- Faculty of Biosciences and Medical
Transcrição
- Faculty of Biosciences and Medical
i “I hereby declare that I have read this thesis and in my opinion this thesis is sufficient in terms of scope and quality for the award of Bachelor of Science (Biology)” Signature : ………………………………………………… Name : DR. TOPIK HIDAYAT Date : 6TH JULY 2012 MOLECULAR IDENTIFICATION OF FUNGUS THAT CAPABLE TO DEGRADE PERSISTENT ORGANIC POLLUTANT JULIANA NATASHA BINTI JAMALUDIN A report submitted in partial fulfilment of the requirement for the award of the Degree of Bachelor of Biology (Science) Faculty of Biosciences and Bioengeneering Universiti Teknologi Malaysia MAY 2012 ii I declare that this thesis entitled Molecular Identification of Fungus That Capable to Degrade Persistent Organic Pollutants (POPs) is the result of my own research except as cited in the references. The thesis has not been accepted for any degree and is not concurrently submitted and candidature of any other degree. Signature : ………………………………………….. Name : Juliana Natasha Binti Jamaludin Date : 6th July 2012 iii To my beloved father and mother and my lovely siblings iv ACKNOWLEDGEMENTS In the name of Allah, the Most Gracious and the Most Merciful. Alhamdulillah, all praises to Allah for the strengths and His blessing in completing this thesis. This thesis would not have been possible without the guidance and help from several individuals who contributed directly or indirectly and extended their valuable assistance in the preparation and completion of this study. First and foremost, my utmost gratitude to my supervisor, Dr. Topik Hidayat whose sincerity and encouragement I will never forget. Dr. Topik has been my inspiration as I hurdle all the obstacles in the completion this research work. I attribute to his encouragement and effort and without him this thesis, too, would not have been completed or written. One simply could not wish for a better or friendlier supervisor. I would like to express my appreciation to senior, Mohd Atiq, Chandrika, Farah Izana, Mohd Safwan and also Tengku Idzzan for their support and help towards my final year undergraduate project. My acknowledgement also goes to all the technicians and office staffs of Faculty Biosciences and Bioengineering for their co-operations. Sincere thanks to all my friends especially Farhanah, Hidayah, Sharifah, Ryan, Ragheed and others for their kindness and moral support during my study. Thanks for the friendship and memories. Last but not least, my deepest gratitude goes to my beloved father; Mr. Jamaludin Bin Jantan and also to my siblings for their endless love, prayers and encouragement. To those who indirectly contributed in this research, your kindness means a lot to me. Thank you very much. v ABSTRACT Persistent organic pollutant is one of the chemical that has been widely used around the world. However, this chemical is proven to be hazardous to human health and the environment and becoming the greatest problems of modern world-society. These compounds naturally degrade very slowly, so they remain in the environment for a long time. In this research, a fungi isolated from Hutan Rekreasi UTM were identified by molecular approach using 18s rDNA, which include 18s rRNA gene sequence and also the phylogenetic tree construction. The 18S rRNA gene were being isolated and amplified by Polymerase Chain Reaction (PCR) using universal primer, NS1 as forward primer and NS8 as the reverse primer from sample named S7. Next, the PCR product were sequenced by using tools for nucleotide which is Basic Local Alignment Tool for nucleotide (BLASTn) and being compared with the sequences retrieved from GeneBank database of National Center of Biotechnology Information (NCBI). The sequence then was analyzed and phylogenetic genetic tree were constructed by using software called Molecular Evolutionary Genetic Analysis (MEGA) version 5.0 to describe and show us the similarity of the sample’s sequence with the other fungi in the database sequence. The BLASTn analysis shows that S7 was closely related to Meyerozyma guilliermondii (JN546137), given the highest similarity to the database. In conclusion, Meyerozyma guilliermondii can be used in degrading persistent organic pollutant in the environment. vi ABSTRAK Bahan-bahan pencemar organik persisten merupakan salah satu bahan kimia yang digunakan secara meluas di serata dunia. Walau bagaimanapun, bahan kimia ini telah menjadi masalah terbesar bagi masyarakat kini kerana ia telah terbukti membahayakan kesihatan manusia sejagat dan juga alam sekitar. Secara semula jadinya, bahan-bahan kimia ini terurai dengan perlahan menyebabkan ia bertahan lama di dalam alam sekitar. Dalam kajian ini, kulat yang diambil daripada Hutan Rekreasi UTM telah dikenal pasti menggunakan pendekatan 18S rRNA, melalui penjujukan gen dan pembinaan pokok filogenetik. Gen 18S rRNA dipencilkan daripada sampel kulat yang dilabel sebagai S7 melalui Polymerase Chain Reaction (PCR) menggunakan primer NS1 dan NS8. Produk PCR dirangkai dan dibandingkan dengan jujukan yang terdapat di dalam pangkalan data Bank Gen dari National Center of Biotechnology Information (NCBI) dengan menggunakan perician carian untuk nukleotida iaitu Basic Local Alignment Search Tool for nucleotide (BLASTn). Urutan yang telah dirangkai ini juga dianalisis dan pokok filogenetik dibina menggunakan perisian Analisis Genetik Evolusi (MEGA) versi 5.0 untuk menunjukkan kesamaan yang terdekat dengan jujukan DNA dari pangkalan data. Keputusan analisis BLASTn menunjukkan sampel S7 berkait rapat dengan Meyerozyma guilliermondii (JN546137). Kesimpulannya, Meyerozyma guilliermondii boleh digunakan untuk merungkai bahan-bahan pencemar organik persisten dalam alam sekitar. vii TABLE OF CONTENTS CHAPTER 1 2 3 TITLE PAGE DECLARATION ii DEDICATION iii ACKNOWLEDGEMENTS iv ABSTRACT v ABSTRAK vi TABLE OF CONTENTS vii LIST OF TABLES ix LIST OF FIGURES x INTRODUCTION 1 1.1 Problem Background 1 1.2 Problem Statement 2 1.3 Objectives of Study 2 1.4 Scope of Study 3 1.5 Research Significance 3 LITERATURE REVIEW 5 2.1 Persistent Organic Pollutants: A Global Issue 5 2.2 Fungi in Bioremediation 10 2.3 Phylogenetic Tree 12 MATERIALS AND METHODS 14 3.1 Experimental Design 14 3.2 Preparation of Materials 15 3.2.1 Preparation of Potato Dextrose Broth (PDB) 15 3.2.2 Preparation of 10X TAE Buffer 15 viii 3.2.3 Preparation of 1%(w/v) Agarose Gel 15 3.3 Fungi Sampling 17 3.4 Extraction of Fungal DNA 17 3.5 Polymerase Chain Reaction (PCR) 18 3.6 PCR Product Purification 20 3.7 DNA Sequencing 21 3.8 Basic Local Alignment Search Tool for Nucleotide 21 (BLASTn) 3.9 4 Phylogenetic Tree Construction 21 RESULTS AND DISCUSSION 22 4.1 Culturing Fungi in Potato Dextrose Broth (PDB) 22 4.2 Gel Electrophoresis for Genomic Extraction 23 4.3 PCR Result 24 4.4 DNA Purification 25 4.5 DNA Sequencing 25 4.6 Homology Similarity Search By Using Basic Local 26 Alignment Search Tool for Nucleotide (BLASTn) 5 4.7 Multiple Sequence Alignment 28 4.8 Phylogenetic Tree Construction 28 CONCLUSIONS AND FUTURE WORKS 30 5.1 Conclusion 30 5.2 Future Works 31 REFERENCES 32 APPENDIX 37 Appendix A 37 Appendix B 40 ix LIST OF TABLES TABLE NO. TITLE PAGE 3.1 Amount of components used in PCR reaction. 19 3.2 Thermal cycle profile for PCR reaction of 18S rRNA. 20 3.3 Primers used for 18S rRNA amplification and 20 sequencing. 4.1 Purification result of sample S7 by using nanodrop. 25 x LIST OF FIGURES FIGURE NO 2.1 TITLE Structural formula of polychlorinated biphenyls (PCB), PAGE 6 C12H(10-n)Cln. 2.2 Structural formula of polychlorinated dibenzo-p-dioxins 6 (PCDD), C12N(8-n)ClnO2 , n=1-8 2.3 Structural formula of polychlorinated dibenzofurans 7 (PCDF), C12H(8-n)ClnO, n=1-8 2.4 Structural formula of aldrin, C12H8Cl6 8 2.5 Structural formula of dieldrin, C12H8Cl6O 8 2.6 Structural formula of endrin, C12H8Cl6O 9 2.7 Structural formula of chlordane, C10H6Cl8 9 2.8 Structural formula of heptachlor, C10H5Cl7 10 2.9 Structural formula of Dichlorodiphenyltrichloroethane 10 (DDT), C14H9Cl5 2.10 Universal phylogenetic tree shows the three major 12 domains. 2.11 Detailed tree for eukaryotic shows the trunk branching to 13 kingdoms. 2.12 Detailed tree for the archaea domain. 13 3.1 Flow chart for identification of fungi using molecular 14 approach. 3.2 1kb Promega Ladder 17 4.1 Fungi sample 14 days after culture in Potato Dextrose 22 Broth (PDB). xi 4.2 Analysis of genomic extraction of sample S7 using 1% 23 (w/v) agarose gel electrophoresis. 4.3 Analysis of polymerase chain reaction (PCR) of the 24 amplified fragment from fungi sample S7 in 1% (w/v) agarose gel electrophoresis 4.4 NS1 sequence for sample S7 26 4.5 Blast result for sample S7. 27 4.6 Phylogenetic tree of sample S7 29 1 CHAPTER 1 INTRODUCTION 1.1. Problem Background Throughout the past century, industrial, military, and farming activities have released many organopollutants into the environment. Since World War II, there have been thousands of chemicals introduced for commercial use. Most of these chemicals have been really helpful in controlling the pest and disease, and have increase crop production and industry. Persistent organic pollutant is one of the chemicals that has been widely used around the world. However, this chemical has been proven to be hazardous to human health and the environment thus becoming the greatest problems of modern world-society. These compounds naturally degrade very slowly, so they remain in the environment for a long time. The most important and effective way to remove the compound contained in the pesticides from the environment is by using biological decomposition. Microorganisms have the capability to interact, both chemically and physically, with substances leading to changes in the structure or absolute degradation of the target molecule (Raymond et al., 2001; Wiren-Lehr et al., 2002). The main transformers and pesticides degraders include bacteria, fungi and actinomycetes (De Schrijver and De Mot, 1999). The primary focus of this review is to identify fungi that can undergo xenobiotic degradation to help in degrading the POPs as the traditional waste disposal methods such as incineration and landfilling need a longer time to degrade 2 it. The fungi used in this experiment will also be characterize based on its molecular to construct a phylogenetic tree to help us know which type of fungal group is suitable in the degrading the POPs 1.2 Problem Statement Humans can be exposed to POPs through food, accidents and the environment (including indoors). Exposure to POPs, either acute or chronic, can be associated with a wide range of adverse health effects, including illness and death (Siripong, 2009). Laboratory investigations and environmental impact studies in the wild have implicated POPs in endocrine disruption, reproductive and immune dysfunction, neurobehavioural and disorders and cancer (Ritter, 1995). More recently some POPs have also been implicated in reduced immunity in infants and children, and the concomitant increase in infection, also with developmental abnormalities, neurobehavioural impairment and cancer and tumour induction or promotion. Some POPs are also being considered as a potentially important risk factor in the etiology of human breast cancer It is a cheaper method to decontaminate toxic waste sites in the United States rather than using traditional waste disposal methods such as incineration and landfill sites (Reddy and Mathew, 2001) Due to this problem and the need of a reasonable solution, a quick, cost-effective, ecologically responsible method of cleanup is really needed. One of the mechanisms of decontamination that may be suitable for all these requirements is bioremediation (Sarah, 2004) 1.3 Objectives of Study The objectives of this study include: 3 a) To identify fungus that is capable of degrading persistent organic pollutant (POP). b) To construct a phylogenetic tree of the isolated fungi. 1.4 Scope of the Study The scope of the study includes two main parts which excludes an in vivo samples provided by Dr Tony from EPASA, UTM which was collected in Hutan Rekreasi UTM. The first part is in vitro a study which covers the method of culturing the fungi; genomic extraction by using Wizard Genomic Purification Kit by Promega, polymerase chain reaction by using i-taq DNA Polymerase kit from Intronbio and the use of gel electrophoresis. The second part of this study is in silico which is bioinformatic data analysis. The sequence that is being extracted will be sent to the gene bank to be analysed. After receiving the result from the gene bank, further analysis will be done by using basic local alignment search tool (BLAST) and MEGA to know the fungi species and be able to construct the phylogenetic tree to compare the fungi genetically. 1.5 Research Significance Knowing the fungi that can degrade the persistent organic pollutant (POPs) will help us in controlling the pollution and reduces the effects on human health in many ways. Microbial degradation is an environmentally friendly and a cost competitive alternative to physico-chemical decomposition processes for the treatment of industrial effluents. 4 It is recommended that degradation products should be included in hazard assessments to gain a more accurate insight into the environmental risk of chemicals. The result of this project could also be combined with information on the toxicity of the degradation products. This should be helpful to provide further insight into the significance of degradation products for environmental hazard assessments. 5 CHAPTER 2 LITERATURE REVIEW 2.1 Persistent Organic Pollutants: A Global Issue. Persistent Organic Pollutants (POPs) can be described as chemical compounds that resist photolytic, chemical, and biological degradation. POPs are usually halogenated and can be characterised by high lipid solubility and low water solubility which will lead to the bioaccumulation in fatty tissues (Cumanova et al., 2007). POPs can be catagorized as a toxic substance as well as being prone to longrange transport (Nostrom et al., 1988). According to Hailong (2010), POPs can be classified into three categories: (1) industrial chemical product such as polychlorinated byphenils (PCBs); (2) Unintentionally formed by products such as hexachlorobenzene (HCB), polychlorinated dibenzo-p-dioxins (PCDD), polychlorinated dibenzo-p-furans (PCDF) and polychlorinated byphelis (PCBs); (3) and pesticides such as aldrin, dieldrin, endrin, mirex, toxaphene, hexaclorobenzene, heptachlor, chlordane and dichlorodiphenyl trichloroethane (DDT). Industrial chemicals was first discovered as environmental pollutants in 1966, polychlorinated biphenyls or PCB compound as in Figure 2.1 have been found throughout the world in various places such as water, sediments, bird tissue and also fish tissue (El-Shawawi et al.,2009). It is mainly used as additives and also in electrical equipment for example in lubricants, adhesives and hydraulic fluids (Vit, 1992). PCBs are a class of chlorinated hydrocarbons that consist of two benzene rings joined by a carbon-carbon bond, with chlorine atoms substituted on any of all the remaining 10 carbon atoms. 6 Figure 2.1 Structural formula of polychlorinated biphenyls (PCB), C12H(10-n)Cln. Unintentionally POPs are the by-products formed from combustion or chemical process that take places when chlorine compounds are present. Polychlorinated dibenzo-p-dioxins (PCDD) and polychlorinated dibenzofurans (PCDF) are unintentionally formed of persistent organic pollutant whereas dioxins and furans are chemical substances that are released by a thermal processes which involves organic matter together with chlorine resulting from incomplete chemical reactions and combustion. PCDDs and PCDFs consist of tricycle aromatic compounds, two benzene ring connected by two oxygen atoms (for PCDDs) or one oxygen atom (for PCDFs) whiles the hydrogen atoms can be replaced by a maximum 8 chlorine atoms. Figure 2.2 and 2.3 shows the structural formula of polychlorinated dibenzo-p-dioxins (PCDD) and Structural formula of polychlorinated dibenzofurans (PCDF) respectively. Figure 2.2 Structural formula of polychlorinated dibenzo-p-dioxins (PCDD), C12N(8-n)ClnO2 , n=1-8 7 Figure 2.3 Structural formula of C12H(8-n)ClnO, n=1-8 polychlorinated dibenzofurans (PCDF), Physically, dioxins exists as colourless compound while furans exist as nonodorous white-needle shaped crystals. Both PCDD (Figure 2. 2) and PCDF (Figure 2.3) were shown to cause developmental toxicity, cancers, mutagenecity and endocrine disruption to animals and most of all to humans. (Eljarrat et al., 2004) Intentionally POP compounds were produced which lead to a reaction with chlorine. These types of compound have high lipopolicity, usually high neurotoxicity and organic molecules that link to chlorine atoms called organochlorine compounds (OCs). Chlorinated insecticides such as dichlorodiphenylchloroethane (DDT) are one example of OCs. Other than that, chemical that can be classified under POPs pesticides are aldrin, dieldrin, endrin, mirex, toxaphene, hexachlorobenzene, heptachlor and chlordane. Aldrin as in figure 2.4 can be characterized as white and odourless crystals when they are pure. It can be either non-corrosive or slightly corrosive to certain metals. Aldrin is readily converted to dieldrin in the environment and is widely used to protect crops. Aldrin is being used to control soil insects such as termites, corn rootworm and grasshoppers. Although aldrin is effectively used to protect wooden structures from termites, the presence of aldrin is toxic to humans. 8 Figure 2.4 Structural formula of aldrin, C12H8Cl6 Dieldrin as in figure 2.5 is closely related to aldrin as it is the stereoisomer of the aldrin. It might be present as white crystals or pale tan flakes and odourless. The used of dieldrin is just as important as aldrin. Dieldrin residues can be detected in water, soil, air, fish, birds and mammals including human breast milk. Chemically, dieldrin has a low phototoxicity. Figure 2.5 Structural formula of dieldrin, C12H8Cl6O Figure 2.6 is referred to endrin which is a white odourless crystalline solid when pure and exists as a stereoisomer of dieldrin. Endrin is an organochlorine foliar insecticide that has been used to control most of the agricultural pests mostly on cotton, rice, sugarcane and grain. It also acts as a rodenticide to control cutworms, mice and borers. Endrin is highly persistent in soil and rapidly metabolised by animals and does not accumulate in fat like other compound with similar structure. It is highly toxic to fish, aquatic invertebrates and phytoplankton. 9 Figure 2.6 Structural formula of endrin, C12H8Cl6O Chlordane which can be referred to in Figure 2.7 can be seen as a colourless to amber-coloured viscous liquid with a pungent smell similar to chlorine. It has been widely use as an insecticide to control the population of cockroaches, ants, termites and other pests. It’s been detected in arctic air, water and organism. Figure 2.7 Structural formula of chlordane, C10H6Cl8 Based on figure 2.8, heptachlor is a white to light tan compound, waxy solid or crystals with a camphor-like odour. It is a nonphytotoxic at insecticidal concentrations and persistent dermal insecticides with some fumigant action. It is used in soil and seed treatment to protect corn and small grains from pest. Heptachlor is highly insoluble in water and soluble in organic solvent and also very toxic to mammals. 10 Figure 2.8 Structural formula of heptachlor, C10H5Cl7 Dichlorodiphenyltrichloroethane (DDT) as in Figure 2.9 appears as an odourless colourless crystal or white powder. It was widely used during the World War II to protect troops and civilians from the spread of vector borne diseases such as malaria and thyphus. DDT is highly insoluble in water and is soluble in most organic solvents. DDT is highly toxic to fish, acutely toxic to birds and in the human organism; DDT exhibits oestrogen-resembling and probable carcinogenic properties. Figure 2.9 2.2 Structural C14H9Cl5 formula of Dichlorodiphenyltrichloroethane (DDT), Fungi in Bioremediation Fungi are part of the eukaryotic family, they include microorganisms such as yeast, moulds and mushrooms. These organisms are categorized as a kingdom, Fungi, is totally different from plants, animals, and bacteria. One major difference between fungi and plants is that fungal cells have cell walls that made up of chitin, unlike that of the cell wall of plants, which contain cellulose (Bowman, 2006). Fungi comprise of a variety of microorganisms and are numerically among the most 11 abundant eukaryotes on earth’s biosphere. Most fungi can be found in soil, on dead matter, and as symbionts of plants, animals, or other fungi. Fungi perform a crucial role in the breakdown of organic matter and have important roles in nutrient cycling and exchange. Bioremediation is defined as the purpose of biological processes as a treatment to pollution. Most research within the field of bioremediation has focused on bacteria, with fungal bioremediation (mycoremediation) attracting concern within the past two decades. Processes of natural bioremediation of lignocelluloses occupy a variety of organisms, but predominantly involving fungi as white rot fungi as it can withstand toxic levels of most organopollutants (Weinstock, 1997 and Aust et al., 2004). The ability of a fungus to facilitate remediation of contaminated environment is becoming an intense interest as it offers a low-cost and ecologically acceptable approach to dissipating pollutants (Anderson, 1993). Many ectomycorrhizas fungi produce POP-degrading enzyme such as laccase, tyrosinasses, catechol oxidases, manganese peroxidises (MNPs), and lignin peroxidises (LIPs) (Meharg et. al., 2000). LIPs, MNPs and laccases are three classes of enzyme that are important in lignin degradation and are stimulated by nutrient limitation (Mansur et al., 2003; Aust et al., 2004). These three enzymes can be suppressed completely in the high nitrogen levels media (Reddy et al, 2001). LIPs (EC 1.11.1.7) are relatively non-specific, which can degrade random structures of lignin (Reddy, 1995). This characteristic enables the enzyme to oxidize a variety of xenobiotics compounds that share similar characteristics to lignin substructures. MNPs (EC 1.11.1.7) are able to oxidize variety phenolic substrate (Kirk, 1987) whereas laccase (EC 1.10.3.2) utilise molecular oxygen as an oxidant and also oxidize phenolic substrate to phenoxy radicals (Hatakka, 1994) 12 2.3 Phylogenetic Tree A phylogenetic tree which is also called as evolutionary tree is a diagram with branches that shows the evolutionary relationships among various biological species or other entities based on their similarities and differences in their genetic characteristics. Phylogeny is based on the concept of genetic evaluation which depends on additional changes in the chromosomal DNA sequences leading progressively to new species (Rittmann and McCarty, 2001). The phylogeny tree is a perceptive that all new species have one evolutionary progenitor that gives root of phylogenetic tree, and the root branches into species (Rittmann and McCarty, 2001). Universal Ancestor (the “root”) Figure 2.10 Universal phylogenetic tree shows the three major domains adapted from Rittmann and McCarty, 2001. The phylogenetic tree explains that all living organisms on earth can be divided into three major domains, which are bacteria, archaea and eukarya. The two domains which are archaea and bacteria are grouped as prokaryotes and these domains are at the trunk of the phylogenetic tree (Rittmann and McCarty, 2001). 13 Figure 2.11 Detailed tree for eucaryoticshows the trunk branching to kingdoms (Rittmann and McCarty, 2001). Every kingdom is separated into smaller branches that gives details between related species. The liner space between related species and others along the tree quantifies their genetic distance. Figure 2.5 shows the close relationship between plants and fungi (Rittmann and McCarty, 2001). Figure 2.12 Detailed tree for the archaea domain (Rittmann and McCarty, 2001). The universal presence of small subunit rRNA become the standard data for molecular polygenetic of fungi diagnosis (Khachatourians and Arora, 2003). 14 CHAPTER 3 MATERIALS AND METHODS 3.1 Experimental Design The experiment involves both in vitro and in silico parts, in vitro meaning that this part of the experiment is being done inside the laboratory, whilst in silico is using bioinformatics analysis needed to prove the experiments theory. Fungi Sampling Agarose Gel Electrophoresis Purification of PCR Product Preparation of Potato Dextrose Broth (PDB) Polymerase Chain Reaction (PCR) DNA Sequencing Agarose Gel Electrophoresis Homology Similarity Search by BLASTn and Phylogenetic Tree analysis Genomic Extraction Figure 3.1 Flow chart for identification of fungi using molecular approach. 15 3.2 Preparation of Materials 3.2.1 Preparation of Potato Dextrose Broth (PDB) Potato dextrose broth is a common microbiological growth media made from potato infusion and dextrose. Potato dextrose broth is the most widely used medium for growing fungi and bacteria which attack living plants or decaying dead plant matter. All fungal strains were freshly cultured aerobically in PDB (1.2g in 50ml distilled water) at 30°C for two weeks until they reached full growth before extraction. Next, the PDB which contain the fungal sample were incubated in the orbital shaker to maximize their grow 3.2.2 Preparation of 10X TAE Buffer TAE buffer is a buffer solution that consists of Tris base, acetic acid and Ethylenediaminetetraacetic acid (EDTA). In this experiment, TAE buffer is used in agarose gel electrophoresis typically for the separation of nucleic acid such as DNA and RNA. It is also used as running buffer in garose gel electrophoresis. To prepare 1X TAE buffer from 50X TAE buffer, 20 mL 50x TAE buffer is diluted in 1 liter distilled water and mix it thoroughly. 3.2.3 Preparation of 1% (w/v) Agarose Gel. DNA Agarose gels can be used to separate and visualize DNA of various sizes ranging from 50 base pair to several mega bases using specialized apparatus. The distance between DNA bands of a given length is determined by the percentage 16 of agarose used for the gel. Firstly 0.5g of agarose gel is weight before mixing it with 50ml Tris-Acetate EDTA (1X TAE buffer) in Erlenmayer flask to form 1% (w/v) agarose gel. The buffer should not occupy more than 50% of the volume of the flask. Next, the agarose solution is heated on the hot plate to allow all of the grains of agarose to dissolve. After all the grains are dissolved, the solution is allowed to cool to cool down at room temperature for 5 minutes before adding 1µl of Ethidium bromide (EtBr) into the solution. Next, the comb is positioned above the plate, thus allowing a complete well to be formed when agarose solidifies. The agarose solution will then being poured into the tray and the formation of air bubble should be avoided under or between the teeth of the comb. After about 30 minutes the gel has solidified, the comb is then removed and the gel is placed into the electrophoresis tank. 1X TAE buffer is added into the tank to cover the gel until the top of the well is submerged. 5 µl samples are mixed with 1µl loading buffer. The mixture is loaded slowly into the well using a micropipette and run with 90V voltage for 30 minutes. The lid of the tank is closed and making sure that the samples are placed at the correct end of the apparatus with respect to the anode and cathode. The unit is working when we see bubbles formed in the buffer due to the electrical field that has been created; We are then able to see the dye moving down the gel. After the electrophoresis is complete, the molecules in the gel can be visible under UV light or can be viewed using UV transiluminator. Figure 3.2 shows 1kb ladder used in this study. 17 Figure 3.2 3.3 1kb Promega Ladder Fungi Sampling The fungi were sampled from Hutan Rekreasi UTM. It was then tested by Dr. Tony from IPASA, UTM if the fungi were able to degrade persistent organic pollutants (POPs). After the fungi was proved to be able to degrade POPs, it was then further analyzed by me to identify the fungi species. 3.4 Extraction of Fungal DNA DNA extraction is the first step in many protocols when the ultimate goal is to analyze a portion of the DNA. Careful extraction technique will result in pure, clean DNA that can be readily analysed. In this experiment we used a simple extraction method (Al-Samarrai and Schmid, 2000) to extract DNA from unknown 18 fungi. The genomic DNA of sample S7 was extracted using Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions. Firstly, a small lump of mycelia was added to liquid nitrogen and ground to a fine powder using a mortar and pestle. Then the powder is put into a 1.5 ml microcentrifuge tube which contains 600μl of nuclei lysis solution. Next, 300μl of cell lysis solution is added before the solution mixture is incubated at 65oC for 30 minutes. 5μl of RNAse solution is added to the cell lysate and the tube containing the mixture is inverted 2-5 times. The sample is then allowed to cool down to room temperature for 5minutes before the addition of 200μl of protein precipitation solution; then vortex it vigorously. After that, the microcentrifuge tube containing the mixture is place in the centrifuge for 3 minutes at 13000rpm. The supernatant which contains DNA is carefully removed into a new microcentrifuge tube containing 600μl of 100% isopropanol kept at room temperature. The solution is mixed gently by inversion until thread-like strands of DNA form a visible mass before centrifuge again for 1 minute at high speed. Next, the supernatant was discarded and 600μl of 70% alcohol was added into the tube to wash the DNA. The tube was centrifuge again at 13000rpm for another minute. The supernatant was discarded and the tube was inverted on absorbent paper to air dry the pellet for 15 minutes. 100μl of DNA rehydration solution was added to the tube. Finally, the tube was incubated at 65oC for 30 minutes. The DNA was stored at -20oC for further use. 3.5 Polymerase Chain Reaction (PCR) Polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of DNA generating a thousand or millions of copies of particular DNA sequence. The method depends on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction of DNA melting and enzymatic replication of the DNA. 19 In this experiment, the DNA was amplified by PCR, using Applied Biosystem (ABI) thermal cycler. The primer pair NS1 and NS8 was used to amplify the conserve region. Table 3.1 shows the components and the volume required for each component used in PCR of 18S rRNA genes from sample S7. The DNA amplification was carried out by using the Perkin Elmer Gene AmpR PCR thermocycler for 35 cycles. The steps were indicated in Table 3.2. The 18S rRNA genes from genomic sample S7 were PCR amplified by using universal primers, NS1 as the forward primer and NS8 as the reverse primer. The details of the primers are shown in Table 3.3. Table 3.1: Amount of components used in PCR reaction Components Volume (µl) 10x PCR buffer 4.0 dNTP 4.0 Forward Primer 2.0 Reverse Primer 2.0 Genomic Template 2.0 i-Taq Polymerase 1.0 Distilled water 25.0 Total 40 20 Table 3.2 Thermal cycle profile for PCR reaction of 18S rRNA. Stage Temperature ( oC) Duration Initial denaturation 94 3 min Denaturation 94 30 sec Annealing 55 30 sec Extension 72 2 min Final extension 72 10 min Hold 4 ∞ 35 cycles Table 3.3: Primers used for 18S rRNA amplification and sequencing (White et al., 1991). Primers NS1 (forward) NS8 (reverse) 3.6 Sequences 5’-GTAGTCATAAGCCTTGTCTC-3’ 5’-TCCGCAGGTTCACCTACGGA-3’ Molecular Weight 5785 6078 PCR Product Purification PCR clean up or purification was carried out by using QIAquick PCR Purification Kit from Qiagen according to the manufacturer’s instruction and the concentration of the PCR product was checked using the Nanodrop instrument. 100 µl of PB buffer was added into 20µl of PCR sample and mixed. The QIAquick spin column was placed in a provided 2ml collection tube. The sample was applied to the QIAquick column and centrifuge for 60 second to bind the DNA. The flow through is being discarded and QIAquick column was being placed back into the same tube. 0.75ml buffer PE was added to the QIAquick column before centrifuge it for another 60 second. Flow through was being discarded and the QIAquick column was placed back in the same tube and the column was being centrifuge for another minute at maximum speed. Next, the QIAquick column was placed into a clean 1.5 ml microcentrifuge tube. 50 µl of buffer EB was added to the center of the QIAquick membrane and centrifuge the column for one minute to elute the DNA. 21 3.7 DNA Sequencing The PCR product of 18s rRNA gene from sample S7 as well as the universal primer which is NS1 and NS8 were sent to 1st BASE Laboratories Sdn. Bhd., Malaysia for DNA sequencing. The samples were applied to Biosystem analyzer by capillary electrophoresis sequencing. 3.8 Basic Local Allignment Search Tool for Nucleotide (BLASTn) After the PCR product was sequenced, Basic Local Alignment Search Tool, or BLAST was used to determine the species of the fungi that we had extract. BLAST is an algorithm for comparing primary biological sequence information, such as the amino-acid sequences of different proteins or the nucleotides of DNA sequences. A BLAST search enables a researcher to compare a query sequence with a library or database of sequences, and identify library sequences that resemble the query sequence above a certain threshold. First Base will give us the sequence of the DNA in FASTA format. Electropherogram is used to determine whether the sequence is good or not before being modified and key in into the software. The software also could help us in establishing phylogeny, construct DNA mapping and can locate common genes in two related species. 3.9 Phylogenetic Tree Construction The full length of DNA sequence of sample S7 was compared with the nucleated sequences from Genbank Database and a Phylogenetic Tree was constructed using Molecular Evolution Genetic Analysis software (MEGA) version 5.0. 22 CHAPTER 4 RESULTS AND DISCUSSIONS 4.1. Culturing Fungi in Potato Dextrose Broth After 2 weeks of incubation, it can be seen on Figure 4.1 that S7 fungi grew well in Potato Dextrose Broth (PDB). The reason why potato dextrose broth is was chosen as the medium to culture the unknown fungi (S7) is because PDB is a general medium for yeast and molds that made up of potato infusion and dextrose. The growth of bacteria is inhibited by the low pH number. It is easy to handle the fungi since it grew properly in the PDB. Figure 4.1 Fungi sample 14 days after culture in Potato Dextrose Broth (PDB). 23 4.2. Gel Electrophoresis for Genomic Extraction The genomic DNA from fungi sample S7 was isolated using Wizard Genomic DNA Purification kit (Promega). The isolated fungal genomic DNA was stored at -20oC prior to study. The purified DNA was examined by using agarose gel electrophoresis and observed under UV illumination. Figure 4.2 shows the isolated genomic DNA of sample S7 with five replicates. The band of genomic DNA of sample S7 which is more than 10kb can be seen at lanes 2 to 6 where as lane 1 was loaded with the DNA ladder (1kb). Based on previous research made by Saad et al., 2004, he stated that the size of genomic DNA isolation of a fungi should be more 10000 base pairs which means the sample band should be above the 10000 base pairs ladder band. Ladder (1kb) S7 S7 S7 S7 S7 10000 bp Figure 4.2 Analysis of genomic extraction of sample S7 using 1% (w/v) agarose gel electrophoresis. 24 4.3 PCR Result 18S rRNA from the fungi sample S7 was amplified by PCR using universal primer; NS1 and NS8. The primers contain of 20 nucleotides and were reported to amplify almost the full 18S rRNA from fungi (White et al., 1991) Based on previous research done by Ragheed, 2011, he stated that the expected length of sequence being amplified by using primer NS1 and NS8 should be about 1800 base pairs. The amplified fragment was analyzed using agarose gel electrophoresis and being observed under UV illumination. This was shown on Figure 4.3 and the 18S rRNA genes were successfully amplified by NS1 and NS8 primers. Ladder (1kb) 2000bp 1500bp Figure 4.3 S7 S7 S7 S7 S7 1800bp Analysis of polymerase chain reaction (PCR) of the amplified fragment from fungi sample S7 in 1% (w/v) agarose gel electrophoresis. 25 4.4 DNA Purification For the PCR purification using QIAquick PCR Purification Kit, Table 4.1 shows that the sample preparation requirement that is needed by to be fulfil before sending the sample to 1st BASE Laboratories Sdn. Bhd., Malaysia for DNA sequencing. As the PCR product obtained from this study was 1800 base pair, so the sample concentration should be exceeded 40ng/µL. Table 4.1 shows that the result of sample S7 by using nanodrop method. Table 4.1 Purification result of sample S7 by using nanodop. Sample 260/280 260/230 Ng/µl S7 1.82 1.91 181.7 Based on Table 4.1, it shows that the concentration of the sample S7 had fulfilled the sequencing concentration requirement. The ratio of 260/280 was actually used to assess the purity of the DNA and a ratio of approximately 1.8 is considered as pure DNA. Meanwhile, 260/230 ratio is used as a secondary measure for nucleic acid purity. The common range of this ratio should be ranging between 2.0 to 2.2 and it was suppose to be slightly higher than the 260/280 ratio. However, the ratio of 260/230 for sample S7 was not in between the range indicates that the sample shows the presence of contaminants. 4.5 DNA Sequencing PCR products of fungi sample S7 were purified and sent with primers NS1 and NS8 to the 1st BASE Laboratories Sdn. Bhd., Malaysia for DNA sequencing. 26 Bioedit version 7.0.5.3 was used to view the sequencing result s generated by the 1 st BASE Laboratories Sdn. Bhd. Because of some problems that occured during the sequencing period of sample S7, only NS1 managed to get sequenced. The size of the sequences obtained is 937 nucleotides. These are shown in Figure 4.4 and Figure 4.5. As the purification of PCR product shows the presence of contaminants, the raw result of the sequencing NS1 can support this statement. Based on figure 4.4, we can see that there is a lot of letter ‘N’ presence in it. Letter N indicate that there are uncertainties of the nucleotide present and might be because of the broad peak or a sets of overlaying peak shown by the chromatogram. NNNCAANNNGNGNNGTATATGCTTGTNTCNTAGGGAACCTGCGGGGTAGNAAATGCTTGTC TCCCTTGTTAACCCGCGGAAGTAGGGGAAGTTTGTTTTCCTCGTGGAACCTCCGGAAACGGCG AAAACCTGTTTCCCGGGAGGGACGCGTTATTAGATAAAAAATCAATGCTCTTTGAGCTCTTTG ATGATTCATAATAACTTTTCGAATCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTG CCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATNGTTTCAACGGGTAACGGGGAATAA GGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGC GCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATACATAACGATACAGGGCCCTT TCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCA AGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTT AAAAAGCTCGTAGTTGAACTTTGGGCTTGGTTGGCCGGTCCGCCTTTTTGGCGAGTACTGGAC CCAACCGAGCCTTTCCTTCTGGCTAACCATTCGCCCTTGTGGTGTTTGGCGAACCAGGACTTTT ACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATATTAGCATGGAATAATA GAATAGGACGTTATGGTTCTATTTTGTTGGTTTCTAGAACATCNTAATNTTAATAGGAACGGTC GGGGGCATCAGTATTTCAGTGNAAGANNTGAAATTCTTAAATTACTGAAGACTAATTCTGNN AAACATTTGCCAGGACGTTTTCTTAATAAANACCAAAGTTAGGGGATCGATNTTATCCG Figure 4.4 4.6 NS1 sequence for sample S7 Homology Similarity Search by Using Basic Local Alignment Search Tool (BLAST) BLAST is a tool used to find out a sequence in database by submitting a particular sequence and it applies a statistical analysis which is used to compare the 27 significance of each match. The sequence matching can be homologous or related to the particular sequence and there are many types of BLAST including BLASTp for amino acids, BLASTn for nucleotides, BLASTx, and other types (Branes, 2007). BLAST is one of the most important bioinformatics software because it is effective and fast to identify the unknown sequence data. The software can be updated and is developed by NCBI (National Center for Biotechnology Information) (Bedell et al., 2003). In this study, the full sequences of sample S7 were submitted as query to BLASTn to find homology and similarity after the sequence had been edited using BIOEDIT software,. The full number of bases viewed was near to full length of 18S rRNA gene. The scores obtained for sample S7 were shown in the Figure 4.5. Figure 4.5 Blast result for sample S7. 28 On the BLAST result based on Figure 4.5, we can see that Meyerozyma guilliermondii (JN546137.1) appear as the first result with the query coverage about 83% and the maximum identical about 97%. However, this result is still uncertain. To support the result, phylogenetic tree was constructed by using Molecular Evolutionary Genetic Analysis (MEGA) software. 4.7 Multiple Sequence Alignment Multiple sequence alignment is a tool that being used to align three or more biological sequences generally protein, DNA or RNA. In most cases, the set of query sequence are assumed to have an evolutionary relationship which mean they might come from the same ancestor. In this study, ClustalX is being used to align all the 10 sequences which one of them is the sequence of sample S7 and the other 9 is the sequences that have been retrieved from the gene bank. 4.8 Phylogenetic Tree Construction Phylogenetic tree shows the evolutionary relationship among organisms and genes which show their comparability and closeness by using the structure of tree (Salami and Vandamme, 2003). The most common method used to construct the phylogenetic tree is neighbor joining method because it is simple and fast. MEGA software is one of the best software that available for constructing neighbour joining tree (Hall, 2008). Figures 4.6 show the rooted and scaled phylogenetic trees of sample S7 constructed by using neighbor joining method with 1000 bootstrap replicates. Saccharomyces cerivisae was used as the out group of the tree. 29 Figure 4.6 Phylogenetic tree of sample S7 From the Figure 4.6 we can see that sample S7 is closely related to Meyerozyma guilliermondii (JN546137.1) as they were sisters in the tree with slightly different in terms of their genetic material and come from the same ancestor which is Pichia guillermondii 30 CHAPTER 5 CONCLUSIONS AND FUTURE WORKS 5.1 Conclusions In this study, fungi S7 that was isolated at Hutan Rekreasi UTM were successfully being identified using 18S rRNA molecular approach. The fungal DNA were isolated by using Wizard Genomic DNA Purification Kit (Promega). The 18S rRNA genes were being amplified by using polymerase chain reaction (PCR) and sent for DNA sequencing. The fungal sequence and phylogenetic tree were assembled and analyzed by using several bioinformatics software such as ClustalX, Bioedit and MEGA. The molecular approach using 18S rRNA identification which gave a more reliable result compared to conventional method which identify the fungi by using microscopic examination and based on morphology was successfully used in this study. It is also proven that based on molecular analysis, it can be conluded that sample S7 as Meyerozyma guillermondii pollutants (POPs). which can be used to degrade persistent organic 31 5.2. Future Works 1. The same method can also be used to identify other fungal samples from different natural sources like soil, water and clinical samples. 2. The potential of S7 can also be explored in application study such as biodegradation toxic dye compounds. 32 REFERENCES Al-Samarrai, T.H., Schmid, J. (2000). A simple method for extraction of fungal genomic DNA. Lett. Appl. Microbiol. 30:53-56. Anderson W.C. (1993). Waste Management: WASTECHTM Assessing Innovative Waste Treatment Technology. Vol. 13: 205-206, USA. Pergamon Press Ltd. Aust S. D., Swaner P. R., Stahl J. D. (2003). Detoxification and metabolism of chemicals by white-rot fungi In: J. J. P. C. Zhu, S. D. Aust, A. T. Lemley Gan. Pesticide decontamination and detoxification. Washington, D.C: Oxford University Press. 3-14. Bedell J., Korf I., and Yandell M. (2003). BLAST. USA: O’Relilly. Bowman S. M and Free S. J. (2006). The Structure and Synthesis of the Fungal Cell Wall. BioEssays. 28(8):799-808 Branes R. M. (2007) Bioinformatics for Genetics. UK: John Wiley and Sons Ltd. Cumanova A., Gilca G. and Orlova N. (2007). The Fate of Persistent Organic Pollutants in the Environment. Dordrecht. Springer. D.S Saad, G.C. Kinsey, S Kim, C.C Gaylarde. (2004). Extraction of Genomic DNA From Filamentous Fungi In Biofilms On Water Based Paint Coating. International Biodeterioration & biodegradation. 54:99-103. De Schrijver A., De Mot R. (1999). Degradation of Pesticides by Actinomycetes, Crit. Rev. Microbiol. 25:85–119. 33 Eljarrat E., Cal A.D.L, Larrazabal D., Fabrellas B., Fernandez-Alba A.R., Borrulld F., Marced R.M. and Barcelo D. (2005). Occurrence of polybrominated diphenylethers, polychlorinated dibenzo-p-dioxins, dibenzofurans and biphenyls in coastal sediments from Spain. Environmental Pollutions. 136:493–501. El-Shahawi M.S., Hamza A., Bashammakh A.S. and Al-Saggaf W.T. (2010). An Overview on the Accumulation, Distribution, Transformations, Toxicity and Analytical Methods for the Monitoring of Persistent Organic Pollutants. Talanta. 80:1587–1597. Gadd G. M. (2001). Cambridge. Fungi in Bioremediation. U.K. Cambridge University Press. Hailong Z.., Ying Q., Huifeng W., Chunyang L., Jiping Z., Xiaoping D., and Qinzhao X. (2010). Molecular Phylogenies and Evolutionary Behavior of ahr (aryl hydrocarbon Receptor) Pathway Genes in Aquatic Animals: Implications for the Toxicology Mechanism of Some Persistent Organic Pollutants (pops). Chemosphere. 78:193–205. Hall G. G. (2008). Phylogenetic Trees Made Easy. USA: Sunderland, MA :Sinauer Associates. Hatakka A. (1994). Lignin-Modifying Enzymes from Selected White-Rot Fungi: Production and Role in Lignin Degradation. FEMS Microbiology Review. 13: 125-135. Khachatourians G. G. and Arora D. K. (2004). Fungal Genomics. Volume 4 of Applied Mycology and Biotechnology. Amsterdam. Elsevier. Kirk T.K., Farrell R.L. (1987). Enzymatic ‘Combustion’: The Microbial Degradation of Lignin. Annual Review Microbiology. 41:465-505. 34 Mansur M., Arias M. E., Copa-Patino J. L., Flärdh M. and González A. E. (2003). The White-Rot Fungus Pleurotus Ostreatus Secretes Laccase Isozymes with Different Substrate Specificities. Mycologia. 97(6): 1013-20. Meharg A. A. and Cairney J. W. G. (2000). Ectomycorrhizas-Extending the Capabilities of Rhizosphere Remediation. Soil Biology & Biochemistry. 32:14751484. Nostrom R.J., Simon M., Muir D.C.G. and Schweinsburg R.E. (1988). Organochlorine Contaminants in Arctic Marine Food Chains: Identification, Geographical Distribution and Temporal Trends in Polar Bears. Environment Science Technology. 22:1063-1071 Ragheed Hussam Yousif. (2011). Molecular Identification of Fungi Isolated From Extremebionic. Master Thesis. Universiti Teknologi Malaysia. Raymond J., Rogers T., Shonnard D., Kline A. (2001). A Review of Structure-Based Biodegradation Estimation Methods. Journal Hazard Matter. 84:189–215. Reddy C. A. and Mathew Z. (2001). Bioremediation potential of white rot fungi. Fungi in Bioremediation. G. M. Gadd Cambridge, U.K. Cambridge University Press. Reddy C. A. (1995). The potential for white-rot fungi in the treatment of pollutants. Current Opinion in Biotechnology. 6: 320-328 Reddy C.A. and Mathew, Z. (2001). Bioremediation potential of white rot fungi. Fungi in bioremediation. G. M. Gadd Cambridge, U.K.: Cambridge University Press. 35 Ritter L., Solomon K.R., Forget J. (1995). Persistent Organic Pollutants. The International Programme on Chemical Safety (IPCS). May 1995. Guelph on Canada. Inter-Organization Programme for the Sound Management of Chemicals (IOMC). Rittmann B. E. and McCarty P.L. (2001). Environmental biotechnology: Principles and applications. New York: McGraw-Hill Book Company. S.M. Bowman, S.J. Free. (2006). The structure and synthesis of the fungal cell wall. Bioessays. 28(8): 799–808. Salami M., and Vandamme A. M. (2003). The Phylogenetic Hand Book: A Practical Approach to DNA and Protein Phylogeny. UK. Cambridge University publisher. Sarah Hamman. (2004). Bioremediation capabilities of white rot fungi. Review article Spring. Siripong P., Oraphin B., Duanporn P. (2009). The Ability of Five Fungal Isolates from Nature to Degrade of Polyaromatic Hydrocarbons (PAHs) and Polychlorinated Biphenyls (PCBs) in Culture Media. Australian Journal of Basic and Applied Sciences. 3(3):1076-1082. Vit L. (1992). Polychlorinated Biphenyls in the Environment. Journal of Chromatography. 595:1-43. Weinstock I. A., Atalla R. H., Reiner R. S., Moen M. A., Hammel K. E., Houtman C. J., Hill C. L. and Harrup M. K. (1997). A New Environmentally Benign Technology for Transforming Wood Pulp into Paper ENGINEERING Polyoxometalates As Catalysts for Multiple Processes. Journal of Molecular Catalysis A: Chemica. 116:59-84 36 White, T. J., T. Bruns, S. Lee, and J. W. Taylor. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White.PCR Protocols: A Guide to Methods and Applications. New York. Academic Press, Inc. Wirén-Lehr S., M.P. Castillo, L. Torstensson, I. Scheunert. (2001). Degradation of Isoproturon in Biobeds. Biol.Fert. Soils. 33:535-540. Wirén-Lehr S., Scheunert I., Dorfler U. (2002). Mineralization of Plant-incorporated Residues of 14C-isoproturon in Arable Soils Originating from Different Farming Systems. Geoderma. 105: 351–366. 37 APPENDIX A BLASTn search results of S7 >gb|JN546137.1| Meyerozyma guilliermondii 18S ribosomal RNA gene, partial sequence Length=1522 Score = 1317 bits (713), Expect = 0.0 Identities = 761/787 (97%), Gaps = 10/787 (1%) Strand=Plus/Plus Query 151 TTATTAGATAAAAAATCAATGCTCTTTGAGCTCTTTGATGATTCATAATAACTTTTCGAA 210 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 124 TTATTAGATAAAAAATCAATGCTCTTTGAGCTCTTTGATGATTCATAATAACTTTTCGAA 183 Query 211 TCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGG 270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 184 TCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGG 243 Query 271 TAGGATAGTGGCCTACCATNGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAG 330 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 244 TAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAG 303 38 Query 331 AGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAA 390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 304 AGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAA 363 Query 391 TCCCGACACGGGGAGGTAGTGACAATACATAACGATACAGGGCCCTTTCGGGTCTTGTAA 450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 364 TCCCGACACGGGGAGGTAGTGACAATACATAACGATACAGGGCCCTTTCGGGTCTTGTAA 423 Query 451 TTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCC 510 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 424 TTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCC 483 Query 511 AGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCT 570 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 484 AGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCT 543 Query 571 CGTAGTTGAACTTTGGGCTTGGTTGGCCGGTCCGCCTTTTTGGCGAGTACTGGACCCAAC 630 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 544 CGTAGTTGAACTTTGGGCTTGGTTGGCCGGTCCGCCTTTTTGGCGAGTACTGGACCCAAC 603 Query 631 CGAGCCTTTCCTTCTGGCTAACCATTCGCCCTTGTGGTGTTTGGCGAACCAGGACTTTTA 690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 604 CGAGCCTTTCCTTCTGGCTAACCATTCGCCCTTGTGGTGTTTGGCGAACCAGGACTTTTA 663 Query 691 CTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATATTAGCATGGAATAA 750 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 664 CTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATATTAGCATGGAATAA 723 Query 751 TAGAATAGGACGTTATGGTTCTATTTTGTTGGTTTCTAGAAC-ATCNTAATN-TTAATAG 808 ||||||||||||||||||||||||||||||||||||||| || ||| |||| ||||||| Sbjct 724 TAGAATAGGACGTTATGGTTCTATTTTGTTGGTTTCTAGGACCATCGTAATGATTAATAG 783 39 Query 809 GAACGGTCGGGGGCATCAGTATTTCAGT-GNAAGANNTGAAATTCTTAAATT-ACTGAAG 866 | ||||||||||||||||||||| |||| | ||| ||||||||||| ||| ||||||| Sbjct 784 GGACGGTCGGGGGCATCAGTATT-CAGTTGTCAGAGGTGAAATTCTTAGATTTACTGAAG 842 Query 867 ACTAATT-CTGNNAAA-CATTTGCCA-GGACGTTTTC-TTAATAAANACC-AAAGTTAGG 921 ||||| | ||| ||| ||||||||| |||||||||| ||||| || | | ||||||||| Sbjct 843 ACTAACTACTGCGAAAGCATTTGCCAAGGACGTTTTCATTAATCAAGAACGAAAGTTAGG 902 Query 922 GGATCGA 928 ||||||| Sbjct 903 GGATCGA 909 40 APPENDIX B Sequencing result for fungi sample S7 using chromatogram