Skript - Institut für Humangenetik
Transcrição
Skript - Institut für Humangenetik
Master Study Molecular Medicine Functional Tumor and Molecular Human Genetics Uniparental Disomies, Rapid Prenatal Testing, Contamination and Paternity Ferdinand von Eggeling von Eggeling, Tumor + Mol Hum 2014/15 1 How does this fit together? von Eggeling, Tumor + Mol Hum 2014/15 2 PCR Polymerase Chain Reaction Folie: 3 von Eggeling, Tumor + Mol Hum 2014/15 3 What are Microsatellites or Short Tandem Repeats (STR)? Microsatellites, also known as simple sequence repeats (SSRs) or short tandem repeats (STRs), are repeating sequences of 2-5 base pairs of DNA. It is a type of Variable Number Tandem Repeat (VNTR). Microsatellites are typically codominant. They are used as molecular markers in STR analysis, for kinship, population and other studies. They can also be used for studies of gene duplication or deletion, marker assisted selection, and fingerprinting. 4 repeats CGT (Trinucleotidrepeat) CTGGATCGTCGTCGTCGTAATAGCAT von Eggeling, Tumor + Mol Hum 2014/15 4 How do we perform an STR analysis? Sketch of a Tetranukleotidrepeat ..NNNNN GATC GATC NNNNNNN.. Allele mother I ..NNNNN GATC GATC GATC NNNNNNN.. Allele mother II ..NNNNN GATC NNNNNNN.. Allele father I ..NNNNN GATC GATC GATC GATC NNNNNNN.. Allele father II Gel view after PCR M V K M M V K Gelgild nach PCR V K von Eggeling, Tumor + Mol Hum 2014/15 5 What we can analyse with Mikrosatellites (short tandem repeats, STR)? • Test for Paternity • Identification of Deliquents (e.g. murder, raper) in forensic medicine • Analysis of Uniparental Disomies • …. And rapid Prenatal Testing von Eggeling, Tumor + Mol Hum 2014/15 6 Paternity test von Eggeling, Tumor + Mol Hum 2014/15 7 ….and of course Amazon von Eggeling, Tumor + Mol Hum 2014/15 8 von Eggeling, Tumor + Mol Hum 2014/15 9 Paternity Test At least 10% of children are not from the father who believe that he is the father…… …..but this is done at the Institute of Forensic Medicine, where also other delinquents can be identified But the same test set (10 STR, in USA 13) is used for….. von Eggeling, Tumor + Mol Hum 2014/15 10 Identification of Deliquents (e.g. murder, raper) in forensic medicine von Eggeling, Tumor + Mol Hum 2014/15 11 Coton swabs von Eggeling, Tumor + Mol Hum 2014/15 12 ……..Analysis of Contamination / Exclusion of a Contamination For what this is needed? • Abortion • Chorionic villus sampling (CVS) von Eggeling, Tumor + Mol Hum 2014/15 13 Chorionic villus sampling (CVS) peritoneal trans-vaginal von Eggeling, Tumor + Mol Hum 2014/15 14 Placenta Mother Child von Eggeling, Tumor + Mol Hum 2014/15 15 How do we perform an STR analysis? Sketch of a Tetranukleotidrepeat ..NNNNN GATC GATC NNNNNNN…………………. Allel Mutter I ..NNNNN GATC GATC GATC NNNNNNN………………….…. Allel Mutter II ..NNNNN GATC NNNNNNN………………….. Allel Vater I Allel Vater II ..NNNNN GATC GATC GATC GATC NNNNNNN………………………... Gelgild nach PCR M V K von Eggeling, Tumor + Mol Hum 2014/15 16 No maternal contamination M K M K M K M K M K M K M K M K M K von Eggeling, Tumor + Mol Hum 2014/15 17 Maternal contamination M K M K M K M K M K M K M K M K M K Amelogenin von Eggeling, Tumor + Mol Hum 2014/15 18 The rapid prenatal screening (STR based) „Aneuploidy Test, PCR based“ von Eggeling, Tumor + Mol Hum 2014/15 19 Case: An amniocentesis was performed by a 38 year old pregnant women. The gynaecologist send the amniotic fluid to Human Genetics Institute To make a “rapid prenatal screening” To analyse chromosomes (Karyogramm) von Eggeling, Tumor + Mol Hum 2014/15 20 Why rapid prenatal screening? Normal karyotyping take about 8 -14 days! von Eggeling, Tumor + Mol Hum 2014/15 21 Rapid prenatal screening Marker for #21 von Eggeling, Tumor + Mol Hum 2014/15 22 Rapid prenatal screening From mother Three peaks: in Meiosis II From mother Two peaks: in Meiosis I Double height von Eggeling, Tumor + Mol Hum 2014/15 23 von Eggeling, Tumor + Mol Hum 2014/15 24 Advantages / Disadvantages Advantage • fast • Cost effective Disadvantage • Mosaics are difficult to see • Numerical Aberrations of the gonosomes can´t be seen (z. B. X0, Turner) • If it is positive, women are earlier worried von Eggeling, Tumor + Mol Hum 2014/15 25 Uniparental Disomy von Eggeling, Tumor + Mol Hum 2014/15 26 Uniparental Disomies (UPD): What’s that? Uni: (from one) single Parental: from parent Disomy: 2x the same Chromosomes = both Chromosomes are from one parent von Eggeling, Tumor + Mol Hum 2014/15 27 Uniparental Disomy Maternal Chromosome Paternal Chromosome von Eggeling, Tumor + Mol Hum 2014/15 28 Uniparental Disomy Definition: Uniparental disomy (UPD) occurs when a person receives two copies of a chromosome, or part of a chromosome, from one parent and no copies from the other parent UPD can occur as a random event during the formation of egg or sperm cells or may happen in early fetal development. It can also occur during transonic rescue. When the child receives the (two) homologous chromosomes (inherited from both grandparents) from one parent, this is called an heterodisomic UPD. Heterodisomy (Heterozygous) indicates a meiosis I error. When the child receives, two (identical) replica copies of a single homolog of a chromosome, this is called an isodisomic UPD. Isodisomy (homozygous) indicates either a meiosis II error or postzygotic duplication. von Eggeling, Tumor + Mol Hum 2014/15 29 Mikrosatellitenanalyse PCR PCR von Eggeling, Tumor + Mol Hum 2014/15 30 The Normal Case Ovum Sperm Zygote Biparental (normal) von Eggeling, Tumor + Mol Hum 2014/15 31 Development of a UPD: Trisomy Rescue Ovum Sperm Zygote biparental (normal) biparental (normal) Uniparental, heterodisom von Eggeling, Tumor + Mol Hum 2014/15 32 Development of a UPD: Monosomy Rescue Ovum Sperm Zygote Uniparental, isodismom von Eggeling, Tumor + Mol Hum 2014/15 33 Development of a UPD: Trisomy Rescue with a Robertson Translation Ovum Sperm Zygote biparental (normal) Uniparental, heterodisome von Eggeling, Tumor + Mol Hum 2014/15 34 Problems with UPD With a uniparental pair of chromosomes the following problems can be associated: Mosaic Trisomy Homozygotisation of autosomal recessive inherited mutations Unphysiological genomic Imprinting von Eggeling, Tumor + Mol Hum 2014/15 35 Mosaic Trisomy Ovum Sperm Klon 1 Zygote Klon 2 biparental (normal) biparental (normal) Uniparental, heterodisom von Eggeling, Tumor + Mol Hum 2014/15 36 Homozygotisation of an autosomal rezessive inherited mutation Ovum Sperm Recessive Disorder Zygote Mutation is now present on both alleles von Eggeling, Tumor + Mol Hum 2014/15 37 What is a Iso-Disomy, what a Hetero-Disomy? Ovum Sperm Zygote Uni-parental, iso-disom Ovum Sperm Zygote biparental biparentalUniparental, (normal) (normal) heterodisom von Eggeling, Tumor + Mol Hum 2014/15 38 Uniparental Disomy Definition: Uniparental disomy (UPD) occurs when a person receives two copies of a chromosome, or part of a chromosome, from one parent and no copies from the other parent UPD can occur as a random event during the formation of egg or sperm cells or may happen in early fetal development. It can also occur during transonic rescue. When the child receives the (two) homologous chromosomes (inherited from both grandparents) from one parent, this is called an heterodisomic UPD. Heterodisomy (Heterozygous) indicates a meiosis I error. When the child receives, two (identical) replica copies of a single homolog of a chromosome, this is called an isodisomic UPD. Isodisomy (homozygous) indicates either a meiosis II error or postzygotic duplication. von Eggeling, Tumor + Mol Hum 2014/15 39 Until now known clinically relevant UPDs upd(6)pat: Transient neonatal Diabetes mellitus upd(7)mat: Russell-Silver Syndrom upd(11)pat: Beckwith-Wiedemann Syndrom (BWS)* upd(14)mat: Dwarfism, Hypotonia, extensible joints, Scoliose, facial Dysmorphisms, mild retardation of developement, early puberty a upd(14)pat: stronger characteristics of upd(14)mat features as well additional mental retardation and skeletal malformations which cause dwarfism upd(15)mat: Prader-Willi Syndrom (PWS)* upd(15)pat: Angelman Syndrom (AS)* von Eggeling, Tumor + Mol Hum 2014/15 40 upd(7)mat: Russell-Silver Syndrom von Eggeling, Tumor + Mol Hum 2014/15 41 upd(11)pat: Beckwith-Wiedemann Syndrom (BWS)* von Eggeling, Tumor + Mol Hum 2014/15 42 UPD 15 Prader-Willi-Syndrom Angelman-Syndrom von Eggeling, Tumor + Mol Hum 2014/15 43 Unphysiological Genomic Imprinting Normal case PWS AS mat pa t Prader-Willi-Syndrom PWS AS mat mat Angelman-Syndrom PWS AS pat pat active Gene inaktive Gene von Eggeling, Tumor + Mol Hum 2014/15 44 When a UPD Diagnostic is performed? • Fetus with Robertson Translocation or an Isochromosome for chromosomes 14 und 15 • Children with Robertson Translocation or an Isochromosome for chromosomes 14 und 15 and growth retardation and/or mental retardation • Fetus with chromosomal markers, which were identified as chromosome 6, 7, 11, 14 or 15 • Abnormalities in ultra sound, which ar consistent with die UPD syndrome features • Fetus with Mosaic trisomy • New born with a neonatal Diabetes mellitus • New born with features of a Silver-Russell Syndrome • New born with suspicion of BWS with normal karyotyp and no FISH proven duplication von 11p15.5 von Eggeling, Tumor + Mol Hum 2014/15 45 How a UPD Diagnostic is performed? von Eggeling, Tumor + Mol Hum 2014/15 46 How a UPD Diagnostic is performed? Vereinfachte Darstellung eines Tetranukleotidrepeats ..NNNNN GATC GATC NNNNNNN.. Allel Mutter I ..NNNNN GATC GATC GATC NNNNNNN.. Allel Mutter II ..NNNNN GATC NNNNNNN.. Allel Vater I Allel Vater II ..NNNNN GATC GATC GATC GATC NNNNNNN.. Gelgild nach PCR M V K von Eggeling, Tumor + Mol Hum 2014/15 47 How a UPD Diagnostic is performed? M ab F cc P ab a b M bc F ac P bb a b c c Uniparental Hetero-disomy 12 Uniparental Iso-disomy 12 D12S2078 D12S1042 M aa F bb a b M bc P cc F ab P bc Uniparental disomy 12 (not informative for iso or hetero) a b c Not informative at all D12S100 D12S372 von Eggeling, Tumor + Mol Hum 2014/15 48 How a UPD Diagnostic is performed? M ab F aa P bb M ab F bc P aa b c F ab D20S1084 P cd M ac F bb D20S470 P ac a a b c d M aa F bc P aa a b b c c D20S601 P dd c d D20S486 M cd F ac a b a a b M bd D20S481 D20S485 von Eggeling, Tumor + Mol Hum 2014/15 49 Results of a UPD testing von Eggeling, Tumor + Mol Hum 2014/15 50 Please see also connections to the lecture: • Epigenetic • Imprinting von Eggeling, Tumor + Mol Hum 2014/15 51 The END Questions? von Eggeling, Tumor + Mol Hum 2014/15 52