais homólogo ao gene
B do que um terceiro gene C. Este conceito está errado. A homologia está relacionada
à ancestralidade de um caráter, gene ou proteína, e é algo que existe ou não existe,
não há graus intermediários. Esse será o tema deste capítulo.
8.1. Homologia, Ortologia e Paralogia
O conceito de homologia é algo que normalmente é utilizado de forma incorreta
por diversos estudantes e pesquisadores. Muitas vezes escuta-se dizer que há
diferentes graus de homologia entre genes ou que o gene A é mais homólogo ao gene
B do que um terceiro gene C. Este conceito está errado. A homologia está relacionada
à ancestralidade de um caráter, gene ou proteína, e é algo que existe ou não existe,
não há graus intermediários. Genes ou proteínas homólogas são aquelas que
apresentam um ancestral comum recente, assim como caracteres homólogos são
derivados de uma mesma estrutura ancestral. As proteínas podem ter mais ou menos
similaridade entre si. Quando fazemos, por exemplo, um alinhamento de seqüências
de duas proteínas de uma certa espécie contra uma terceira de outra espécie,
poderemos descobrir qual das duas é mais similar à terceira. Portanto, a homologia
está relacionada à evolução e não apresenta níveis intermediários: ou é ou não é. E
existem duas classes distintas de genes/proteínas homólogos, os ortólogos e os
parálogos.
E de suma importância para o correto estudo da evolução, é a identificação de
proteínas ortólogas e parálogas. A evolução deve ser estudada apenas em proteínas
ortólogas, ou seja, aquelas que descendem de uma mesma proteína ancestral (e não
foram duplicadas dentro de linhagens -- parálogas --, já que as estas últimas
normalmente acumulam mutações extras devido ao fato de não haver pressão seletiva
para manutenção de sua função) (Jensen, 2001). Já as proteínas ortólogas, que
normalmente apresentam o mesmo papel funcional na célula, são importantes para a
execução deste papel e, portanto, não devem acumular mutações que alterem sua
capacidade funcional. O estudo de evolução em nível molecular baseia-se na
comparação entre proteínas ortólogas, derivadas de uma mesma proteína no
ancestral comum entre as espécies.
Ultimamente os termos ortologia e paralogia têm sido muito utilizados na
biologia genômica para expressar relações funcionais entre genes. Genes ortólogos são
considerados aqueles homólogos que apresentam a mesma função em organismos
diferentes. Já os genes parálogos são considerados homólogos, presentes num mesmo
organismo, que não apresentam a mesma função. Entretanto, de acordo com Walter
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
55
Fitch, que primeiramente utilizou esses termos, eles não apresentam esse significado
funcional e sim um significado evolutivo.
Segundo sua definição, a determinação de ortologia ou paralogia está
relacionada a eventos de evolução gênica. Genes que tenham sido duplicados dentro
de uma mesma linhagem (linhas horizontais) são parálogos, não importando se
possuem a mesma função ou não. Já os genes que foram alterados dentro de
linhagens específicas, após especiação (aqueles nos quais, se voltarmos à sua origem,
chegamos a uma bifurcação ou Y invertido) são os chamados ortólogos.
Figura 8.1. Eventos de paralogia e ortologia. Adaptada de Jensen, 2001
Isso significa dizer que, na figura acima, A1 tem três ortólogos na espécie C,
mas somente C1 é ortólogo de B1. Já B2 tem dois ortólogos na espécie C (C2 e C3),
onde C2 e C3 são parálogos. Portanto, toda relação de homologia entre genes pode ser
classificada como ortologia ou paralogia e deve-se perceber que um dado gene em
uma espécie pode ter mais do que um ortólogo em outra. Além disso, podemos
detectar também genes parálogos em espécies diferentes. É bom lembrar que existe
também uma terceira relação entre genes conhecida como xenologia, que consiste na
relação entre genes quando, na sua história evolutiva, pelo um deles surgiu por
transferência horizontal, ou seja, o gene em algum momento foi absorvido do meio
para dentro do genoma do organismo (através de vírus, por exemplo).
Portanto essa definição de nada tem a ver com a função e sim com a história
evolutiva dos genes e é assim que essa nomenclatura foi definida primeiramente.
Entretanto, devemos notar que, para definirmos corretamente a relação entre os
genes, temos que conhecer detalhes sobre sua rota evolutiva. O problema é que, na
grande maioria das vezes, não temos informações suficientes para montar essa rota de
forma correta.
É interessante notar que, para os pesquisadores da ciência genômica, é
importante saber, principalmente, se dois genes homólogos possuem uma mesma
característica funcional. Esse conhecimento permite entender melhor tanto as origens
estruturais das funções biológicas como as bases moleculares para a divergência
dessas funções, permitindo aos pesquisadores comparar relações sobre a seqüência,
estrutura e função de grupos de homólogos.
Assim, considerando que os termos ortologia e paralogia mostram-se
inadequados para uso, Gerlt e Babbit sugerem novos termos a serem utilizados na
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
56
pesquisa genômica. Assim, genes isofuncionais seriam aqueles homólogos que
apresentam a mesma função; heterofuncionais seriam aqueles que apresentam
funções diferentes; isoespecíficos seriam homólogos encontrados na mesma espécie e
heteroespecíficos seriam homólogos presentes em espécies diferentes.
Dessa forma, genes homólogos com a mesma função em espécies diferentes
seriam heteroespecíficos e isofuncionais, homólogos com funções diferentes no mesmo
organismo seriam isoespecíficos e heterofuncionais, homólogos com a mesma função
num mesmo organismo seriam isoespecíficos e isofuncionais e homólogos com funções
diferentes em diferentes organismos seriam heteroespecíficos e heterofuncionais.
8.2. COG
Portanto, como vimos acima, algo que é bastante penoso e questionável em
estudos evolutivos é a definição de critérios que possam identificar determinados
genes como ortólogos para que sejam realizados estudos evolutivos entre eles
(Sonnhammer & Koonin 2002). Não existem metodologias consensuais para identificar
ortólogos e cada pesquisador considera-os da forma como acredita ser melhor.
Entretanto, o NCBI apresenta um serviço conhecido como COG -- Clusters of
Ortologous Groups (http://www.ncbi.nlm.nih.gov/COG/) -- onde foi realizado um
estudo para a definição dos grupos de proteínas ortólogas presentes em organismos de
genomas completos (Tatusov et al., 1997). Assim, o COG disponibiliza grupos de
proteínas ortólogas classificadas de acordo com sua função biológica em dois serviços,
um para organismos procariotos (Tatusov et al., 2001) e outro para eucariotos
(Tatusov et al., 2003).
A forma como o COG define proteínas como ortólogas baseia-se no critério
conhecido como BeTs. Os BeTs, ou best hits bidirecionais são resultantes de
alinhamentos locais entre proteínas de um determinado organismo e o genoma de
outro. Para que uma proteína 1, em um organismo 1, seja BeT de uma proteína 2, no
organismo 2, o melhor resultado (best hit) de uma busca BLAST (Altschul et al., 1997)
entre a proteína 1 contra o genoma do organismo 2 deve encontrar a proteína 2 como
best hit da busca, assim como o contrário. Ou seja, ao executarmos o BLAST da
proteína 2, contra o genoma do organismo 1, o best hit deve ser a proteína 1. Assim,
define-se grupos de proteína BeT (Tatusov et al., 1997). Assim, para a definição de um
grupo de proteínas ortólogas em um COG é necessário haver BeT entre pelo menos
três diferentes organismos, sendo que as três (ou mais) proteínas devem ser BeT das
outras proteínas encontradas nos outros organismos.
Assim o KOG, que representa o serviço do COG para organismos eucarióticos,
apresenta 4852 grupos de proteínas ortólogas de diversos organismos. Assim, para
cada gene conhecido dos organismos existe um número de KOG característico e, se
buscarmos em outro organismos os genes de mesmo identificador KOG, pegaremos os
genes que provavelmente realizam a mesma função neste organismo. O COG,
portanto, facilita o estudo da evolução gênica considerando que ele mesmo já separa
para o pesquisador os genes que provavelmente são ortólogos nos diferentes
organismos. O serviço COG de procariotos apresenta 66 genomas completos que são
disponibilizados no site http://www.ncbi.nlm.nih.gov/COG, enquanto o serviço do KOG
de eucariotos atualmente apresenta sete organismos em seu banco de dados.
8.3. Trabalhando com genomas completos
Tão importante quanto aprender a trabalhar para montar um genoma,
produzindo toda sua seqüência de bases, é saber como podemos utilizar as
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
57
informações de genomas já seqüenciados e disponíveis nos bancos de dados públicos.
Na tabela 8.1 abaixo podemos ver quantos genomas de diferentes grupos de
organismos já foram seqüenciados até o presente momento (01/2005).
Organism
Vírus
Arqueobactérias
Bactérias
Outros Eucariotos
Complete Genomes
published
2024
21
196
18
Tabela 8.1. Número de seqüências genômicas já publicadas para diferentes classes de
organismos. Obtido em http://www.ncbi.nlm.nih.gov/genomes/static/gpstat.html, a
27/01/2005.
As seqüências genômicas de diversos organismos podem ser obtidas no site do
NCBI http://www.ncbi.nlm.nih.gov, a partir do serviço Entrez Genomes. Os genomas
presentes ali geralmente são fornecidos na forma de diversos arquivos de entrada,
cada um contendo uma informação específica, que pode ser vista na tabela abaixo:
Arquivo
Informação contida no arquivo
asn
Arquivo no formato GenBank contendo informações de genoma
formatadas em XML
faa
Seqüências de aminoácidos de todas as proteínas inferidas no formato
FASTA
ffn
Seqüências de Nucleotídeos de todos os genes inferidos no formato
FASTA, apresentando, no cabeçalho informação sobre sua posição no
genoma
fna
Contém a informação sobre a seqüência de nucleotídeos do genoma
completo do organismo
gbk
Contém todo o genoma do organismo anotado segundo padrão
GenBank
ptt
Apresenta informações sobre localização, fita, tamanho, identificador,
nome e código de cada um dos genes, assim como sua categoria
funcional segundo o COG
Tabela 8.2. Arquivos disponibilizados pelo NCBI para seqüências de genomas
completos de procariotos (ftp://ftp.ncbi.nlm.nih.gov/genomes/Bacteria).
Assim, temos disponível para nosso uso tanto a seqüência do
do organismo quanto as seqüências de cada um dos seus genes
essas informações torna-se possível que realizemos vários tipos de
próprio interesse e utilizemos as seqüências dos genomas da
interessar.
genoma completo
e proteínas. Com
estudos de nosso
forma como nos
8.4. Referências Bibliográficas
1. Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W. and
Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25: 3389-3402.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
58
2. Jensen, RA. Orthologs and paralogs – we need to get it right. Genome Biology 2001
2 (8): 1002.1-1002.3
3. Sonnhammer EL, Koonin EV (2002). Orthology, paralogy and proposed
classification for paralog subtypes. Trends Genet. Dec;18(12):619-20.
4. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov
DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, Smirnov S, Sverdlov AV,
Vasudevan S, Wolf YI, Yin JJ, Natale DA (2003). The COG database: an updated
version includes eukaryotes. BMC Bioinformatics. Sep 11;4(1):41.
5. Tatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS,
Kiryutin B, Galperin MY, Fedorova ND, Koonin EV (2001). The COG database: new
developments in phylogenetic classification of proteins from complete genomes.
Nucleic Acids Res. Jan 1;29(1):22-8.
6. Tatusov RL, Koonin EV, Lipman DJ (1997). A genomic perspective on protein
families. Science. Oct 24;278(5338):631-7.
8.5. Brainstorm
1. Qual o conceito de homologia e por que não se diz que dois genes são mais
homólogos entre si do que um terceiro?
2. O que são genes parálogos e ortólogos?
3. Como o COG classifica os genes em ortólogos? Discuta sobre a classificação do
COG e o conceito de ortologia da resposta anterior.
4. Por que você acredita que os genomas virais são os mais seqüenciados de todos?
5. Que tipo de informação é disponibilizada sobre um organismo quando um genoma
está completo?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
59
CAPÍTULO 9
Bioinformática estrutural
Iniciando nossa Interação
Como já dissemos a bioinformática consiste principal no estudo de seqüências de
biomoléculas. Até agora já conseguimos entender a relevância da bioinformatica com
relação a seqüências de DNA (genoma) e RNA (transcriptoma). Portanto é hora de nos
voltarmos para as seqüências de proteínas. As proteínas são muitas vezes
consideradas as principais moléculas de uma células, já que são elas que realizam as
funções celulares, sendo que o DNA e RNA têm principalmente a característica de
armazenamento e processamento de informações. Sabe-se bem que as proteínas
exercem sua função de acordo com sua estrutura espacial, ou seja, a função da
proteína está intrinsecamente ligada a sua conformação tridimensional, à sua
estrutura. E é justamente a busca por esta conformação espacial uma das principais
áreas da bioinformática, que será discutida no presente capítulo.
9.1. Sobre a estrutura das proteínas
A seqüência de aminoácidos que forma uma determinada proteína é conhecida
como sua estrutura primária. Já a forma como os aminoácidos se interconectam
formando alças, hélices ou folhas consiste na estrutura secundária da proteína.
Entretanto, o que realmente importa para a função de uma proteína é sua forma
tridimensional no espaço. É através dessa conformação espacial que a proteína encaixa
segundo o modelo chave-fechadura nos seus substratos para catalisar uma
determinada reação química que dê origem aos produtos da ação enzimática. No caso
da estrutura de uma proteína, existem dois ângulos principais de torção entre átomos
dos aminoácidos que são responsáveis pela forma final na qual uma proteína se
enovela no espaço, esses são os ângulos phi e psi. Eles são formados pela ligação
carbono alfa dos aminoácidos e seus grupos amino e ácido carboxílico. Cada
aminoácido da proteína apresenta um valor de torção de tais ângulos e, soubéssemos
esse valor para cada um deles, conheceríamos perfeitamente a forma como a proteína
se enovela para realizar sua função. Ainda hoje é impossível prever teoricamente a
estrutura 3D de uma proteína quando conhecemos apenas sua estrutura primária e
esse é um dos grandes, senão o maior, desafio da bioinformática nos dias de hoje.
Mesmo alguns cientistas célebres dizem que a bioinformática consiste apenas em uma
forma de processar a informação de genomas, transcriptomas ou proteomas e que
nunca algo realmente de valor pode ser produzido apenas por análises computacionais
de seqüências de biomoléculas. Entretanto, acredita-se que a forma como as proteínas
se enovelam no espaço seja realmente uma das grandes questões da atualidade e,
possivelmente, isso traria daria fama e respeito em toda comunidade científica caso
um método teórico de predição de estrutura de proteínas fosse desenvolvido através
de ferramentas computacionais. E, na minha opinião, se algo pode dar um Nobel a um
bioinformata, essa é a grande pergunta a ser respondida e trabalhada.
Bem, mas a vida real é mais dura e, hoje, para descobrirmos a estrutura
terciária de uma proteína, que consiste exatamente na sua forma espacial, devemos
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
60
utilizar laboriosos testes experimentais para tal, sendo que os principais métodos
utilizados hoje em dia são a difração de raios-X e a ressonância nuclear magnética.
Na difração de raios-X, a primeira dificuldade consiste na produção de um
cristal da proteína desejada. E essa dificuldade deve-se ao fato de que a cristalização
consiste num processo um tanto quanto caótico e imprevisível, sendo que
determinadas proteínas podem ser cristalizadas em poucos dias enquanto outras
demoram anos para que possam ser cristalizadas. Esse cristal deve então ser
submetido a uma fonte de raios-X e o padrão de difração obtido pela incidência do
raio-X no cristal da proteína deve ser então analisado computacionalmente para que
seja produzida a estrutura precisa da proteína em questão. Com os dados obtidos no
experimento de difração é montado um mapa de densidades eletrônicas onde os
aminoácidos são “encaixados” e o quebra cabeça que representa a estrutura da
proteína é gerado. Dependendo da resolução obtida pode-se chegar até a descobrir
exatamente qual a seqüência de aminoácidos da proteína. Quase 100% das vezes,
entretanto, a seqüência primária já é conhecida de antemão.
Ao contrário da técnica de difração de raios-X, a ressonância nuclear magnética
ou NMR, da sigla em inglês, permite que a estrutura da proteína seja conhecida sem
que haja necessidade da cristalização da mesma (as proteínas são utilizadas em
solução) e, portanto, proteínas que não são possíveis de se cristalizar têm sua
estrutura 3D resolvida por este método. No fundo esse é um método de minimização
de energia que produz um resultado menos preciso e de menor resolução do que os
resultados de difração. Freqüentemente os resultados de NMR produzem mais de um
resultado que apresente uma energia mínima e, assim, os arquivos de estruturas de
proteínas resolvidas por NMR são, na verdade, um conjunto contendo todas as
estruturas da proteína que apresentaram menor energia e várias estruturas parecidas
são observadas nestes arquivos.
9.2. Protein Data Bank: o banco de dados de estruturas de proteínas
O PDB (Protein Data Bank ou Banco de Dados de Proteína) consiste no principal
banco de dados de estrutura de proteínas existente no mundo. A figura 9.1 apresenta
o crescimento do número de estruturas depositadas desde a criação do PDB, em 1972.
Algo interessante a ser notado é que, se nos lembrarmos da primeira aula que
tivemos, da primeira figura deste curso, a figura 1.1, perceberemos que, enquanto
cerca de 16 milhões de seqüências nucleotídicas são conhecidas, ainda hoje temos
conhecimento apenas de cerca de 30 mil estruturas de proteínas. E isso nos mostra
como a descoberta das estruturas terciárias das proteínas ainda hoje consiste num
método trabalhoso e complicado. Analisando ainda a figura, vemos que com o passar
dos anos, cada vez mais estruturas são reveladas (barras vermelhas), mas ainda
assim há uma clara e notória diferença entre a informação de seqüência e de estrutura
das biomoléculas.
O PDB também abriga dados estruturais de pequenos peptídeos, vírus, ácidos
nucléicos e carboidratos e, das cerca de 30 mil estruturas presentes no banco cerca de
vinte e cinco mil foram resolvidas através de difração de raios-X enquanto cerca de
cinco mil foram resolvidas por experimentos de ressonância magnética. Algumas
proteínas, entretanto, tiveram suas estruturas resolvidas pelas duas técnicas.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
61
Figura 9.1. Crescimento do PDB. Crescimento do número de estruturas de proteínas
contidas
no
PDB
ao
longo
das
três
últimas
décadas.
Obtido
em
http://www.rcsb.org/pdb/holdings.html.
Outra informação importante sobre o PDB é que ele consiste, assim como o
GenBank, em um banco de dados primário de estruturas de proteínas, onde as
mesmas não são classificadas ou analisadas de nenhuma forma específica, estando
publicadas da mesma forma que o pesquisador que as produziu depositou no banco.
9.3. Modelagem molecular por homologia
A modelagem molecular por homologia representa a tentativa de se descobrir a
estrutura de uma determinada proteína tendo como base a estrutura de uma outra
proteína de seqüência relativamente similar. E a necessidade de se modelar uma
estrutura vem do fato de que a informação biológica sobre uma determinada proteína
cresce quando se conhece sua estrutura (figura 9.2). Com a informação da estrutura
de uma proteína é possível tentar descobrir, por exemplo, outras proteínas que
interajam com ela, fármacos que possam ativá-la ou inibi-la ou, simplesmente,
permite que entendamos melhor seu mecanismo molecular de ação.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
62
Figura 9.2. O desafio da modelagem por homologia.
A premissa básica na qual se baseia a modelagem por homologia é a de que: se
duas proteínas apresentam seqüência primária similar é bem provável que sua
estrutura seja também parecida. E essa premissa tem se mostrado real, apesar de
que, algumas vezes, mesmo proteínas que apresentam seqüências primárias
diferentes podem apresentar conformações tridimensionais parecidas, no que novos
programas de threading têm sido desenvolvidos para tentar prever essas estruturas.
Voltando à modelagem por homologia, entretanto, é preciso definir bem quais são as
situações nas quais a modelagem molecular vale a pena ou não em ser realizada.
Basicamente, ela vale ser realizada nos seguintes casos: (1) quando o problema é
experimentalmente difícil, por exemplo, quando as proteínas são muito difíceis de
serem cristalizadas, como é o caso de proteínas glicosiladas ou de membrana; (2)
quando se deseja apenas saber aproximadamente a estrutura da proteína, ou seja,
quando o problema não justifica o investimento e o tempo necessários para produzir
experimentalmente a estrutura da proteína; ou (3) quando este é o único recurso
disponível, no caso, por exemplo de um laboratório que não tenha os equipamentos de
dedução experimental ao alcance.
Os procedimentos realizados para a modelagem por homologia normalmente
consistem nos seguintes passos: (1) identificação das proteínas já modeladas
apresentando seqüências primárias similares, normalmente realizada através de
alinhamentos locais da proteína desejada contra as seqüências das proteínas do PDB;
(2) seleção das proteínas similares que serão utilizadas como modelo; (3) alinhamento
global da seqüência desejada com as que serão utilizadas; (4) construção do modelo
através de similaridade com os modelos das proteínas escolhidas do PDB utilizando um
software de modelagem; (5) avaliação do modelo utilizando diferentes algoritmos de
teste. Vale notar que o processo de modelagem por homologia é um processo
iterativo, ou seja, que pode apresentar várias iterações ou repetições. No final,
avalia-se o modelo obtido e, se o modelo não for satisfatório, tenta-se escolher outras
proteínas homólogas, alinhamentos um pouco diferentes ou tenta-se modificar alguns
parâmetros do programa de modelagem até que o modelo passe bem nos testes que
avaliam os ângulos de torção dos aminoácidos e as propriedades físico-químicas da
proteína.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
63
9.4. Alguns programas de modelagem molecular
Existem vários programas que permitem a realização da modelagem molecular.
O mais fácil de utilizar é o swiss-model http://swissmodel.expasy.org/SWISSMODEL.html. Ele consiste num servidor que realiza todos os procedimentos de forma
transparente para o usuário, que precisa apenas entrar com a seqüência primária da
proteína de interesse. O próprio swiss-model procura as proteínas similares de
estrutura conhecida e realiza a montagem do modelo por homologia segundo um
algoritmo próprio. Apesar disso, ele permite que o usuário também entre com os
identificadores PDB das proteínas que o mesmo deseje utilizar como molde ou definir
um valor de cutoff de BLAST para ser utilizado na escolha automática das proteínas
pelo sistema. Apesar de simples, o swiss-model é normalmente utilizado apenas para a
produção de modelos aproximados ou como recurso didático.
Já o algoritmo Modeller consiste num software mais robusto para a elucidação
de estruturas por homologia. O Modeller trabalha através de satisfação de restrições
espaciais, apresentando um banco de dados interno que contém alinhamentos de 416
proteínas de 105 diferentes famílias e, para a satisfação de tais restrições, ele ainda
calcula as distâncias entre os átomos dos aminoácidos utilizando funções estatísticas
de densidade de probabilidade. Apresenta ainda um algoritmo de otimização através
de dinâmica molecular, onde as restrições espaciais são otimizadas levando em
consideração termos energéticos e de estereoquímica de aminoácidos. O Modeller
contém também um banco de dados contendo proteínas representativas de todo o
PDB.
9.5. Threading
Vimos, portanto, como normalmente é realizada a montagem de modelos
teóricos de estruturas protéicas baseados em homologia de seqüência entre diferentes
proteínas. Entretanto, o que fazer quando o pesquisador deseja modelar teoricamente
uma determinada proteína mas não há outras seqüências similares o suficiente no
banco de dados do PDB para realizar essa modelagem? Foi pensando nesse tema e no
fato de que algumas proteínas de seqüência bem divergente apresentam estruturas
similares, que os algoritmos de threading foram desenvolvidos. Tais programas, como
o gene threader, tentam modelar proteínas que não apresentem seqüências
primárias similares com estrutura conhecida. Um programa de threading funciona de
acordo com a montagem dos chamados modelos descritivos, que são montados para
tentar criar um padrão relacionando seqüência e estrutura, mas não de uma forma tão
rígida quanto num alinhamento. Esses padrões levam em consideração alguns fatores,
como: (1) a distância entre os resíduos de aminoácidos; (2) a estrutura secundária de
vários segmentos das proteínas; (3) as características físico-químicas de cada resíduo
e sua ordem na cadeia. Dessa forma, esses algoritmos são, por vezes, capazes de
gerar estruturas terciárias de proteínas sem que existam outras proteínas já
modeladas com seqüência similar.
9.6. CASP – Critical Assessment of Structure Prediction
É interessante notar que a cada dois anos é realizada uma espécie de
“competição” para tentar descobrir quais são os melhores programas de modelagem
molecular existentes no mundo. Essa saudável competição é realizada como um
estudo cego onde uma proteína recém modelada experimentalmente tem sua estrutura
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
64
escondida e vários grupos de modelagem em todo o mundo obtêm sua seqüência
primária e tentam modelá-la através de diversas técnicas diferentes. Ganha o concurso
o grupo que se aproximar mais da estrutura real da proteína, que só é liberada depois
que o concurso termina. E a cada biênio os pesquisadores mostram conseguir chegar
mais perto da estrutura real da proteína desconhecida.
9.7. Estrutura de um arquivo no formato PDB
O arquivo abaixo consiste na parte inicial de um arquivo no formato PDB que
representa a estrutura de uma proteína, no caso de uma variante da hemoglobina
humana. O arquivo PDB normalmente é estruturado de acordo com as seguintes
partes:
Informações do arquivo
Identificadores da primeira coluna
Título
TITLE, COMPND, SOURCE, AUTHOR, REMARKS
Estrutura primária
DBREF, SEQADV, SEQRES, MODRES
Heteroátomos
HET, HETNAM, HETSYN, FORMUL
Estrutura secundária
HELIX, SHEET, TURN
Ligações químicas
SSBOND, HYDBND, SLTBRG, CYSPEP
Dados cristalográficos
CRIST1, ORIGXn, SCALEn, MTRIXn
Coordenadas atômicas
MODEL, ATOM, TER, HETATM
Tabela 9.1. Informações presentes num arquivo PDB de estrutura de proteína.
Exemplo de um arquivo PDB:
HEADER
COMPND
COMPND
COMPND
COMPND
COMPND
COMPND
COMPND
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
SOURCE
KEYWDS
EXPDTA
AUTHOR
REVDAT
JRNL
JRNL
JRNL
JRNL
JRNL
JRNL
JRNL
JRNL
OXYGEN TRANSPORT
14-APR-95
1HDB
MOL_ID: 1;
2 MOLECULE: HEMOGLOBIN (DEOXY) BETA-V67T;
3 CHAIN: A, B, C, D;
4 SYNONYM: HBV67T;
5 ENGINEERED: YES;
6 MUTATION: CHAIN B, D, V67T;
7 OTHER_DETAILS: ALPHA-BETA-ALPHA-BETA TETRAMER
MOL_ID: 1;
2 SYNTHETIC: YES;
3 ORGANISM_SCIENTIFIC: HOMO SAPIENS;
4 ORGANISM_COMMON: HUMAN;
5 TISSUE: BLOOD;
6 CELL: ERYTHROCYTE;
7 EXPRESSION_SYSTEM: ESCHERICHIA COLI;
8 EXPRESSION_SYSTEM_STRAIN: AR120;
9 EXPRESSION_SYSTEM_PLASMID: PJK05 (FRONTICELLI ET AL.,1991);
10 EXPRESSION_SYSTEM_GENE: BETA-GLOBIN CDNA FUSED TO A
11 TRUNCATED VIRAL GENE
HUMAN HEMOGLOBIN, DEOXY-BETA-V67T
X-RAY DIFFRACTION
I.PECHIK,X.JI,C.FRONTICELLI,G.L.GILLILAND
1
03-APR-96 1HDB
0
AUTH
I.PECHIK,X.JI,J.DILL,K.FIDELIS,J.MOULT,
AUTH 2 W.S.BRINIGAR,M.KARAVITIS,C.FRONTICELLI,
AUTH 3 G.L.GILLILAND
TITL
ANALYSIS OF THE CRYSTAL STRUCTURE, MOLECULAR
TITL 2 MODELING AND INFRARED SPECTROSCOPY OF THE DISTAL
TITL 3 BETA-HEME POCKET VALINE67(E11)-THREONINE MUTATION
TITL 4 OF HEMOGLOBIN
REF
TO BE PUBLISHED
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
65
JRNL
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REMARK
REFN
0353
1
1 REFERENCE 1
1 AUTH
C.FRONTICELLI,I.PECHIK,W.S.BRINIGAR,Z.GRYCZYNSKI,
1 AUTH 2 G.L.GILLILAND
1 TITL
OXYGEN AFFINITY MODULATION BY THE N-TERMINI OF THE
1 TITL 2 BETA- CHAINS IN HUMAN AND BOVINE HEMOGLOBIN
1 REF
J.BIOL.CHEM.
V. 269 23965 1994
1 REFN
ASTM JBCHA3 US ISSN 0021-9258
0071
2
2 RESOLUTION. 2.2 ANGSTROMS.
3
3 REFINEMENT.
3
PROGRAM
GPRLSA
3
AUTHORS
FUREY
3
R VALUE
0.149
3
MEAN B VALUE
21.43 ANGSTROMS**2
3
FINAL RMS COORD. SHIFT
0.024 ANGSTROMS
3
3
NUMBER OF REFLECTIONS
21669
3
RESOLUTION RANGE
6.0 - 2.2 ANGSTROMS
3
DATA CUTOFF
2.
SIGMA(F)
3
3 DATA COLLECTION.
3
NUMBER OF UNIQUE REFLECTIONS
27163
3
COMPLETENESS OF DATA
84.
%
3
REJECTION CRITERIA
0.0
SIGMA(I)
3
3 NUMBER OF ATOMS USED IN REFINEMENT.
3
NUMBER OF PROTEIN ATOMS
4384
3
NUMBER OF NUCLEIC ACID ATOMS
0
3
NUMBER OF HETEROGEN ATOMS
172
3
NUMBER OF SOLVENT ATOMS
444
3
3 RMS DEVIATIONS FROM IDEAL VALUES (THE VALUES OF
3
SIGMA, IN PARENTHESES, ARE THE INPUT ESTIMATED
3
STANDARD DEVIATIONS THAT DETERMINE THE RELATIVE
3
WEIGHTS OF THE CORRESPONDING RESTRAINTS).
3
DISTANCE RESTRAINTS (ANGSTROMS).
3
BOND DISTANCE
0.017(0.025)
3
ANGLE DISTANCE
0.038(0.036)
3
PLANAR 1-4 DISTANCE
0.039(0.040)
3
ANGLE RESTRAINTS (DEGREES).
3
PLANE RESTRAINT (ANGSTROMS)
0.023(0.030)
3
CHIRAL-CENTER RESTRAINT (ANGSTROMS**3)
0.181(0.200)
3
NON-BONDED CONTACT RESTRAINTS (ANGSTROMS).
3
SINGLE TORSION CONTACT
0.186(0.300)
3
MULTIPLE TORSION CONTACT
0.187(0.300)
3
POSSIBLE HYDROGEN BOND
0.174(0.300)
3
CONFORMATIONAL TORSION ANGLE RESTRAINT (DEGREES).
3
PLANAR
3.5(5.0)
3
STAGGERED
17.4(15.0)
3
ORTHONORMAL
31.7(15.0)
3
ISOTROPIC THERMAL FACTOR RESTRAINTS (ANGSTROMS**2).
3
MAIN-CHAIN BOND
0.676(1.000)
3
MAIN-CHAIN ANGLE
1.140(1.500)
3
SIDE-CHAIN BOND
1.279(1.500)
3
SIDE-CHAIN ANGLE
2.031(2.000)
3
3
MAIN-CHAIN BOND
0.676(1.000)
3
MAIN-CHAIN ANGLE
1.140(1.500)
3
SIDE-CHAIN BOND
1.279(1.500)
3
SIDE-CHAIN ANGLE
2.031(2.000)
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
66
REMARK
REMARK
REMARK
REMARK
REMARK
DBREF
DBREF
DBREF
DBREF
SEQADV
SEQADV
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
SEQRES
HET
HET
HET
HET
HET
HET
18
18 DATE OF DATA COLLECTION
: 07-04-94
18 MONOCHROMATIC (Y/N)
: Y
18 INTENSITY-INTEGRATION SOFTWARE : XENGEN
18 DATA REDUNDANCY
: 2.75
1HDB A
1
141 SWS
P01922
HBA_HUMAN
1
141
1HDB B
1
146 SWS
P02023
HBB_HUMAN
1
146
1HDB C
1
141 SWS
P01922
HBA_HUMAN
1
141
1HDB D
1
146 SWS
P02023
HBB_HUMAN
1
146
1HDB THR B
67 SWS P02023
VAL
67 ENGINEERED
1HDB THR D
67 SWS P02023
VAL
67 ENGINEERED
1 A 141 VAL LEU SER PRO ALA ASP LYS THR ASN VAL LYS ALA ALA
2 A 141 TRP GLY LYS VAL GLY ALA HIS ALA GLY GLU TYR GLY ALA
3 A 141 GLU ALA LEU GLU ARG MET PHE LEU SER PHE PRO THR THR
4 A 141 LYS THR TYR PHE PRO HIS PHE ASP LEU SER HIS GLY SER
5 A 141 ALA GLN VAL LYS GLY HIS GLY LYS LYS VAL ALA ASP ALA
6 A 141 LEU THR ASN ALA VAL ALA HIS VAL ASP ASP MET PRO ASN
7 A 141 ALA LEU SER ALA LEU SER ASP LEU HIS ALA HIS LYS LEU
8 A 141 ARG VAL ASP PRO VAL ASN PHE LYS LEU LEU SER HIS CYS
9 A 141 LEU LEU VAL THR LEU ALA ALA HIS LEU PRO ALA GLU PHE
10 A 141 THR PRO ALA VAL HIS ALA SER LEU ASP LYS PHE LEU ALA
11 A 141 SER VAL SER THR VAL LEU THR SER LYS TYR ARG
1 B 146 VAL HIS LEU THR PRO GLU GLU LYS SER ALA VAL THR ALA
2 B 146 LEU TRP GLY LYS VAL ASN VAL ASP GLU VAL GLY GLY GLU
3 B 146 ALA LEU GLY ARG LEU LEU VAL VAL TYR PRO TRP THR GLN
4 B 146 ARG PHE PHE GLU SER PHE GLY ASP LEU SER THR PRO ASP
5 B 146 ALA VAL MET GLY ASN PRO LYS VAL LYS ALA HIS GLY LYS
6 B 146 LYS THR LEU GLY ALA PHE SER ASP GLY LEU ALA HIS LEU
7 B 146 ASP ASN LEU LYS GLY THR PHE ALA THR LEU SER GLU LEU
8 B 146 HIS CYS ASP LYS LEU HIS VAL ASP PRO GLU ASN PHE ARG
9 B 146 LEU LEU GLY ASN VAL LEU VAL CYS VAL LEU ALA HIS HIS
10 B 146 PHE GLY LYS GLU PHE THR PRO PRO VAL GLN ALA ALA TYR
11 B 146 GLN LYS VAL VAL ALA GLY VAL ALA ASN ALA LEU ALA HIS
12 B 146 LYS TYR HIS
1 C 141 VAL LEU SER PRO ALA ASP LYS THR ASN VAL LYS ALA ALA
2 C 141 TRP GLY LYS VAL GLY ALA HIS ALA GLY GLU TYR GLY ALA
3 C 141 GLU ALA LEU GLU ARG MET PHE LEU SER PHE PRO THR THR
4 C 141 LYS THR TYR PHE PRO HIS PHE ASP LEU SER HIS GLY SER
5 C 141 ALA GLN VAL LYS GLY HIS GLY LYS LYS VAL ALA ASP ALA
6 C 141 LEU THR ASN ALA VAL ALA HIS VAL ASP ASP MET PRO ASN
7 C 141 ALA LEU SER ALA LEU SER ASP LEU HIS ALA HIS LYS LEU
8 C 141 ARG VAL ASP PRO VAL ASN PHE LYS LEU LEU SER HIS CYS
9 C 141 LEU LEU VAL THR LEU ALA ALA HIS LEU PRO ALA GLU PHE
10 C 141 THR PRO ALA VAL HIS ALA SER LEU ASP LYS PHE LEU ALA
11 C 141 SER VAL SER THR VAL LEU THR SER LYS TYR ARG
1 D 146 VAL HIS LEU THR PRO GLU GLU LYS SER ALA VAL THR ALA
2 D 146 LEU TRP GLY LYS VAL ASN VAL ASP GLU VAL GLY GLY GLU
3 D 146 ALA LEU GLY ARG LEU LEU VAL VAL TYR PRO TRP THR GLN
4 D 146 ARG PHE PHE GLU SER PHE GLY ASP LEU SER THR PRO ASP
5 D 146 ALA VAL MET GLY ASN PRO LYS VAL LYS ALA HIS GLY LYS
6 D 146 LYS THR LEU GLY ALA PHE SER ASP GLY LEU ALA HIS LEU
7 D 146 ASP ASN LEU LYS GLY THR PHE ALA THR LEU SER GLU LEU
8 D 146 HIS CYS ASP LYS LEU HIS VAL ASP PRO GLU ASN PHE ARG
9 D 146 LEU LEU GLY ASN VAL LEU VAL CYS VAL LEU ALA HIS HIS
10 D 146 PHE GLY LYS GLU PHE THR PRO PRO VAL GLN ALA ALA TYR
11 D 146 GLN LYS VAL VAL ALA GLY VAL ALA ASN ALA LEU ALA HIS
12 D 146 LYS TYR HIS
HEM A 142
43
PROTOPORPHYRIN IX CONTAINS FE(II)
HEM B 147
43
PROTOPORPHYRIN IX CONTAINS FE(II)
HEM C 142
43
PROTOPORPHYRIN IX CONTAINS FE(II)
HEM D 147
43
PROTOPORPHYRIN IX CONTAINS FE(II)
SO4
1
5
SULFATE ION
SO4
2
5
SULFATE ION
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
67
FORMUL
FORMUL
FORMUL
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
HELIX
CRYST1
ORIGX1
ORIGX2
ORIGX3
SCALE1
SCALE2
SCALE3
ATOM
ATOM
ATOM
ATOM
ATOM
ATOM
ATOM
ATOM
ATOM
ATOM
5 HEM
4(C34 H32 N4 O4 FE1 2+)
6 SO4
2(O4 S1 2-)
7 HOH
*434(H2 O1)
1
1 PRO A
4 SER A
35 1
2
2 PRO A
37 TYR A
42 5
3
3 ALA A
53 ALA A
71 1
4
4 MET A
76 ALA A
79 1
5
5 SER A
81 HIS A
89 1
6
6 PRO A
95 HIS A 112 5
7
7 PRO A 119 THR A 137 1
8
8 PRO B
5 LYS B
17 1
9
9 VAL B
20 VAL B
34 1
10 10 PRO B
36 PHE B
45 5
11 11 PRO B
51 GLY B
56 1
12 12 PRO B
58 HIS B
77 1
13 13 LEU B
81 ASP B
94 1
14 14 PRO B 100 GLU B 121 5
15 15 PRO B 124 ALA B 142 1
16 16 PRO C
4 SER C
35 1
17 17 PRO C
37 TYR C
42 5
18 18 ALA C
53 ALA C
71 1
19 19 MET C
76 ALA C
79 1
20 20 SER C
81 HIS C
89 1
21 21 PRO C
95 HIS C 112 5
22 22 PRO C 119 LEU C 136 1
23 23 PRO D
5 LYS D
17 1
24 24 VAL D
20 VAL D
34 1
25 25 PRO D
36 PHE D
45 5
26 26 PRO D
51 GLY D
56 1
27 27 PRO D
58 HIS D
77 1
28 28 LEU D
81 ASP D
94 1
29 29 PRO D 100 GLU D 121 5
30 30 PRO D 124 ALA D 142 1
63.540
83.190
54.020 90.00 99.15
1.000000 0.000000 0.000000
0.000000 1.000000 0.000000
0.000000 0.000000 1.000000
0.015738 0.000000 0.002535
0.000000 0.012021 0.000000
0.000000 0.000000 0.018750
1 N
VAL A
1
19.345 29.258
2 CA VAL A
1
20.198 30.251
3 C
VAL A
1
21.681 29.970
4 O
VAL A
1
22.004 29.466
5 CB VAL A
1
19.720 31.621
6 CG1 VAL A
1
19.955 31.726
7 CG2 VAL A
1
20.335 32.766
8 N
LEU A
2
22.515 30.278
9 CA LEU A
2
23.964 30.010
10 C
LEU A
2
24.657 31.119
90.00 P 21
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
43.165 1.00
42.493 1.00
42.744 1.00
43.860 1.00
43.026 1.00
44.529 1.00
42.236 1.00
41.750 1.00
41.896 1.00
42.673 1.00
4
33.80
33.75
33.53
33.92
33.70
33.94
34.02
32.79
32.05
31.36
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
1HDB
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
Aqui são mostrados apenas os 10 primeiros átomos com suas coordenadas,
mas o arquivo inteiro apresenta mais de 5000 átomos com suas respectivas
coordenadas atômicas, que representam sua posição espacial num eixo tridimensional.
9.8. Referências Bibliográficas
1. PDB http://www.rcsb.org/pdb/ Mais famoso e completo banco de dados de
estrutura de proteínas.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
68
2. Protein explorer http://molvis.sdsc.edu/protexpl/ Programa derivado do RasMol
para a visualização de estruturas de proteínas.
3. SWISS-PDBviewer http://www.expasy.org/spdbv/ Programa para a visualização e
análise da estrutura de proteínas. Permite a realização de mutações, alterações em
pontes de hidrogênio, ângulos de torção e distâncias entre átomos.
4. Libra http://www.ddbj.nig.ac.jp/E-mail/libra/LIBRA_I.html Programa on-line que
utiliza threading para encontrar uma seqüência de resíduos de aminoácidos que
melhor se adequem a uma estrutura terciária conhecida e vice-versa
5. Threader Programa de predição da estrutura terciária através do reconhecimento
do enovelamento a partir de bibliotecas alternativas
6. CASP http://predictioncenter.llnl.gov/Center.html Critical Assesment of Structural
Prediction. “Competição” que avalia os softwares de predição de estrutura de
proteínas
7. SWISS-MODEL
Modelagem
de
proteínas
por
homologia
http://www.expasy.org/swissmod
9.9. Brainstorm
1. Por que o conhecimento sobre a estrutura das proteínas é importante?
2. Descreva brevemente como funcionam as duas principais técnicas experimentais
para a descoberta da estrutura terciárias das proteínas.
3. O que é o PDB? Por que há menos estruturas protéicas produzidas do que
seqüências gênicas?
4. A modelagem por homologia se baseia em qual premissa?
5. Quais são os casos onde se recomenda realizar a modelagem por homologia?
6. Quais são os passos necessários para se realizar a modelagem por homologia?
7. Em que se baseia a modelagem por threading? Você acha que a modelagem por
threading mostra que a premissa da modelagem por homologia esteja incorreta ou
incompleta? Por que?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
69
CAPÍTULO 10
Conclusões e pensamentos filosóficos sobre a bioinformática
10.1. Sobre bioinformática, genoma e ciência
Abaixo você vai ver o rascunho do artigo que publiquei na Revista Ciência Hoje,
de Outubro de 2004, em colaboração com meu orientador de doutorado, o Prof.
Fabrício Rodrigues dos Santos. O artigo pretende apresentar a bioinformática, coisa
que você já deve estar ciente neste momento, e discutir a relevância da pesquisa de
genoma num contexto científico. Além disso, o artigo apresenta alguns paradigmas
interessantes da pesquisa em bioinformática.
10.2. Introdução
A bioinformática consiste principalmente na análise computacional de
seqüências de DNA, RNA e proteínas. Essa nova ciência surgiu na última década devido
a uma necessidade urgente pela utilização de ferramentas sofisticadas para a análise
de um crescente número de dados que veio a ser produzido em biologia molecular. O
GenBank foi um dos primeiros e ainda é o mais popular banco de dados para o
depósito de seqüências de DNA. Criado dentro do NCBI -- o centro americano para
informação biotecnológica --, é lá onde pesquisadores de todo o mundo depositam as
seqüências de A, C, G e Ts que obtêm em seus laboratórios através do
sequenciamento do DNA dos mais diversos organismos. No final da década de 90
observou-se um crescimento exponencial do número de seqüências de biomoléculas
depositadas no GenBank e a figura 1 já é clássica no âmbito da biologia
computacional. Esse assustador crescimento começou a ocorrer após a comercialização
dos seqüenciadores de DNA a laser, em 1990. Os seqüenciadores atuais são
totalmente automatizados
e foram
especialmente
desenvolvidos
para o
seqüenciamento de moléculas DNA em larga-escala. Freqüentemente apresentam 96
capilares (tubos minúsculos por onde passam fragmentos de DNA a serem analisados)
e conseguem gerar, em média, seqüências de DNA de 600 letras A, C, G e T por
capilar em cada análise (o genoma humano é constituído por cerca de 3 bilhões de
letras de DNA). Seqüenciadores ainda mais potentes, apresentando 384 capilares,
podem produzir mais de um milhão de letras do DNA por dia! No Brasil, existem
dezenas de seqüenciadores e grande parte deles foi distribuída entre laboratórios em
todo o país quando da implantação do Projeto Genoma FAPESP para o seqüenciamento
da bactéria Xylella fastidiosa que ataca a laranja (http://aeg.lbi.ic.unicamp.br/xf/) e do
Projeto Genoma Brasileiro (http://www.brgene.lncc.br) durante o qual foram
seqüenciadas as bactérias Chromobacterium violaceum e Mycoplasma synoviae.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
70
Figura 10.1. Crescimento do número de seqüências depositadas no Genbank desde
sua criação.
A grande maioria dessas seqüências publicadas em bancos de dados
internacionais vêm de projetos genoma e transcriptoma (ou genoma funcional).
Genomas para cá, genomas para lá, desde o seqüenciamento da primeira bactéria -- o
Haemophilus influenzae em meados de 1995 -- hoje o NCBI já apresenta 1274
genomas de vírus seqüenciados, 169 genomas de procariotos (bactérias e
arqueobactérias) e 20 genomas de organismos eucarióticos. Estas seqüências de
biomoléculas têm gerado uma grande quantidade de informação cuja complexidade é
crescente com o estudo das interações entre biomoléculas e das variações observadas
entre cada um dos indivíduos de uma certa população. Mas, afinal, que informações
cientificamente relevantes o genoma trouxe para os cientistas, para as pessoas e para
a sociedade? Enfim, será que projetos genoma são pesquisas meramente descritivas?
Qual seria então a relevância da genômica e o papel da bioinformática para
consolidação desta ciência?
10.3. Genoma e o método científico
À primeira vista parece-nos que os estudos de genoma não são estudos
científicos clássicos. Isso se deve ao fato de que o início de um projeto genoma não se
baseia em uma hipótese clara e bem elaborada a priori sobre a biologia de um
determinado organismo. No máximo, a pergunta que se poderia fazer antes de se
seqüenciar um genoma seria: “será que este organismo apresenta algum gene de
potencial biotecnológico?”; ou, “o que há no genoma deste organismo que o faz
conseguir viver nessa condição, ou gerar uma patologia?” Mas, no fundo, tais
perguntas dificilmente serão respondidas diretamente através do seqüenciamento do
genoma. Estudos posteriores serão certamente necessários para responder tais
perguntas de forma adequada. E mais ainda: é possível que alguma investigação nãogenômica mais minuciosa sobre esse ou aquele aspecto em particular possam dar
resposta mais direta a tais questões.
Mas não pense que isso tira o mérito dos estudos genômicos. Acreditamos que
a ciência vive hoje a era da anatomia molecular. Se voltarmos filosoficamente ao
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
71
século XIX, veremos que, naquela época em que pouco se conhecia -- de forma
sistematicamente documentada -- do mundo biológico em geral, os grandes cientistas
eram considerados os naturalistas; aqueles que exploravam o mundo em busca de
informação taxonômica, encontrando e classificando novos animais e plantas antes
desconhecidos. A descrição e a documentação de novas espécies era especialmente
necessária naquela época, uma vez que pouco ou nada se conhecia sobre a grande
diversidade da vida em nosso planeta. Assim, poucos questionamentos eram feitos a
respeito de nossa biodiversidade. Desta forma, como nos estudos dos naturalistas,
houve a época onde os anatomistas começaram a surgir, escrevendo seus tratados e
mostrando os primeiros detalhes bem documentados sobre a anatomia humana e de
diversas outras espécies. Descreviam da melhor maneira possível à época, a
localização dos órgãos e tecidos humanos que se tinha conhecimento. Igualmente, se a
genômica não pode ser vista classicamente como uma ciência, a taxonomia e a
anatomia também não o podem. E isso vem do fato de que tais empreendimentos
científicos são principalmente descritivos ao invés de investigativos. Mas, mais uma
vez, isso não lhes tira o mérito, muito pelo contrário. Quanto conhecimento científico
já não foi construído baseado nas informações geradas pelos naturalistas e
anatomistas? Toda uma ciência biomédica foi montada com bases nos conhecimentos
descritivos gerados pelos anatomistas e a teoria mais importante e unificadora de toda
a biologia -- a Evolução -- surgiu diretamente das observações, documentações e
estudos descritivos dos naturalistas Charles Darwin e Alfred Wallace.
Bem, e a genômica? O genoma pode ser descrito como a anatomia molecular
de uma espécie. E é só agora, neste início de século XXI, que estamos conseguindo
desvendar e descrever como as espécies são constituídas em seu nível mais básico; o
da informação molecular. A genômica é a “ciência descritiva” dos nossos tempos. E
assim como as ciências biomédicas surgiram para trazer o método científico ao estudo
da anatomia, a bioinformática surge agora para trazer a cientificidade aos dados
genômicos, para casar a genômica ao método científico e para gerar informações
relevantes e indispensáveis na incessante busca do conhecimento em que consiste o
empreendimento científico.
10.4. Um conceito de bioinformática
Nesse momento é importante definirmos bem do que se trata a bioinformática e
em que contexto utilizamos este conceito no presente ensaio. Muita confusão é feita
nesse ponto e muitos acreditam que a bioinformática consista em qualquer análise
computacional de problemas biológicos, o que não se enquadra na origem desta
disciplina. A bioinformática clássica surgiu com o seqüenciamento de biomoléculas e
destas permanece inseparável. É possível propor uma definição razoavelmente clara do
que seja a bioinformática dizendo que esta consista em “todo o tipo de estudo ou de
ferramenta que se pode realizar e/ou produzir de forma a organizar ou obter
informação biológica a partir de seqüências de biomoléculas”. Se o estudo usa
seqüências de biomoléculas (DNA, RNA ou proteínas), direta ou indiretamente,
tratamos como bioinformática; do contrário estaremos falando de computação aplicada
à biologia, campo extremamente importante em várias disciplinas e presente bem
antes de ser iniciado o seqüenciamento de biomoléculas. Uma vez definido o conceito
de bioinformática utilizado aqui, podemos perceber que muitos estudos na área podem
ser enquadrados em três princípios paradigmáticos, chamadas aqui, metaforicamente,
de tijolo, peneira e lupa.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
72
10.5. Princípios paradigmáticos em bioinformática
Estudos de bioinformática tijolo consistem naqueles relacionados à execução
de projetos genoma e normalmente produzem ferramentas para a análise de
seqüências e interpretação de genomas. Alguns processos já são clássicos dentre as
análises de seqüências de DNA. Dentre eles podemos citar o base-calling, onde as
bases do DNA são lidas no seqüenciador a partir dos cromatogramas (perfis de
emissão fluorescente que variam entre os nucleotídeos A, C, G e T durante a análise).
Neste processo, são gerados os chamados cromatogramas e eles são transformados
em uma seqüência e um índice de confiabilidade é associado a cada letra do DNA. Em
um processo subseqüente faz-se a análise de seqüências que apresentam uma
determinada seqüência de letras em comum para a geração dos “textos” genômicos.
Como já comentado, uma seqüência obtida no seqüenciador possui aproximadamente
600 letras de DNA e um genoma consiste normalmente em uma seqüência de milhões
ou bilhões de letras. Portanto, na produção de um genoma é preciso alinhar as
seqüências geradas uma após a outra, verificando suas regiões de sobreposição, para
que seja possível montar o conjunto de toda a informação genética da espécie em
estudo. Novas ferramentas para o alinhamento de seqüências, a padronização de
processos de base-calling, a montagem de seqüências para se gerar um genoma e a
produção de ferramentas para identificação de genes, são alguns exemplos de projetos
de bioinformática tijolo, sem as quais é impossível a análise eficiente dos “edifícios
genômicos”. Vale notar ainda que as ferramentas de comparação de seqüências de
DNA têm permitido um grande avanço no que diz respeito à identificação das funções
de genes. Através da comparação entre a seqüência de um novo gene e um banco de
dados de genes de função conhecida, pode-se inferir rapidamente a possível função de
um gene completamente desconhecido. Caso fosse necessária a realização de testes
experimentais para descobrirmos a função de cada um dos genes que vêm sendo
descritos, possivelmente teríamos ainda de pesquisar várias décadas antes de publicar
um genoma com esta informação. A bioinformática, portanto, permite uma rápida
identificação da provável função de um gene seqüenciado pela primeira vez.
Como já dissemos, muita informação é descrita durante projetos genoma e é
virtualmente impossível a análise de todos esses dados (ou mesmo uma pequena
quantidade deles) pelo grupo que gerou a seqüência completa de DNA de um
organismo. Assim, são necessários trabalhos posteriores para a análise de pedaços
específicos de diferentes genomas, com o objetivo de produzir mais informação sobre
um tema específico como, por exemplo, as proteínas para metabolismo de açúcares.
Esses trabalhos de mineração de dados genômicos são característicos dos projetos da
chamada bioinformática peneira. Como a genômica é essencialmente uma disciplina
descritiva, os trabalhos publicados apresentam muitas informações sem qualquer
detalhamento, muitas vezes por própria limitação do periódico científico. Na figura 2
vemos um exemplo da informação descritiva freqüentemente presente em artigos de
genoma, a divisão em grupos de genes de acordo com sua função biológica. Que
informação relevante há de se tirar desse monte de dados?
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
73
Figura 10.2. Típica figura apresentando informação de cunho descritivo que é
encontrada em artigos científicos sobre genomas. Aqui é feita a descrição das
porcentagens de genes encontrados no genoma que apresentam diferentes funções
biológicas.
É interessante observar que há, ao redor do mundo, alguns centros
especializados em seqüenciamento de genomas, publicando seqüências e mais
seqüências para que outros pesquisadores possam ter informações disponíveis para
fazer seus próprios estudos de mineração de dados. Usando peneiras específicas, os
cientistas em todo o mundo podem ser capazes de gerar conhecimento mais
aprofundado sobre aspectos particulares de seu próprio interesse. A construção de
bancos de dados de seqüências de genes com uma ou outra função específica ou de
estruturas tridimensionais de proteínas, por exemplo, consistem também em trabalhos
montados no âmbito da bioinformática peneira e, todo ano, a primeira edição da
revista britânica Nucleic Acids Research traz um resumo dos bancos de dados mais
utilizados na área da bioinformática.
Por fim, nos trabalhos de bioinformática lupa é onde a ciência se faz presente
com maior clareza na área genômica. Vale notar que todos os estudos de genoma e
bioinformática descritos até agora são de suma importância para o aumento do
conhecimento científico sobre os organismos e sobre suas constituições moleculares.
Mas em estudos de bioinformática lupa o método científico é rigorosamente aplicado.
Aqui, através das mais variadas ferramentas computacionais é possível gerar
metodologias algorítmicas para testar hipóteses e produzir resultados que verifiquem
ou refutem suas afirmações quando se observam dados genômicos. O processo
investigativo científico é retomado: observam-se os dados, criam-se hipóteses e
realizam-se experimentos in silico (dentro do computador) de forma a testá-las
através de algoritmos bioinformáticos. Posteriormente, é corroborada ou refutada a
hipótese inicial a partir da análise dos resultados obtidos. É interessante notar que
estudos dessa categoria não são necessariamente publicados em revistas
especializadas em bioinformática. Isso vem do fato de que os algoritmos montados
aqui são apenas um detalhe e caracterizam a metodologia de um trabalho que tenta
mostrar um resultado biológico mais específico. A bioinformática não é o centro do
trabalho, como ocorre nas abordagens de tijolo e peneira. Nos trabalhos classificados
como lupa, a hipótese e os resultados são mais importantes do que as ferramentas
bioinformáticas utilizadas como meio investigativo. Assim, tais estudos são
freqüentemente publicados nas revistas relacionadas com o organismo em que se está
estudando, com o fenômeno estudado, ou em revistas específicas de genética, biologia
molecular ou bioquímica. Exemplos de estudos de bioinformática lupa são aqueles
onde alguma característica biológica de um determinado organismo é explicada a partir
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
74
da observação de seu conjunto de seqüências gênicas ou protéicas e da comparação
com seqüências similares em organismos proximamente relacionados. Através desses
estudos de genômica comparativa é possível associar aspectos da biologia dos
organismos comparados à presença ou a ausência de determinado gene, grupo de
genes ou processos metabólicos.
10.6. Conclusão
Dessa forma, a bioinformática, além de outras ciências já bem estabelecidas,
como a biologia molecular, a genética e a bioquímica vêm trazer uma abordagem
baseada no método científico aos dados gerados em projetos genoma. Vale notar, no
âmbito nacional, a iniciativa pioneira da CAPES (Coordenação para o Aperfeiçoamento
de Profissionais de Ensino Superior) na indução da criação de cursos de doutorado na
área de bioinformática, que resultou em dois cursos implementados recentemente no
país (UFMG e USP) que já apresentam dezenas de alunos em processo de formação
nessa área estratégica. Conclui-se, a partir do presente ensaio, que os estudos de
genomas são importantes para produzir um grande número de informações sobre a
anatomia molecular de uma espécie. Informações estas que poderão ser utilizadas
como pontos de partida para a produção de novos conhecimentos científicos através de
diferentes paradigmas experimentais, utilizando abordagens in vitro, in vivo ou in
silico, esta última sendo representada por metodologias baseadas na criação de
algoritmos dessa nova e importante ciência do século XXI, a bioinformática.
10.7. Brainstorm
1. Defina bioinformática com suas próprias palavras.
2. Sua visão sobre bioinformática e genoma foi modificada após a realização deste
curso? O que você pensava antes e pensa agora?
3. As pesquisas genômicas são científicas? O que você entende por ciência?
4. Como você definiria a expressão “anatomia molecular”?
5. Cite exemplos e discorra sobre a bioinformática tijolo.
6. Cite exemplos e discorra sobre a bioinformática peneira.
7. Cite exemplos e discorra sobre a bioinformática lupa e explique por que os
trabalhos de lupa normalmente não são publicados em revistas de bioinformática.
8. Você consegue pensar em mais algum paradigma da bioinformática atual?
9. Qual foi a aula mais interessante, em sua opinião? Por que?
10. Qual foi a aula que você achou mais complicada? Por que?
11. Dê sua apreciação geral sobre o curso realizado.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br
75
SOBRE O AUTOR
Francisco Prosdocimi de Castro Santos nasceu em Belo Horizonte, no ano de 1979, e é
atualmente professor e pesquisador da Universidade Católica de Brasília. Ministra
disciplinas de Biologia Molecular e Bioinformática para alunos da graduação em
Ciências Biológicas e Ciências Biomédicas. Na pós graduação em ciências genômicas,
Francisco ministra aulas de bioinformática, análises de genomas e filogenia molecular.
Francisco é biólogo (2001), mestre em Genética (2003) e doutor em Bioinformática
(2006) pela UFMG, tendo trabalho como pós-doutor na França durante um ano e meio
(2008/2009) e tendo passagens acadêmicas de média ou curta duração pela Inglaterra
(2005), Alemanha (2006) e Estados Unidos (2009).
Francisco tem ainda interesse por divulgação científica, história e filosofia da ciência
(http://tragodefilosofia.blogspot.com). Isso sem falar em suas modestas habilidades
em música e literatura (http://chicopros.blogspot.com) ou seus ideais democráticos,
ambientalistas, humanistas e liberais.
© Francisco Prosdocimi, 2007. Todos os direitos reservados ao autor da obra.
Críticas, sugestões, comentários e apreciações são bem-vindos franc @ icb . ufmg . br