docReport 2012 - Biocenter - Medizinische Universität Innsbruck
download 
Denúncia Transcrição
Report 2012 - Biocenter - Medizinische Universität Innsbruck
REPORT2010-12! BIOCENTER! Innsbruck Medical University! biocenter.i-med.ac.at! TCCAGTGGTATTCAGGTCCACTGTTTCCTCATTGATTCTGTCTGGATGATCTATTCATTGCTGAAAGTGGAGTACTGAAGTCCCACACTATTGTTGTATTGCTATCTATTTCTCCTTTTAGTTCTGTTAATATTTCTTTATATATTTAGGTACTTCAATGTTGAG ATATATGTTTACTATTGTTTTATTCTTTTGATGAATTGACCCTGTTATCATTATATAATGACATTATCTCTTATGACAGATTTGATTCAAAGTCTATTTTTTCTGACATAAATATTGCTTACCCATTCTCTCTTTGTTTTCATTTGCATGGAATATTTTTTATTT TTCACTTGCAGTCAATATGTCTTCTTAAGGCTAAATTGAGTCCCCAGCAGGAATCATACTGTTTGATCTTGTTTTTTATTATCCATTCAGCCATGCTGTGTCCTTTGACTAGAGCATTTAATCCATTACATTTAAAGAAATTATTGATAGGTAAGAATTTACTAT TATTATTTTCAATTGTTTTCTAATTGTTTTGTAGTTCCTTATTTCCTCTCTTTCTGATTTGCTTTGTGATTGGTTGATTTTCTGTAGTGGTATGCTTTTTTTTTTTTTCTTTAAGTTCTGGGATACATGTGCAGAACACGCAGGTTTGTTACATAGGTACACATG CATGGTGGTTTGCTCCACCTATCAACCCGTCATCTAGGTTTTAAGCCCCGCATGCATTAGGTATTTGATTTCTTTTTCGTCATGTTTTGTGCACTGACTAGAGGTTTTTTGTGGTTACCATGAATCTTATATAAAAATCTTATCATTATAACATTCTATTTTAAA ATAACTTCAATCACATACAAAAATTATACTTTACTTTTCTCAAACAATAATTTTATGTGATTGACATCACACTTTATATCCTTTTATATTATGTCTACATTAACAAATTATTGTAGCTATAGTTATTTCTATTATATATGTCTTTTAAATTTAATAGTAGAGTTA GAGATTAAATACAACCACTACTATATTAGTGCATTCTGAATTTGACTATATATCTATCTTTACCTGTGTATATCTGTGTATATATACTTTCATACATTTTCATGTTGCTGGTTTTTGTCTTTTTGTTTCAACTTGAAGAACCTCCTTTAGCATTTATTGTAAGGT TCTTATGGTGATGAATTCCCACATTTTTTTTGTCTGGGAATGTCTTTATCCTTTCTTACTTCTGAAGGACAGTTTTTCGTAATATTGTTTCATAGTTATTTTTTCTTTCAGCATTTTGAATATATAATCTCAGTGCCTCCTGGTCTATAAAATTTCCTCTGAGAA CATTGATAGACTCATTGGGGTGCCCTCATATGTGAAGAGACTCTTTTACTAGTTTCAGGATTTCTCTTTGTCTTTAACTTTTGAGAATTTCATTATAATATGTCTTGGGATAATTTTGATTTTAACTTATTGTCATCCTTTGAGCTTCATAAGTCTGGATGTGCA CTTTCACCTAATTTTGGAAGTTTTCAGTCATTTCTCTAAATAAGCTGCCTTTTTTTTTTTCTTTTTTTTTTAAAGACATACGTAACTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCACATTGATAGTTCACTGCAACCTTGATCTCCTGGAGTCAAGAGATCA TACCTCGCTTCCTGAATAGTGAGGACTACAGGTATGTATCATCACACCTGGCTGATTTTTTTTTTTTTTTTTTTTTTGGAAGATGGTGGTCTTAGTATGTTGCCCAGGCTGGTTTTAAATTCCTATCCTCAAGCAAACCATCTGCTTTGCCTTCCCAAAGCACTG TGACAGACATGAGCCACTGAGCCCAGCCCTCTAAATAAGCTTTCTGTCTCATTTTCCCTTTCTTCTCATTCTAGAAATCCTATAATTCATATATTTCTATGCTTGATGGTGTCCCATAGGTCCCTTATGCTTTCTTCAATCTTTTATTTTATTCCTCTAATTGGC TTTCAAATGACTAATCTTTGAGTTCCCTAATTCTGTTTTATAATTGAGTCTATCAAATTTTGCAGTTCTATCATTATGTTCTTCGGCTCCAGGATTTTTGTTTGCTTCCTTTTTATGGATTCCATTTCTTTGTTAAACTTCTCATTTTGTTCATGCATTGCTTTC ATTTTGTTTCGTTTTCAGTATGTGTTCTCTTGAATCTCATTGAGCTTCAAGATGATTTTTTTGTCAGGCAATTTGTAGATCTCTATTTCTATAGGATTGATTACTGGAGCCTTTCTAGTTTCATTTGGTTGTTTTATTGTCCATAAAGCCTCACATTATTGCCTG AACTAAAGGAGCAAACACCTCTTTCAGTTTTTATAAGCTGGTTTTAGCATATAAAGACTTTCTCTTTTGGAGTCCTTGCAAAGACATGACTACCTTCAGGATCACAGATGAATGGGGTTGAAGCCAGGTCACCTAACTGCTGCCGGGTTTGCAGTGGAGCCTGTA GGCAGATCTATTACCAAGTGCTTGAATGGGCATGGATTCTATCTAGTCTCTTGGTGCACTTAACTGCCTCCACAGCCTTGGTCAGTAGGGGTTGCACCTGGACCAGCGTCTTATTCAGTGTCTGCCAACAGAAAGACTGTTACCAAATATACAGATGCTCAGATG ATCACTTCCTCTGGGTTTCGGGACGGCTTCCTGCTGTGTCACTGGTTAAATACCTGGGCAGGCAATACTGGCCCATGACTGCAACTGAGCTAGAATGGAGTTCTAGCTGGGAAAGAACTGAGTTACAGGGTTCTGTCAATTTCCACAGCTGAGACTCATGTCTGT GTTGCCCCTAGGGGCACAGATGGATGTCTCTGTTTTCAGGCTCAACTCTTAATTAAAAGTTACTTCCAAAATTCAAAAAATCCATTAAAAACCAGGCTTTCTGGGCTGCTTTCAGACTGCAGCTGACAAGGACTGGAGCCAGGTTCCATCTGAGGATCTGTTGTG CTGAGTTCAGCTGTTCTTCCAGTTGGGGGACAGATGTGTGTTTCTCTCCCTCAGTCCCTGGACAGGCACAACTGCTCTCAGACCAGAACTGAGTGAGGTTAGAACTGAGTTACAAGGCTGTTTCAGGGTGCATAGCAGGTACCGAGGCCAGCAGGCCTGCTATCC GCATGAGTAGGCATGAATGCTGCTGGGTTCCTTGTCAGATGGTTCTGGCAATAGGACCCATGCCAAATGGAAATGAACTCAATCCACAAGGGAATGGAGATATTTCGGGGTTTAGAGGCGGGACCACGGTTGGCAAGTCTGCAACCTGGGAATACTTCTGCCCTC AATCAACCTTCCTAGGTCTTGGGTAGCAACAAGTTTTAGTAACTTCCTGCCTGAATCCCAAAGCTCCCACAAAGGCACTTTTGTTCGTGAATGGCTGCAAAACCAGTGTTTCTATGGAAAGAATATGAGCCAGAAGAACTCCTATTCTACCATCTTGCTGATGTC CTAGAAATAATCATTACTGTGCTCACTAACACTGTTCCCTTTTCAGTTTCTTGACCTCCATAAATTTTCTGTCTCTTTTGAACTCTGTAAATAAAATTATTAATTCATTATATATATATCACTATTCTGTATTTAATAGCCTCCCATTTTCTGAGATTAATTTCT ATTATTTTTATTGACCTGGAGACTATGAATTAACAAAATGTTCAAAATAAAAGTTTAAAGAAAATTAGCACGCATATTTTCTTTTTTTTCTTTATCTTTCTAGAGATGTGTAATTCCTACATTACACAAAGAGAATTTGTAGGAGAAACCAGGAAAGGAAAACAG GGAAAAGACTTTTCTGATAAATACATGGTTTCATTTTCCTCTCCCTTCTTTGATGCAGAAGAGACCTTGATGTGTCCAAGAGTATATGAGGAGGTTAGATGTGCAGTCTCATTGACTGGAGAAGTGTCAGGAAGGAGGGGTTTATTTTTGCTTAGCTTTGCCCTG TCATTTTTCTTGTTGCATAAGCTTCTTATCGACATTAATTTTAGACTCCCAAGATGTTTTGCATAACATAGAATTATAATCTAGTGTCTAAAATAGTTGCAAACCATAGTTTCAAATACATTAGGAAGATGAATCATTTCCTTAACATGAACCACTGTGTTATTT ATGATTACTTACAAGGGAGAAGTGATACATAATTAAAGTATCATGTGACATACAAAAAAGAAATCAATGAAATTCAAACAATAAATGCTTCTTCTGTTTCTCGTGAAAGATAGATGAAATATGCAGCTCCTTCTCATATCCATTTTGAAATGAATGGGTCTTGAA CATAACTATGTTATTTCAGTAGTAAGTAGAAATATTTCAGTATCAGAAGGGAAGAAATGAAATGAAATCAATCTACATCACTTTGGATTTTTAACTCCTCTAAAAACGTCTTACTGGGTATACATTATTGTTGTCAAATCCATTTTAATTTGAATTTTACTGTGT TGTATGTGTATGCATGCACTTACTTTTGTTTTTAACTCTCTTAAATAGCTTCAAAATGAAAGTTTTGTAACCAAATTTGAGCAGCAAAGAAAAAGGAGAAAGGGATCAAATATCTCTAACATATTCTACTTCATACAGTTCTTGGGTTTCTTTTTGCCAAGCTTT TCATAGCAGCTACACCAGTACCATCATGAATACTAATGAAATGTAATAGAAGGCATCAGTCATGATCCATCCAGGCTAGGGACATAACCATATACAAAGTGATAGTTCTTCCAGCTTAATGAAGCCTTCTTAAAGAAAAACTGTTTACATTCAAATTTGGATAAG TGAGAGCTTGTAAGCTATGAGAGCTAGACTGTACAGTTTTTAGGGGCAGGCATTGGTACAGGGAAACTCTATTATCTTCTTTATTTTCCTTCCAAAATTGTGCCTCATCAAAGTCCTGGGCATAAAATGTTTACTGAACAAAGTTTCAAAGAAATGCCATAGGAA AAGCTTAAAACTGTAGAAATCGAAAGTAAAAGATTTTAAACAGATAGACAACAGTGTTTAGATAAGCAAATACTTTTTCTGCAATCCTTAAGGTTTGCTGCCAACCTATGGAGTTCAAATTAACATTTCTCTCAGAAGTAAGCCTCATCTTTCTACTATCTTTTT CTATGTTTCTACATTCTATATATTCCTCCTTTCCAATAACAAGTCTCAGGAGTGGTTTTGGAACTCACTGATTTTTGGATCAAGCTAATATAGGATGGCATTAATGTAAAGTAATGCTATTACTCAAATATCAGGGATACTATCGTGACAGCTATATCCCTGGAA CTGAATAAGCTTACAAAACTTACTCTGCAAGAAGCTCCTGCTGAAACTTGAAAAGCATGTCAACAGAGGCTCCAAATGACAGAAAATTGCAATTTGTTATAACATTAAAAGAGAACTTATAACTTATTCTGACATATAATACTTCCCATAACCTGGTCAGGCCTC TATTATTCAAGGTTTTCTAAAACCTCACTCTCATTATGAAGCTTTTCCAGACTCACTGCAAATAAAATTATCAGAGAAGAGACACATTCATATCTTACATGGCAATGTACTTGGCCACGAGTGCAAAGGTGCTTTGGCCTTGTATAAATTTAGTTACTAAATTTG CACATGCATGTAAGTTTTTGTTTAATTTTATTTTGTTTTCCTTACCATATATGATTTAAATTATGAACTTCTACAGTCAAAATAATTTTAACTAAATTTTTATATCTATCTTTGGGGAGGGAGTACAAAGAAGTATACTAGTCAAATAATGTTGCAATATTGCTG GACAAATAGCCAGAAAATCTCAGTGGTACCCAACTATGAGGATCTTATCTCACTCAGTCCAAATGTCAGCTAGCATGGTGCCACCTCAGCATATGCATCTTCAGAGTTGCTGAATTTTGTTTCTCCTGGTTCATGCTGGACCTAAGGCTGAAGAAACAGTAGCTA GGGGTACCTTCTTCTTATAGAGGAGATATGAAGGTCCCAGAGAGTGCAAGCCAAACTGTGTGATGTCTCTTAAGATCTATGCTTAATATTTGATCCCTACTGCATTCCTTCTGCACGTCCTACTGTAAAATCATGTCCCTTGACCTAACACAATTTCTATGGATT GACATGTACTATTGACATGGAATGGGAAGATCACAAGAGGTGAATATACCCTGATAAATATTCTAAATATACCATAGTGTACCCTCTTATTTAAAAATGTTCACATCTCTGGTCGGGTGAGGTGGCTCACATCTGTAATCCCAGCACTTTGGGAGGCCGACGCAG GATCACAAGGTCAGGGGATCGAGACCACCTTGGCCAACATGGTGAAACCCCATCTTTACTAAAATACAAAAAATTAACCGGGTGTGGTGGTGGGTGCTTGTAATCCCAGCTACTTGGGAGGCTGAGGCAGGGGTATCACGTGAACCCAGGAGGGAGAGTTTGCAG GCTGAGATCGCATCACTGCACTCCAGCCTAGCAACAGAGCAAGACTCCATTATTAATAATAATTAATTTATTAATTCATGTAAAACATAGAAAATGTGCAGCCATATAGGCTTATTTGCCTTCTTTTCCAGTCTTCTATGCTATAATTTTCCAGTCTTTTATGCT ATTGTCATATGTATTACACATACATAAATTAAAATATATTATAATTTTTACATTAAAAAACTATATGTAAACACAATAAACAAAATAATCAAACAAAATAAAAAATTTGTCTTCTATGTTTACTCATATATCTTTCATTTCTAATCCTCCATATTTCTTCCTAAA CCATTTCTCCATCTGGTATCATTTTCCTTCAACCTGCAAGACTTTCTTGGTTTTGGCTTACCTGAAAATGGCTTTATTTTGCCTATGTTATTAAACAATGTTTCTGAATTTTGAAATTAACCCTTTATTTCTTGAATAATTAGAGATGGGGAAGTCTTCTGGTAG AGTTTTGAGGGAATAAATCAGGAGATTGATGTCGGGCATACTGAATTCAAGATACTAAAACCTCCAAGAAGATACATAAACCTGGTGTTTGAGAAAACAGTCAGAATTGGACATAAAGAATTATGGGTTGTCAACATATATTACAGATAGTATTTAGAGCTATGA GATAGGACTCACATCTAGGACTATCATCAAGGGAGTGAGTGTAGTTAATGAAGTGAAGGAGGCTCTGAACTGTGTCTTAGAGCACTCCAACAATGTGAAGCTAGAGAAGAGGAGGAAACAGCAACAGAAAGTGAGGAGCAACTAATGAGTTAGGAGAAAACAAAC AGTGTATGGTTTTCTACAAGCTATATAAATAATGAAAATGAAGAAGGAAAAAACAATAATATCAAGGGCTACAGACTGGAAAGATTGGGACAGAAAATTAACCATTAGAATTAATTGAACGCAGGTCACCGGCAACCTTGAAGTTTTGGTGAACTGGTGGAAGTA GTGTGATTGGAGTGGGTCATTAATTTTTAATAATGACAGTAGTGAATAGGTAAACATCCTATAGTGGTCACAAGAACATAATTGTGAATATAAATAACATTACATTCTTATTTATAACATTGTTTTATGATTTTCACATTATCCTGTTGGATTTATACCCAATAA ACCACTACTTTTTTGAGAACTGCCCTCTACCCTAGCCCCTGAAAATATATTATATGAAAATTCTCTCCCAGCTCTAATTGGTTTAACAAAATATATGACCCAACCCAATCACAAGGTCAGGGGATCGAGACCACCTTGGCCAACATGGTGAAACCCCATCTTTAC AATACAAAAAATTAACCGGGTGTGGTGGTGGGTGCTTGTAATCCCAGCTACTTGGGAGGCTGAGGCAGGGGTATCACGTGAACCCAGGAGGGAGAGTTTGCAGTGAGCTGAGATCGCATCACTGCACTCCAGCCTAGCAACAGAGCAAGACTCCATTATTAATAA TTAATTTATTAATTCATGTAAAACATAGAAAATGTGCAGCCATATAGGCTTATTTGCCTTCTTTTCCAGTCTTCTATGCTATAATTTTCCAGTCTTTTATGCTATAATTGTCATATGTATTACACATACATAAATTAAAATATATTATAATTTTTACATTAAAAA ATATGTAAACACAATAAACAAAATAATCAAACAAAATAAAAAATTTGTCTTCTATGTTTACTCATATATCTTTCATTTCTAATCCTCCATATTTCTTCCTAAAATTCCATTTCTCCATCTGGTATCATTTTCCTTCAACCTGCAAGACTTTCTTGGTTTTGGCTT TGAAAATGGCTTTATTTTGCCTATGTTATTAAACAATGTTTCTGAATTTTGAAATTAACCCTTTATTTCTTGAATAATTAGAGATGGGGAAGTCTTCTGGTAGGGTAGTTTTGAGGGAATAAATCAGGAGATTGATGTCGGGCATACTGAATTCAAGATACTAAA TCCAAGAAGATACATAAACCTGGTGTTTGAGAAAACAGTCAGAATTGGACATAAAGAATTATGGGTTGTCAACATATATTACAGATAGTATTTAGAGCTATGAGATGATAGGACTCACATCTAGGACTATCATCAAGGGAGTGAGTGTAGTTAATGAAGTGAAGG CTCTGAACTGTGTCTTAGAGCACTCCAACAATGTGAAGCTAGAGAAGAGGAGGAAACAGCAACAGAAAGTGAGGAGCAACTAATGAGTTAGGAGAAAACAAACCGTAGTGTATGGTTTTCTACAAGCTATATAAATAATGAAAATGAAGAAGGAAAAAACAATAA CAAGGGCTACAGACTGGAAAGATTGGGACAGAAAATTAACCATTAGAATTAATTGAACGCAGGTCACCGGCAACCTTGAAGTTTTGGTGAACTGGTGGAAGTAAAAGTGTGATTGGAGTGGGTCATTAATTTTTAATAATGACAGTAGTGAATAGGTAAACATCC Angelova Mihaela | Abt Sigried-Beate | Allipour Birgani Shadab | Alonso Y Adell Manuel | Altenbacher Georg | Amort Melanie | Amort Thomas | Andrä Brigitte | Aneichyk Tatsiana | Aydemir Cicek | Baier-Bitterlich Gabriele | Bandtlow Christine | Bauer Ingo | Bäumer Bastian | Baumgartner Florian | Becker Katrin | Beckmann Nicola | Berger Irina | Biadene Marianna | Bindreither Daniel | Blatzer Michael | Blitz Johanna | Bock Florian | Böck Günther | Boima Augustine | Boltengagen Mark | Borrie Sarah | Bratschun Doris | Brosch Gerald | Brunner Marietta | Burtscher Laura | Casari Andrea | Charoentong Pornpimol | Clementi Nina | Dander Andreas | Dassati Sahra | Datta Sebak | Daum Petra | De Smet Cedric | Devich Astrid | Doppler Wolfgang | Dunzendorfer-Matt Theresia | Ecker Karin | Efremova Mirjana | Eller Christian | Enrich Julia | Erlacher Matthias | Faber Birgit | Faserl Klaus | Fava Luca | Filipek Przemyslaw | Fischer Maria | Fuchs Dietmar | Fürst Beatrix | Gadner Bettina | Gaggl Irene | Gallasch Ralf | Gehring Isabell | Geisler Simon | Geley Stephan | Golderer Georg | Gostner Johanna | Götsch Katrin | Grässle Stefan | Griehl Matthias | Grubbauer Claudia | Gruber Peter | Gruber-Sgonc Roswitha | Gründlinger Mario | Grunicke Hans | Gsaller Fabio | Gschirr Barbara | Gstir Ronald | Guimaraes Araujo | Mariana Eca | Haara Doris | Haas Hubertus | Haas Nadja | Hackl Hubert | Halfinger Bernhard | Haslacher Sandra | Hegedüs Nikoletta | Helmberg Arno | Hengst Ludger | Herrmann Caroline | Hertscheg Monika | Heymann Melanie | Hilber Diana | Hofer Melanie | Höfer Sonja | Hofmann Johann | Holzknecht Rita Maria | Hörtnagl Karoline | Hörtnagl Verena | Huber Gertrude | Huber Lukas | Humenberger Alexandra | Hüttenhofer Alexander | Jäkel Heidelinde | Jakic Bojana | Jaklitsch Ines | Jenal Annina | Kaya Levent | Keller Markus | Khurana Rimpi | Kindler-Maly Elisabeth | Klammer Veronika | Kofler Anita | Kofler Renhard | Krabichler Hermann | Kremser Leopold | Krogsdam Anne | Krumschnabel Gerhard | Kuehnle Leonie Klara | Kullmann Michael | Kupra Elisabeth | Kurz Antje | Labi Verena | Lamberti Giorgia | Lammirato Andrea | Laschober Gerhard | Lechner Bea | Lechner Stefan | Lengenfelder Ilona | Lentsch Karin | Leuenberger Julianna | Lindner Herbert | Ljesic Vinca | Loidl Adele | Loidl Peter | Loitzl Petra | Lucke Yvonne | Lukasser Melanie | Lusser Alexandra | Madl Nina | Maly Karl | Manzl Claudia | Marx-Ladurna Florentine | Masuccio Alessia | Mattissek Claudia | Maurer Sylvia | Mayer Matthias | Mayerl Christina | Merschak Petra | Metzger Christian | Moser Johannes | Muckenhuber Hubert | Müller Martin | Müller Pia | Nachbauer Birgit | Nagele Rosanna | Naschberger Andreas | Naschberger Martina | Neu Johannes | Nikolaidis Georg | Nogalo Anto | Nössing Patrizia | Nuener Thomas | Offterdinger Martin | Onestingel Elisabeth | Ottina Eleonora Marisa Rosa | Pabinger Stephan | Patsch Katherin | Pedit Viktoria | Peintner Lukas | Perfler Katrin | Peschel Ines | Pfeiffenberger Elisabeth | Pfeifenberger Tamara | Pfeilschifter-Resch Ruth | Pfurtscheller Maria | Piatti Paolo | Piendl Wolfgang | Ploner Andreas | Podmirseg Silvio | Polacek Norbert | Radl Lisa | Raggl Emanuel | Rainer Johannes | Ram Claudia | Ranches Glory | Redl Bernhard | Rieder Dietmar | Riedinger Stefan | Roilo Martina | Rossi Katharina | Ruth Joas | Sachsenmaier Wilhelm | Sarg Bettina | Saurer Maria | Schafferer Lukas | Schafferer Simon | Scheffler Julia | Scheffzek Klaus | Scheran Gabriele | Schluifer Karin | Schmidt Oliver | Schoettl Yasmin | Schrettl Markus | Schuler Fabian | Schwarz Siegfried | Schwarzer Lena | Schweigreiter Rüdiger | Sebald Johanna | Shivalingaiah Giridhar | Snajder Rene | Sochalska Maja | Soratroi Claudia | Sparber Elisabeth | Sperk Michael | Stasyk Taras | Staudinger Tamara | Steixner Stefan | Stelzhammer Stefan | Stocker Gernot | Stöckl Gabriele | Talasz Heribert | Tanzer Maria | Teis David | Thauerer Bettina | Thöni Cornelia | Tischner Denise | Trajanoski Zlatko | Trojer Sandra | Tuzlak Selma | Tymoszuk Piotr | Überall Florian | Unterberger Bettina | Vietor Ilja | Villunger Andreas | Villunger-Gfreiner Manuela | Vosper Jonathan | Watschinger Katrin | Welti Stefan | Werner Ernst R. | Werner-Felmayer Gabriele | Werth Sibylle | Weys Sabine | Wick Cecilia | Wick Georg | Wick Martina | Wiegers Jan | Wille Alexandra | Wörle Hildegard | Wöss Claudia | Wrulich Oliver | Yannoutsos Nikolas | Yigit Ayten | Yordanov Teodor | Zeilner Anette | ! The People! The Biocenter! The Rector‘s View! The official opening of the Center of Chemistry and Biomedicine (CCB) just over a year ago was the ceremonial end to an extremely successful infrastructure project of two universities of Innsbruck, i.e. the University of Innsbruck and the Innsbruck Medical University. It was certainly also a highly visible signal of our scientific ambitions in the field of Life Sciences and clearly showed our goal of creating the best possible conditions for the advancement of academic medicine. Building on our present success, on our distinctive profile and on the international reputation in this field, we as the members of the Innsbruck Medical University wanted to form an appropriate home for this promising and pioneering research field. The new building has already in the first twelve months proven its worth, both by building bridges to the University of Innsbruck’s interdisciplinary faculty of chemistry and pharmacy, which is so important to us, and as an outstanding facility for our own scientists, teachers and students. ! The Biocenter of the Medical University, now located in the CCB, houses a total of eleven theoretical institutes (now called „divisions“), which were previously spread out over different locations. To maximize the benefit of uniting the department under one roof, to optimize the infrastructure and not least to create options for the future, this concept was from the outset incorporated in the design of the new building. That is one reason why the result seems so satisfying to all. Not surprisingly, the impact of the expected boost for cooperation between the divisions and research groups of the Medical University itself as well as with those in the University of Innsbruck can already today be clearly seen. After all, in addition to first-class technological equipment and state-of-the-art office and laboratory spaces, the communicative aspect of the building was one of the design priorities. This promise was realized perfectly by the architects and designers, as all the people in the CCB uniformly say. ! As the employees in the building already communicate quite openly, and the new home of the Biocenter exceeds our most ambitious aspirations, we can look with some satisfaction on what we have achieved. At the same time, we must make the most of the benefits that the infrastructure offers, and continually adapt and optimize them in accordance with the requirements of this highly dynamic and rapidly advancing branch of Life Sciences. From the outset, one of our objectives was not only to unite the institutes’ capabilities – resources, expertise and strengths - but also to help them to grow and to develop further. That applies both for research and teaching. With virtually perfect working and studying conditions, the Biocenter is also a catalyst of medical progress, which – with just a few minutes' walking from the University Hospital and other university institutions - is ideally rooted in the comprehensive expertise of our university, functionally, translationally and interdisciplinarily, and a model project for the City of Innsbruck. ! Finally, I would like to express my gratitude to all involved in designing and building the center. Especially the colleagues and employees who work there, who contributed to making our vision in so short a time a reality – creating a center of attraction for colleagues from around the world and a stronghold for consolidated scientific expertise. As Rector, I wish them all the best. ! 02 ! Herbert Lochs! Rector, Innsbruck Medical University! The Biocenter! The Director‘s View! In spring 2012, the Biocenter of Innsbruck Medical University (MUI) moved into the new CCB (Center for Chemistry and Biomedicine) building together with our colleagues from the University of Innsbruck (Faculty for Chemistry and Pharmacy). This was a major milestone in the development of the Innsbruck University Campus and for our international visibility. The new building provides our research community with 36.000 m2 of state-of-the-art laboratory and office space. We have also implemented core facilities in proteomics, genomics, deep sequencing, microscopy, flow cytometry and histology. In addition we have friendly lecture halls, modern teaching laboratories, generous room for communication and a spacy cafeteria. What else would you like to have? Well, from the director’s view there is plenty of room for further improvement and we do have some challenges in front of us. ! First, the new campus is located within walking distance to the clinical departments and other institutes of both of our Universities. This centrally located and tightly cross-linked campus structure is one of our major competitive advantages in Innsbruck, which deserves more intensive exploitation to the benefit of all involved parties, doctors, researches, students and patients. The close vicinity of medicine, chemistry, pharmacy, and biomedicine provides the necessary grounds for translational research. For biomedicine to improve human health, our scientific discoveries must be translated into applications at the point of patient care. These applications can be information-generating (e.g. genetic tests aiding in prediction of disease risk or personalized cancer therapy) or therapeutic (new drug molecules or cellular therapies/vaccines). Understanding disease at the molecular level requires a strong basic research setting. Translation of the acquired knowledge into new treatment options requires chemistry and pharmacy and, most importantly, a strong and evidence-based medicine. Translational medical research also requires regular talking to clinicians for understanding unmet medical needs. With the new CCB building at the heart of the universities and of the Clinical Campus we do have all requirements here to work between or at the interface of those two poles. The Competence Center for Personalized Cancer Medicine, Oncotyrol, and the newly founded Austrian Drug Screening Institute (ADSI) are also next door, therefore, let’s grab the chance!! Second, we have exciting opportunities ahead of us in teaching. What would a campus be without excellent students and devoted teachers? The Medical University has launched recently the Bachelor and Master studies in Molecular Medicine. With this internationally competitive and already well-visible degree courses we invest in our future in modern medicine and molecular life sciences. We are all highly motivated to bring our students to a top level, we enjoy teaching here in human medicine, molecular medicine or within our PhD courses, but we have to constantly work on the quality of our teaching. ! Third, what would a campus be without serving the community? Biocenter members are serving at all levels in University committees and national as well as international advisory and reviewing boards. I would like to thank them honestly for their service and I would like to encourage them to continue in doing so. Serving the community means challenging yourself to experience of new things outside your comfort zone. It helps changing a campus to the better and it expands your perspectives by working with and learning from people of different races, cultures, ages, life- and professional-experiences.! Last but not least I would like to whole-heartedly thank all my wonderful colleagues here. Without you we would not be there where we are! Thanks for all your hard work and support during the year, in the planning and implementation of our new building and for the excellent research you did. Many thanks also to Siegi Schwarz for giving artistic form to this beautiful brochure and for the many hours he spent. ! ! Enjoy reading it!! ! ! ! !! Lukas A. Huber! Director [email protected]! 03 ! The Biocenter! The new CCB building 2012! the plan din! a4! the reality! A joint project between the University of Innsbruck and the Innsbruck Medical University! 05 ! architects innsbruck! The Biocenter! The new CCB building 2012! The facility, into which also the Biocenter is incorporated, comprises 35.000 sqm of laboratories, offices and lecture rooms, its building costs amounting to 75 million Euros. By 2011, the new Biocenter was originally expected to start full operation. As Federal Minister Johannes Hahn said, this facility will be a landmark for the Life Sciences in western Austria.! On September 19, 2008, the foundation ceremony of the new research building was held by Federal Minister Johannes Hahn, Rector Karlheinz Töchterle (University of Innsbruck), Vice Rector Manfred Dierich (Innsbruck Medical University) and Lukas A. Huber (Director, Biocenter).! On May 21, 2012, the official Opening of the building was celebrated and the name CCB – Center for Chemistry and Biomedicine was given. ! the plan 06 ! There is one person to mention here: Pia Müller, M.Sc.. Since years she has devoted all her working energy into the fine planning of this builiding. Hours of discussions with technical providers, furniture companies etc. All details were in her mind.! Thank you, Pia!! the reality! architects innsbruck! din! a4! The Biocenter! The new CCB building 2012! 07 ! The Biocenter! The new CCB building 2012! 08 ! Our Staff! The Biocenter! Administration! (1st row)! Glassware cleaning ! (3rd row) ! Laboratory assistants ! (4th row )! Irina Berger ! Petra Daum! Melanie Hofer! Verena Hörtnagl! Gertrude Huber ! Ines Jaklitsch! Ilona Lengenfelder! Rosanna Nagele! Patrizia Nössing! Angelika Posch ! Claudia Ram! (2nd row)! Maria Saurer ! Manuela Villunger-! Gfreiner! Brigitte Andrä! Cicek Aydemir ! Doris Haara! Monika Hertscher ! Karoline Hörtnagel! Vinca Ljesic ! Bettina Unterberger! Ayten Yigit! Christian Eller ! Karin Lentsch ! Stefan Steixner! 09 ! Facts! The Biocenter! The BIOCENTER engages alltogether! ! 237 collaborators, 60% scientific, 40% general! ! ! ! 60% financed by regular university budget, 40% by scientific grants! ! ! (i.e. external funding)! ! ! ! ! ! 3 Emeriti Professors ! 10 Full Professors! 36 Associate Professors! 35 Post Docs! 52 PhD Students! 26 Diploma Students! ! 60 Technicians (Biomedical Assistants)! ! 15 Administrative personel! Since the founding of the BIOCENTER, several hundred diploma and doctoral theses by students enrolled in the PhD and MD programmes of the University of Innsbruck and the Innsbruck Medical University have been successfully elaborated.! External funding ! 2011 2012! FWF, EU, GEN-AU! Others! 4,58 1,49 4,24 0,86 Total ! 6,07 5,10 Mio Euro! Public & private support! BIOCENTER SEMINARS! Every Friday afternoon, one of our postdocs or Ph.D. students gives a lecture of her/his recent scientific achievements.! Therafter, HAPPY HOUR is on, which is an important relaxation after a hard „working“ week as well as for the establishment of scientific cooperations.! HLENE WASTL MENTORING PROGRAMME FOR WOMEN IN SCIENCE of the Innsbruck Medical University. An „established“ person accompanies a young female scientist through her career in academia in her first year. In case of obstacles and difficulities, the mentor is trying to find solutions for her mentée. Christine Bandtlow, Roswitha Gruber-Sgonc, Alexandra Lusser, Florentine Marx-Ladurner and Gabriele Werner-Felmayer of the Biocenter are appointed mentors.! http://www.imed.ac.at/gleichstellung/mentoring/mentorinnen.html! ETHICS & MISCONDUCT IN BIOMEDICINE, A continuous seminar given by Gabriele Werner-Felmayer of the Biocenter! Basic research! Publications! 2010-2012! 356 www.i-med.ac.at/imcbc/molecularcellbiologyfolder/aushaenge/Aushang_Bioethik_SS_08.pdf! GOOD SCIENTIFIC PRACTICE! Christine Bandtlow and Gabriele Werner-Felmayer of the Biocenter have recently been appointed to act as members of the commission on the establishment and supervision of Good Scientific Practice at MUI http://www.i-med.ac.at/qm/gsp! 10 ! Mio Euro! Mio Euro! Impact factors citations! 2010-2012 ! 1676 1444 Patents! Spin-offs! The Biocenter! Support & Collaborating Partners! Institute for Biomedical Aging Research! Austrian Academy of Sciences! 11 ! The Biocenter! Spezialforschungsbereiche: SFB f44, SFB021 ! http://www.uibk.ac.at/pharmazie/pharmakologie/sfb-f44/! http://www.sfb021.at/! Members from the Biocenter! Members from the Biocenter! •! Hüttenhofer Alexander •! Lusser Alexandra Genomics Genomicsand andRNomics! RNomics! Molecular ! Biology!Molecular Biology! other members are! Regenerative Medcine, Paracelcus Medizinische ! •! L. Aigner, S. Couillard-Despres Molecular Molecular Regenerative Medcine, Paracelcus Medizinische PrivatuniversitätSalzburg! Salzburg! ! Privatuniversität Dep. Dep. Physiology, IMU! IMU! •! B. Flucher, G. Obermair Physiology, University Clinic for for Ophthalmology, IMU,! •! C. Humpel, J. Marksteiner University Clinic Ophthalmology, IMU, University Clinic for University Clinic for IMU! Social Psychiatry, IMU! ! Social Psychiatry, Applied Physiology, University of Ulm, Germany ! ! •! B. Liss Applied Physiology, University of Ulm, Germany Inst. Pharmacology andand Toxicology, Dept. of Pharmacy, ! ! •! N. Singewald ! Inst. Pharmacology Toxicology, Dept. of Pharmacy, UniversityofofInnsbruck! Innsbruck! ! University Inst. Pharmacology and Toxicology, Dept. of Pharmacy, ! ! •! J. Striessnig, A. Koschak Inst. Pharmacology and Toxicology, Dept. of Pharmacy, UniversityofofInnsbruck Innsbruckand andCenter CenterofofPhysiology Physiologyand and ! ! ! University Pharmacology,Medical MedicalUniversity UniversityVienna! Vienna! ! Pharmacology, University Clinic forfor Neurology, IMU! •! G. Wenning, N. Stefanova University Clinic Neurology, IMU! 12 Chronic diseases of the central nervous system (CNS), such as fear/anxiety disorders and neurodegenerative diseases occur with high and increasing prevalence. Since molecular disease mechanisms are not fully understood, current drug therapies are often unsatisfactory. The development of novel and improved therapeutic strategies requires the identification of innovative targets for therapeutic intervention. The major goal of this SFB is to comprehensively study two signaling pathways that bear such potential: L-type calcium channels (LTCCs) and epigenetic modulators, in particular histone deacetylases (HDACs). Both pathways appear to participate in the etiology of several neurological disorders. Moreover, recent preliminary findings from our consortium suggest that they can be (patho-) physiologically linked. ! - Huber Lukas A. ! Cell Biology (Div. of Cell Biology)" - Scheffzek Klaus ! Molecular Oncology (Div. of Biological Chemistry)! - Teis David ! Membrane traffic and Signaling (Div. of Cell Biology)! - Trajanoski Zlatko! Bioinformatics, Cancer Research (Div. of Bioinformatics)! - Villunger Andreas Cellular Immunology, Tumor Biology, Apoptosis (Div. of ! Developmental Immunology)" Associated Members " - Geley Stephan ! Cell Biology, Cancer Research (Div. of Molecular ! ! Pathophysiology)! - Hengst Ludger ! Cell Biology, Cancer Research, Medical Biochemistry (Division of ! ! Medical Biochemistry)! - Kofler Reinhard ! Cell Biology, Cancer Research (Division of Molecular ! ! ! Pathophysiology)! For a detailed description of the various research topics, see the hompeage of the SFB (http:// www.sfb021.at/) and the respective individual pages of SFB members later in this brochure! ! The major goals of the SFB021 are to understand molecular pathways that link signals leading either to cell death/survival or to cell proliferation/cell cycle arrest in tumors. The SFB021 also aims to better understand, why the immune system apparently fails to eliminate tumor cells focusing on the established pathways regulating T cell activation thresholds. In continuation of the work during the first funding period (2003-2007) SFB021 scientists propose the coordinated use of biochemical and genetic as well as proteomic/transcriptomic approaches to delineate changes in cellular pathways that occur in several types of tumors, namely epithelial tumors (breast cancer, liver, skin), chronic myeloic leukemia (CML) or tumors of lymphatic origin (acute lymphatic leukemia (ALL) and multiple myeloma). In addition, for the second funding period (2008-2010) they have now extended their experimental approaches towards antigen receptor signal processing machinery in T cells during immunesurveillance in tumors, adhesion signaling in tumor cells, as well as posttranslational modifications of the Cdk inhibitor p27Kip1. ! ! Laboratory Immunology & Molecular Cancer Research! Networking! The Biocenter! Dietmar Fuchs and Ernst Werner of the Division of Biological Chemistry are founding and steering members of the ! International Neopterin Network www.neopterin.net! They organize since many years the annual Winter Workshop on Clinical, Chemical and Biochemical Aspects of Pteridines in St. Christoph/Arlberg/Austria! Andreas Villunger of the Division of Developmental Immunology of the Biocenter was integrated into ! ApopTrain, a Transeuropean Network of Apoptosis research laboratories! Georg Wick, professor emeritus of the Division of Experimental Pathophysiology and Immunology has coined TOLERAGE, a combination of tolerance and age, and coordinates this EU research project. http://ec.europa.eu/research/health/medicalresearch/human-development-and-ageing/projects/tolerage_en.html! Christine Bandtlow of the Div. of Neurobiochemistry is participates with her coworkers in the SPIN network (Signal Processing In Neurons).! Other Members are! • Georg Dechant, Speaker, Institute for Neuroscience! • Francesco Ferraguti, Department of Pharmacology! • Lars Klimaschewski, Division of Neuroanatomy! • Hans-Guenther Knaus, Division of Molecular & Cellular Pharmacology! • Michaela Kress, Department of Physiology and Medical Physics! • Markus Reindl, Deputy Speaker, Clinical Department of Neurology, Neurological Research Lab.! • Alois Saria, Division of Experimental Psychiatry! • Veronika Schuchter, SPIN Coordinator, Institute for Neuroscience: SPIN Office! • Christoph Schwarzer, Department of Pharmacology! • Nicolas Singewald, Institute of Neuropharmacology! • Gregor Wenning, Department of Neurology, Division of Clinical Neurobiology! • Gerald Zernig, Division of Experimental Psychiatry! SPIN is an initiative of Innsbruck Medical University and Innsbruck Leopold-Franzens University. It was established in 2007 with the support of the FWF Austrian Science Fund (Dk-SPIN, WI206)! http://www.neurospin.at/! Benefits:! •!individual supervision and monitoring (students have their individual thesis steering committee)! •!a highly structured SPIN-specific educational program! •!laboratory rotations in the twelve participating institutions! •!funded research exchange with international laboratories! •!retreats and social activities! •!state-of-the art facilities and resources! •!personal and career development! 13 ! The Biocenter! Christian Doppler Laboratory! CHRISTIAN DOPPLER Gesellschaft ! Hubertus Haas of the Division of Molecular Biology of the Biocenter leads the module ”Oxygen regulation and stress in biotechnologically used filamentous fungi” within the CHRISTIAN DOPPLER laboratory ”Biotechnology of Fungi” run by Prof. Ulrich Kück from the Ruhr University Bochum, Germany. ! http://www.ruhr-uni-bochum.de/cd-labor/en/index.html! Fungi belong to the most important organisms used for the biotechnological production of primary metabolites in the food industry and secondary metabolites in the pharmaceutical industry (antibiotics, alkaloid drugs, immunosuppressants, steroids, statins), agricultural industry (plant hormones, e.g. gibberillins) and other industries (e.g. enzymes used in textile, paper, and pulp industry).! A prerequisite for the advancement of such processes is the improvement of strains including the optimization of (i) product yield, (ii) growth substrate adaption and metabolization, (iii) genetic stability, and (iv) fermentation-suitable morphology.! The recent availability of whole genome sequences of biotechnologically relevant fungi (e.g. Penicillium chrysogenum, Aspergillus terreus, Acremonium chrysogenum) has opened new possibilities for both directional genetic strain improvement and strain analysis and manipulation.! Our CD laboratory ”Biotechnology of Fungi” analyzes in close collaboration with Sandoz (Kundl, Austria) various industrially relevant filamentous fungi as a prelude to improve and manipulate the production of a diverse range of drugs. The goals include (1) the development and improvement of molecular tools for genetic manipulation, (2) identification of novel regulatory factors involved in secondary metabolism and morphology, (3) analysis of metabolic networks and stress resistance. ! Sandoz is the second-largest generics company in the world, employing approximately 24# 000 people across the globe with a worldwide network of more than 30 manufacturing sites, with a presence in more than 140 countries. Sandoz has a deep interest in Asco- and Basidiomycetes for the production of a wide array of compounds (Table 1). Sandoz’s expertise is based on decades of experience with early successes including the first-ever oral penicillin produced by the fungus Penicillium chrysogenum in 1951.! Table 1. Compounds produced by Sandoz by Producer Compound Acremonium chrysogenum Cephalosporin Penicillium chrysogenum Penicillin Aspergillus terreus Lovastatin Penicillium citrinum Mevastatin Tolypocladium inflatum Cyclosporin Penicillium brevicompactum Mycophenolic acid Clitopilus passeckerianus Pleuromutilin Pleurotus ostreatus Technical enzyme the use of filamentous fungi Use ß-Lactam antibiotic used in human medicine ß-Lactam antibiotic used in human medicine Lowering of cholesterin, precursor for Simvastatin Lowering of cholesterin, precursor for Pravastatin Immunosuppressant used in transplantation medicine Immunosuppressant used in transplantation medicine Antibiotic used in veterinary medicine Enzymatic cleavage processes The CHRISTIAN DOPPLER Forschungsgesellschaft (CDG) - named after the famous Austrian mathematician, physicist and astronomer - promotes the intensive collaboration of academia and industry by funding applied research within socalled CHRISTIAN DOPPLER (CD) laboratories (http://www.cdg.ac.at/).! Cephalosporin C! 14 Cephalosporin C producer ! Acremonium chrysogenum! ! Group members Beate Abt, Fabio Gsaller, Michael Blatzer, Mario Gründlinger, Markus Schrettl! Seminars! Biocenter ! SEMINARS Neuroscience Seminars INNSBRUCK NSI Lecture Series WS 12 !"#!$#%$!% $"#!!#%$!% %&#!!#%$!% !&'!( !&'!( !"'M$ )*+ EC4F2C3GH Erin Schuman )*+ EC4F2C3GH )8I3:=8-J3,-./0/1/2354C3KC80-3L2.28C@;>3AC8-J51C/ )*+ EC4F2C3GH N090.04-3453D2C2OC8=3H/C1@/1C23P8/04-8=3,-./0/1/2354C3:;<.04=470@8=3H@[email protected])<4?80Q0 RJ8S8J0>3T8U8-38-?3,HVW+1./C08 !!#!%#%$!% $(#$M#%$!M !&'!( !&'!( )*+ EC4F2C3GH )*+ EC4F2C3GH )*+ EC4F2C3GH 12. 03.’10 Natalia Schiefermeier (Lukas Huber) Regulation of cell migration and focal adhesions by MAPK scaffolding and endosomes Markus Keller (Ernst Werner) Monitoring of fatty aldehyde dehydrogenase activity by pyrenedecanal Florian Kronenberg (Florian Kronenberg) Genetic epidemiology at the intersection between function and disease Simone Kreutmayer (Georg Wick) What makes endothelial cells a target for anti-HSP60 immunity Georg Dechant (Georg Dechant) Neurotrophic factors, mediators of neuronal plasticity Johannes Rainer (Reinhard Kofler) Bioinformatic analysis of the glucocorticoid response in leukemia cells using high throughput microarray technologies 19. 03.’10 26. 03.’10 B"2$,)C/$'-,$*&"')$*)=7'$#-(- 09. 04.’10 Ryuichi Shigemoto 16. 04.’10 D=81?08362C?2C04 !&'!( MCBO Science day Rudolf Wiesner !"#$%&'()%(*$+",&-%)./&0(-).(,(*&"'-)"1)%&*"23"'./&$,)!456) #/"+$+,7),($.&'8)*")."#$%&'(/8&2)'(9/"').($*3 .9/&'8)$8&'8)$'.):$/;&'-"'-).&-($-()<=>?@=(%&'$/A DPL3,-./0/1/23453P21C4.@02-@2>3)0=8- G",()"1)%&2/"8,&$@.(/&0(.)%&2/"0(-&2,(-)&' 2(,,@*"@2(,,)2"%%9'&2$*&"')&')*3()+/$&' Mate Döbrössy B-092C.0/X/.3Y=0-0J1Z3AC20O1C7 23. 04.’10 30. 04.’10 07. 05.’10 28. 05.’10 11. 06.’10 H(,,)/(#,$2(%('*)*3(/$#7)&')'(9/".(8('(/$*&0().&-($-(- Zoltan Nusser [8O4C8/4C<3453D2==1=8C3P21C4U;<.04=47<>3,-./0/1/23453\IU2C0Z2-/8=3)2?0@0-2> G1-78C08-3+@8?2Z<3453H@02-@2 I9$'*&*$*&0()%",(29,$/).&11(/('2(-)&')#/(-7'$#*&2)$2*&0()F"'(<=>?@=(%&'$/A Due to limitations in space, only one example can be shown here, representative for the entire program of the Neuroscience Lecture Series organized by SPIN.! SPEAKER / TITLE 05. 03.’10 ,-./0/1/234536272/8/0923:;<.04=47<>3)2?0@8=3A8@1=/<>3B-092C.0/<3453D4=47-2 D&83)/(-",9*&"')E9$'*&*$*&0(),"2$,&F$*&"')"1)0",*$8(@.(#('.('* 2$,2&9%)23$''(,-)&')*3()+/$&')+7)&%%9'"8",.)(,(2*/"')%&2/"-2"#7 <=>?@=(%&'$/A %&#!!#%$!% DATE 18. 06.’10 25. 06.’10 02. 07.’10 Fridays 16:00 Hörsaal B Fritz-Pregl-Str. 3 Katrin Watschinger (Ernst Werner) Alkylglycerol monooxygenase: Still an orphan enzyme? Domagoj Cikes (Ilja Vietor) Role of TIS7 and SKMc15 proteins in lipid metabolism Cornelia Wandke (Stefan Geley) Motors in mitosis Kamilla Bakowska-Zywicka (Norbert Polacek) Does the „RNA World“ still communicate with the translation machinery? Paolo Piatti (Alexandra Lusser) Functional characterization of mammalian chromatin remodeling factor CHD1 Florian Baumgartner (Andreas Villunger) Bim and Bmf in breast cancer Michael Blatzer (Hubertus Haas) Siderophore export in Aspergillus fumigatus Happy Hour afterwards with beer and beverages sponsored by 15 ! Seminars! Biocenter ! 4 " "!($1-/ 1'$+$1'6*-0-+$"-+.*$5 ,#+6-&$,$0(0 4 !" 8!$/ ** "1(3(16+-,(1-/(,&-%+2*1("-+.-,$,1./$. / 1(-,0!6&*-! * &$,$$5./$00(-, ,#,$14-/) , *60(0 4 & !("" -..*$/ #$;"($,"6 ,#/$0(01 ,"$-%+ ++ /6" ,"$/1- "'$+-1'$/ .6 4 # 0 $&2* 1(-,-%"-,(#(-&$,$0(0 ,#0$"-,# /6+$1 !-*(0+ (, 4 #! "" 0 $*%./-1$"1(-, & (,01&*(-1-5(, ,(++2,-02../$00(3$ 1-5(,./-#2"$#!6 4 $*$6 -1-/0(,+(1-0(0 4 "! $,&01 (00$"1(,&1'$+-*$"2* /+$"' ,(0+0-%1 1(,+$#( 1$#"$** ! *% 0+ 2*+& *%,1*!#&,* "6"*$ //$01 16 ! 4 !"'# ,#1*-4 01'$-&-/$"$.1-/'-+-*-&&"/(1(" *%-/"21 ,$-20 0$,0-/6(,,$/3 1(-, 4 !"" 911$,'-%$/ $3$*-.(,& ,$2/-,"+("/-"'(.%-/(#$,1(;" 1(-, -%,-3$*,-,"-#(,&0(,3-*3$#(,,$2/-, *#(%%$/$,1( 1(-, 4 $*$6 $6-,#+(1-0(0-*$0-% 4 ) $ " ,#1*-4 '$, 12/ *'(01-/6-%1'$,$/3$&/-41'(,'(!(1-/-&- 4 " %""% 1-(17,$/ $,#/(1(""$**0(,0)(," ,"$/ .-1$,1( *1 /&$10%-/(++2,-1'$/ .6 ))0(-* ",!*/* + /%,$!!*' !.!*#!+ +)('+(*! 0 #"!! : "+"%8%1 %!$8&/13(%)2,%3 : )"&"$"!.$3,/6 (%.!341!,()23/18/&3(%.%15%'1/63().()")3/1/'/ : "$"!17 31%221%20/.2%3/!.3)&4.'!,01/3%).2).20%1'),,42 : "(4"%1 (%/,%/&8/2).").3(%!3(/'%.%2)2/& )#1/5),,).#,42)/.)2%!2% : "#$#'4"%1 )-%1%2/,5%$).3%1!#3)/./&2#!&&/,$#/-0,%7%2 : %," "!""4"%1/-!.) !.'%1(!.2!.$$%.$1)3)##%,,&4.#3)/.).0!",!3%$-)#% : "/;%1 %'4,!3)/./&%701%22)/./&3(%)-'%.%,/#42 ).!0/03/2)2 : #$"933%.(/&%10(1422) /.#/$).'&4.#3)/./&- /2+!1 $1)5).'//'%.%2)2). : "%1.%1 /,%/&.)31)#/7)$%28.3(!2%)2/&/1-2).)2#(%-)!1%0%1&42)/.).*418 : "$/,!#%+ (%%,42)5%-/,%#4,!1")/,/'8/&3(%5!4,3 : "$$),,4.'%1 .5%23)'!3).'3(%1/,%/&).,8-0(/#83%$%5%,/0-%.3 : $$422%1 /,%/&#(1/-!3).1%-/$%,).'&!#3/1).%-"18/.)#23%-#%,,2 0+&$61 801$$, 0+270'), 20 $//6.30 $(2'05$0&1 5+2*%''0$-& %'4'0$)'1 1/.-1.0'&%6 Seminars! Biocenter ! ! ; ; '01- #"!! "%"2 #/ ,1'+5#*-+!-+.-2,""#3#*-.+#,1',,-3#*; *')#9 0050501#+0 $"%"""2/,#/ *14-/+00+-"#*0501#+01-012"501#+!#**0 /#%,#/1'-,,"/#./-"2!1'-, 0+&$61 #'1&#/', 801$$, 0+270'), 20 -/', )".* 3 +!+"& ' '+')$+,&+* /(1$4:/(&674(4(1(,&+65&+(,'/&+7/6; 1,8(45,6:!,(11$ 56@224 3 +&$+"&+());(. %2766+((& /,.('20$,12)6+(3426(,1$1',651(,*+%24+22' 3 ')&("%'$!)'&+'& #4$-$125., 2'(/,1*67024,0071(&(//,16(4$&6,21,1&2/24(&6$/&$1&(4 3 ))+"&&),1'1(4 426(,1$&,/,6: 3'$6( ; '01- $" "%"-$+,, /-1#',',0##.0'*-,,&' '1'-, ; "# "611#,&-$#/ .1+#/00"'%,-01'!+/)#/',&/-,'!'",#5'0#0# ; $ 3 &)%%")+'!,(624 2/(&7/$40(&+$1,5052)64$15&4,36,21$/4(*7/$6,21 ; '01- #"0 /-,/#0'01,!#', 3 $*,&$%,+!+)+,)&,)&+*&'- >29$4'$*(1(6,&6+(24:2)&+,/'+22',1)(&6,275',5($5(5? ; #"%%" # !%% 9#**0'%,*',%',!&/-,'!"'0-/"#/0: 3 "'$#%&&$$5 4(&745245733/:)245,'(423+24(%,25:16+(5,5,1 ',2%2/1'-,-$ 8 3 )"',$"0),&74$ +(42/(2)34(4,%259,6&+(5,1%$&6(4,$/*(1(4(*7/$6,21 3 "%'&!))<66(1+2)(4 4201(74$/',))(4(16,$6,212)(0%4:21,&56(0&(//5 62$121&2',1*0,&42$44$:&+,3 3 &,$$'&*'$$(,5 ,5$55(0%/:2)6+(0$&+,1(4:'74,1*!8(5,&/()240$6,21 3 "'+).%'*/,#"233/(4 +(42/(2)6$6,1',))(4(16,$6,212)67024$552&,$6('0$&423+$*(5 ,1!1(70$00$4:67024%($4,1*0,&( 3 ")"!)!"-$"& "!(/(: +(42/(2);4,18(46(%4$6('(8(/230(16 ; % ##'**2,%#/ $$',!#**"#3#*-.+#,1,"02/3'3* ; "$$"%"#'0 '0)#5/#%2*1-/-$.-1#,1'*+#+ /,#01/#00 /#0.-,0#.1&45 ; "%$'!) !!',1'-,%',011&#/-0!*#/-0'0 ; "$"/#00*# &'01-,#"#!#15*0#0+(-//#%2*1-/-$0#!-,"/5 +#1 -*'1#./-"2!1'-,',$2,%' ; $$&"200#/ '-*-%'!*$2,!1'-,,"/#%2*1'-,-$+-20# +12.,.)+' 801$$, +12. 9,,'0120$11' $//6.30 $(2'05$0&1 5+2*%''0$-& %'4'0$)'1 1/.-1.0'&%6 17 ! !++2*/,!%.$,1!,#-1(.'"$$,!)#"$0$,!&$--+*)-*,$#"2 Hubertus Haas is kindly thanked for organizing the BC Seminars since all the years they were held!! Seminars! Biocenter ! 18 ! The first Biocenter Seminar in the new CCB building took place on March 16, 2012! Homepage: The Biocenter! http://biocenter.i-med.ac.at! 19 ! This homepage was designed and is maintained by Rene Snajder, Division of Bioinformatics! Awards! The Biocenter! Alexandra Lusser! Division of Molecular Biology! 2005 – 2011! Norbert Polacek! Division of Genomics and RNomics! 2006 – 2012! David Teis! Division of Cell Biology! 2009 – 2015! Fromer START Awardee! Andreas Villunger! Division of Developmental Immunology! 2003 - 2009! 20 ! David Teis with Johannes Hahn, Federal Minister of Science! The Biocenter! Former Start Prize Awardees! The START-Prize has been founded in 1996 by the then Federal Minister of Science Rudolf Scholten. It is announced every year. Applicants must be under 35 years and are selected by an international jury of renowned scientists. Successful applicants are supported for up to 6 years. Therefore, the START prize represents that award of the FWF that is of highest national reputation. Also, it is the highest amount of support (i.e. 1.200.000 Euro) in Austria that can be given to single awardee. The most important idea behind this prize is to give young and highly qualified scientists the financial basis to persue a long-term research project independent from their university supervisors. It is mostly young scientist who worked successfully as post-doctoral fellows abroad and who plan to return to their home universities. Often, the situation at home is difficult in terms of a secured career perspective which may hinder their return and which would mean a brain drain to Austrian universities. Until now, the START Prize has been awarded 76 times (see some of the portraits of awardees on the previous page). It is a great pleasure to mention that 11 of 76 awardees belong the Innsbruck Universities and 4 of these 11 to our institution. Only 7 of 76 awardees were women, however 1 of these 4 Biocenter awardees is a women. A list of awardees can be found under http://www.start-portal.at/die-starter/liste.html.! Andreas Villunger, born 1967 in Innsbruck, studied Biology at the University of Salzburg, later Microbiology and Biochemistry in Innsbruck. He graduated in 1996 with a thesis on "Interleukin-6 regulated cell death and survival in multiple myeloma“. Programmed cell death, often also called apoptosis, started to receive major scientific attention in the late 1980ies, a field of research that was also awarded the Nobel Prize in Physiology and Medicine in 2002. Andreas left for Melbourne, Australia, in 1998 and worked with Professsor Andreas Strasser at the prestigeous Walter & Eliza Hall Institute for Medical Research, returned after 4 years to Innsbruck where he became Associate Professor in Immunology in 2007 at the Division of Pathophysiology and Full Professor of Developmental Immunology in 2009.! Alexandra Lusser, born 1970 in Lienz, studied Microbiology at the University of Innsbruck. Results from her doctoral thesis under the supervision of Peter Loidl were already published in Science! From 2001 till 2004, Alexandra worked as post-doc with James T. Kadonaga in the Section of Molecular Biology at the University of California in San Diego. Returned to Innsbruck, she became Associate Professor. Alexandra is interested in elucidating the mechanisms that govern chromatin dynamics, a field that gained great momentum 10 years ago. In San Diego, Alexandra discovered an ATP-dependent enzyme which is required for a dsDNA to get wrapped around histone proteins. She now works with her team on CHD1, one of two proteins currently known as being required for chromatin assembly and disassembly. Without this factor, fertilization is not possible! ! Norbert Polacek, born 1970 in Vienna, studied Biology and Genetics at the University of Vienna. He graduated in 2000 with a thesis under Andrea Barta describing changes in structure of rRNA during translation. Later he went as post-doc to Knud Nierhaus at the Max-Planck Institute of Molecular Genetics in Berlin, thereafter to Alexander S. Mankin at the Center for Pharmaceutical Biotechnology, University of Illinois at Chicago. There, Norbert continued his work on the catalytic properties of rRNA. In 2003, he returned to Austria and joined Alexander Hüttenhofer. In 2005, Norbert became Associate Professor and in 2006, he received the START Prize. He became interested in non-coding RNAs (ncRNAs), ribozymes In 2011, Norbert received a call for Full Professor of Biochemistry at the University of Bern, which he accepted. We will miss him here.! David Teis, born 1975 in Graz, studied Microbiology at the University of Graz. For his PhD# thesis David joined the international PhD-Program at the renowned Institute of Molecular Pathology (IMP) in Vienna. After graduating in 2002, David#moved with Lukas Huber to the Division of Cell Biology at the University of Innsbruck. In# 2005, David – with an EMBO and a Human Frontier Science (HFSP) #long-term fellowship in his pocket - moved as a post-doc to Scott D. Emr, University of California, San Diego, later Cornell University, New York. In 2009 David returned to the Biocenter and#received the START prize. Here, as SFB021 Junior Investigator, he established# an independent research# group in the Division of Cell Biology. The main focus of his team# are the molecular mechansims#used by #cells#to#adapt to their environmental. In particular, he is interested how membrane transport and signaling are coordinated. In 2012, David became Associate Professor.! 21 ! The Biocenter! Awards & Honors! CORNELIA THÖNI from the Div. of Cell Biology (group of Lukas Huber) was recently selected to be DMMGF Scholar 2012 (Days of Molecular Medicine Global Foundation, seated in Cambridge, MA). ! OLIVER SCHMIDT from the Div. of Cell Biology (group of David Teis) received in 2012 a prestigious longterm fellowship from the EMBO.! 22 ! VERNEA LABI from the Div. of Developmental Immunology (Andreas Villunger) was awarded the Science-Prize 2012 of the Stadt Innsbruck, and also received an EMBO Postdoc Fellowship to join Klaus Rajewski in Boston.! DENISE TISCHNER from the same lab received the Sanofi-Award 2012! ELISABETH PFEIFENBERGER from the Div. of Molecular Pathophysiology (group of Stephan Geley) received a 6-months stipendium to study in Singapore‘s Biopolis.! PETRA MICOLCEVIC from the same lab was selected as best out of 100 applicants for a postdoc position at the famous IRB Barcelona. She also received the 2012 Research Funding Prize of the Austrian Society of Endocrinology.! GIORGA LAMBERTI from the Div. of Cell Biology (group of Lukas Huber) has received a Lise-MeitnerProgram grant from the Austrian Research Fund (FWF).! CECILIA GRUNDTMANN and GEORG WICK of the Div. of Exper. Pathophysiology & Imm. edited a book on „Inflammation and Atherosclerosis“, 2012 Springer. ! DIETMAR FUCHS of the Div. of Biological Chemistry became in 2011 Honorary Member of the Austrian Society for Clinical Chemistry and Laboratory Medicine.! DIETMAR FUCHS of the Division of Biological Chemistry was identified by the LABORJOURNAL as having reached in 2012 rank 8 among the most cited researchers in Germanspeaking countries in the field of Clinical Chemistry .! KATRIN WATSCHINGER from the Div. of Biological Chemistry (group of Ernst Werner) received an FWF Schrödinger-Stipendium for 12 months and moved to the Wellcome Trust Centre for Human Genetics (University of Oxford.! NINA CLEMENTI from the Div. of Genomics & RNomics (group of Norbert Polacek) received 2011 the Liechteinstein-Prize for Excellence in Science.! The Biocenter! Awards & Honors! MARKUS KELLER from the Div. of Biological Chemistry (group of Ernst Werner) received a 2012 Erwin Schrödinger-Stipendium from the Austrian Research Fund.! MARKUS GRÜNDLINGER from the Div. of Molecular Biology (group of Hubertus Haas) received the 2012 Microbiology Prize from the Austrian Soc. Hygieny (ÖGHMP). ! NORBERT POLACEK from the Div. of Genomics & RNomics became in 2011 Full Professor of Biochemistry at the University of Berne, Switzerland. ! ERNST WERNER from the same lab received the Sir Gowland Hopkins-Award at the 2012 Int‘l. Symposium on Pteridines and Folates.! MICHALE BLATZER from the same lab received the Prof. Ernst BrandlPrize 2012.! Norbert was also elected as member of the Young Faculty of the Austrian Academy of Sciences. ! MELANIE AMORT, Div. of Genomics & RNomics (group of Norbert Polacek),! CLAUDIA WÖSS, Div. of Developmental Immunology (group of Andreas Villunger) received in 2011 a DOC-fFORTE stipendium from the Austrian Academy of Sciences. ! LUCA FAVA from the Div. of Developmental Immunology (group of Andreas Villunger) received in 2011 a 3 years EMBO research fellowship to work in Andreas‘ group. ! BENNO CARDINI from the Div. of Biological Chemistry (group of Ernst Werner) received in 2011 the Wilhelm-Auerswald-Prize for best Dissertation.! PRZEMYSLAW FILIPEK from the Div. Cell Biology (group of Lukas A. Huber) received at the 2011 Austrian Proteomic Research Symposium the Best-Poster-Award. ! MARKUS A. KELLER from the Div. of für Biological Chemistry (group of Ernst Werner)! received in 2011 DOC-FORTE stipendia from the Austrian Academy of Sciences. ! KATRIN WATSCHINGER from the Div. of Biological Chemistry (group of Ernst Werner) received the Sanofi-Aventis Price 2010 of the MUI. ! DAVID TEISS from the Div. of Cell Biology received Career Development Award 2010 of the Human Frontier Science Programme of the EU. ! BETTINA SARG from the Div. of Clinical Biochemistry received the Otto-Kraupp-Award for the „Best Habilitation in Austria in 2010“. ! SIEGFRIED SCHWARZ from the Div. of Exper. Pathophysiology & Immunology was awarded with the Best Project Award of the Clinical Skills Project for Medical students for his Venipuncture (2011).! INES WASLE from the Div. of Experimental Pathophysiolg. & Immunology received – together with her thesis „mother“ ROSWITHA SGONC – the „Best Dissertation Prize“ of the Austrian Society for Rheumatology. ! ARNO HELMBERG from the Div. of Molecular Pathophysiology was elected as Vice-chairman of the Innsbruck Medical University Senate (2011). ! 23 ! Visitation at the BC! By invitation of LUKAS A. HUBER and Oncotyrol, the Biocenter got the uniqe opportunity to welcome Univ.Prof. Dr.Dr.h.c.mult. HARALD ZUR HAUSEN from the DKFZ (Deutsches Krebsforschungsinstitut Heidelberg). On April 4, ZUR HAUSEN gave a grand lecture within the „Onkologisches Kolloquium“-Series (organized and maintained since more than 30 years by emer.Univ.Prof. WILHELM SACHSENMAIER). The topic was Cancer caused by infections: Status and Perspectives. The lecture hall was cramped full and the discussions long! We at the Biocenter feel very honoured by this visit. Next day, ZUR HAUSEN had a lofty breakfast downtown with some of our young doctoral students, then listened to a presentation of DAVID TEISS und NORBERT POLACEK and thereafter gave a press conference.! More details: http://www.i-med.ac.at/mypoint/news/2011040401.xml ! 24 ! Obituaries! The Biocenter! Emer.Univ.Prof. Dr.phil. Dr.rer.nat.h.c. Dr.med.h.c.. Helmut Wachter! died on January 21st 2012! MR Dr.med. Erika Artner, geb. Dworzak! died on January 5th 2012! Univ.Prof. Dr. rer. nat. Arnulf Hausen! died died in July 2011! ARNULF HAUSEN, former member and assistent professor of the Division of Medical Chemistry, died in July, in the age of 72 years. Many M.D.s in the Biocenter were former students of Arnulf, who introduced them into the secrets of chemistry and biochemistry. He was a quiet and friendlyminded person. ! DIETMAR FUCHS has written an obituary notice on Arnulf on the homepage of our MUI: ! http://www.i-med.ac.at/mypoint/news/ 2011080601.xml.! 25 ! Long Night of Research April 28, 2012! The BIOCENTER actively supports the dissemination of scientific knowledge and interest among laypersons, in particular the young ones. Therefore, many scientist form the Biocenter participated in The Long Night of Research 2012, an initiative of the Federal Ministry of Science and Technology, together with all Universities of Austria. Hundreds of children visited the CCB and asked questions and were tutored by patiently answering members of the Biocenter. ! 26 ! Opening of the CCB May 21, 2012! 27 ! Inauguration of the CCB June 1, 2012! THE LANGUAGE OF CELLS WHY WE ARE NOT THE SLAVES OF OUR GENES Gottfried Schatz !University of Basel! Studied chemistry and biochemistry in Graz and in Vienna, professor at Cornell University, Ithaca, N.Y., professor (now emeritus) at the Biozentrum at the University of Basel, was secretary general of EMBO and president of the Swiss National Science and Technology Council; member of various scientific academies, many prestigious awards, pioneering studies on mitochondria and discoverer of mitochondrial DNA! EXPLORING THE PROTEIN UNIVERSE WITH METHODS OF PHYSICAL CHEMISTRY Kurt Wüthrich ETH Zurich & Scripps Res. Inst.! Student of physics, chemistry and mathematics at Universities of Bern, Basel, Berkely, Bell Laboratories. Member of the German, Hungarian, Swiss Academies of Sciences. Professor of Biophysics at the ETH Zurich as well as at Scripps Research Institute, La Jolla, CA. ! 2002 Nobel Prize for Chemistry for his work on the structure elucidation of proteins.! ATP-SENSITIVE POTASSIUM CHANNELS, NEONATAL DIABETES AND NEUROLOGICAL COMPLICATIONS: FROM MOLECULE TO DISEASE Frances M. Ashcroft University of Oxford! Royal Society Reseaarch Professor at the University of Oxford and Fellow of Trinity College Oxford. Director of the Oxford Centre for Gene Function. „For Women in Science Laureate 2012“ (by L’Oréal Corporate Foundation and UNESCO) for her pioneering work in the elucidation of glucoseinduced insulin secretion and the contribution of the potassium channels herein.! THE BIRTH AND DEATH OF THE SYNAPSE: A ROLE FOR WNT SIGNALING Patricia Salinas University College London! Study of Clinical Biochemistry, University of Tucuman, Argentina, PhD at Oregon Health Sci. Univ., then Howard Hughes Med. Inst., Stanford Univ., Group Leader, Senior Lecturer, Reader at the Developmental Biology Research Centre, The Randall Institute, King's College London, now Professor in Cellular Neurobiology, University College London.! CRICK'S CENTRAL DOGMA FROM REPLICATION, TRANSCRIPTION TO TRANSLATIONS 28 ! Dominique Lecourt !U Université Paris VII! Former student of the Ecole Superieure, philosopher, Professor at the Université Paris Diderot 7 and director Centre Georges Canguilhem. Cofounder of the International College of Philosophy, member of the Human Rights Commission of UNESCO, member of the CNRS Ethics Committee. Officer de la Légion d‘Honneur, Chevalier de l‘Ordre National de Mérite. ! Thomas A. Steitz ! Yale University! Molecular biologist, biochemist, PhD at Harvard University, Research Fellow at the British MRC in Cambridge, then Yale University in New Haven, Connecticut, Sterling Professor for Molecular Biophysics and Biochemistry, HHMI Investigator at the Howard Hughes Medical Institute. Member of the US National Academy of Sciences, Member of the Royal Society.! Nobelprize 2009 for Chemistry for his work on the structure and function of ribosomes! From MOLECULES TO LIFE! Inauguration of the CCB June 1, 2012! From MOLECULES TO LIFE! 29 ! Wachter Foundation! Professor Mag. Dr.DDr. H.c. Helmut Wachter, born 1929 in Landeck, studied pharmacy at the University of Innsbruck. After graduation, he studied medicine and later joined as Assistant Professor the Institute of Medical Chemistry. There, he became Associate Professor and installed a very productive research group. The focus of this group was the investigation of an until then barely recognized group of small molecules, i.e. the pteridines. 1971 – 1972, Professor Wachter was appointed Visiting Professor at the Westminster Medical School, University of London, in 1974, he became Full Professor of Medical Chemistry at the University of Innsbruck. In 1986, he founded the Ludwig Boltzmann-Institute for AIDS Research at the University of Innsbruck. In 1987, he received a Honorary Degree (Dr. h.c.) in Natural Sciences by the University of Aston in Birmingham, with more honorations to follow: Austrian First Class Honorary Cross for Science and Arts (1988), the Fritz-Pregl-Medal of the Austrian Society of Analytical Chemistry (1992), Honorary membership of the Austrian Society for Clinical Chemistry (1992), Honorary Decoration of Tyrol (1996), Honorary membership of the International Society for Pteridinology (1998), whose elected president he was until 1992. In 1997, Professor Wachter retired as Professor Emeritus of Analytic Medical Chemistry. ! In 1994, Helmut Wachter together with his wife Ilse Wachter donated a foundation to the University of Innsbruck, the ILSE & HELMUT WACHTER-STIFTUNG (http://www.wachterstiftung.org). It is devoted to further medical science for the welfare of mankind and to raise the reputation of the Medical University of Innsbruck. This goal shall be accomplished by granting a scientific award. The prize is 15.000 Euro and will be given to international scientists of highest reputation, being nominated by peers and colleagues (self-application not possible). ! Thus far, five awards have been given: Professors Avram Hershko and Aaron Ciechanover, Technion-Israel Institute of Technology, Haifa, for their discovery of the ubiquitin system (1999) [who received in 2004 also the Nobel prize]; Professor Hanns Möhler, University of Zurich, for his elucidation of the anxiolytic properties of benzodiazepine drugs (2001); Professor Wolfgang P. Baumeister, Max Planck-Institute of Biochemistry, Martinsried, for his elucidation of the structure of the proteasome (2003); Professor Cynthia J. Kenyon, University of California, San Francisco, for her ground-breaking work on the regulation of aging mechanisms in C. elegans (2005); Professor Irving L. Weissman, Stanford University, California, for his life-long work on the differentiation of lymphoid cells as well as on stem cells and their medical use (2007). [portraits of the awardees on the bottom of this page, from left to right] ! Nine experts of the Medicial University of Innsbruck form a committee for selecting one of the nominated persons. The board of the foundation‘s directors then bestows the prize to the awardee. The board of directors consists of 2 professors of the Medical University of Innsbruck, i.e. Professor Peter Fritsch and Prof. Dietmar Fuchs, and Dr. Helmut Fröhlich, retired CEO of the Hypobank Tirol. Since 2009, Prof.. Lukas Huber acts as chairman of this board.! This year‘s awardee was Professor Jean-Laurent Casanova (picture below in color), Professor of Pediatrics, Head of St. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, New York for his work on A genetic theory of childhood infectious disease.! 30 ! The Biocenter! Artwork in the CCB! Gabriela Nepo-Stieldorf created this sculpture which was given by Ilse Wachter, in the name of the Ilse and Helmut Wachter-Foundation, to the Biocenter. The grand lecture hall (M.EG.180) belonging to the Biocenter is since then named „Ilse and Helmut Wachter-Lecture Hall“.! 31 ! The Biocenter! Artwork in the CCB! 32 ! The Biocenter! Artwork in the CCB! ARS MORPHOLOGICA Kristian Pfaller created these 3 pictures made from raster electron-microscopic slides Left one showing a cancer cell (provided by Ilja Vietor), ! middle one showing a neuron (povided by Christine Bandtlow), ! right one showing an Aspergillus (provided by Hubertus Haas) ! 33 ! The Biocenter! Artwork in the CCB! 34 ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Siegfried Schwarz created by molecular modelling from PDB data these 15 pictures and kindly gave them to the Biocenter. They can be seen on the northwestern walls of floors 2, 3, and 4. ! 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 199 1A4Y 1BBE 1GLU 1IGT 1BRD 1NK3 1NPO 1OEL 3HHR 1A28 1AU7 1GC1 1AO7 1TSR Mitomycin + DNA. RNAse inhibitor. Collagen triple helix. Glucocorticoid receptor dimer + DNA. Antibody. Rhodopsin + all trans Retinal NKX2-1 homeobox domain + DNA. AVP + NP2 Groel chaperone HGH + HGH receptor dimer Progesterone (P) receptor + P Pit 1 dimer + DNA. CD4 + HIV gp120 + Anti-gp120 Fab HLA A + ß2MG + HTLV1 Tax peptide + T cell rec. p53 dimer + DNA. ARS IN_STRUCTA! MOLECULES OF LIFE & MUTATIONS 8*&,31,9:4;:<:=1,)!:6>:4567: ??@ A?*+"*,:B(,:?!*/'2",9:C:@'(/*0')'+*D E((/$:F56-445:A6-GHD: !"#$%&'()*+,*-.$/0*123(44'(56*-.$/0*7&().*$%)*83("(0&$*9/%'(%)!"4(":;$<<* -(,%!<(*1=($5("0* P(KBJ1+J:@13/*'2"*,:A=IQ>:=R+)!*+D QK/*:S)!K')!"'+J:A=IQ>:T*'0*K&*,JD T(,2":U*22K*,:AVW:=R+)!*+D XK10'/',:Y1,(Z.Y1,(Z(9:AW?[>:[1Z'2>:WS\D Q/,*:@*,J*,:A]=@F:H,*+(&K*D U,'2"'+1:[^'+(Z').?1,3J(:A=8IF>:P'*+>:2*22'(+:)!1',D @*,+!1,0:E3##:AX'2"1>:WS\D I1,"')'#1"'(+:'2:B,**:(B:)!1,J*>:#K*12*:,*J'2"*,:&9:*./1'K:"(:,(21++1-+1J*K*L'./*0-1)-1": ;545:H,1M:.:I3,)!2",1N*:;O !""#$%%&'()*+"*,-'./*0-1)-1"%&'(2",3)"4567 35 ! MCBO Science Day 2013! https://www.i-med.ac.at/mypoint/news/671247.htm 36 ! pictures by Siegi Schwarz March 1, 2013. For the first time, the traditional MCBO (Molecular Cell Biology & Oncology) Science Day was held in the new CCB building of the Biocenter. Poster prizes received Gurjot Kaur (Striessnig Lab), Solmaz Etemad (Flucher lab) and Manuel Alonso Y Adell (Teis lab) (see picture in the right lower corner, together with Bernhard Flucher, coordinator of the MCBO programme). Eleonora Otii (Villunger lab) and Marin Barisic (Geley lab) were invited Alumni speakers. Eleonora was also recipient of the MCBO Award 2013 for her work Targeting antiapoptotic A1/Bfl-1 by in vivo RNAi reveals multiple roles in leukocyte development in mice. MCBO Science Day 2013 in the new CCB! 37 ! http://www.oncotyrol.at/! Oncotyrol – Personalized Cancer Medicine Made in Tyrol! Oncotyrol – Center for Personalized Cancer Medicine is the Austrian address for translational research of personalized cancer medicine in a public private partnership. The combination of basic research and long-lasting experience in clinical oncology in Tyrol is the basis of Oncotyrol. Scientific, clinical and industrial partners from all over the world are connected that are sharing the wish to bring personalized cancer medicine to the market. ! Closing the Gap between Academic Research and Commercial Development! Oncotyrol's goal is to accelerate the development and evaluation of individualized cancer therapies, diagnostics and IT solutions. ! Oncotyrol is committed to ! • crowning the excellent research of our academic partners by practical application of their inventions! • fulfilling the needs of clinicians treating cancer patients day-to-day ! • valuably amending the product pipeline of our industrial partners – fast, cooperatively and cost-effectively! • effectively and responsibly use public funding to the benefit of the patients and the life science location. ! From Bench to Bedside – and Back! Oncotyrol realized that clinical benchmarking is the key to efficiency and success. The needs of clinicians treating cancer patients on a day-to-day basis are permanently fed back into Oncotyrol's development process. ! Lukas Huber! CSO! Bernhard Hofer! CEO! The K1 Competence Center Oncotyrol ! Oncotyrol is funded within the scope of COMET – Competence Centers for Excellent Technologies by the Federal Ministry for Transport, Innovation and Technology (BMVIT) and the Federal Ministry of Economy, Family and Youth (BMWFJ) as well as the federal states Tyrol and Salzburg. The Austrian Research Promotion Agency (FFG) manages the competence center program COMET. Within the scope of the COMET program, 55 % of research is funded by public authorities and 45 % by industry. Besides that, Oncotyrol has a separate business unit, where commercial activities like exploitation of results, contract research, services and COMET-independent public funded projects are located.! Oncotyrol's shareholders are the Innsbruck Medical University (24,9%), Leopold Franzens University Innsbruck 10%, UMIT – the health and life sciences university (21%), Location Agency for Business and Science Tyrol (21%), Tyrolean Hospital Holding TILAK (21%), Cemit GmbH (2,1%). To represent the perceptions of the industrial partners in Oncotyrol, the Location Agency for Business and Science Tyrol, TILAK and Cemit act as speakers for the enterprises, thereby ensuring a balance between academic and industrial interests.! 38 ! | Contact: Oncotyrol | Center for Personalized Cancer Medicine GmbH | Karl-Kapferer-Straße 5 / 3rd floor | 6020 Innsbruck | Austria | ! | Tel. +43.512.576523-0 | Fax. +43.512.576523-301 | Email: offi[email protected] | www.oncotyrol.at | ! http://www.oncotyrol.at/! Research Areas! The COMET funded part of Oncotyrol, called Division I, is structured like a value chain for the development of novel therapeutic and diagnostic concepts. Therefore our value chain is based on the 4 major pillars! 1. Biomarker and drug target identification (Area 1), coordinated by Prof. Helmut Klocker! 2. Assay development and drug screening (Area 2), coordinated by Prof. Lukas A. Huber! 3. Innovative therapies (Area 3), coordinated by Prof. Martin Thurnher! 4. Health Technology Assessment (HTA) and bioinformatics (Area 4), coordinated by Prof. Uwe Siebert and Prof. Zlatko Trajanoski! Area 1 - coordinator: Prof. Helmut Klocker! The identification of biomarkers and drug targets is the first step towards personalized cancer treatment and as such comprises area 1 in Oncotyrol. Biomarkers are required for diagnosis, risk prediction and prognosis, as well as for therapeutic approaches, e.g. drug development and augmentation of drug efficiency. Accordingly biomarker and drug target identification are complementary if not entangled. During funding period 1, this task has been distributed between the areas 1, 2 and 3. For the second funding period we stratified all project areas and rearranged them based on technical and outcome oriented structures. Therefore, all biomarker projects have now been merged into area 1. This project portfolio in area 1 is the first link into Oncoytrol’s value chain, since without definition of molecular parameters modern diagnosis and drug developments are not possible. The markers identified in area 1 can then directly be exploited by Onctoyrol’s company partners or transferred into area 2 for assay development.! The availability of early validation of markers and targets is an added value of Oncotyrol. Health Technology Assessment (HTA) is an integrated component of many projects, constantly validating the approaches themselves.! The expertise within area 1 represents a condensate from funding period 1 with successfully established and therefore prolonged projects but complemented with some new and very innovative approaches.! Area 2 - coordinator: Prof. Lukas A. Huber! The second element in Oncotyrol’s value chain is Area 2, named “Assay Development and Drug Screening”. Several markers and molecular targets have been identified in funding period 1, which have now to be translated into applicable tools. Area 2 is focused on developing assays for drug screening and at the same time making use of the knowledge gained in Area 1 (previously part of 1, 2, and 3). For discovery of markers and targets usually very laborious and complicated technological approaches have to be applied. However, once defined the presence and/or activity of such markers can be measured much more easily in optimized assays. However, in order to measure diagnostic markers, basic technologies have to be developed first that are fast, reliable and easy to use. These technologies (ELISAs, gene chips, antibody chips, proteomics …) have to be validated in larger cohorts of patient samples to prove their credibility. Once this will be achieved in Oncotyrol it is planned to license them to companies (or project partners) who will transfer the technology into marketable products. Concerning drug targets the development of reliable assays to measure the target or its activity is only one step of the planned process. The second step is to apply these assays within the drug screening process itself.! 39 ! http://www.oncotyrol.at/! Recent improvements in target discovery and high throughput screening have increased the pressure at key points along the drug discovery pipeline. High-content screening was developed to ease bottlenecks that have formed at target validation and lead optimization points in the pipeline. It is rather obvious that Oncotyrol does not have the required infrastructure to compete with pharmaceutical industry in high throughput screening approaches in terms of speed and chemical capacity. However, Oncotyrol harbors well developed potential and expertise in molecular mechanisms, sophisticated cell models and many other innovative approaches. Consequently Oncotyrol focuses on a low and medium throughput but high contents approach in drug screening.! In Area 2 infrastructural and technological developments are either brought in by company partners and or being developed within our Oncotyrol laboratories. These include latest technologies for pipetting automation, cell culture automation, molecular measurement and imaging. Most importantly, chemical libraries are made available for the screening projects through Oncotyrol’s company partners. Most of the aquired and developed tools can be shared between individual screening projects, with a few exceptions and/or limitations due to background IPR restrictions. A complete fusion of this area from single projects into a program is the ambitious but aimed goal in this funding period. This could on one hand be considered within the Austrian Drug Screening Institute (ADSI) in Innsbruck, by the Leopold-Franzens University. The ADSI will be closely associated with Oncoytrol and could be an ideal partner, for instance, to take over screening programs using the assays developed in Oncotyrol. On the other hand, Oncotyrol will still be able to allocate the screening capacity in-house.! Once hits for drug candidates are discovered in Oncotyrol the laborious hit to lead development is the next task. For instance, in one of our screening programs (e.g., project 1.2 from funding period 1) the Nested Chemical Library™ provided by company partner Vichem is applied for hit identification for a particular kinase target. Scaffold hopping will lead to the identification of novel lead structures, yet conserving the structural features of the initial, non-proprietary hits. Vichem then uses its pharmacophore modeling technique including the computational screening of a virtual library, consisting of 15 million potentially synthesizable compounds, and our medicinal chemistry expertise to come up with novel patentable scaffolds. ! Area 3 - coordinator: Prof. Martin Thurnher! Within Area 3 projects develop therapeutic concepts in preclinical animal models and even in small patient studies. Ideally the concept for the therapeutic approaches comes from Oncotyrol’s added value chain. But the center has also included mature approaches from outside the center, which will be integrated for funding period 2.! 40 ! The projects of area 3 are approaching the edge of therapeutic evolution within the center. Due to the massive expenses of clinical trials, performing preclinical and small patient studies is currently the self-set limit of development. The individual projects are quite distinctive, ranging from immunostimulatory approaches via biologicals to the influence of diets on cancer genesis. Due to the heterogeneity of the projects, synergisms in the content are hard to define. However, common technical resources such as the available GMP laboratory, certified standards and ethical monitoring will be used.! Area 4 - coordinators: Prof. Uwe Siebert, Prof. Zlatko Trajanoski! In funding period 1 health technology assessment (HTA) and bioinformatics were each represented by individual scientific areas. HTA is a rather new discipline of direct importance for clinicians, public health care and pharmaceutical companies, providing standardized decision making and evaluation tools. Bioinformatics is a rapidly growing interdisciplinary topic inevitable and constantly improving to provide tools for modern data analysis. Consequently both are very distinctive disciplines. In their role in the center, however, they share their importance in accompanying the research in the areas 1,2 and 3 by translating genomic and proteomic research into innovative, individualized, safe and cost-effective approaches for cancer prevention, diagnosis and treatment and thereby also supporting dissemination and reimbursement of such technologies.! Therefore, without undermining the importance of the two research disciplines, but with the focus on the new outcome and technology based structure of the center, they were fused to one area, HTA and bioinformatics, respectively.! Both, HTA and bioinformatics play a dual role, on one hand the development of new methods and technologies, on the other the supportive provision of these and other technologies to optimize projects from the other areas. A common problem of both disciplines is the difficulty in protection of IPR, which is compensated by the generation of visibility for the center and the direct impact on local healthcare.! HTA is directly involved in monitoring and early time evaluation of newly discovered or developed markers and technologies. The crucial point is an early stage decision making if a project is worth pursuing or not to save time, money and last but not the least human resources and personal fates.! Bioinformatics is required to manage and analyze the massive amounts of data produced by modern technologies like deep sequencing, high throughput life cell imaging, chip technologies and many others used in the center. The importance of bioinformatics is underlined by the establishment of our bioinformatics and knowledge management core facility.! Oncotyrol is one of twelve partners in the EU-FP7 project OPTATIO (OPtimizing TArgets and Therapeutics In high risk and refractOry Multiple Myeloma) that researches new strategies to fight against multiple myeloma. The scientific coordinator is Dr. Wolfgang Willenbacher from Innsbruck Medical University. Prof. Lukas Huber and Dr. Winfried Wunderlich are the contact persons for Oncotyrol's tasks within OPTATIO. http://www.cemit.at/projekte/eu-fp7-optatio.html! http://www.adsi.ac.at/! Austrian Drug Screening Institute ! High Content Screening with tailored clinically relevant assays! The Austrian Drug Screening Institute (ADSI) is a new research enterprise of the Leopold Franzens University of Innsbruck (LFU) and offers drug screening services for companies (e.g. Bionorica) as well as academic research institutes. The special thing about the ADSI is on the one hand that cell-based assays are tailored in a way that they are particularly clinically relevant. On the other hand as many parameters as possible are read out (High Content Screening). This allows a quick and systematic scan of focused compound- or extract-libraries for effective candidates in view of various medical questions (hit finding). Scientific Directors are Prof. Lukas Huber (Biocenter, Medical University Innsbruck) and Prof. Günther Bonn (Institute of Analytical Chemistry and Radiochemistry, Leopold-Franzens University Innsbruck).! Active substance candidates with better chances! The ADSI does not limit its efforts to simply answering the question “effective or not“, but furthermore provides an explanation how and why a substance is effective and whether side effects are to be expected. This information allows better assessing the chances of active substances for clinical trials. Therefore, the ADSI not only offers an ideal platform for discovering active substance candidates, but also provides a special environment to characterize more precisely first hits of a previous high throughput screening and to further develop them (h hit to lead development).! The company Bionorica is the first company taking advantage of the Institute's screening service to develop effective plant extracts for phytomedicine, so that the ADSI is characterized by a special expertise in the screening of natural substances. Further partnerships with companies and public research institutions are planned within the scope of public private partnerships.! Opening of the ADSI on November 27, 2012! Klaus Grössinger is the CEO of ADSI, Lukas A. Huber is director of the Biological Division, Günther Bonn is director of the Analytical Division (f.l.t.r.).! The ADSI benefits from proximity to Innsbruck's hospitals and close cooperation with the Center for Personalized Cancer Medicine Oncotyrol, in which promising candidates can be further optimized with company partners for preclinical and clinical development.! | Contact: ADSI – Austrian Drug Screening Institute | office: Innrain 52 | 6020 Innsbruck | Austria | ! | Tel.: +43 512 507-32203 | Fax: +43 512 507-32299 | offi[email protected] | Laboratory: Innrain 66a |! 41 ! Life Science_Meetings Innsbruck Universities! 42 ! +! 3rd! Congress IGLS September 23 – 24, 2011! PLENARY LECTURES! 4th! Meeting covers designed by Siegfried Schwarz! Life Science_Meetings Innsbruck Universities! Congress IGLS September 27 – 28, 2012! PLENARY LECTURES! Ilme Schlichting" Ari Helenius! Department of Biomolecular Mechanisms" Max Planck Institute for Medical Research," Heidelberg, Germany! Institute of Biochemistry, ETH Zürich, Switzerland! On flavin based photoswitches! Adrian R. Ferré-D’Amaré" Laboratory of RNA Biophysics and Cellular Physiology, ! Biochemistry and Biophysics Center, National Heart, Lung and Blood Institute, Bethesda, USA! A systems approach to virus entry! Anne-Claude Gavin! Structural and Computational Biology, EMBL Heidelberg, Germany! From biochemical network to phenotypes! Catalytic and gene-regulatory RNAs, from crystallography to evolution! Organized by Professors Alexander Hüttenhofer (BC), Reinhard Kofler ! (BC, Klaus Scheffzek (BC), and Ernst R. Werner (BC)! +! Ronald Micura (CMBI), Simone Sartori (CMBI), Jörg Striessnig (CMBI) Bert Hobmayer (CMBI) ! 43 ! 3rd Life Science_Meeting Innsbruck Universities! September 24, 2011. Prizes for best talk or poster, respectively, were given to 5 young scientists. Best talk prize received Katrin Watschinger, group of Ernst Werner, Biocenter, for her work Characterization of Tetrahydrobiopterin-dependent Alkylglycerol Monooxygenase. Poster prizes received Lukas Schafferer, grooup of Hubertus Haas, Biocenter, for his work The Role of Ornithine Supply in Siderophore Biosynthesis in Aspergillus fumigatus, Armin Wilfinger, group of Dirk Meyer, CMBI, for his work The Role of Islet Genes During Formation of Zebrafish Endocrine and Exocrine Pancreas, Birgit Waltenberger, group of H. Stuppner, CMBI, for her work Phytochemical Investigation of Himatanthus Sucuuba Bark Leading to the Identification of Novel Antiinflammatory Compounds and Daniela Schuster, CMBI, for work Pharmacophore-based Discovery of Natural Products as Protein Tyrosine Phosphatase 1B (PTP1B) Inhibitors.! 44 ! https://www.i-med.ac.at/mypoint/archiv/2011100601.xml! 4th Life Science_Meeting Innsbruck Universities! September 29, 2012. Prizes for best talk or poster, respectively were given to 6 young scientists. Best talk prize received Markus A. Keller (Ernst Werner‘s group, Biocenter) for his work Mechanistic studies of recombinant human fatty aldehyde dehydrogenase, Poster prizes were given to Barbara Ganisl (Kathrin Breuker‘s group, CMBI) for her work Disulfide vs. backbone bond cleavage in electron capture dissociation of proteins, Ruth Greussing (Pidder Jansen-Dürr‘s group, CMBI) for her work Mechanism of UVB-induced premature senescence, Johanna E. Mayrhofer (Taras Valovka‘s group, CMBI) for her work Identification of PRMT1 as a regulator of TNFalpha/NfkappaB signaling, Elisabeth Pfeiffenberger (Stephan Geley‘s group, BC) for her work Expression of active recombinant CDK16/CCNY in insect cells, and to Florian Widner (Bernhard Kräutler‘s group, CMBI) for his work Adenosylrhodibyric acid – a milestone on the way to surrogate coenzyme B12.! f.l.t.r.: Markus Keller, Florian Wiedner, Elisabeth Pfeiffenberger, Johanna Mayrhofer, Ruth Greussing, Barbara Ganisl; Prof. Jörg Striessnig and Prof. Lukas A. Huber! 45 ! https://www.i-med.ac.at/mypoint/news/665877.html! 46 ! 4th Life Science_Meeting Innsbruck Universities! 4th Life Science_Meeting Innsbruck Universities! 47 ! The Biocenter! Divisions & Groups! Bioinformatics 48 ! ! ! !Zlatko TRAJANOSKI! Biological Chemistry ! . Structural Biology ! . Pteridine Metabolism – Clinical Immunology . Model Organisms ! . Biochemistry ! ! . Cell Culture & Bioethics ! !Klaus SCHEFFZEK! !Klaus SCHEFFZEK! !Dietmar FUCHS! !Georg GOLDERER! !Ernst WERNER! !Gabriele WERNER-FELMAYR! Cell Biology ! ! . Signal Transduction & Proteomics . Cell Differentiation ! . Membrane Traffic & Signalling ! !Lukas A. HUBER! !Lukas A. HUBER! !Ilja VIETOR! !David TEIS ! Clinical Biochemistry . Protein Analysis ! ! !Ludger HENGST (interim)! !Herbert LINDNER! Developmental Immunology . Apoptosis & Tumor Biology . Immunoendocrinology ! ! ! !Andreas VILLUNGER! !Andreas VILLUNGER! !Jan WIEGERS! Experimental Pathophysiology & Immunology . Experimental Rheumatology ! . Molecular Endocrinology ! . Biophysics/Biooptics ! !Lukas A. HUBER (interim)! !Roswitha SGONC! !Siegfried SCHWARZ! !Günther BÖCK! Genomics and RNomics ! . Experimental RNomics ! . Ribonucleoprotein Complexes ! !Alexander HÜTTENHOFER! Alexander HÜTTENHOFER! !Norbert POLACEK (on leave)! Medical Biochemistry ! . Cell Cycle and Cell Proliferation ! . Signal Transduction in Mammary Gland . Biochemical Pharmacology ! . Ribosomal Proteins and RNA ! . Nutritional Biochemistry ! !Ludger HENGST! !Ludger HENGST! !Wolfgang DOPPLER! !Johann HOFMANN! !Wolfgang PIENDL! !Florian ÜBERALL ! Molecular Biology ! ! . Chromatin and Epigenetics: Maize & Mouse . Chromatin and Epigenetics: Filamentous Fungi ! ! . Chromatin Assembly and Remodelling . Molecular Microbiology ! . Applied Mycology ! . Lipocalins ! ! !Peter LOIDL! !Peter LOIDL ! !Gerald BROSCH! !Stefan GRÄSSLE! !Alexandra LUSSER! !Hubertus HAAS! !Florentine MARX! !Bernhard REDL! Molecular Pathophysiology . Leukemia – Apoptosis . Molecular Oncology . Cell Cycle Control . Applied Bioinformatics ! ! ! ! ! !Reinhard KOFLER! !Reinhard KOFLER! !Arno HELMBERG! !Stephan GELEY! !Johannes RAINER! Neurobiochemistry . Neurobiochemistry . Neurotoxicity! . Biooptics ! ! ! ! ! !Christine BANDTLOW! !Christine BANDTLOW! !Gabriele BAIER-BITTERLICH! !Martin OFFTERDINGER! EMERITI PROFESSORS! . Medical Chemistry & Biochemistry . Clinical Biochemistry ! . Experimental Pathophysiology & Immunology !Hans GRUNICKE! !Wilhem SACHSENMAIER! !Georg WICK! Emeriti Professors! Tel.: 0043 (512) 9003.70328 ! ! email: [email protected]! Wilhelm Sachsenmaier Professor Sachsenmaier became in 1970 Full Professor of „Biochemistry“ and Chairman of the newly founded “Institute of Biochemistry and Experimental Cancer Research” at the Medical Faculty of the Leopold-Franzens-University of Innsbruck. From 1977-79, he was President of the Austrian Biochemical Society. In 1995, he retired as Professor emeritus for Biochemistry. ! In his active time, Professor Sachsenmaier conducted research on molecular aspects of cell proliferation and used hereto a model system, i.e. the synchronous multinuclear plasmodium of the myxomycete Physarum polycephalum, which he introduced from his former affiliations with the McArdle Institute of Cancer Research, Madison/Wisconsin and the German Cancer Research Center, Heidelberg.! Current activities! Joint research project with Prof. Stephan Geley on „Functional analysis of Fzrl1“ (§27-Project P5080). ! Austrian Cancer Society–Tyrol Section: Reactivation of the Society by Prof. Sachsenmaier, as he became President in 1970, and from thereon permanent member of its research advisory board. Present number of active members: ~400. In 2010 and 2011 financial support with fund-raising money (600.000 EUR) was granted by the society to approx. 50 selected research projects of predominantly young scientists (< 35 yrs). Also, Prof. Sachsenmaier organizes the “Oncology-Seminars”, i.e. guest lectures of international cancer scientists. A recent top speaker was Nobel Laureate Harald zu Hausen on April 4, 2011, „Cancer caused by infection: Status and perspectives“.! Prof. Sachsenmaier also organizes since years the Emeriti Professors-Meetings of the Innsbruck Medical University. A list of speakers can be seen on the link below. Not only professors but also eminent persons from governement, culture and industry were and are invited to give talks on topics of general interest.! http://www.krebshilfe-tirol.at/service/onko_kolloquien.shtm http://www.krebshilfe.net/home-shtm https://www.i-med.ac.at/imcbc/staff_doc/sachsenmaier.html Tel.: 0043 (512) 9003.70112 email: [email protected]! Hans Grunicke! Professor Hans Grunicke was appointed Full Professor of Medical Chemistry and head of the Institute of Medical Chemistry (later Medical Chemistry and Biochemistry) in 1974. His research was focussed on two areas: Mitogenic signal transduction and development of novel antitumor agents.! He served as Dean of the Medical Faculty from 1981 to 1983 and from 2001 to 2003 and as the first Rector of the then newly founded Medical University of Innsbruck (2003-2005). As Rector, he supported the establishment of multidisciplinary departments like this Biocenter by merging pre-existing institutes with complementary activities.! Prof. Grunicke served as president or member of the executive committees of a number of national and international professional societies including the Austrian Biochemical Society (President 1887/89; 1999/2001; 2008/2009); European Association for Cancer Research (President 2002-2004). From 2009 to 2010, he acted as the first president of the Austrian Association for Molecular Biosciences and Biotechnology (ÖGMBT), created by a merger of the Austrian Biochemical Society, the Austrian Society for Genetics and Gene technology and the Austrian Society for Biotechnology.! Awards and honours:! Gerhard-Domagk Award for Cancer research (1971); Wilhelm-Warner Prize for Cancer research (1975); Great silver medal of honour for meritorious service to the Republic of Austria (Großes Silbernes Ehrenzeichen für Verdienste um die Republik Österreich 1976); Austrian cross of honour for art and sciences (Ehrenzeichen für Wissenschaft und Kunst Erster Klasse 1996); Great medal of honour of the state of Tyrol (Großes Ehrenzeichen des Landes Tirol (2006).! Present Activities:! Professor Grunicke is now focussing his scientific activities on reviewing, writing and consulting in the above mentioned areas with special reference to the role of protein kinase C in mitogenic signalling and the interaction of Ras- and Ca2+-dependent pathways. Furthermore he devotes a considerable share of his time to support the activities of the Austrian Society for Molecular Biosciences and Biotechnology and the European Association for Cancer Research in fostering public awareness of the need for adequate resources for basic research in these areas and political support optimizing the legal frame work for scientific research in these fields. ! 49 ! Emeriti Professors! Autoimmunity ! ! ! www.autoimmunity.at Tel.: 0043 (512) 9003.70960 email: [email protected]! Georg Wick! This group works on two major research projects, i.e. the immunology of atherosclerosis and the immunology of fibrosis. Both projects are supported by competitive grants, notably from the Austrian Science Fund (FWF) and the Framework 7 (FR7) Program of the European Union. Additional Support is obtained from private foundations. ! The Immunology of Atherosclerosis. This project has been in the center of Georg Wick’s group for the last two decades and resulted in the formulation of a new “autoimmune” hypothesis for the development of atherosclerosis, supported by solid data from in vitro and animal experiments as well as from cross-sectional and prospective longitudinal studies in human cohorts. In essence, this hypothesis states that classical atherosclerosis risk factors, their well-proven atherogenic role being undisputed, first act as endothelial stressors inducing the expression of a stress protein (heat shock protein 60 – Hsp60) which then acts as a “danger signal” and thus serves as a target for preexisting innate and adaptive anti Hsp60 immunity. Our present research is on one hand focussed on the elucidation of the HSP60-inducing role of classical atherosclerosis risk factors in endothelial cells and on the other hand on the identification of the earliest immunologic effector mechanisms leading to the first inflammatory stage of atherosclerosis! The Immunology of Fibrosis. Fibrosis is an important consequence of various pathological conditions ranging from tissue damage, over inflammation, reactions against foreign body implants to “spontaneous” fibrotic diseases. In spite of these heterogenic causes, the final stage of fibrogenesis is very stereotypic and always associated with inflammatory immunologic processes. The focus of research of the group in this area is put on the clarification of the imbalance of pro- and antifibrotic cytokines produced by the mononuclear inflammatory cells in tissues with incipient fibrotic changes. Most recently, an impaired function of regulatory T cells (Treg) within fibrotic tissues allowing for a hyperactivity of T effector cells (Treg) has been demonstrated that may underly the abundant production of pro-fibrotic cytokines by the latter. ! 50 ! Group members: Maja Buszko, Adam Csordas, Cecilia Grundtmann, Bojana Jakic, Elisabeth Onestingel, Nadine Plank! Publications! ! !! Immunology of Atherosclerosis! •!G. Wick, C. Grundtman (Eds.)! Inflammation and Atherosclerosis, Springer Wien New York (2012)! https://www.i-med.ac.at/mypoint/thema/653343.html! Reviews! •!C. Grundtman, Animal Models of Atherosclerosis in: Inflammation and Atherosclerosis (Eds.: G. Wick, C. Grundtman), Springer Verlag Wien New York, 2012! •! C. Grundtman, Vaccination against Atherosclerosis. ibid. ! •!G. Wick, N. Buhr, G. Fraedrich, C. Grundtman, A Darwinian-Evolutionary Concept for Atherogenesis: The Role of Immunity to HSP60. ibid! Professor ! ! on leave from the Biocenter! Tel.: 0041 31 31 631 43 20 email: [email protected]! http://dcb-groups.unibe.ch/groups/polacek/! http://www.dcb.unibe.ch/content/forschung/forschungsgruppen/polacek/index_ger.html! Ribonuceloprotein complexes Norbert Polacek! In our group we focus on the functional characterization of ncRNAs in large cellular RNA/protein complexes, such as the ribosome or the vault particle. We approach these aims by applying biochemical, genomic, genetic and bioinformatic tools in model organisms representing all three domains of life (archaea, bacteria and eukarya).! At the beginning of 2012, Norbert Polacek formerly a collaborator of Alexander Hüttenhofer in the Division of Genomics and Rnomics, left us to follow a call and to become Full Professor of Biochemistry at the Department of Chemistry and Biochemistry at the University of Bern, Switzerland. Some of his former students, however, still continue their work here at BC.! The scientific interests of Norbert remained what they were while here at the BC: „We aim at deepening our molecular understanding of non-protein-coding RNAs (ncRNAs) in large ribonucleoprotein (RNP) complexes. In particular we study the ribosome and the vault complex. To unravel the functional contributions of specific rRNA nucleotides for protein synthesis, we have developed an ‘atomic mutagenesis’ approach. This tool allows manipulating single functional groups or even single atoms of rRNA residues within the ribosome. To study translation regulation, we recently performed genomic screens seeking for novel small ncRNAs that directly bind and possibly regulate translating ribosomes in model organisms from all three domains of life“.! The central dogma of molecular biology predicts, that the flow of genetic information proceeds from the DNA level to RNA and finally to proteins (F. Crick, 1958). Today, in the so called ‘postgenomic era’, we realize that this assumption is true for only a minor population of genes, namely the protein encoding genes. However, especially in higher multicellular eukaryotic species (e.g. human, mouse), only about 1.4% of the genome encodes protein genes while 50 to 100% of the genome is actually transcribed but never translated. This functionally poorly characterized pool of transcripts is commonly referred to as non-protein-coding RNAs (ncRNAs).! In the recent past, the importance of the surprisingly diverse class of ncRNAs has been widely recognized. They play key roles in a variety of fundamental biological processes in all three domains of life. The functional contribution of ncRNAs to biology is manifold and includes DNA replication and chromosome maintenance, regulation of transcription and translation, RNA processing, protein synthesis and stability of mRNAs. Many ncRNAs have been discovered fortuitously, suggesting they merely represent the tip of the iceberg.! Figure 1: Following peptide bond formation, the reaction products (peptidyl-tRNA and deacylatedtRNA) need to be translocated from the A- and P-sites to the P- and E-sites, respectively. This process is facilitated by the GTPase elongation factor G (EF-G). By employing an ‘atomic mutagenesis’ approach, we disclosed the adenine exocyclic N6 amino group at A2660 of the 23S rRNA sarcin-ricin-loop as key determinant to trigger GTP hydrolysis on EF-G. We showed the purine $-system expanding characteristics of the exocyclic functional group at A2660 to be essential. We proposed that stacking interactions of A2660 to EF-G may act as molecular trigger to induce repositioning of suspected functional amino acids in EF-G that in turn promote GTP hydrolysis. Recent publications! Gebetsberger, J., Zywicki, M., Künzi, A., and Polacek, N. (2013). tRNA-derived fragments target the ribosome and function as regulatory non-coding RNA in Haloferax volcanii. Archaea, in press.! Erlacher, M., and Polacek, N. (2012). Probing functions of the ribosomal peptidyl transferase center by nucleotide analog interference. Methods Mol. Biol. 848:215-226! Graber, D., Trappl, K., Steger, J., Geiermann A.S., Rigger, L., Moroder H., Polacek, N., and Micura, R.(2012). Deoxyribozyme-based, semisynthetic access to stable peptidyl-tRNAs exemplified by tRNA(Val) carrying a macrolide antibiotic resistance peptide. Methods Mol. Biol. 848:201-213.! Zywicki, M., Bakowska-Zywicka, K., and Polacek, N. (2012). Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis. Nucleic Acids Res.: doi: 10.1093/nar/gks020! 51 ! Group members still in Innsbruck working: Melanie Amort, Nina Clementi, Birgit Nachbauer! Bioinformatics! ! www.i-med.ac.at/biocenter/bioinformatics.html Zlatko Trajanoski! Tel.: 0043 (512) 9003.71400 email: [email protected]! Director! Bioinformatics services! Bioinformatics ! ! Zlatko Trajanoski! The research activities at the Division of Bioinformatics are directed towards two major thrusts:! 1.! Computational genomics. We are computationally exploring diverse functional genomics data in the context of human diseases. By analyzing high-dimensional datasets we aim to identify and prioritize candidate genes and further characterize pathways contributing to the pathophysiology of diseases.! 2.! Cancer immunology. Our aim is to decipher tumor-immune cell interaction using a combined computational-experimental approach. Specifically, we are addressing the question how is the immune system shaping the mutational spectrum of the tumor during progression.! Computational genomics! Recent advances in genome sequencing technologies are rapidly changing the research and routine work of biologists and human geneticists. Due to the brisk decline of costs per base pair, next-generation sequencing (NGS) is now affordable even for small-tomid sized laboratories. Whole-genome sequencing and whole-exome sequencing have proven to be valuable methods for the discovery of the genetic causes of rare Mendelian disorders as well complex diseases. The current bottleneck s not the sequencing of the DNA itself but lies in the structured way of data management and the sophisticated computational analysis of the experimental data. In order to get meaningful biological results, each step of the analysis workflow needs to be carefully considered, and specific tools need to be used for certain experimental setups. ! 52 ! We are providing bioinformatics services for researchers at the Biocenter and at the Innsbruck Medical University as well as external experimental collaborators. A highperformance computational infrastructure and a number of software tools are maintained and continuously adapted to state-of-the-art software technology (see http://icbi.at). The software development is directed towards specialized databases, analytical pipelines, and web-services. ! We also advise scientists on designing experiments and support analyses of highdimensional datasets including:! -NGS data " -whole-genome/whole-exome data,! -RNA-Seq,! -ChIP-Seq-, ! -high-content microscopy data, and! -proteomics data. ! International cooperations! INSERM U872, Paris, France; Bioinformatics Institute, Singapore; National Cancer Institute, NIH, Bethesda, MD/USA! Grants! -GEN-AU Bioinformatics Integration Network ! -FWF SFB Cell Proliferation and Cell Death in Tumors! -FWF DK MCBO! -Bioinformatics Tyrol, Standortagentur Tirol! -Oncotyrol! Group members: Mihaela Angelova, Pornpimol Charoentong, Andreas Dander, Mirjana Efremova, Maria Fischer, Ralf Galasch, Hubert Hackl, Anne Krogsdam, Gerhard Laschober, Stephan Pabinger, Dietmar Rieder, Rene Snajder, Michael Sperk, Martina Wick ! Bioinformatics! Tumor! Mutational spectrum? Immunogenicity? data generation/TCGA! analytical workflow tumor ! ! NGS Furthermore, the challenge of the ‘next-generation biology/genetics’ is one of narrowing down the list of candidate variants and interpreting remaining variants. The major focus of our research activities is to narrow down the genome search space by integrating and analyzing disparate data sources including various omics data and clinical data. We aim to to identify causative genes, prioritize candidates for experimental studies, and further characterize pathways contributing to the pathophysiology of diseases. ! exome-Seq Cancer immunology! ! ! ! Most advanced solid tumors remain incurable and are resistant to chemotherapeutics and targeted therapies. A series of recent studies reported baffling intratumor heterogeneity which may contribute to this failure. While increasing attention is being paid to the mutational spectrum of various cancers little attention has been devoted to either define the immunogenicity of these mutations or characterize the immune responses they elicit. Identification of nonsynonymous mutations processed and presented in an immunologically relevant manner will not only highlight the mechanisms driving tumor progression but will also provide a rich source for novel immunotherapeutic targets. Thus, it is of utmost importance to decipher the cross-talk between the tumor and the immune system during tumor development.! Our long-term goal is to develop a mechanistic multi-scale model and investigate the tumor-immune cell interaction in colorectal cancer. Towards this goal we are exploring the immunogenicity of the colorectal cancer mutanome (Figure 1) by conducting computational experiments and carrying out experimental studies using cell and mouse models. Additionally, we are building mathematical models at various scales and performing simulations that will help us to identify immune signals controlling tumor progression which can be then experimentally verified. ! normal! new experiment RNA-Seq! a priori knowledge?! consensus?! filter expressed genes! 9-11 mers?! epitope prediction immune infiltrates! HLA type?! ! ! simulations! dx/dt=f(x,m,y,t)! dy/dt=f(y,x,t)! ! Rag2 -/- vs. wt! ! IHC Figure 1: Analytical workflow designed to assess the mutational spectrum and estimate the immunogenic potential of colorectal cancer tumors. The generated data is used to build a model of clonal evolution under immunological control. ! 53 ! Biological Chemistry! ! www.i-med.ac.at/imcbc/molecularcellbiologyfolder/molcellbiol.html Klaus Scheffzek! Tel.: 0043 (512) 9003.70300 email : [email protected]! Director! Scheffzek! Fuchs! Golderer! Research Groups! Structural Biology - Signaling - Disease Proteins ! Pteridine Metabolism - Clinical immunobiology! Model organisms !! Biochemistry ! Cell culture & bioethics! Werner! Werner-Felmayer ! Klaus SCHEFFZEK! (Head of Division)! Dietmar FUCHS! Georg GOLDERER! Ernst WERNER! Gabriele WERNER-FELMAYER! ! ! ! ! !Research in the division is organized!! in five research groups, led by senior investigators who conduct basic research with focus on topics of medical importance. A historically developed field of research centers on pteridine metabolism (D. Fuchs, G. Golderer, E.R. Werner, G. Werner-Felmayer). Pteridines play important roles in human metabolism and immune function. They have been implicated in the prognosis of a variety of pathologies including cardiovascular disorders, post traumatic diseases, HIV infection, allograft rejection and several types of cancers. Research in the division has led to the characterization of novel genes and to a variety of assays and protocols that are now widely used in medical diagnostics and quality control.! With the arrival of the new directors group (K. Scheffzek) in July 2011, the research profile of the institute has expanded to intracellular signal transduction and its regulation with focus on the effects of genetic alterations of contributing components. Having solved important regulatory mechanisms earlier, the group is currently focusing on a disease protein that is responsible for the pathogenesis of the common familial cancer syndrome Neurofibromatosis Type 1.! 54 ! The method spectrum covers biochemical techniques including FPLC/HPLC for preparative protein purification and analysis, eukaryotic cell culture, various biophysical methods and X-ray crystallography.! We consider teaching a major responsibility in the education of the young scientist generation and contribute to respective activities for students of the Medical as well as of the Leopold-Franzens-University of Innsbruck.! Structural Biology – Signaling – Disease Proteins ! Klaus Scheffzek! Defects in signalling pathways are often associated with the occurrence of severe diseases, e.g. cancer. We are interested in understanding the mechanisms of pathogenesis associated with cancer-related diseases. In previous work we have characterised the regulation of Ras, a GTP binding protein mutated in 30% of human tumours, and the related Rho proteins. Ras functions like a binary molecular switch cycling between GTP-bound ‘ON’- and GDP-bound ‘OFF’-states; Ras-mediated GTP hydrolysis turns the switch off. This intrinsically slow process is enhanced by so-called GTPase activating proteins (GAPs). Oncogenic Ras mutants are permanently activated and are not sensitive to GAPs. In earlier studies we have elucidated the chemical mechanism of GTPase activation and explained why oncogenic Ras mutants are not GAP sensitive.! Currently a major focus is on neurofibromatosis type 1 (NF1), a genetic disease with an incidence of 1 in 3,500 newborns. NF1 patients have an increased tumour risk, may show a variety of developmental defects and frequently have learning disabilities. The NF1 gene encodes a huge protein (20 times larger than the oxygen carrier protein myoglobin), termed neurofibromin, and when mutated is responsible for the disease pathology. Neurofibromin acts as a Ras-specific GAP, and in some tumour types lacking the protein, Ras is indeed hyperactive. The GAP activity of neurofibromin resides in a segment which represents only 10% of the protein and remains the only clearly defined biochemical function of the protein.! ! Biological Chemistry! Our goal is to define the functional spectrum of neurofibromin in as much detail as possible. We are following a structural proteomics approach to explore possible functions of the remaining portion of the protein. The idea is to identify neurofibromin segments that can be expressed as soluble proteins, determine the structures of such fragments, and by comparison with known protein structures or by bound ligands obtain ideas for functional/biochemical studies. Work on this project offers the opportunity to contribute to a challenging and physiologically exciting research topic. Our main technique is X-ray crystallography, with other experimental approaches being increasingly employed. Using this approach, we have previously discovered a novel bipartite module containing a lipid binding Sec14-homology (NF1-Sec14) and a previously undetected pleckstrin homology (NF1-PH)-like domain that binds cellular glycerophospholipids. Current studies in that field focus on the potential functions of the Sec14PH module using biochemical and cellular studies.! Future projects and goals! A major goal is to arrive at a 3D model of neurofibromin. In addition to the ‘divide and conquer’ strategy, we have been gradually returning to the ‘conquer only’ approach by trying to produce the full-length neurofibromin in various eukaryotic hosts. With its availablility we will also consider electron microscopy as well as small angle x-ray scattering to study its structure. In addition, we will continue searching for interaction partners of neurofibromin and investigate their role for the function of the protein. Studying Sec14-like domains in the context of other signal regulatory proteins such as RhoGAPs, RhoGEFs and PTPases is an important direction in the future. Further projects of the laboratory include signalling by eukaryotic and prokaryotic protein kinases, novel phosphoryl transfer systems, structural neurobiology, and G-protein regulation by complex regulators.! Figure 1: Top: domain scheme of human Neurofibromin. Mid: structure of the lipid bound Sec14PH module together with its protein crystal and a segment of the electron density. Bottom: On the basis of the structure, a mechanistic model of its biochemical function was formulated and tested by different assays including mass-spectrometry analysis and protein-lipid overlays.! 55 ! Group members: Marianna Biadene, Theresia Dunzendorfer-Matt, Stefan Lechner, Julianna Leuenberger, Christina Mayerl, Andreas Naschberger, Stefan Welti! Biological Chemistry! ! www.i-med.ac.at/imcbc/molecularcellbiologyfolder/molcellbiol.html Pteridine Metabolism! ! Dietmar Fuchs Georg Golderer! Ernst R. Werner Gabriele Werner-Felmayer! Pteridines are a class of compounds essential for human metabolism. Some of them, i.e. riboflavin and folic acid, are vitamins, others, like molybdopterin and tetrahydrobiopterin are essential cofactors of enzymes. Building on the work of Prof. Wachter and colleagues, our group has a long standing expertise in pteridine metabolism. ! Figure 3: Biosynthesis and known cofactor roles of tetrahydrobiopterin! Neopterin – a message from the immune system! In the 1980s, we found that neopterin is produced by human macrophages during immune activation and it later on turned out that neopterin concentrations are among the best predictors of the future disease course in patients with cardiovascular disorders, after multiple trauma and with several types of cancer. In patients with HIV infection neopterin concentrations are even more closely related with survival than virus load. Monitoring neopterin concentrations also allows early detection of immunological complications in allograft recipients. Because of its high sensitivity for early detection of acute virus infections, neopterin screening is nationwide in use to improve virus safety in blood donation in Austria.! Abbreviations:! DC: dendritic cell! Mph: macrophage! IDO: indoleamine-! 2,3-dioxygenase! IFN-g: Interferon-! iNOS: inducible nitric oxide synthase ROS:reactive oxygen species 56 ! Figure 2: TH1-type immune response and some of its metabolic effects! [email protected]! [email protected]! [email protected]! [email protected]! Tetrahydrobiopterin – a small molecule with central functions! Tetrahydrobiopterin serves as a cofactor in biosynthesis of neurotransmitters, nitric oxide and the degradation of etherlipids. We found that many cell types produce tetrahydrobiopterin upon immune stimulation and that intracellular concentrations of this cofactor limit the amounts of the signal molecule nitric oxide formed through nitric oxide synthases by the cells. Nitric oxide synthases are essential for regulation of blood pressure, immune defense and neurotransmission. Major breakthroughs of our work were the characterization of the sequences of the first non-animal nitric oxide synthase (2001) and mammalian alkyl glycerol monooxygenase (2010). This enzyme cleaves etherlipids which serve as signal molecules in inflammation and which are membrane constituents in the brain.! To complement our understanding of the role of pteridines, we are studying also related pathways and issues, e.g. the degradation of tryptophan by indoleamine-dioxygenase (IDO), the metabolism of the aromatic amino acids phenylalanine and tyrosine in vivo, the detoxification of fatty aldehydes by its specific dehydrogenase, and the underlying cytokine network. In the in vitro model of human peripheral blood cells, the potential influence of food compounds, of food supplements like preservatives and colorants, on immunoregulation and disease development are investigated. In addition to studying pteridine metabolism in humans, we also rely on model organisms (the worm Caenorhabditis elegans and the slime molds Physarum polycephalum and Dictyostelium discoideum) as well as cell culture models.! Biological Chemistry! Pharmacological effects of tetrahydrobiopterin derivatives! Additional activities /Meetings organized! In collaboration with the Innsbruck Department of Surgery, we study the capacity of tetrahydrobiopterin treatment in protecting transplanted organs from redox damage (ischemia/ reperfusion injury ). A tetrahydrobiopterin analogue developed in our laboratory, i.e. ! 4-amino-tetrahydrobiopterin, is currently in clinical testing as a treatment in craniocerebral injury.! International Winterworkshop on Clinical, Chemical and Biochemical Aspects of Pteridines (organized annually), 15th International Meeting on Pterins and Folates (2012), Workshop on Nanomaterial Safety: Biomarkers (2012), Genetics as Culture in a Consumerist Age (2011) [Workshop on NF1, 2012). The International Society of Pteridinology (current president: Dietmar Fuchs) is publishing the peer-reviewed international Journal Pteridines (current executive editor: Dietmar Fuchs). ! Recent Achievements! -! Sanofi Aventis Prize 2010 to Katrin Watschinger! -! Wilhelm Auerswald Prize 2011 to Benno Cardini! -! Honorary Membership, Austrian Soc. of Lab. Med. & Clin. Chem. 2011 (D. Fuchs )! -! Gowland Hopkins Award for Pteridine Research 2012 to Ernst R. Werner! -! Förderpreis des Landes Tirol für Wissenschaft 2012 to Katrin Watschinger! -! Erwin-Schrödinger grant to Katrin Watschinger (currently at Oxford University, UK)! -! Erwin-Schrödinger grant to Markus Keller (currently at Cambridge University, UK)! -! Best speaker Innbruck Life Science Meeting 2011 (K. Watschinger) and 2 012 (M. Keller)! -! Dietmar Fuchs ranked #8 among German –Swiss-Austrian Clinical Chemists (2012) ! International cooperations: Numerous international cooperations (clinical and experimental), including, e.g., the UCSF, SanFrancisco, CA, USA, the Imperial College London, London, UK, and the Department of Cardiovascular Medicine, Oxford University, UK! Bioethics Gabriele WERNER-FELMAYER! In 2007, Ethucation, an interdisciplinary nation-wide bioethics network, was established on the initiative of Gabriele Werner-Felmayer. Activities of the network comprise improving bioethics teaching in the curricula of the MUI and building an interdisciplinary platform for bioethics debate. Ethucation is the Austrian Unit of NIMED, the International Network of the UNESCO Chair in Bioethics. More information can be found at: www.i-med.ac.at/ethucation and at http://www.unescochair-bioethics.org/UI/A01.aspx. Through NIMED, Ethucation takes part in developing tools and strategies for improving bioethics teaching in medical faculties worldwide.! Research on bioethical issues is performed in the following areas:! -! Ways of introducing knowledge generated in biomedical fields like genomics and reproductive ! medicine into society and culture ! -! Novel direct-to-consumer genetic and genomic tests in prenatal and preconceptional screening.! -!Egg cell donation and cultural differences in dealing with possibilities of modern assisted reproductive methods! Recent publications:! • Genetics as Social Practice: Transdisciplinary Views on Science and Culture (edited by B. Prainsack, S. Schicktanz and G. Werner-Felmayer), spring 2013 (Ashgate, Surrey, UK) (https:// www.i-med.ac.at/ethucation/Events/conference_2011.html). ! • Patterns of globalized reproduction: Egg cells regulation in Israel and Austria. C. Shalev and G. Werner-Felmayer, Israel Journal of Health Policy Research 2012, 1: 15! Figure 4: Localization of alkylglycerol mono-! oxygenase in the cell! Figure 5: HPLC chromatograms showing fatty alde-hyde dehydrogenase deficiency in Sjogren Larsson syndrome patients! Group members: Simon Geisler, Rita Holzknecht, Ayesha Irshad, Markus Keller, Petra Loitzl, Nina Madl, Tamara Pfeifenberger, Sebastian Schröcksnadel, Katrin Watschinger, further: Annina Christa Jenal, Leonie Klara Kuehne, Emmanuel Raggl, Yasmin Schöttl, (no pictures)! •!Always young and never dead? An old dream of humanity from the perspective of current biomedicine, G. Werner-Felmayer, in: Bios – Cultus – (Im)mortalitas. Amei Lang, Peter Marinkovic (eds.), Marie Leidorf Press, Rahden, Germany 2012! 57 ! Cell Biology! ! www.i-med.ac.at/cellbio/ Lukas A. Huber! Tel.: 0043 (512) 9003.70171 email: [email protected]! Director! Signal Transduction & Proteomics Lukas A. Huber! The endocytic pathway is involved in a large variety of cellular processes, such as the uptake of nutrients, the biological response to extracellular stimuli through the regulation of receptor recycling or degradation and antigen presentation in the immune response. The central role of the endocytic pathway in cellular physiology is emphasized by the identification of many endocytosis related pathologies, including Hermansky-Pudlak syndrome type 2, the Chediak-Higashi syndrome and Niemann-Pick type C disease. We focus our attention on two rare congenital disorders linked to intracellular trafficking defects: the primary immunodeficiency disorder caused by a hypomorph allele of the endosomal adaptor Lamtor2, and the Microvillus inclusion disease. To achieve a comprehensive overview, we use a wide variety of strategies: mouse models, proteomics, molecular and cellular biology, yeast genetics, life-cell imaging, lipidomics and ultrastructural-morphology analyses.! The LAMTOR complex: immunity! Macrophages and dendritic cells are key players of the immune system and link innate to adaptive immunity. Their major task is the uptake and processing of pathogens and subsequent presentation of antigens. These processes are strongly dependent on endosomal /lysosomal trafficking. Lamtor2 deficiency in humans was previously linked to a defective immune response. In murine macrophages we could recently confirm that LAMTOR2 is a host defense factor against pathogens (Taub, Nairz et al, J Cell Sci. 2012). To follow up the defective phagocytosis of genetic lamtor2 depletion, we are currently investigating its role in phagosomal maturation. Additionally, mice depleted of LAMTOR2 in dendritic cells develop a myeloid proliferative disorder, characterized by a shift in the hematopoiesis towards dendritic cell differentiation and followed by a massive infiltration of activated dendritic cells in various organs. Interestingly, these symptoms were caused by an endosomal missorting of the Flt3 receptor, crucial for DC differentiation. Plasma membrane accumulation of Flt3 induced increased downstream activation of Akt-mTOR signaling, leading to dendritic cell expansion.! ! Groups within the Division of Cell Biology •! Signal Transduction & Proteomics •! Cell Differentiation ! •! Membrane Traffic & Signaling! LMCp14+/+! LMCp14!//!! ! !! ! Lukas A. Huber! Ilja Vietor! David Teis! Figure 1: (a) Macrophages (left: control, right: Lamtor2 knockout) 24h after Salmonella infection. Green: Salmonella, red: actin, blue; nucleus. (b) Dendritic cell infiltrate in liver. Green: CD11b, red: CD11c, blue : nucleus. * blood vessel! CD11c p14!//!! *! Group members: Mariana Eca Guimaraes de Araujo, Johanna Blitz, Przemiyslaw Filipek, Beatrix 58 ! Fürst, Diana Hilber, Caroline Herrmann, Giorgia Lamberti, Yvonne Lucke, Ulrike Pachmann, Cedric De Smet, Julia Scheffler (continued on next page)! Cell Biology! ! www.i-med.ac.at/cellbio/labore/sigtranslab/index.html The LAMTOR complex: interplay between signaling and endosomal biogenesis! We have shown previously that LAMTOR3 is localized to late endosomes by the adaptor protein LAMTOR2 (Wunderlich et al., J Cell Biol, 2001, Teis et al., Dev. Cell, 2002). The two proteins heterodimerize (Kurzbauer et al., PNAS, 2004), bind MEK1 and ERK1/2, and facilitate signal transduction through the MAPK cascade on this specific subcellular location (Teis, Taub et al., JCB, 2006). The complex in anchored by a lipid modified protein called LAMTOR1. Recently, it was shown that the LAMTOR complex mediates the translocation of mammalian target of rapamycin complex 1 (mTORC1) to the lysosomal surface and that the complex has guanine nucleotide exchange factor activity (GEF) towards RagA and RagB GTPases, thereby signaling amino acid levels to mTORC1. In addition, using conditional gene disruption of lamtor2 in mice we have previously demonstrated that the LAMTOR2/3 complex regulates late endosomal traffic and cellular proliferation (Taub et al., MBC 2007), and we could show that patients with a human immunodeficiency syndrome caused by genetic deficiency of lamtor2 display aberrant lysosomal function (Bohn, Taub et al., Nat Med, 2007). In addition, the LAMTOR1-mTORC1 pathway has recently been implicated in terminal maturation of lysosomes and we could show that LAMTOR2 not only regulates the endo-lysosomal system, but also influences phagosome maturation (Taub, Nairz et al, J Cell Sci. 2012). Taken together, work performed by our group and others, highlights the role of the endosomal LAMTOR complex not only as a convergence point of MAPK and mTORC1 signaling pathways but also as a key regulator of endosomal biogenesis. ! In order to identify the molecular mechanisms of LAMTOR mediated endosomal biogenesis, we used proteomics to decipher the endosomal proteome of LAMTOR2-ablated cells (Stasyk et al., Proteomics, 2010). We are currently complementing that analysis with an extensive search for novel interactors of the complex. Membrane lipid composition plays a critical role in endosomal biogenesis: it affects cargo targeting, membrane fusion, membrane fission and docking events. Therefore as a complementary approach to our proteomic screens, we have initiated the lipidomics analysis of LAMTOR2-deleted cells. Finally, using structural biology methods, we plan to mechanistically address how the LAMTOR complex assembles and coordinates its diverse functions. ! Mutations in MYO5b cause microvillus inclusion disease! Autosomal recessive microvillus inclusion disease (MVID) is characterized by an intractable diarrhea, a lack of microvilli on the surface of villous enterocytes, the occurrence of intracellular vacuoles lined by microvilli (microvillus inclusions), and the cytoplasmic accumulation of periodic acid-Schiff (PAS)-positive vesicles in enterocytes. Together with our collaborators, we could show that the culprit for this disease are mutations in the MYO5B gene (Müller et al., Nat Genet., 2008, Ruemmele et al., Hum Mutat. 2010). Current studies are deciphering the cascade downstream of Myosin Vb and its effectors and their role in polarity of epithelial cells.! Figure 3: (a) Core interactors of the LAMTOR complex (String analysis of proteomics data); ! (b) Structural superimposition of LAMTOR2 (green), LAMTOR3 (yellow), LAMTOR4 (Blue) and the 3D model for LAMTOR5 (orange). ! Cooperations! Division of Histology & Embryology, Medical University of Innsbruck (Michael Hess, Kristian Pfaller); Pediatric Clinic MUI (Thomas Mueller); Dermatology Department (Nikolaus Romani); Analytical Chemistry and Radiochemistry (Günther Bonn); Ce-M-M Research Center for Molecular Medicine of the Austrian Academy for Science (Giulio Superti-Furga, Keiryn Bennett)! International cooperations! Max Planck Institute of Biochemistry, Department of Molecular Medicine (Reinhard Fässler); Harvard Medical School Brigham and Women`s Hospital, Boston, Mass. (David B. Sacks); University of Montreal, Cellular Microbiology (Michele Desjardins); SickKids Toronto (Ernest Cutz); University of Southern Denmark Department of Biochemistry and Molecular Biology (Christer Ejsing )! 59 ! Group members (continued): Taras Stasyk, Cornelia Thoeni, Georg Vogel, Teodor Yordanov! Cell Biology! ! www.i-med.ac.at/cellbio/labore/celldifflab/index.html Tel.: 0043 (512) 9003.70175 email: [email protected]! Major achievements! Cell Differentiation Ilja Vietor! The interplay between cell proliferation and differentiation controls not only development but also regeneration. Therefore its regulatory mechanisms are of interest, also as possible therapeutic targets. Based on our studies, we predict that the transcriptional co-repressor TPA-inducible sequence 7 (TIS7) is one of the players affecting cellular regeneration events. TIS7, induced by the mitogen TPA or growth factors, is differentially expressed in various polarized cell types. We have shown that TIS7 interacts with the SIN3 complex and represses transcription in an HDAC-dependent manner. In the TIS7regulated downstream target genes we have identified a common regulatory motif C/ EBPalpha-Sp1 transcription factor "module". Furthermore, TIS7 has the ability to inhibit the Wnt signaling in an HDAC-dependent manner. TIS7 expression increases during the process of tissue regeneration following a challenge like muscle crush damage or intestinal resection. Our previous studies have shown that in TIS7 knockout mice the expression of myogenic regulatory proteins is deregulated and the differentiation and fusion potential of muscle satellite cells is impaired. Different lines of experiments in our laboratory showed that lack of TIS7 expression or its over-expression affect the expression of downstream target genes. Therefore in our current projects we mainly focus on the identification of molecular mechanisms by which TIS7 regulates transcription. We are searching for protein interacting partners and pathways affected by TIS7. We do so using organs and cell lines derived from TIS7 knockout mice. We perform these analyses in close collaboration with the Division of Bioinformatics and the Expression profiling unit of the Biocenter. ! ! A second member of a novel gene family, SKMc15, is a protein which shares with TIS7 high homology at the amino acid level. Therefore, our laboratory generated SKMc15 single as well as TIS7 SKMc15 double knockout mice and now concentrates on the identification of the functional role of both genes and their protein products. Interestingly, the TIS7 SKMc15 double knockout mice have a prominent phenotype: they are significantly smaller and leaner and, most importantly, they are resistant against weight gain upon feeding with high fat-diet. We are currently searching for the mechanism responsible for this phenotype on the molecular level.! Figure 1: Muscle satellite cells grown under differentiation conditions. Raster scanning electron microscopy images of TIS7 WT and KO MSCs and after 24 h differentiation (scale bars represent 200 m and 50 m, respectively). © Kristian Pfaller! See also:! http://www.i-med.ac.at/mypoint/news/2009030901.xml! http://www.i-med.ac.at/mypoint/news/2005121401.xml! http://www.i-med.ac.at/mypoint/news/2005101801.xml! 60 The group of our collaborators around Prof. Chris Karp at the Cincinnati College of Medicine, USA, using our TIS7 knockout mice as a specific experimental animal model, identified TIS7 to be the major modifier of the severity of the lung disease in cystic fibrosis. In humans, TIS7 polymorphisms were significantly associated with variation in neutrophil effector function. The experimental data gained in TIS7 knockout mice indicated that TIS7 modulates the pathogenesis of cystic fibrosis lung disease through the regulation of neutrophil effector function. These findings were published as a mutual collaboration in the journal Nature.! Group members: Andrea Lammirato, Fabien Feiereisen, Katherin Patsch, Karin Schluifer! Cell Biology! Future goals! 1)! 2)! 3)! 4)! 5)! 6)! Bioinformatic and “wet lab” analyses of TIS7- and SKMc15- regulated genes in various tissues of wt and TIS7/SKMc15 dKO mice.! Identification of regulatory mechanisms by which TIS7 and SKMc15 affect the expression of downstream target genes.! Promoter analysis of TIS7/SKMc15-regulated genes looking for transcription factors whose activity is specifically affected.! Application of this knowledge on concrete mechanisms of regulation of fat deposits and muscle differentiation.! Study of TIS7 / SKMc15-interacting proteins in the context of common regulatory pathways and analyses of their biological role. ! Identification of possible points of intervention with the goal to intervene with specific signaling pathways.! Body weight [g]" 35" 30" 25" 20" 15" 10" ***! ***! ***! ***! ***! ***! ***! WT! dKO! ***! 5" 0" 3" 4" 5" 6" 7" 8" Age (weeks)" 9" 10" Reduced body weight of TIS7 SKMc15 double knockout mice. ! Lack of fat vacuoles in the jejunum of TIS7 SKMc15 double knockout mice (right). Oil red oil staining; magnification 40x. © Michael W. Hess! International cooperations! Department of Medicine, Washington University School of Medicine, St Louis, Missouri, USA; Division of Molecular Immunology at Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio, USA; Department of Immunology, Lerner Research Institute, Cleveland, Ohio, USA; Else Kröner-Fresenius Center for Nutritional Medicine, Freising, Germany! 61 ! Network of regulated genes. Red marked are differentially expressed genes in TIS7 SKMc15 double knockout mice! Cell Biology! Membrane Traffic and Signaling https://www.i-med.ac.at/cellbio/labore/Membrane_Traffic_and_Signaling/! Tel.: 0043 (512) 9003.70191 email:[email protected] ! David Teis! Adaptation is a central concept of biology. Cells use an array of different receptors at their surface to sense their natural surrounding. Hence, the specific removal and downregulation of receptors from the surface essentially determines how cells adapt to their environment. A key step of receptor downregulation occurs on endosomes, where the endosomal sorting complexes required for transport (ESCRTs) sort ubiquitinated cell surface receptors via the multivesicular body (MVB) pathway to the lumen of lysosomes for degradation. This essential, ESCRT-dependent, degradation pathway controls the repertoire of cell surface receptors and all other transmembrane proteins.! While probably all components of the core ESCRT machinery have been identified, the molecular mechanism underlying the regulation of ESCRT activity and the consequences of its dysfunction, raise several questions. ! We are currently focusing on two projects:! 1.! How is ESCRT function regulated during MVB vesicle formation? ! 2.! How do cell react/adapt to the loss of ESCRT function and the subsequent accumulation of membrane proteins?! Addressing these question will help to understand how membrane proteins are degraded and may provide first insight into the molecular mechanism underlying the wide variety of ESCRT-associated diseases ranging from cancer to neuro-degeneration and AIDS. ! Figure 1: Endo-membrane system of eukaryotic cells. The research of D.T. focuses on endocytic and recycling pathways of signaling cell surface receptors! Recent achievements! OLIVER SCHMIDT, a postdoctoral fellow in the group of DAVID TEIS in the Division of Cell Biology, was recenty granted the prestigous ’EMBO longterm fellowship’. ! International collaborations! Reinhard Fässler (MPI, München, GE), Scott D. Emr (Cornell University, Ithaca, NY), Matthias Peter (ETH, Zürich)! 62 ! Group members: Manuel Alonso Y Adell, Marietta Brunner, Claudia Mattissek, Martin Müller, Mershad Pakdel, Oliver Schmidt, Simon Sprenger, Simona Maria Migliano, Sabine Weys! Cell Biology! WT 1.! Mutant 1 Mutant 2 Mutant 1+2 WT Mutant 1 How is ESCRT function regulated during MVB vesicle formation?! The ESCRT machinery has a modular setup with five distinct complexes (ESCRT-0, -I, II, -III and the Vps4 complex) that have a clear division of tasks - interaction with ubiquitinated membrane proteins (cargo), membrane deformation and scission. The ordered assembly of ESCRT-0, -I, -II and III is essential for efficient cargo interaction and MVB vesicle formation. However it is less clear how the ESCRT machinery is disassembled and reused for a subsequent round of cargo sorting and MVB vesicle formation. The AAA-ATPase Vps4 uses the energy from ATP hydrolysis to disassemble the membrane bound ESCRT-III complexes, thereby recycling the individual ESCRT-III subunits from membranes into the cytoplasm. ! Using a combination of yeast genetics, biochemistry and high resolution imaging, we are currently addressing the molecular mechanism underlying this essential Vps4 driven disassembly reaction, its timing, order and its role (direct or indirect) in MVB vesicle formation (Figure 2). ! 2. How do cells react to the loss of ESCRT function?! Four major protein degradation pathways are part of the cellular quality control system. The endoplasmic reticulum associated protein degradation (ERAD) and the ubiquitinproteasome system (UPS) pathway target substrates to the proteasome. Sophisticated stress response mechanisms (unfolded protein response, heat shock response) counteract the failure of these pathways. Autophagy and the ESCRT dependent MVB pathway transport proteins into the lysosome for degradation. Little is known how cells respond to the loss ESCRT function and the subsequent accumulation of membrane proteins on endosomes. ! To address how cells react to the accumulation on membrane proteins on endosomes, we compared the mRNA expression (Affymetrix GeneChip analysis) and the proteome of an yeast ESCRT mutant with isogenic wildtyp cells. (Figure3). We have now identified 30 genes that are upregulated (on mRNA and protein level) upon loss of ESCRT function. We are now beginning to characterize these genes and their role as potential are effectors of a membrane stress response pathway, that may be activated upon loss of ESCRT function. ! Figure 2. Point mutants in ESCRT subunits, that affect ESCRT disassembly also affect MVB sorting (A) and MVB vesicle formation (B). ! Mutant 2 Mutant 1+2 (A) Fluorescence Microscopy of ESCRT mutants expressing GFP-Cps (bar=5 mm). (B) High Pressure Freezing and Transmission Electron Microscopy of MVB (bar=500 nm)! Figure 3. (A) Heat map of differentially regulated mRNAs. ! (B) ‘Christmas tree’ of differentially regulated proteins. ! (C) Data correlation of mRNA and protein abundance. ! 63 ! Clinical Biochemistry! http://www.i-med.ac.at/imcbc/clinbiochemfolder/clinbiochem.html! Ludger Hengst! Tel.: 0043 (512) 9003.70310 email: [email protected]! Interim Director! Main technologies! Protein Analysis Group Herbert Lindner ! - ESI- and MALDI-TOF mass spectrometry! - HPLC, e.g. RPC, HILIC, IEC, GPC! -! Capillary electrophoresis! -! Phosphoproteomics! - Chromatin immunoprecipitation! - Coimmunoprecipitation! -! Proteome-wide quantification (e.g., SILAC)! Development of high-resolution methods for the separation and identification of post-translationally modified proteins and for investigating their biological significance.! Our group focuses on the development of high-resolution methods for the separation and identification of post-translational modified proteins in order to investigate their biological significance. A set of separation methods based on capillary electrophoresis (CE), reversed-phase chromatography, hydrophilic interaction liquid chromatography (HILIC) and mass spectrometry (MS) was introduced in our lab. Now, as a result of a continuous development program over many years, our group offers a wide range of analytical methods and services to support the work of other research scientist in the University. ! At present, we have two main research interests. The first one focuses on the evaluation of capillary electrophoresis-electrospray ionization-mass spectrometry (CE-ESI-MS) as an alternative proteomics tool to nanoLC-ESI-MS for the analysis of medium complex mixtures consisting of distinctly acetylated, phosphorylated, methylated and deamidated proteins as well as microsequence variants differing only slightly in mass and charge. Our second interest is directed to structural and quantitative analysis of low abundant heart failure biomarker proteins, post-translationally modified by O-linked glycosylation and phosphorylation. Moreover, we are currently establishing a nanoLCESI-MS based assay (pSRM) for biomarker absolute quantification as a reference method to automated immunoassays, which will allow defining an absolute scale for clinically relevant concentrations.! 64 ! Group members: Astrid Devich, Klaus Faserl, Bettina Gadner, Bernhard Halfinger, Leopold Kremser, Lisa Radl, Bettina Sarg, Heribert Talasz! Nano-LC-MSn analysis of a tryptic glycopeptide fraction obtained from immunoprecipitation followed by µ-immunoaffinity-HPLC shown by a logarithmic 3D intensity plot. Inset: Fab’ derivatized from a high-affinity IgG coupled to a silica-based solid phase by a heterobifunctional crosslinker. ! Clinical Biochemistry! Protein Micro-Analysis Facility! The Protein Facility is dedicated to provide investigators with equipment, expertise and custom services for the detection, characterization and quantification of proteins and peptides on a recharge basis. The facility maintains a suite of# state of the art instrumentation including a MALDI TOF/TOF 4800 plus analyzer (AB Sciex), a hybrid FT mass spectrometer LTQ Orbitrap XL ETD (Thermo Fisher Scientific), an LTQ VELOS mass spectrometer (Thermo Fisher Scientific), a Procise 492 protein sequencer (Applied Biosystems), Nano-LC gradient systems UltiMate 3000 (Dionex), a Probot microfraction collector (LC-Packings) for on-line MALDI target preparations. Various capillary electrophoresis and HPLC Systems and, in addition,# a solar M6 dual Zeeman spectrometer (Thermo Fisher Scientific) for trace element analysis are operated in the facility.! Major achievements! - Applying our high-resolving techniques like HILIC, capillary electrophoresis and nanospray mass spectrometry we determined for the first time in vivo evidence that lysine 20 of mammalian H4 is not only mono- and dimethylated but also trimethylated and that the proportion of trimethylated H4 significantly increases during aging. ! -!Examination of cell cycle dependent phosphorylation of human H1 variants revealed an unambiguous site-specificity for the phosphorylation during both interphase and mitosis, suggesting that distinct serine- and threonine-specific kinases are involved in this process.! -! Development of affinity based enrichment methods for MS-based structural investigation of bioactive peptides in human plasma/serum.! MALDI TOF/TOF 4800 plus ! NanoLC-ESI mass spectrometer! Main Aims and Projects! - Development of multidimensional LC/CE-MS-based methods! - PTM identification of various nuclear and extracellular proteins! - Identification of novel phospho-histone binding proteins! -! Identification of histone modification patterns at the nucleosomal level! -! Method development for heterogeneous protein O-glycosylation analysis ! -! Development of targeted protein absolute quantification methods! International Cooperations! I. Rundquist (Linkoping University, Sweden); N. Guzman (Princeton Biochemicals, NY); R. Schneider (MPI Freiburg); Pedro Suau (Universitat Autonoma de Barcelona); Roche Diagnostics, Penzberg, Germany; Beckman Coulter Inc., Brea, CA! Sheathless capillary electrophoresis-electrospray ionization-mass spectrometry (CE-ESI-MS) interface with a porous tip as nanospray emitter for the use in peptide analysis. ! 65 ! Developmental Immunology! ! www.apoptosis.at/ Andreas Villunger! Tel.: 0043 (512) 9003.70380 email: [email protected]! Director! Apoptosis & Tumor Biology Andreas Villunger! Research Focus 1 - BH3-only proteins in cell death and disease! Whether a cell continues to live in response to diverse forms of stress or undergoes apoptosis along the intrinsic cell death signaling pathway is largely determined by the complex interplay between individual members of the Bcl-2 protein family that can either promote or prevent apoptosis.! Survival-promoting Bcl-2 family members, i.e. Bcl-2, Bcl-xL, Bcl-w, Mcl-1 and A1 share up to four Bcl-2 homology domains (BH1-BH4) amongst each other. All these proteins are critical for cell survival, since loss of any of them causes premature cell death of certain cell types. Consistently, overexpression of Bcl-2 pro-survival molecules is associated with prolonged cell survival and resistance to cytotoxic drugs in a number of model systems, but more importantly, also in tumor patients.! The pro-apoptotic Bcl-2 family members can be divided into two classes: the Bax-like proteins, i.e. Bax, Bak, Bok that contain three BH-domains (BH123 or multi-domain pro-apoptotic Bcl-2 proteins) and the BH3-only proteins. The latter include Bim, Bid, Puma, Noxa, Bmf, Bad, Hrk and Bik that are unrelated in their sequence to each other or other Bcl-2 family members (except for the BH3-domain).! We study the role of BH3-only proteins using genetically modified model systems, currently focusing on the role of Bim, Bmf and Puma in tumor and lymphocyte development! Group members: Angela Außerbichler, Florian Bock, Luka Fava, Irene Gaggl, Manuel Haschka, 66 ! Sebastian Herzog, Gerhard Krumschnabel, Verena Labi, Eleonora Ottina, Ruth Pfeilschifter, Lukas Peintner, Kathrin Rossi, Fabian Schuler,! Maja Anna Sochalska, Claudia Soratroi, Maria Tanzer, Denise Tischner, Selma Tuzlak (upper line) ! Groups within the Division of Developmental Immunology! •! Apoptosis & Tumor Biology ! •! Glucocorticoids & Immunology ! ! ! Andreas Villunger ! Jan Wiegers! Figure 1: Two major signalling pathways trigger cell death in mammals. The Bcl-2 regulated apoptosis signaling pathway, conserved in C. elegans, and the 'death receptor' pathway. Both converge at the level of effector caspase activation that causes cellular demolition. In certain cell types, members of the TNF-family have been reported to link the death receptor pathway with the Bcl-2-regulated pathway via caspase cleavage-mediated activation of the BH3-only protein Bid.! Developmental Immunology! DNA-damage! ATM/ATR! The p53-induced protein with a death domain (PIDD) has been identified as a gene activated in response to p53 upon DNA-damage. Together with the adapter molecule RAIDD, PIDD is involved in the activation of caspase-2, in a complex called the “PIDDosome”. Interestingly, PIDD has recently also been implicated in DNA damageinduced NF-kB activation, promoting the transcription of cell survival genes and DNArepair by forming a complex with the kinase RIP-1 and with Nemo. Caspase-2 is an illdefined protease that has been implicated in multiple cellular responses including the one triggered by deprivation of metabolites, heat shock or DNA damage. However, the contribution of caspase-2 to these responses is in many cases still unclear (Fig.2). ! We are currently investigating the role of the known PIDDosome components in tumor suppression and aim to identify caspase 2-specific substrates to gain further insight into the functions of this multi-protein complex.! Recent achievements! Gordon Research Conference poster prize to Verena Labi, 2009! ECDO poster prize to Francesca Grespi, 2009! Swarovski Research Prize to Claudia Manzl; 2009! Krebshilfe support to: Gerhard Krumschnabel, Claudia Manzl, Florian Bock & Florian Baumgartner! Krebshilfe 2012 support to: Luca Fava % 35.000,00! MUI START 2012: Denise Tischner! Chk1! Heat-shock! p53! Caspase-2! PIDDosome! Golgi! International collaborators! Georg Häcker, TU-Munich, GER; Andreas Strasser, WEHI, Melbourne, AUS; Jürg Tschopp, ! Lausanne, CH; Eric Eldering, AMC, Amsterdam; Alexandar Tzankov, Basel, CH! BID! tBID! Mitochondrium! Caspase-9! Ongoing projects! •!Bim and Bmf in the regulation of B cell survival downstream of BAFF! •!Redundancies and specificities of the BH3-only proteins Bim & Bmf! •!Bim & Bmf in ErbB2-dirven breast cancer development! •!Regulation of Bmf protein expression and function! •!Lymphocyte development in the absence of A1! •!PUMA-mediated tumor suppression in response to DNA-damage! •!PIDD in caspase-2 and NF-kB activation! •!PIDDosome mediated tumor suppression! •!Identification of Caspase-2 substrates! DR! Nucleus! Amplification Loop?! Research Focus 2 - The PIDDosome in the cellular response to DNA damage ! Cells that have been exposed to UV, ionizing radiation or DNA-damaging drugs aim to repair the inflicted damage. However, when this attempt fails, cells usually activate an apoptotic program to avoid the spread of cells with compromized genomes. The molecular basis of these life/death decisions is still not entirely clear. ! ER! Caspase-3! Apoptosis! Figure 2. Schematic model summarizing the most important apoptotic pathways with a suggested involvement of caspase-2 activity, i.e. cell death in response to DNA-damage, ER-stress, heat shock, and death receptor (DR) ligation. ATM, Ataxia telangiectasia mutated; ATR, Ataxia telangiectasia and Rad3 related; PIDDosome, overlay! protein complex consisting of PIDD, RAIDD and GM-130! caspase-2; TRAIL, tumor necrosis factor related apoptosis inducing ligand; FADD, Fas-associated death domain (modified according to G. Krumschnabel et al., Cell Death Diff 16: 195-207, 2009)! 67 ! Developmental Immunology! Tel.: 0043 (512) 9003.70390 68 GFP! Research Focus 1 – Impact of life span on regulatory T cell maturation and function Regulatory T cells (Treg) expressing the transcription factor Foxp3 play an essential role in keeping immune homeostasis and preventing autoimmunity. A spontaneous loss of function-mutation in foxp3 in ‘scurfy’ mice leads to fulminant lymphoproliferation and multiorgan autoimmunity. For a better and more efficient therapy of autoimmune diseases, a more profound knowledge is essential on factors that affect (i) Treg maturation and number in the thymus and (ii) Treg homeostasis under either normal conditions or during the course of an immune response. It is currently also unclear how (iii) life span influences the capacity of Treg to suppress immunity. To study maturation and function of Treg cells, we use foxp3GFP knock-in mice that coexpress GFP under control of the endogenous foxp3 promoter. This allows convenient detection and purification of Treg cells by flow cytometry and the possibility to isolate nearly 100% pure Treg cells (Fig. 1). ! before sort! GFP! Jan Wiegers! after sort! International collaborators! Falus A Department of Genetics, Celland Immunobiology (earlier Department of Biology) at Semmelweis University, Budapest; Reul JM Laboratories of Integrative Neuroscience and Endocrinology (LINE), University of Bristol, UK; Boyd RL Department of Immunology, Monash University, Clayton, Victoria, Australia! CD4! Regulation of Immunity email: [email protected]! FSC! Research Focus 2 – Glucocorticoids and T cell development ! Selection processes in the thymus ensure that mature peripheral T cells fulfill two essential prerequisites: activation by foreign peptides bound to (host) MHC molecules, but tolerance to self-derived peptides presented in the same context. To that end, thymocytes that express T cell receptors (TCRs) with high avidity for self antigen:MHC and therefore are potentially autoreactive, undergo apoptosis (negative selection). In contrast, thymocytes expressing TCR with moderate avidity for self antigen:MHC are rescued and differentiate into mature T cells that migrate to the periphery (positive selection). Glucocorticoid hormones (GC) have been suggested to influence these processes, e.g. induce apoptosis in developing T cells, the thymus itself producing GCs! In addition, GC resistance of thymocytes against GC-induced apoptosis is associated with autoimmune diseases. We focus therefore on the following questions: i) what is the molecular background of thymocyte resistance to GC-induced apoptosis in animal models of autoimmune diseases, and ii) what factors determine sensitivity to GCinduced apoptosis in immature vs. mature thymocytes (Fig. 2). ! CD4! CD4+ CD8+! Isotype FITC! CD4+ CD8+! GR-FITC! CD8+! CD8-CY! CD4-PE! Isotype FITC! Fig. 1.: Purification of Foxp3GFP+ Treg cells. Isolated splenocytes were stained for CD4 (left panel) and Foxp3GFP+ Treg cells (upper right panel) and Foxp3GFP– Tcon cells (lower right panel) isolated by cell sorting with a flow cytometer. ! Fig. 2: Glucocorticoid receptor (GR) expression in thymocyte subsets. Thymocytes were stained for CD4, CD8 and GR, washed and mounted with Mowiol. Isotype control and GR stained thymocytes were mixed 1:1.! GR-FITC! Major achievements: Glucocorticoids enhance thymocyte development at the double-negative ! level. ! Group member: Irene Gaggl! Ongoing projects: Regulatory T cells in bim-/- and vav-bcl2 transgenic mice, Glucocorticoids and T cell development! Exp. Pathophysiology- & Immunology ! ! erimental ! ! ! ! ! ! www2.i-med.ac.at/expatho/sgonc.html Lukas A. Huber! Tel.: 0043 (512) 9003.70970 email: [email protected]! Future goals! Interim Director! 1. Further elucidation of early pathomechanisms in SSc; 2. development of new, highly specific diagnostic tests for an earlier diagnosis of SSc; 3. development of efficient therapies based on our research results! International collaborators! Experimental Rheumatology Roswitha Sgonc! Jeremy Saklatvala and Robin Wait, Kennedy Institute of Rheumatology, University of Oxford; Oliver Distler, Center of Exp. Rheumatology, University Hospital Zurich; Andreas Zisch†, Department of Obstetrics, University Hospital Zurich; Olov Ekwall, Department of Rheumatology, Göteborg; Susanne Kerje, Department of Medical Sciences, Uppsala University! Our group is interested primarily in the pathogenesis of systemic sclerosis (SSc), which we study in human patients as well as in the spontaneous UCD-200/206 model. UCD-200/206 chickens are the only animal model, that manifests the whole clinical, histopathological and serological spectrum of human SSc. This makes it the ideal tool to investigate the initial pathomechanisms, and to test new evidence-based therapies. ! Thus, only the comparative study of UCD-200/206 and human SSc made it possible to identify microvascular endothelial cells as the primary target of the autoimmune attack. The subsequent endothelial cell apoptosis is induced by AECA (anti-endothelial cell antibody)-dependent cellular cytotoxicity (ADCC) via the Fas/Fas ligand pathway. ! Currently, we focus on three projects:! 1.! the identification of (auto)antigens expressed by microvascular endothelial ! cells, using a proteomic approach,! 2.! the therapy of ischemic lesions in SSc, and! 3.! the study of genetic factors underlying the disease. ! EC-apoptosis! Human SSc! Major achievements! 1. Identification of three autoantigens expressed by microvascular endothelial cells and recognized ! by chicken and human SSc sera.! 2. Effective therapy of ischemic skin lesions of UCD-206 chickens with VEGF121-Fibrin.! 3. Identification of a novel potential SSc susceptibility gene in UCD-200 chickens, namely IGFBP3 ! (collaborative study with Susanne Kerje, University of Uppsala).! UCD-200! EC-apoptosis! 69 ! Group members Shadab Allipour, Gabriele Stöckl, Ines Wasle, Junyun Zhao! Exp. Pathophysiology- & Immunology ! ! erimental ! ! ! ! ! ! www2.i-med.ac.at/expatho/boeck.html Tel.: 0043 (512) 9003.70385 email: [email protected]! CURRENT EQUIPMENT Biophysics & Biooptics !! Günther Böck ! The aim of our biophysics-biooptics group is to provide a service for the various cell biology groups within as well as outside the Biocenter, together with instructions and training.! The service includes mainly flow cytometry and flow sorting. Some examples of these developments are given below:! b)! c)! d)! the use of a fluorescence-activated cell sorter (FACS) for single cell level receptor demonstration and biochemical characterization! sorting cells being transfected with expression plasmids for GFP fusion proteins for further analysis! sorting of stem cells for further analysis! DNA/cell cycle analysis (an example being shown below)! OFFERS SUPPORT FOR Analysis! Protein expression, GFP ...! Surface markers, CDxxx! Sorting up to 40 mio cells/h! 70 !! Fluorescence = DNA content! a)! S/G2/mitotic cells! Nuclei of G0 cells! Apoptotic bodies! ! Side scatter width! Analyzers (f.l.t.r. upper picture)! - LSRFortessa: 11colors! -! Scan: ! 3 colors! -! Calibur: ! 4 colors + HTS module ! Sorters (f.l.t.r. lower picture)! Front:! FACS AriaIII:! 4-way sorting, 12 colores! Back: ! FACS VantageSE 4colores! Exp. Pathophysiology- & Immunology ! ! erimental ! ! ! ! ! ! www2.i-med.ac.at/expatho/schwarz.html Tel.: 0043 (512) 9003.70975 email: [email protected]! Since 2008, Professor Schwarz is appointed Guest Professor for Pathophysiology at the Suranaree University of Technology (Korath/ Nakhon Ratchasima, Thailand).! Molecular Endocrinology Siegfried Schwarz! Research! This laboratory's work has focussed on the study of various hormone/neurotransmitter binding proteins and receptors as well as their ligands. Key papers describe: ! -! Discovery of Sex Hormone Binding Globulin (SHBG) in cerebrospinal fluid (CSF) and ! interaction of SHBG with Danazol (non-genomic actions of steroids)! -! 1st Demonstration of homocysteate as an NMDA-selective excitatory agonist! - 1st Description of an epitope map of the glycoprotein hormone hCG! - Construction of epitope-selective immunoassays for glycoprotein hormones! -!Demonstration of different orientations of receptor-bound agonistic vs. antagonistic ! hCG! - Prediction of the 3D structure of the extracellular domain of the hCG receptor! -! Characterizartion of an apoptotic activity within urinary hCG preparations towards! Kaposi‘s sarcoma cells! -!Demonstration of the importance of vasopressin in critical ill patients! Teaching Pathophysiology! The University law 2002 mandated the implementation of the NEW CURRICULUM HUMAN MEDICINE at the Innsbruck Medical University. The latter required a full-time teaching devotion for the subject PATHOPHYSIOLOGY. In accordance with these duties, Professor Schwarz published two textbooks, one in 2002, the other in 2007, on molecular aspects of pathophysiology. ! In contrast to previous and „classical“ curricula, Pathophysiology is not any more taught within 2 semesters as a separate and isolated subject, rather it is incorporated into an integrative teaching style of organ and disease modules. A module is covered by lecturers from diverse preclinical and clinical disciplines. The modules are the following: diagnostics and laboratory medicine, endocrinology, hematology, cardiovascular diseases, nephrology, pulmonology, neurology & psychiatry, infectious diseases + immunology, cancer, dermatology, gastroenterology, osteology, teratology, environmental medicine. ! In the 2009 formed CLINICAL SKILLS LABproject implemented by the MUI, the Venipuncture practicum-proposal of S.S. was ranked 2nd out of 12. In 2012, this practicum was declared by the Study Commission as mandatory for all medical students.! In 2009, Prof. Schwarz was invited to display 10 pictures of this book (format 50x50) in the newly built Pediatric University Hospital Innsbruck, 1st floor West. This exhibition serves an aesthetic as well as an educative purpose: ARS IN_STRUCTA (a term coined by Stephan Geley). ! http://www2.i-med.ac.at/expatho/ molecules_of_life_anncmt.html! Book Award 2003 by the British Medical Association! Therefore, teaching of Pathophysiology is stratified over five semesters instead of the previously two. Except for infectious diseases and cancer, the entire teaching of Patho-physiology in main lectures is covered by Prof. Schwarz. In addition, he is appointed coordinator of the module „Endocrinology“, coordinator of the 4th semester, organizer of the SIP3 (summative integrative examination at the end of the 6th semester). Also, he acts as a deputy chief examiner at the EMS (Eingangstest Medizin-Studium) mandatory for the enrollement in the study of medicine, and is member of the examination board of SIP3.! http://www.maudrich.com/list? back=1f74a3719cde4316d61ae4a1952981f6&isbn=978385175 8603! 71 ! Genomics & RNomics! Alexander Hüttenhofer! Tel.: 0043 (512) 9003.70250 Director! Groups within the Division of Genomics & Rnomics! RNomics ! Alexander Hüttenhofer! •! Experimental RNomics (Alexander Hüttenhofer)! •! Proteinsynthesis and decoding (Matthias Erlacher)! •! Ribonucleo-protein complexes (Norbert Polacek)! Non-coding RNAs in model organisms: identification and function! In cells from all organisms studied to date two different types of RNA molecules are found: messenger RNAs (mRNAs), which are translated into proteins, and so-called “non-protein-coding RNAs” (ncRNAs), which are not translated into proteins but function at the level of the RNA itself. Many known ncRNAs, such as microRNAs, are involved in the regulation of gene expression and thus act as genetic switches. While the proteome of most model organisms is rather well-defined, i.e. the total number of protein-coding genes, we are only at the beginning of describing the ncRNA transcriptome. Thus, the predictions on the number of ncRNA genes in the human genome range from about 1.000 up to 450.000 (estimated from tiling-array experiments); in comparison, only about 20.000 protein-coding genes have been identified in the human genome. ! NcRNAs are often found in complex with proteins that are bound to the ncRNA and thus form ribonucleo-protein complexes (RNPs). Such RNPs, present in cellular compartments as diverse as the nucleolus or dendritic processes of nerve cells, exhibit a surprisingly diverse range of functions. However, the biological roles of most of them remains elusive. Moreover, most systematic genomic searches are biased against their detection and comprehensive identification by computational analysis of the genomic sequence of any organism remains an unsolved problem. Therefore, our goal is to directly identify ncRNAs and their genes in the human genome and those of various model organisms as well as to elucidate their functions in cellular processes and human diseases.! Fig. 1: Two classes of RNA species are transcribed from genomes of all organisms: messenger RNAs (mRNAs) and non-coding RNAs (ncRNAs); ncRNAs are not translated into proteins and many of them are able to regulate gene expression by regulating transcription or translation of mRNAs and thus act a genetic switches.! Group members: Helena Dickinson, Matthias Erlacher, Matthias Griehl, Ronald Gstir, Thomas Hoernes, Paul Huter, Rimpi Khurana, Melanie Lukasser, Hubert Muckenhuber, Matthias Misslinger, Katrin 72 ! Perfler, Simon Schafferer! ! genomics.i-med.ac.at/ email: [email protected]! Genomics & RNomics! http://genomics.i-med.ac.at/wg/func_genomics1.html! Experimental RNomics! Our group works on the identification of regulatory non-coding RNAs (ncRNAs) in various model organisms for which we have coined the term “Experimental RNomics". In particular, we are interested in the identification of ncRNAs regulating neuronal development and in the identification of ncRNAs which are involved in CNS diseases. To that end, we have characterized the entire small ncRNA transcriptome, invoIved in the differentiation of mouse ES cells into neural cells, by generating three specialized ribonucleo-protein particle (RNP)-derived cDNA libraries, i. e. from pluripotent ES cells, neural progenitors (NP) and differentiated neural cells (N/G), respectively. By high-throughput sequencing and transcriptional profiling we identified several novel miRNAs to be involved in ES cell differentiation, as well as seven small nucleolar RNAs. About half of ncRNA sequences from the three cDNA libraries mapped to intergenic or intragenic regions, designated as interRNAs and intraRNAs, respectively. Thereby, novel ncRNA candidates exhibited a predominant size of 18-30 nt, thus resembling miRNA species, but, with few exceptions, lacking canonical miRNA features. In total, about 1000 novel ncRNAs have been identified by our approach. Based on these findings, we have generated a custom micrarray chip, covering a) novel ncRNAs from ES cell differentiation, b) ncRNAs from whole mouse brain and c) ncRNAs from dorsal root ganglia as a model system for developing neurons. We are currently applying the microarray chip to investigate differential expression of ncRNAs in mouse models of Alzheimer and Parkinsons diseases as well as within behavioural paradigms such as fear memory extinction and depression. Major achievements! •! Coordination GEN-AU Programme: ncRNAs: from identification to functional characterization! •! Member of the 7th framework EU: SysKid! •! PhD programme participant: SPIN: signal processing in neurons! Future goals! •! Identification of the biological functions of neuronal ncRNAs! •! Analysis and investigation of regulatory ncRNA networks by bioinformatical methods! International collaborators! Joerg Vogel, MPI, Berlin, Germany; Ralph Bock, MPI Potsdam, Germany; Jürgen Brosius, University of Münster, Germany; Yuuchi Soeno, Nippon University, Tokyo, Japan! Fig. 2: The 100 most differentially expressed novel neuronal ncRNAs during ES cell differentiation. Fold changes are depicted in a log2 scale. The dendrogram to the right indicates the Euclidean distance of the expression values. 73 ! Genomics & RNomics! Protein Synthesis and Decoding ! ! ! ! Matthias Erlacher! Paul Huter! Ribosomes are multifunctional ribonucleo-protein (RNP) complexes that translate the message of a genome into proteins which are required for all essential functions in every living cell. The decoding process during protein synthesis is an important step to provide functional proteins to the cell. Crystal structures provided some insights how the ribosome ensures the correct codon/anticodon interaction between the mRNA and the aminoacylated tRNA. To get a more detailed view of decoding we biochemically investigate this process by introducing non-natural modifications into the decoding center of the small ribosomal subunit.! Fig. 3: Non natural modifications can be site specifically incorporated into the 16S rRNA, which sub-sequently is used to reconstitute functional ribosomal particles. Ribonucleo-protein Complexes Norbert Polacek ! RNA biology of the vault RNA and the ribosome! Norbert Polacek has been appointed a full professorship at the University of Bern/Switzerland; thus, he and his team recently have moved to Switzerland. Still, a part of his group is investigating the molecular biology of the vault RNA and of the ribosome at the Division of Genomics and RNomics.! Current email address: [email protected] ! Fig. 4: Vault RNAs (vtRNAs) are ncRNAs that are integral to the caps of the vault complex, a gigantic hollow ribonucleoprotein particle of 13 MDa. Ist function is not yet elucidated. Fig. 5 : 3D structure of a ribosome Clementi et al., Nature Chem. Biol. 2010 74 ! Group members: Melanie Amort, Nina Clementi, Birgit Nachbauer! Genomics & RNomics! Core Facility Deep-Sequencing (Head: Univ. Prof. Dr. Alexander Hüttenhofer, scientific support: Dr. Anne Krogsdam) ! The Division of Genomics and RNomics supports a core facility for sequencing at the Medical University of Innsbruck. Instrumentation owned by the facility, includes a 16capillary sequencer from Applied Biosystems (ABI 3100). The facility offers to the scientific community of Innsbruck (i. e. institutes, clinics, companies, etc.) to run their own sequencing reactions on the ABI 3100. In addition, two high-throughput sequencing devices are available at the core facility. The first one is an Ion Torrent Sequencer (Life Technologies), able to sequence several hundred Mb/run with 100-400 bp read length, and thus ideally suited to perform targeted sequencing of genes and gene mutations as well as fungal, bacterial or mitochondrial whole genome/transcriptome analysis. The SOLID 5500 XL deep-sequencing machine expands the sequencing capacity, beyond that of the Ion Torrent Sequencer, to the range of about 120 Gb and can be employed for whole genome/transcriptome studies of higher eukaryal genomes, including human whole genome and transcriptome sequencing. This opens new venues in medical applications such as cancer genomics and personalized medicine. Bioinformatics support is provided by the Division of Bioinformatics (Head: Prof. Z. Trajanoski). For further information, see our website at: http://ngsfacility.i-med.ac.at/ 75 ! ABI 3100 Ion Torrent SOLID 5500XL Medical Biochemistry! ! www.i-med.ac.at/ imcbc/medclinchemfolder/medclinchem.html Ludger Hengst! Tel.: 0043 (512) 9003.70111 email: [email protected]! Director! Cell Cycle and Proliferation Ludger Hengst! Precisely coordinated cell division and differentiation processes are essential for growth, development and integrity of multicellular organisms. Before cells commit to divide, they are exposed to a flood of diverse signals aimed to regulate growth, differentiation, proliferation and cell fate. These external and internal signals impinge on the central cell cycle control machinery in order to either permit or prohibit cell proliferation. Mistakes in interpretation, processing or integration of these signals can lead to hypo- or hyperproliferative diseases, including cancer.! Our group investigates molecular mechanisms that link diverse signalling networks to the central cell cycle control machinery. At the core of this machinery is a conserved family of protein kinases, called cyclin-dependent kinases (Cdks). Cdks need to be activated by binding of a positive regulatory subunit, the cyclin. Activation and inactivation of specific Cdk complexes is required for cell cycle progression. Cdkinteracting protein (p21 - Cip1) and kinase inhibitory proteins (p27 - Kip1 and p57 Kip2) constitute a family of Cdk inhibitors (CKI) that bind to and regulate Cdk kinase activity. Their concentration, localisation and modifications plays a key role in regulating Cdk kinase activity and cell proliferation. In addition to their canonical function in Cdk regulation, CDK inhibitors can exert specific functions. For example, after its translocation to the cytoplasm, the Cdk inhibitor p27 can regulate cell motility and cell migration.! Among others, we identified one of these Cdk inhibitor proteins, p27Kip1. The activity, localisation and stability of this protein are regulated in part by mitogen signalling. We investigate pathways and mechanisms that control Cip/Kip localization, modification, abundance and activity and function and study their physiological roles in normal cells, oncogenesis and cancer cells.! 76 ! Groups within the Division of Medical Biochemistry! •! Cell Cycle & Proliferation! •! Signal Transduction & Proliferation ! •! Biochemical Pharmacology !! •! Ribosomal Proteins! •! Bioinformatics! Ludger Hengst! Karl Maly! Wolfgang Doppler! Johann Hofmann! Wolfgang Piendl! Florian Überall! Figure 1: Overview of the cell cycle. Central CDK/cyclin complexes are indicated next to the cell cycle position when they are active and the Cip/Kip CDK inhibitors are shown next to the appropriate CDK/Cyclin complexes.! Group members: Andrea Casari, Karin Ecker, Heidelinde Jäkel, Michael Keith Kullmann, Lisa Kindler-Maly, Karl Maly, Alessia Masuchio, Georg Nikolaidis, Ines Peschel, Silvio Podmirseg, Glory Ranches, ! Martina Roilo, Martin Taschler, Jonathan Vosper! Medical Biochemistry! The eukaryotic cell division cycle is divided into four phases. DNA replication during Sphase is separated by so-called gap phases, G1 and G2, from the segregation of the duplicated DNA and other cellular components in mitosis. At the end of M phase, two daugher cells are generated by cytokinesis. Cells decide to withdraw from proliferation or to commit to another round of cell division during a specific window of their cell cycle in G1 phase, until they reach the restriction point (Figure 1). ! p27 regulates cell cycle progression over the restriction point. Abundant p27 binds and inactivates Cdks and prevents cell proliferation. The Cdk inhibitor protein becomes unstable as cells progress towards S-phase, as a positive feedback loop couples p27 ubiquitin-dependnet stability to Cdk activation (Fig. 2). The mechanism which triggers this feedback loop has long remained a puzzle.! Tyrosine-88 phosphorylation ejects this inhibitory helix from the catalytic cleft and permits the p27-bound Cdk to bind ATP and to phosphorylate substrates. Among these substrates is p27 itself. Phosphorylation of p27 by the bound Cdk generates a phosphodegron which mediates the ubiquitin-proteasomal degradation of the Cdk inhibitor (Figure 3).! Our discovery provides a model on how p27 can be inactivated and degraded in response to mitogen signals and how it can function as assembly factor of active Cdk complexes. ! Figure 2 Figure 3! Ongoing research! Current research projects ! Regulation of cell cycle progression through G1 phase by tyrosine kinases, translational control in and of the cell cycle; temporal and spatial regulation of Cdk-inhibitory proteins during cell cycle progression. ! in the lab focus on two main areas: ! - Function and regulation of Cdk-inhibitory proteins. ! - Role of translational control for the decision between cell proliferation and withdrawal from the cell cycle.! Major achievements! Cooperations! We discovered a mechanism which can trigger p27 degradation, Cdk activation and cell cycle progression in G1 phase. Different tyrosine kinases can phosphorylate p27. Among these kinases are known oncogenes like Src family kinases or BCR-Abl, whose activation leads to increased and deregulated p27 tyrosine phosphorylation. In addition, cytokines can activate kinases which phosphorylate p27.! Phosphorylation on tyrosine-88 leads to a conformational of p27 on bound Cdk/cyclin complexes. In its unphosphorylated state, tyrosine 88 of p27 is part of an inhibitory helix that occupies the purin binding pocket of the kinase and thereby prevents access of ATP to the catalytic cleft. ! Joyce M Slingerland, University of Miami, U.S.A.; Richard W. Kriwacki, St. Jude Hospital of Sick Childreen, Memphis, U.S.A.; Markus Gerhard, Klinikum Rechts der Isar, München, Germany; Hartmut Halfter, Universität Münster, Germany, Pierre Roger, Bruxelles, Belgium; Stephen J. Elledge, Harvard, Boston, USA! 77 ! Medical Biochemistry! ! www.i-med.ac.at/imcbc/staff_doc/doppler_wolfgang.html Tel.: 0043 (512) 9003.70150 email: [email protected]! Figure 1: Clustering of breast cancer patients according to expression of STAT1, STAT1 target genes, and immune cell markers! STAT1 in Cancer Wolfgang Doppler! The signal transducer and activator of transcription 1 (STAT1) serves as a key mediator of the action of interferons on cells of the innate and acquired immune system. It also can directly trigger cell cycle arrest and apoptosis in normal epithelial as well as cancer cells. To fulfill these functions it acts as a transcription factor to induce the expression of genes required for antigen processing, maturation and recruitment of immune effector cells, antiviral defense and co-operates with the cellular machinery regulating proliferation and apoptosis. Activation of STAT1 is a membrane receptor triggered event and canonically linked to its tyrosine phosphorylation by a receptor associated tyrosine kinase. Different tumors exhibit high variation in the expression and activation of STAT1 both in the tumor epithelium as well as in the tumor infiltrating immune cells, even when tumors of the same histological type are compared.! Figure 2: STAT1 in tumor epithelium & infiltrating tumor associated macrophages (TAMs, CD45+CD11b+F4/80+)! Figure 3: STAT1 dependent interaction between tumor and infiltrating cells in the response to chemotherapy! Major achievements:! •! Complete STAT1 deficiency accelerates mammary tumor development and formation of metastasis driven by HER2/erbB2. It promotes the spontaneous development of teratomas. ! •! The response to chemotherapy was blunted in the absence of STAT1 and this was shown to depend on a non-cell autonomous mechanism.! •! In human mammary carcinomas a link between infiltration of the tumor with myeloid cells, high expression of STAT1 and STAT1 target genes as well as genes serving as markers for immunosuppression was observed. These parameters are indicative for a chronic long term state of immune activation. Patients with high expression generally exhibit a higher risk to develop metastasis. By contrast, STAT1 tyrosine phosphorylation as a marker for short term activation of STAT1 was found to be linked to good prognosis.! •! An early defect of B-cell development and impaired recovery from myelosuppression was observed as a consequence of STAT1 deficiency.! Cooperations: ! Elizabeth M Jaffee, Johns Hopkins, Baltimore, USA; Matthew L. Albert, Institute Pasteur, Paris, FRANCE! Ongoing research:! We are currently focusing on how expression and activation of STAT1 in a particular tumor type contributes to the development of the tumor, its propensity to develop metastasis, and its sensitivity to drug treat-ment. In particular we are interested in the relative importance of STAT1 in the tumor epithelium vvith infil-trating immune cells.! Current research projects:! •! Elucidation of the mechanism for non-cell autonomous effects of STAT1 on the response to therapy. Potential role of tumor infiltrating myeloid and T-cells in these processes.! •! Definition of critical STAT1 target genes in tumor development and metastasis formation.! 78 ! Group members: ! Sebak Datta, Piotr Tymoszuk, Anto Nogalo! Medical Biochemistry! ! www.i-med.ac.at/imcbc/staff_doc/hoffman_johann.html Tel.: 0043 (512) 9003.70130 Biochemical Pharmacology email: [email protected]! Johann Hofmann! Research Areas! •!Investigations into the function of the C6orf69, RhoBTB3 and BTBD10 genes! •!Development of antagonists of PKCepsilon by interference between PKCepsilon and RACK2! •!Investigations into the mechanism of action of novel bicyclic hydrazones as antitumor compounds! Major achievements! •! Generation of an inhibitor of PKC epsilon by PKCepsilon/RACK2 interaction! (Patent application in progress)! •! Progress in exploration of the function of C6orf69 and RhoBTB3! •! Progress in elucidation of the mechanism of action of heterocyclic hydrazones! Future goals! •! Exploration of the function of BTBD10! •! Investigations into the mechanism of action of heterocyclic hydrazones! International collaborators! Giorgio Cozza, University of Padova; Maria Rybczynska, Medical University of Poznan; Maria Preobazhenskaya, Academy of Sciences, Moscow; Peter Galfi, Veterinary University, Budapest; Janet Lord, University of Birmingham; Peter Goekjian, University of Lyon; Hui-Ching Wang, University of Basel! Figure 1: RACK2 (green) with inhibitory octapeptide EAVSLKPT (blue). RACK2 represents a protein that by binding to PKCepsilon defines its final sorting in the cell, e.g. for anchoring PKCepsilon onto cardiac myofilaments/myofibrils. (RACK = receptor for activated C kinases). The octapeptide shown here is part of the RACK2-binding domain on PKCepsilon. By using such peptides or similarily structured other small molecules, the translocation and thus the function of PKCepsilon is inhibited.! Figure 2: Colocalization of RACK2 and PKC-epsilon in the Golgi! 79 ! Group members: Peter Gruber, Dorata Garczarczyk, Doris Hinger! Medical Biochemistry! http://www.i-med.ac.at/imcbc/staff_doc/piendl_wolfgang.html! Tel.: 0043 (512) 9003.70331 Ribosomal Proteins Wolfgang Piendl ! Interaction of ribosomal proteins with rRNA and mRNA! We are investigating ribosomal proteins L1, L4 and L10 (as part of the L10/L12 stalk complex) from different (hyper)thermophilic archaea and bacteria. They exhibit a 10 to 100 fold higher affinity to their specific binding sites on rRNA and mRNA compared to that of their mesophilic counterparts. This stronger protein-RNA interaction might substantially contribute to the thermal tolerance of ribosomes in thermophilic organisms. Our investigations are focusing on the identification and characterization of those structural features of RNA-binding proteins that modulate the affinity for their specific RNA binding site. In this context we try to determine the crystal structures of the protein-RNA complexes at high resolution (in collaboration with our Russian partners).! Control of ribosomal protein synthesis in mesophilic and thermophilic archaea! As bacteria and eukarya, archaea have to coordinate the synthesis of about 60 ribosomal proteins with each other and with three rRNAs. Research is focusing on the MvaL1 operon (encoding ribosomal proteins L1, L10 and L12) from mesophilic and thermophilic Methanococcus species. As in bacteria, regulation of this operon takes place at the level of translation. The regulator protein MvaL1 binds preferentially to its binding site on the 23S rRNA, and, when in excess, binds with a 20-fold lower affinity to its regulatory binding site on its mRNA (a structural mimic of the 23S rRNA binding site) and thus inhibits translation of all three cistrons of the operon. MvaL1 inhibits its own translation before or at the formation of the first peptide bond, but Mval1 does not inhibit the formation of the functional ternary initiation complex. Our data suggest a novel mechanism of translational inhibition that is different from the displacement or entrapment mechanism described for the regulation of ribosomal proteins in bacteria. ! Our next aim is to pinpoint exactly the translation step at which MvaL1 inhibits its own synthesis.! Function of ribosomal protein L1! L1 is a two-domain protein with N and C termini located in domain I. In close collaboration with a Russian group we succeeded in constructing a truncation mutant of L1 representing domain I by deletion of the central part of L1 (= domain II). We could demonstrate that domain I alone is sufficient for specific RNA binding, whereas domain II stabilizes the L1-23S rRNA complex. ! In the ribosome L1 is located in the stalk region proximal to the E-site where the deacylated tRNA is ejected. We plan to study the exact function of L1, especially of its domain II in the process of protein synthesis.! Major achievements! 80 ! •! Solution of the structure of the L1 protuberance in the ribosome (with the Russian collaborator); see figure! •! Construction of a truncated mutant of ribosomal protein L1 and elucidation of its role in RNA binding! email: [email protected]! Figure 1: Ribosomal protein L1 from the archaeon Sulfolobus acidocaldarius in complex with 23S rRNA! Future goals! •! To study the role of ribosomal protein L1 and its individual domains within the ribosome! •! To define the translational step at which archaeal L1 inhibits its own synthesis! •! To determine the stoichiometry of the ribosomalL10/L12 complex in archaea! International collaborators, institutions! Prof. Dr. M. Garber, Institute of Protein Research, Russian Academy of Sciences, Pushchino, Moscow Region, Russia! Medical Biochemistry! ! www.i-med.ac.at/imcbc/staff_doc/ueberall_florian.html Tel.: 0043 (512) 9003.70120 email: fl[email protected]! Future goals! •! Deeper insights into systems biology! •! Cellular redox-chemistry/biochemistry! •! Keap-1/Nrf-2/PKC and cytochrome 450 isoenzymes signalling! •! Volatile organic compound (VOC)-mediated gene expression profiling! •! Signalling of allelochemicals (GC-MS, PTR-MS/TOF)! Nutritional Biochemistry ! Florian Überall! We are interested in cellular communication systems found in nature. By applying holistic approaches from systems biology we study the fundamental properties and functions of volatile organic compounds and phytochemicals which they have on human cell systems.! International collaborators! Ulrich-Merzenich G, New perspectives for synergy research with the „omics“-technologies in phytomedicine, Bonn, Germany! Moscat J, Protein kinase C signalling, Genome Research Institut Cincinnati, USA! Schwabl H, Institute for Nonlinear Studies, Zürich Switzerland! Schwarzentruber P, Pyroseqencing of microbioms, OMYA, Oftringen, Switzerland! PHYTEST: Establishment of in-vitro methods for a better risk-benefit assessment of natural products ! PHYTORAF I: In the science cluster “Intelligent technologies“ (bmvit) we are engaged in lab work on human and plant cells to understand the biological function of non-volatile allelochemicals in-vitro! Together with a commercial partner in Switzerland we investigate the fundamental regulation of non-volatile and volatile allelochemicals on human cell models, field microbioms, and in the open field! VOConCELL: Establishment of novel methods in order to characterize volatile organic compounds released from wood based materials on human cell systems! Major achievements! •! Risk-benefit assessment of natural products and phytochemicals on cell models! •! Identification of novel endogenous PKC epsilon substrates! •! Quantification of VOCs from plants, microbes and human cell systems! •! Gene expression profiling of VOCs and phytochemicals on human cell models! •! Characterization of abiotic stress factors of cyanobacteria - isolation of active ! principles (together with M. Ganzera, FWF-project)! Group members: Kathrin Becker, Johanna Gostner, Peter Gruber, Martina Naschberger, Anto Nogalo, Simon Überall, Oliver Wrulich, Johannes Zeisler! 81 ! Molecular Biology! Peter Loidl! Director ! Research of the division is devoted to various topics of molecular biology, molecular microbiology, epigenetics, applied microbiology and lipocalin structure and function. Research is mainly focused on the regulation of gene expression in filamentous fungi, plants and cultured mammalian cells.! The division of Molecular Biology is responsible for teaching and training medical students, students of a newly implemented bachelor curriculum in Molecular Medicine of the Innsbruck Medical University and biology students of the Faculty of Biology of the University of Innsbruck in molecular biology, medical microbiology and infectious disease control.! Groups within the Division of Molecular Biology! Chromatin and Epigenetics! -Structure and Function of Chromatin: Maize and Mouse -Structure and Function of Chromatin: Filamentous Fungi !! -Chromatin Assembly and Remodeling ! Molecular Microbiology ! ! Applied Mycology ! ! Lipocalins ! ! ! ! Loidl! Peter ! Gerald Brosch ! Stefan Grässle! ! Alexandra Lusser! ! Hubertus Haas! ! Florentine Marx! ! Bernhard Redl! Chromatin & Epigenetics Group! Nuclear DNA is compacted into chromatin which represents a structure of repeating nucleosomes. These consist of DNA wrapped around a histone octamer. At least 2 domains can be distinguished in histones, a globular histone-fold domain involved in histone-histone interactions and the flexible N-terminal tails (H3, H4) or N-terminal and C-terminal tails (H2A, H2B). In the past years our traditional view of chromatin as a static and largely repressive functional state has changed to a more complex view of chromatin as a dynamic state that is essential for cellular regulation. The dynamic properties of chromatin are mediated by multiprotein complexes with different functions that set marks overlying the stable information of DNA. Factors that affect chromatin are enzymes that modify histones and chromatin remodeling machines. Histones are substrates of posttranslational modifications, like acetylation, methylation, phosphorylation and others which all can cause structural and functional rearrangements in chromatin and therefore represent essential elements of the complex epigenetic histone code. ! 82 ! To decipher this code which is recognized and interpreted by transcriptional regulators and chromatin remodeling machines, is one of the central challenges of chromatin research. Moreover, numerous regulatory, non-histone proteins are modified by histone acetyltransferases (HATs) and histone deacetylases (HDACs). This is an important point, in that the same enzyme activities that are responsible for the acetylation/deacetylation of nucleosomal histones also modify those regulatory proteins that bind to chromatin and probably recognize the complex modification pattern established on nucleosomes. One therefore faces a currently elusive correlation between pattern formation on nucleosomes and signal establishment on histone-binding proteins.! Tasks! •! identification and functional analysis of HDACs, histone methyltransferases and ! demethylases in filamentous fungi and plants! •! role of HDACs in host-microbe interactions! •! mechanism of action of HDAC- and protein methyltransferase-inhibitors ! •! acetylation of nucleolar proteins! •! functional significance of histone and non-histone protein modifications for cell ! cycle regulation (p130)! •! chromatin assembly and remodeling! Molecular Biology! Structure and Function of Chromatin: Maize and Mouse ! ! ! Peter Loidl! Research Topics! -Acetylation of ! •!nonhistone, nuclear proteins (Acetoproteomics)! •!nucleolar proteins (UBF, PAF53)! •!cell cycle regulatory pocket proteins (Rb2/p130)! -HDACs and protein methyltransferases during maize embryo germination! My laboratory was formerly engaged in the investigation of core histone acetylation; we have intensively studied histone acetylation in the acellular slime mold Physarum polycephalum and in plants. In particular, we have purified, characterized and identified histone acetyltransferases and histone deacetylases in Zea mays and Arabidopsis thaliana. In the course of these studies we identified a novel, plant specific type of histone deacetylase (HD2) and a yet unknown level of regulation of an HD-A type deacetylase by limited proteolytic cleavage. Currently we investigate this type of regulation in more detail and we extended our investigations in maize for the purification and characterization of histone/protein methyltransferases.! During the last years it became more and more clear that a huge number of non-histone proteins are substrates for enzymes that were initially identified as histone-modifying enzymes; this holds true, in particular, for HATs and HDACs and histone methyltransferases. Since 2006 we focussed our research on the analysis of the functional consequences of acetylation of UBF and PAF53 (nucleolar transcription regulators/adaptors) and Rb2/p130 (a cell cycle regulatory pocket protein).! ! ! mol-biol.i-med.ac.at/wg/chromatin_lab_mm.html mol-biol.i-med.ac.at/ Tel.: 0043 (512) 9003.70200 email: [email protected]! Major achievements! We have identified the nucleolar proteins UBF and PAF53 as well as the pocket protein Rb2/130 as proteins that are acetylated by HATs and we could at least partially unravel the functional significance of the modification.! Rb2/p130 is acetylated in a cell cycle dependent manner at 3 sites, lysine 1079 being the most prominent residue. We could recently demonstrate that lysine 1079 acetylation primes Rb2/p130 for phosphorylation in a cell cycle dependent manner. ! Future goals! We would like to understand the complex interrelation between regulatory non-histone proteins that are acetylated/deacetylated by HATs/HDACs and chromatin.! 83 ! Group members: Hermann Krabichler, Adele Loidl Molecular Biology! Chromatin Tel.: 0043 (512) 9003.70211 ! email: [email protected]! & ! mol-biol.i-med.ac.at/wg/chromatin_lab_ff.html Epigenetics! Tel.: 0043 (512) 9003.70218 email: [email protected]! Structure and Function of Chromatin: Filamentous fungi! Histone methylation in filamentous fungi Histone methylation in filamentous fungi ! Gerald Brosch! Arginine residues of proteins can be modified by members of the protein arginine methyltransferase (PRMT) family. PRMTs are in general involved in diverse cellular processes including transcription, RNA processing, DNA repair or signal transduction. In Aspergillus nidulans, three PRMTs were identified. Two of these proteins are the PRMT1 and PRMT5 family members, respectively, whereas the third enzyme displays unique enzymatic and structural properties and therefore has an exceptional position within the PRMT family. Our longterm objective is to clarify the functional role of the Aspergillus PRMTs, in particular the fungus-specific enzyme RmtB. Our strategy to reach this goal is on the one hand based on the deletion of the corresponding PRMT genes by targetted gene replacement and the generation of double and triple mutant strains. This allows us to analyze putative growth defects of the deletion mutants under various growth conditions and the concomitant investigation of physiological and developmental effects. On the other hand, we started to isolate and characterize enzymes involved in arginine methylation, and these enzymes enable us to screen for novel, yet unidentified substrate proteins of Aspergillus PRMTs. The outcomes of these investigations will finally provide the basis for the (longterm) analysis of the functional implication of this modification. This will include the specific mutation of substrate genes and/or methylation sites with subsequent analysis of effects on gene expression and physiology, as well as to explore the role of protein methylation for fungal specific processes such as the regulation of secondary metabolism. ! 84 ! Group members Ingo Bauer, Birgit Faber, Hermann Krabichler, Angelo Pidroni! Functional roles of distinct histone deacetylases in the filamentous fungi! ! Stefan Grässle! Histone acetylation plays a crucial role in the processes of gene regulation in eukaryotes. In particular, histones can be acetylated by histone acetyltransferases (HATs) and can be deacetylated by a second group of enzymes, the histone deacetylases (HDACs). In contrast to HATs, for which to date no potent inhibitors are known, there is a panel of structurally unrelated agents available that affect HDACs in a selective way. Today these inhibitors are important tools for the study of histone acetylation processes. Our working group studies histone acetylation/deacetylation processes and attempts to purify HATs and HDACs of multiple organisms. Recently, we have identified and partially characterized HDACs of different classes in the filamentous fungus Aspergillus nidulans. The further characterization and clarification of the function of these enzymes within our model organism is the goal of this project. Since filamentous fungi are more complex than yeast in many important aspects, yet genetic manipulation is relatively simple and easy to perform, they have widely been regarded as model systems to study the basis of eukaryotic gene regulation. Moreover, many of these organisms contribute to the decay of organic material and thereby play an important role in the spoilage of food. But there are also filamentous fungi which represent dangerous pathogenic agents for people such as the closely related species to A. nidulans, A. fumigatus, which can cause life-threatening infections in patients that have a compromized immune system. For these reasons the study of these group of organisms is also of economic and medical interest. ! Molecular Biology! " A! A Major achievements! •! Histone methylation: The screening for selective and non-selective targets by a proteomics approach (2D-gel electrophoresis/mass spectrometry) led to the isolation and identification of several putative target proteins of Aspergillus PRMTs, including the LaeA-like protein that has sequence similarity to a regulator of secondary metabolism (LaeA), and ArtB that is one of the two Aspergillus 14-3-3 homologs. 14-3-3 proteins play important roles in a wide range of regulatory processes, including signal transduction, cell cycle control, and transcriptional regulation. Methylation assays with recombinant and native RmtB and RmtC proteins as enzyme source revealed that both proteins were significantly methylated in vitro. Moreover, biochemical purification with subsquent analysis by MS identified distinct arginine residues as methylation sites, which confirmed that LaeA-like and 14-3-3 represent targets of Aspergillus PRMTs. ! •! Histone acetylation: We showed that deletion of distinct A. nidulans HDACs significantly affects the transcription of secondary metabolite gene clusters and consequently leads to altered levels of the corresponding molecules (toxin and antibiotic). Treatment of other fungal genera with HDAC inhibitors resulted in overproduction of several metabolites, suggesting a conserved mechanism of HDAC regulation of defined secondary metabolite gene clusters. Moreover, depletion of RpdA, another fungal HDAC, leads to a drastic reduction of growth and sporulation of Aspergillus nidulans and to a hyperbranching of the hyphae. Functional studies revealed that a short fungal specific motif is required for the catalytic activity of the enzyme that cannot be deleted without affecting the viability of A. nidulans. Thus, the RpdA motif represents a promising target for HDAC-inhibitors with antifungal activity.! Future goals! •! To further characterize properties of isolated PRMT substrate proteins. ! •! To identify the enzyme(s) responsible for methylation of ArtB and LaeA-like proteins.! •! To study the functional role of this modification in oxidative stress response.! •! To investigate the impact of histone modifications on the regulation of secondary metabolism in A. nidulans.! •!To clarify the molecular mechanism of the essential motif of RpdA and its putative role as new target for antifungal drugs. Since several euascomycetes are not only well known for infection of food and crop plants, but also represent causative agents of infections in humans, the development of novel antimycotic sub-stances is highly desirable! B! " " " B ! wt ! !hdac ! 24h ! 48h ! 60h ! Figure: (A) Screening for novel substrate proteins of Aspergillus PRMTs by in vitro methylation assays combined with subsequent separation by 2D gel electrophoresis and identification of proteins by MS analysis. A purified protein fraction was incubated with RmtB and SAM for methyltransferase assay. Reaction products were subjected to isoelectric focusing (pH 3-11) and subsequently to 14% SDS-PAGE. Gels were dried and applied to fluorography. Spots indicate methylated proteins that were further analyzed by MS. (B) Penicillin (PN) production of an A.#nidulans wild type (wt) strain vs. an HDAC deletion mutant (!hdac). Bacterial growth inhibition assay plate showing PN production of the strains grown for 24, 48, and 60h in liquid shake culture. Culture medium was added to wells on agarplates inoculated with the PN-sensitive indicator strain Kocuria rhizophila (ATCC 9341). The relative size of the bacterial growth inhibition zone corresponds to the relative PN production of the fungi. ! International collaborators! Nancy Keller, Department of Plant Pathology, University of Wisconsin-Madison, USA; Manfred Jung, Department of Pharmaceutical Sciences, Albert-Ludwigs-Universität Freiburg, Germany; Antonello Mai, Dipartimento Studi Farmaceutici Università degli Studi di Roma "La Sapienza“, Italy; Jonathan Walton, Department of Energy Plant Research Laboratory, Michigan State University, East Lansing; Gianluca Sbardella, Dipartimento di Scienze Farmaceutiche, Università di Salerno, Fisciano, Italy! 85 ! Molecular Biology! ! mol-biol.i-med.ac.at/wg/chromatin_assembly.html Tel.: 0043 (512) 9003.70210 email: [email protected]! Major achievements! Chromatin & Epigenetics! Chromatin Assembly & Remodelling Alexandra Lusser ! The way in which eukaryotic DNA is organized in chromatin has profound effects on all processes that direct DNA metabolism (such as transcription, replication, repair and recombination). We are interested to learn how the establishment and maintenance of eukaryotic chromatin affects those processes. We are approaching this question by studying the molecular mechanism and biological context of the chromatin assembly process. ! Chromatin assembly is a fundamentally important process that is tightly linked to DNA replication and enables the cell to faithfully duplicate the chromosomes. In addition, chromatin assembly occurs independently of replication to turn-over histones, for instance during transcription or DNA damage repair. We have recently identified Drosophila CHD1 as an ATP-dependent chromatin assembly factor that belongs to the SNF2 superfamily of ATPases. Many members of this large group of molecular motor proteins are involved in the modification of chromatin structure. ! To study the implications of chromatin assembly in processes of DNA metabolism, we use a biochemical approach employing in vitro chromatin reconstitution and transcription systems. In addition, we are particularly interested in the biological functions of CHD1 in the regulation of transcriptional processes. To address this question we use Drosophila and the mouse as model organisms. In the fly, we study the structurefunction relationship of CHD1 using fly transgenesis, and we examine the role of CHD1 in fertility and immunity. In the mouse, we study CHD1 and other chromatin modifying factors in embryonic stem cells, neurogenesis and neurological disease. The latter project is part of the SFB-F44 network grant on „Cell Signaling in Chronic CNS Disorders“. Another research interest of the lab is the characterization of factors that are necessary for the formation of centromeric chromatin in Drosophila. This project is carried out within the framework of the Marie Curie International Training Network „Nucleosome4D“.! 86 ! Group members: Thomas Amort, Anastasia Boltenhagen, Mark Boltengagen, Paolo Piatti, Gabriele Scheran, Johanna Sebald, Alexandra Wille, Anette Zeilner! In our studies of the biological roles of the ATP-dependent chromatin remodeling factor we found that CHD1 has a crucial role in vivo in the remodeling of sperm chromatin during fertilization. CHD1 is essential for the incorporation of the variant histone H3.3 into paternal DNA during early Drosophila development. Thus, CHD1 is the first ATP-dependent remodeling factor that is linked to an H3.3-specific nucleosome assembly pathway.! Future goals! To understand the mechanistic and biological roles of chromatin assembly and remodeling factor CHD1; to explore the possibility for posttranscriptional regulation of long ncRNAs by chemical modification.! International collaborators! Dmitry Fyodorov, Albert Einstein College of Medicine, Bronx, USA; Jim Kadonaga, University of California, San Diego, USA; Cees Dekker, Delft University of Technology, Delft, NL; Alexander Konev, Russian Academy of Sciences, St. Petersburg, Russia, Tamar Juven-Gershon, Bar-Ilan University, Tel Aviv, Israel. ! Figure 1: A working model for Chromatin Assembly. Schematic representation of our repressive ! active! chromatin chromatin! recent experimental findings: the ATP-dependent chromatin remodeling factors CHD1 and ACF can assemble distinct types of chromatin in vitro, i.e. ACF incorporates the linker histone H1, while CHD1 cannot. These data together with in vivo findings suggest that ACF might play a role in the assembly of repressive chromatin, whereas CHD1 might be important for the assembly of chromatin in transcriptionally active genomic regions.! Molecular Biology! ! mol-biol.i-med.ac.at/wg/molec_microbiol.html Tel.: 0043 (512) 9003.70205 email: [email protected]! Major achievements! Molecular Microbiology Hubertus Haas! Fungi affect the life of mankind positively and negatively. On the one hand, fungi are major players in saprobic decomposition, mutually interact with plants (mycorrhiza), serve directly as food (mushrooms) or in food production (e.g., bread, cheese, alcohol), and produce widely used primary (e.g. citric acid) and secondary metabolites (e.g. penicillin). On the other hand, some fungi are pathogens of plants (e.g. Fusarium spp.) and animals (e.g. Aspergillus fumigatus), or spoil food by contamination or toxin production (e.g. aflatoxin). Therefore, fungi impact ecology, biotechnology, medicine, agriculture and food industry. The best studied fungal organism is Saccharomyces cerevisiae. In several respects, however, the physiology of this yeast is not comparable with that of filamentous fungi (e.g. iron metabolism, light regulation, secondary metabolism). We are mainly interested in the molecular elucidation of the peculiarities of filamentous fungi´s physiology. ! •! Identification of novel fungal iron-regulatory mechanisms ! •! Characterization of fungal mechanisms for iron uptake and storage, in particular the siderophore system! •! Regulatory and structural links of iron homeostatic mechanims and other metabolic pathways, e.g. with pH regulation, ergosterol biosynthesis, hypoxia adaptation! •! first-time in vivo PET-imaging of fungal infections using 68Gallium-labelled siderophores! Future goals! Detailed characterization of the iron homeostasis-maintaining mechanisms of filamentous fungi (in particular of Aspergilli) and applied medical and biotechnological exploitation of the gained knowledge! International collaborators! Elaine Bignell, Dep. Molec. Microbiol. & Infec., Imperial Coll. London, UK; Axel A. Brakhage, Leibniz-Inst. for Natural Product Res. & Infection Biol., F. Schiller Univ. Jena, GER; Robert Cramer. Dept. Microbiology & Immunology, Geisel School of Medicine at Dartmouth, USA; Michael J. Hynes, Dep. Genetics, Univ. Melbourne, AUS; Jean-Paul Latgé, Institut Pasteur, Paris, France; Antonio Di Pietro, Dep. Genetics, Univ. Cordoba, Spain; William C. Nierman, J. Craig Venter Institute, The George Washington Univ., Rockville, MD, USA; Gillian Turgeon, Dep. Plant Pathol., Cornell Univ., Ithaca, USA.! C! A! Our current research focus is the iron/siderophore metabolism of Aspergilli. A. fumigatus is a typical saprobic filamentous ascomycete but also the most common airborne fungal pathogen of humans. It causes allergic and invasive disease depending on the immune system. Unsatisfying diagnostic and therapeutic possibilities are reflected in a high mortality rate. The low-pathogenic relative Aspergillus nidulans represents an established genetic model system.! Both Aspergillus species produce extracellular siderophores (triacetylfusarinine C) for iron acquisition and intracellular siderophores (ferricrocin) for storage and distribution of iron. Siderophore biosynthesis is regulated by two transcription factors, SreA and HapX. Siderophores are central components of the fungal metabolism as they affect germination, sexual and asexual reproduction, oxidative stress resistance and virulence. Lack of siderophore biosynthesis renders A. fumigatus apathogenic. Consequently, the siderophore system represents a novel, attractive target for improvement of antifungal therapy and diagnosis of fungal infections. ! Additional research topics include light regulation, nitrogen metabolism, noncoding RNAs, secondary metabolism (e.g. cephalosporin biosynthesis by Achremonium chrysogenum) and improvement of molecular tools for the manipulation of fungi. ! Our central research goal is to characterize the fungal metabolism and to exploit this knowledge for both improvement of antifungal therapy and diagnosis of fungal infections as well as improvement of the biotechnological potential of fungi.! Group members: Beate Abt, Nicola Beckmann, Michael Blatzer, Mario Gründlinger, Fabio Gsaller, Veronika Klammer, Bea Lechner, Lukas Schafferer, Markus Schrettl! B! Aspergillus fumigatus: A, on plates; B, scanning electron-microscopy of hyphae and conidia (courtesy of K. Pfaller); C, siderophore metabolism.! 87 ! Molecular Biology! ! mol-biol.i-med.ac.at/wg/applied_mycol.html Tel.: 0043 (512) 9003.70207 email: fl[email protected]! International collaborators! Gyula Batta, University of Debrecen, Hungary; Gustavo Goldman, University of Sao Paulo; Brazil; Ulrich Kück, Ruhr-University Bochum, Germany; Vera Meyer, Technical University Berlin, Germany! Applied Mycology Figure 1: Tentative model of the mode of action of the Penicillium chrysogenum antifungal protein PAF in Aspergillus nidulans! Florentine Marx! Filamentous fungi secrete a wide array of different proteins into the external medium where they accomplish most diverse functions, e.g. assimilation of complex nutrients, communication between other fungal cells, interaction between pathogenic fungi and their host and others. Apart from some secreted enzymes which have been developed for a variety of commercial uses (mainly for the fermentation industry), only few extracellular proteins are well characterized with respect to their function as pathogenic factors or as cell signalling factors. ! Our main scientific interest is to identify, isolate and further characterize on the molecular and functional level novel extracellular proteins with antimicrobial activity from Penicillium chrysogenum, Aspergillus nidulans and Aspergillus fumigatus. Anti-microbial proteins are promising candidates for the development of novel therapies applicable in medicine as well as in agriculture and in the food industry to prevent and treat microbial infections. Therefore, the detailed characterization of the mode of action of these proteins is of crucial importance and a prerequisite for the development of new therapeutic approaches and their successful application in the future.! 1! 2! Major research interests! •! Characterization of the mode of action of antimicrobial proteins secreted by filamentous fungi on the molecular and cellular level! •! Identification and characterization of molecular targets in sensitive fungi! •! Localization studies and characterization of endocytotic pathways in fungi! •! Structural biology! •! Determination of the relevance and function of antimicrobial proteins for the producing organisms! Major achievements! Co + PAF! Figure 3:. TEM images of the cellular ultrastructure of A. nidulans in response to PAF treatment compared with the untreated control. The PAF treated sample shows apoptotic marks.! 3! First steps towards biotechnological utilization of antimicrobial proteins and understanding of the structure-function relation! Future goals! Identification of molecular targets for the development of new therapeutic drugs. Characterization of additional celullar functions of antifungal proteins apart from their antimicrobial activity! 88 ! Group members: Doris Bratschun, Laura Burtscher, Sibylle Werth! Figure 2: Fluorescence micrographs showing chitin distribution and hyperbranching of A. nidulans hyphal tips in response to PAF treatement (+PAF) compared with the untreated control (Co)! Co + PAF! Molecular Biology! ! mol-biol.i-med.ac.at/wg/lipocalin_lab.html Tel.: 0043 (512) 9003.70203 email: [email protected]! Major achievements! Lipocalin allergen uptake in dendritic cells! International collaborators! Arne Skerra, TU Munich, Freising-Weihenstephan; Ben J. Glasgow, UCLA School of Medicine, Los Angeles, CA, USA! Lipocalins Bernhard Redl! Structure and Function of Lipocalins and their Cellular Receptors ! Our group investigates structural and functional features of human lipocalins. The protein superfamily of „lipocalins“ consists of small, mainly secretory proteins defined on the basis of conserved amino acid sequence motifs and their common structure. Functionally, they were found to be important extracellular carriers of lipophilic compounds in vertebrates, invertebrates, plants, and bacteria. There is increasing evidence that this group of proteins is involved in a variety of physiological processes including retinoid, fatty acid, and pheromone signaling, immunomodulation, inflammation, detoxification, modulation of growth and metabolism, tissue development, apoptosis, and even behavioral processes. Whereas the structural basis of lipocalin-ligand binding is now well understood, there is a major lack of knowledge regarding the mechanisms by which lipocalins exert their biological effects. This is mainly due to the fact that only limited data are available on lipocalin receptors and lipocalin-receptor interactions, although it is well accepted that many, if not all, of these proteins are able to bind to specific cell receptors.! Current research projects of our lab focus on the following subjects:! A! Figure:! A Structure of Lipocalins ! B Lipocalin receptors! C Cellular targeting of Lipocalins! B! S E Y D P L V M E A V R E Q L F H E R I R E C Y I Q W N Y L R P L S L L V E N S I I I S T I SF P L L A F GA V L L L T L L A I A L L I Y L CT F T C H I F L E L A A I K T N R F V K T A K D P A E E F D T T N S L Y D E R F N I W E A H Y G K Y L N L W K P N D A I V L Y L F V L A S C S Y F S N L M L V W V I S F S G G F I L L V L L L V L L L M P F A T L L M L V C T L P T F F Y T V V M A L G L R E E M S Y V E F R G S G F V A L T G S R K G V G G S L K L •! Identification of cellular lipocalin receptors, characterization of the molecular mechanism of the receptor-ligand interaction and the biological processes beyond receptor binding! •! Evaluation of novel functions of lipocalins in innate immunity and allergy ! E E Q L Y C S A F E E A A D E L V P K L R L L P M A A E D I L L E I H I L A V I L V T G L S L V L L C R G M Q G T S L G Q V C! F D L L R G T D L F G G L F R T S F R N K S L G S F W L G N F V P G F L A A I Y Q I V S S V V L F V L I F Y L L V L Y N A A F L M A C V C V S S V T T L G N G I I V G L C L A L A L A M L F Y L V Q K P S S T T Y Cytosol M F P G A T L L A F T N A D R R V H S Q R L R P R W W A A E S L A I K R R A R F Q Q K G Q H T L E R K D L S A R L Q L P V F P R L P V S G Q S T Q L A L L H T R L R I C E L N P T S C W L P L D M V R Q 89 ! Group members: Sarah Dassati, Petra Merschak, Tamara Staudinger! Molecular Pathophysiology! ! Reinhard Kofler! Director Tel.: 0043 (512) 9003.70360 The Division of Molecular Pathophysiology (DMP) aims at a better molecular understanding of fundamental biological processes with the ultimate goal to apply this knowledge to improve therapy and diagnosis of human diseases. Specifically, we investigate apoptosis (Kofler), cell cycle control (Geley) and proteins interacting with the glucocorticoid receptor (Helmberg). A recent addition to our lab is the Applied Bioinformatics Group (Rainer) that supports our high throughput analyses (mainly performed in Kofler´s group) and the MUIExpression Prolifing Facility which is also attached to the DMP. The work in our Division is supported by grants from the FWF, the MCBO graduate college and various other sources including the Cancer Aid Society and Tyrolean Cancer Research Institute that is headed by RK.! Leukemia Apoptosis Reinhard Kofler! Resistance to anticancer therapy represents a major clinical problem. Glucocorticoids (GC), trigger a suicide program - called apoptosis - in certain benign and malignant lymphoid cells and are therefore used for the therapy of hematological malignancies, most importantly childhood acute lymphoblastic leukemia (ALL). In the Berlin-Frankfurt-Münster (BFM) protocol, children suffering from ALL receive GC for 1 week before being assigned to a polychemotherapy regimen of a risk-dependent intensity.! In most cases, GC treatment results in a remarkable reduction of tumor cells. However, if the patients fail to respond to this therapy they require an intensified chemotherapy. We aim to understand the effects of GC on leukemia cells on a molecular level as well as to identify the various resistance mechanisms. This knowledge should allow us to develop concepts for new therapies. The following research strategies are persued in our division.! 90 ! Group members: Claudia Grubbauer, Katrin Götsch, Barbara Gschirr, Anita Kofler, Armin Krösbacher, Simon Spiegl, Verena Zyka! www.tkfi.at/dmp! email: reinhard.kofl[email protected]! Groups within the Division of Molecular Pathophysiology! •! Leukemia Apoptosis •! Cell Cycle Control •! Molecular Oncology •! Applied Bioinformatics ! ! ! ! ! ! ! ! Reinhard Kofler! Stephan Geley! Arno Helmberg! Johannes Rainer! Glucocorticoid-induced apoptosis! Molecular Pathophysiology! ! www.tkfi.at/dmp/en/research/detail.php?id=2 Identification of candidate genes for the anti-leukemic effects of GC, i.e. determination of the gene expression profile of such cells in the absence or presence of GC, in a clinical setting, i.e. in patients with acute lymphoblastic leukemia (ALL) using whole genome microarray-based expression profiling (performed in our "Expression Profiling Unit“). By inclusion of peripheral blood lymphocytes from GC-exposed non-leukemic donors, GC-sensitive and resistant ALL cell lines and mouse thymocytes, an essentially complete list of GC-regulated candidate genes in clinical settings and experimental systems was generated, allowing immediate analysis of any gene for its potential significance to GC-induced apoptosis.! Advanced microarray technology and deep sequencing. More recently we have embarked in analysing alternative transcripts (via Exon-Array technology), GC receptor binding site definition in the human genome (ChIP-on-CHIP, ChIP-seq), translatome analyses, and microRNA profiling. ! „High throughput“ functional analysis of candidate genes. Our „Applied Bioinformatics Group“ performs complex integrative analyses of the data generated in the various systems and generates lists of candidate genes and pathways that need to be functionally tested for their potential role in GC-induced apoptosis and GC resistance. Since our work suggests multiple pathways leading to these phenomena, many different genes need to be analyzed in different cell line systems. For this we have developed a lentiviral expression system that allows efficient analysis of many genes in multiple cell lines in combinations of up to 4 genes per cell line.! Current results. Defining GC-regulated genes and transcripts in a variety of experimental and clinical systems revealed an unexpected heterogeneity of this response questioning the model system derived conclusions from previous studies. The transcriptional GC response is highly complex including pro- and anti-apoptotic signals that encompass both protein- and microRNA-encoding genes. Moreover, the response differs considerably between the different biological system raising the possibility that multiple pathways may lead to GC-induced apoptosis and GC resistance. Apart from its most apical component, the GC receptor (GR, NR3C1), no key regulator downstream of the GR has thus far been identified in our functional analyses. At least in some systems, GC-induction of BH3-only molecules (like the killer proteins BCL2L11/Bim and BIK) appears to be critical for cell death induction. Additional cell death pathways including metabolic alterations exaggerated by the lack of a negative GR feedback may, however, contribute to this response.! Major achievements! •!Defining the GC-regulated transcriptome in children during systemic GC mono-therapy and numerous other biologically relevant lymphoid systems! •! functional analyses of numerous GC response genes! •! first identification of GC-regulated microRNAs! Future goals! A better delineation of the transcriptional response to glucocorticoids in normal and malignant cells of the lymphoid lineage as it relates to the anti-leukemic and other effects of glucocorticoids and resistance to this substance! .! Major national and international collaborators! •! J.A. Irving, Northern Institute for Cancer Research, Newcastle Upon Tyne! •! H. Kovar, R. Panzer, S. Strehl, St.Anna Kinderspital, Vienna; ! •! J. Penninger, IMBA, Vienna! •! B. Meister, Depertment of Pediatrics, MUI! The Expression Profiling Unit (EPU) of the Innsbruck Medical University (head: Reinhard Kofler) provides a number of services and bioinformatic support related to microarray-based technologies including expression profiling on various Affymetrix arrays and microRNA screening, genomewide detection of DNA-binding proteins (ChIP-on-CHIP technology), etc. The EPU is located at the Division of Molecular Pathophysiology. For further details, please visit the EPU home page ! http://biocenter.i-med.ac.at/ expression-profiling-unit! 91 ! Molecular Pathophysiology! ! www.tkfi.at/dmp/en/research/detail.php?id=3 Tel.: 0043 (512) 9003.70366 email: [email protected]! Molecular Oncology Arno Helmberg ! Research! Having our roots in Reinhard Kofler's lab, we have been searching for proteins interacting with the glucocorticoid receptor (GR). The classical tool to detect low to intermediate affinity protein-protein interactions is the yeast two-hybrid system. In its commonly used form, it makes use of protein–protein interactions to reconstitute a transcription factor necessary for the expression of reporter or selection genes. Although powerful, this system has inherent limitations. Proteins like the GR, containing transactivating domains, cannot be used as bait, as they would directly activate expression of reporter genes independently of an interaction partner. To overcome these limitations, we have modified a specialized, cytoplasmic form of the two-hybrid system developed by A. Aronheim. By tethering the GR to the plasma membrane of the yeast cell, we have been screening a HeLa library for proteins interacting with the receptor. Isolated candidate proteins are then assayed in human cell lines for interaction with the receptor. By doing so, we have isolated ZKSCAN4, a KRAB-containing zinc finger protein that can be coprecipitated with the receptor at normal expression levels of the two proteins. ZKSCAN4 seems to exert a chromatin-dependent inhibitory effect on glucocorticoid receptor-mediated transactivation. For details, please see Ecker et al., J Mol Endocrinol. 42: 105-117 (2009).! Teaching! A large part of my time is devoted to teaching mecidal students in the areas of! •! immunology! •! carcinogenesis! •! pathophysiology of the liver & gastrointestinal system! •! recombinant protein drugs! For these areas, I am providing extensive lecture notes in German and in English to help students keep track of the essential information of the lectures series. These lecture notes are kept up to date and may be freely accessed at my homepage www.helmberg.at! 92 ! Figure 1: Looking for glucocorticoid receptor-interacting proteins. Scanning electron micrograph of a lymphocyte, courtesy of Kristian Pfaller! Major achievements! Identification of ZKSCAN4, a KRAB-containing zinc finger protein, as an interaction partner of the glucocorticoid receptor! In 2010, Professor Helmberg was elected as „Professor of the term“ by the medical students of the 7th semester.! In 2011, Professor Helmberg was nominated and elected as Vicechairman of the Senate of the Medical University of Innsbruck! Molecular Pathophysiology! ! www.tkfi.at/dmp/en/research/detail.php?id=1 Tel.: 0043 (512) 9003.70365 Cell Cycle Control Main aims and projects:! We are interested in the control of metaphase spindle formation, especially the regulation of chromosome movements, the function and regulation of CDKs as well as APC/C-dependent proteolysis in cell cycle regulation and beyond.! •! Function and regulation of the APC/C regulator FZR1 ! •! Functional analysis of microtubule-based motor proteins! •! Functional analysis of CCNY-CDK16 ! •! Development of lentiviral protein overexpression and knockdown vectors! •! Gene targeting by homologous recombination! Cooperations T. Hunt (Cancer Research UK, London); R. Fässler (MPI Martinsried, Munich), ! Group members: Georg Altenbacher, Richard Hilbe,! Raphael Hohlfeld (no picture),! Sylvia Maurer, Hannes Moser, Daniela Reiter, Judith Schweitzer, Giridhar Shivalingaiah, Elisabeth Sparbe (no picture)r, Simon Spiegl! Stephan Geley ! Cellular reproduction relies on the faithful copying and segregation of the genome during defined phases of the cell division cycle, which is controlled by cyclin dependent kinases (CDK). High CDK activity is required for entry into mitosis and formation of the mitotic spindle, a microtubule-based apparatus required for chromosome segregation. Upon formation of the mitotic spindle, CDK activity is downregulated by cyclin proteolysis allowing sister chromatids to disjoin and cells to divide. Proteolysis is controlled by the anaphase promoting complex, a large multisubunit ubiquitin ligase that is active in mitosis, G1-phase as well as in differentiated non-proliferating cells. After exit from mitosis cyclin levels are kept low to prepare for the next round of DNA replication or to provide a window of opportunity for exiting the proliferative state.! P. Meraldi (Univ. Geneva, Switzerland), H. Maiato (Univ. Porto, Portugal)! email: [email protected]! Figure 1: Live cell imaging of kinetochore oscillations (left) and mitotic spindles in control and chromokinesin RNAi cells (right).! Figure 2: In the absence of stable (NDC80) and transient (Spindly) interactions between kinetochores (red) and microtubules (green), chromosomes DNA (blue) is not attached to the mitotic spindl (left: xy view, right: xz view).! Major achievements! Strategies and main technologies! •! FZR1 function in development! •! Role of chromokinesins in mitosis! •! Regulation of CDK16 by CCNY! •! Regulation of Spindly by lipidation! •! In vitro expression cloning! •! Phosphoproteomics! •! Recombineering and GATEWAY technology! •! Lenti- adenoviral gene transduction! •! Lentiviral conditional RNAi! •! Gene targeting in mouse and human cell lines! •! Mouse genetics! •! AAV-mediated gene targeting! •! Gene editing: by TALENs! •! Live cell imaging, microinjection! •! Cell cycle analysis! Future goals! •! FZR1 substrates! •! Regulation of Spindly! •! Regulation of chromokinesins! •! Substrates of CCNY-CDK16! •! Function of CCNY-regulated CDKs! 93 ! Molecular Pathophysiology! Tel.: 0043 (512) 900370961 ! bioinfo.i-med.ac.at/ email: [email protected]! Current projects! •! Applied Bioinformatics Johannes Rainer! Our primary research focus is on transcriptomics where we are particularly interested in the analysis of high density microarray and high throughput sequencing data and the development of new as well as adaptation of established methods for the analysis thereof. In this context we are analysing data sets generated in the Division Molecular Pathophysiology, Leukemia apoptosis group, in order to determine the transcriptional effects of glucocorticoids (GC) in acute lymphoblastic leukemia (ALL) cells and to delineate and understand the treatment responses and resistance mechanisms observed in patients suffering from this disease.! In addition, we provide support for clients and collaboration partners of the Expression Profiling Unit (i.e. the Affymetrix Core Facility of the Innsbruck Medical University) and perform the data analyses of the generated microarray data sets.! •! •! •! Development of methods for the prediction of chromosome and chromosome arm copy number alterations on gene expression microarray data.! Definition of molecular signatures for ALL patients classification and stratification.! Integrative analysis of microarray gene expression data, active glucocorticoid levels and cancer cell counts in ALL patients during initial phase of GC-therapy to identify genes responsible for the treatment effect.! Translatome analysis: genome wide identification of translated and not-translated transcripts in GC treated ALL cells.! Figure 2: Chromosome copy number alterations estimated on gene expression microarray data. Green colouring indicates amplification, red colouring deletions. Chromosomes 8, 10, 14, 18, 21 and X were found to be amplified in the selected patient.! Figure 1: Increasing transcriptional response of ALL cells during GC-treatment. Shown is the significance (y-axis) against extent (x-axis) of differential expression for individual genes. Red points indicate genes with a GC-receptor-DNA interaction in their promoter.! Major collaborators! M. Morgan, Fred Hutchinson Cancer Research Center, Seattle, USA; J.A. Irving, Northern Institute for Cancer Research, Newcastle Upon Tyne, UK; R. Panzer, St.Anna Kinderspital, Vienna; J. Penninger, IMBA, Vienna! 94 ! Group members: Tatsiana Aneichyk, Daniel Bindreither! Major achievements! •! •! •! •! •! Improved pre-processing and differential splicing analysis for Affymetrix Exon microarrays. ! Identification of the transcriptional response in acute lymphoblastic leukemia cells.! Identification of genome-wide GC-receptor-DNA interactions in two ALL cell systems.! Identification of a novel transcript variant of the gene ZBTB16 induced by GC treatment in BALL cells.! Various software packages for the analysis of biological data (including Bioconductor packages maDB and pgUtils).! Neurobiochemistry! Christine Bandtlow! ! www.i-med.ac.at/ imcbc/neurobiochemistry/ Tel.: 0043 (512) 9003.70281 email: [email protected]! Director ! Neurobiochemistry Christine Bandtlow! Groups within the Division of Neurobiochemistry! The lab is primarily interested in delineating the physiological functions of reticulon proteins (RTN) and their signaling molecules in the nervous system. Related to their association with the ER, RTN proteins have been suggested to play a role in the regulation of intracellular trafficking of proteins involved in exo- and endocytosis, but their precise cellular functions remain unknown. Although many RTN isoforms show distinct expression patterns in the CNS and PNS - both in the developing and mature nervous system – RTN4-A/Nogo, is the only RTN member with a defined function in the adult brain. Nogo-A was originally identified as a myelin-derived inhibitor of neurite outgrowth and has been implicated as a major factor preventing neuronal regeneration and compensatory sprouting in the adult CNS. Over the past few years, considerable progress has been made in our understanding of the structure-function relationship of Nogo-A, its axonal receptors, and the intracellular signaling cascades mediating inhibition of axon outgrowth. However its physiological significance as an intracellular protein of neurons is unknown. ! Neurobiochemistry! Neurotoxicity! Christine Bandtlow! Gabriele Baier-Bitterlich! Recent studies in our lab highlight novel functions of RTN-4A/Nogo-A and other RTN isoforms as important intracellular regulators of axonal and dendritic morphogenesis in vitro and in vivo. Present aims are to unravel the molecular mechanisms that mediate these effects and to analyse proteins that specifically interact with neuronally expressed RTN proteins. In addition, we use several knockout mouse model systems to explore and define the role of the Nogo receptor components p75NTR and NgR in normal and diseased brains.! Major achievements! Identification of of RyR2 as a novel interaction partner of RTN1 in neurons! Identification of VersicanV0/V1 as a specific NgR2 ligand that controls epidermal innervation! Future goals! Characterization of the physiological function of RTN protein interactions in neurons! Group members: Bastian Bäumer, Augustine Boima, Sarah Borrie,! Isabell Gehring, Levent Kaya, Antje Kurz, Rüdiger Schweigreiter, Sandra Trojer! International collaborators! Mathias Klugmann, University of New South Wales, Sidney, AUS; Martin Korte, Marta Zagrebelsky,TU Braunschweig, Germany; Paul Lingor, Univ. Göttingen, Germany; Dieter Zimmermann, Univ. Zurich, Switzerland! 95 ! Neurobiochemistry! ! http://www.i-med.ac.at/neurobiochemistry/neurobiochemistry/Biooptics/Main.html Tel.: 0043 (512) 9003.70287 Biooptics/Microscopy ! Figure 1: Isosurface reconstruction (cyan) of a U2OS cell nucleus (green) in close contact with IGFBP3 positive vesicles (red). ! Figure 2: Orthoslice of a plant‘s cells with cell wall (red) and chloroplasts (green). ! Software support is offered at various levels, from basic user training to complex interactive and collaborative calculations. We currently officially support Fiji (ImageJ), CellProfiler and MATLAB. Moreover, we have licensed a server-based deconvolution software package (Huygens Professional), which enables improvement of the resolution of light microscopic images, including spinning disk images of the new iMIC. All users can get access to the server via their local PCs using auxiliary software. Moreover, we are running a 3D image analysis software (Imaris) allowing for challenging interactive 3D image analyses. In general, the software is mainly employed for 3D analysis of confocal images, isosurface renderings and advanced movies. ! Microscopy related teaching is offered in several PhD programmes and prior to independent usage of any microscope all users recieve an instrument-specific training. ! For all scientific equipment within the core facility biooptics (microscopes), an improved on-line booking system has been established in 2012 in order to ensure easy and fair access for all users.! ! ! email: [email protected]! Martin Offterdinger! The MUI Biooptics/microscopy facility, implemented in 2009 at the Division of Neurobiochemistry,# aims at providing university-wide access to advanced equipment, training, education and expertise in light microscopy to all scientists on the campus. We currently offer assisted access to research microscopes and image processing software. ! Presently, we are harbouring 2 laser scanning confocal microscopes (Leica SP5, Zeiss, LSM510 Meta), and (since 08/2012) one novel multifunctional microscope (Till, iMIC) for live cell imaging, which is equipped for TIRF, spinning disk, FRAP and calcium imaging. We have integrated a number of existing microscopes after the movement into the new biocenter, such as 2 widefield microscopes and a widefield screening system. Access to an integrated stereology microscope/software system for neuron tracing (Neurolucida) is offered in collaboration with the Department of Pharmacology.! 96 ! Future goals! We plan to upgrade the SP5 confocal microscope with more sensitive detectors in the near future.! Neurobiochemistry! Tel.: 0043 (512) 9003.70289 email: [email protected]! Hypoxia! Ischemia! 45./61+789:;'(1+ Major achievements! !-',/91,' 2345#$67!896708967*: Gabriele Baier-Bitterlich! To reduce apoptosis in the brain is central to functional recovery after stroke. Present research is focused on the development of drugs that block the apoptotic process, hoping to improve clinical outcome. The purine nucleoside adenosine is produced and released in the central nervous system in response to ischemia and hypoxia. It acts as a powerful endogenous neuroprotectant during ischemia-induced energy failure, by decreasing neuronal metabolism and increasing cerebral blood flow. Purine nucleosides interact specifically with several different purinoceptors (A1, A2, A3, A2B) in the figure to the right) and thereby induce several distinct intercellular signaling pathways. This is particularly the case in the brain, which expresses high concentrations of purinoceptors. Activation of adenosine receptors and stimulation of their downstream signaling functions were hypothesized to result in an effective treatment of stroke. ! Previous results in this laboratory demonstrated the positive impact of the purine nucleosides adenosine, inosine and guanosine on viability and neurite outgrowth of neuronal PC12 cells and on primary rat cerebellar granule neurons. Our data on the activation and potential causal roles of p42/p44 mitogen-activated kinases (alias ERK1/2) and hypoxia-inducible transcription factor-1 (HIF1-alpha) in these pathways supported the investigation of the molecular effector pathways of MAPK/HIF1-alpha in purine nucleoside-mediated signaling leading to regeneration and/or survival of neurons.! !$# !%# %'()*+,' -'./0+*12+31/, #A !$# &$# !%# &%# >53/-'93*<:31?' ',25('9 @*''=*+-1:+09 #<*1,'=,<:0'/91-'9 !-',/91,' &<+,/91,' 8,/91,' '0 0= - '+ 3; ,-).#%&'"# +(/$&*%(+#( #A A'<*/3*+,9(133'* >+BC > #A !"#$%&'$# (#)#*+%( 0-/$%&'$# (#)#*+%(1 D1.1.'*/61-+31/, D'<E/:53'9 #*/1,F0+((+3/*5 :53/E1,'9 A ' < * / . */ 3 ' : 31 / , 1/ , Neurotoxicity !"# 8,F 0+ ( ( +3 Figure 1: Biochemistry of ischemia-reperfusion injury. Hypoxic-ischemic brain injury starts with the insult but extends into a recovery-reperfusion period. In parallel, hypoxia leads to the decreased production and enhanced breakdown of purine nucleotides to purine nucleosides (PN), which may enter cells via bidirectional nucleoside transporters (ENTs) or, in the case of adenosine and inosine, directly bind to adenosine receptors (data and references cited in Thauerer et al, 2012).! Hoechst/PI! •! Establishment of positive effect of purine nucleosides on viability and neurite outgrowth and of the special role of p42/44 MAPK and HIF-1alpha.! •! FWF project 19578-B05, Hertha-Firnberg fellowship (B.Thauerer)! Future goals! Analysis of p42/44 MAPK activation and substrates in purine-mediated protection! International collaborators! Figure 2.: Hypoxic cell death of cerebellar granule neurons! Michail Sitkovsky, Dana-Farber Cancer Institute, Boston, USA! 97 ! ! Group member: Bettina Thauerer (former Tomaselli) The Biocenter! Publications 2010! Original Articles! Abdelmoez, AA.; Thurner, GC.; Wallnofer, EA.; Klammsteiner, N.; Kremser, C.; Talasz, H.; Mrakovcic, M.; Frohlich, E.; Jaschke, W.; Debbage, P.: Albumin-based nanoparticles as magnetic resonance contrast agents: II. Physicochemical characterisation of purified and standardised nanoparticles. HISTOCHEMISTRY AND CELL BIOLOGY. 2010; 134(2); 171-196.IIF: 4.727! Albrecht, K.; Greindl, M.; Deutel, B.; Kremser, C.; Wolf, C.; Talasz, H.; Stollenwerk, MM.; Debbage, P.; Bernkop-Schnurch, A.: In Vivo Investigation of Thiomer-Polyvinylpyrrolidon Nanoparticles Using Magnetic Resonance Imaging. JOURNAL OF PHARMACEUTICAL SCIENCES. 2010; 99(4); 2008-2017. IF: 3.031! Aryee, DNT.; Niedan, S.; Kauer, M.; Schwentner, R.; Bennani-Baiti, IM.; Ban, J.; Muehlbacher, K.; Kreppel, M.; Walker, RL.; Meltzer, P.; Poremba, C.; Kofler, R.; Kovar, H.: Hypoxia Modulates EWSFLI1 Transcriptional Signature and Enhances the Malignant Properties of Ewing's Sarcoma Cells In vitro. CANCER RESEARCH. 2010; 70(10); 4015-4023. IF: 8.234! Barisic, M.; Sohm, B.; Mikolcevic, P.; Wandke, C.; Rauch, V.; Ringer, T.; Hess, M.; Bonn, G.; Geley, S.: Spindly/CCDC99 is required for efficient chromosome congression and mitotic checkpoint regulation. MOLECULAR BIOLOGY OF THE CELL. 2010; 21(12); 1968-1981. IF: 5.861! Bauer, I.; Graessle, S.; Loidl, P.; Hohenstein, K.; Brosch, G.: Novel insights into the functional role of three protein arginine methyltransferases in Aspergillus nidulans. FUNGAL GENETICS AND BIOLOGY. 2010; 47(6); 551-561. IF: 3.333! 98 ! Binder, U.; Chu, ML.; Read, ND.; Marx, F.: The Antifungal Activity of the Penicillium chrysogenum Protein PAF Disrupts Calcium Homeostasis in Neurospora crassa. EUKARYOTIC CELL. 2010; 9(9); 1374-1382. IF: 3.395! Binder, U.; Oberparleiter, C.; Meyer, V.; Marx, F.: The antifungal protein PAF interferes with PKC/ MPK and cAMP/PKA signalling of Aspergillus nidulans. MOLECULAR MICROBIOLOGY. 2010; 75 (2); 294-307. IF: 4.819! Bogner-Strauss, JG.; Prokesch, A.; Sanchez-Cabo, F.; Rieder, D.; Hackl, H.; Duszka, K.; Krogsdam, A.; Di Camillo, B.; Walenta, E.; Klatzer, A.; Lass, A.; Pinent, M.; Wong, WC.; Eisenhaber, F.; Trajanoski, Z.: Reconstruction of gene association network reveals a transmembrane protein required for adipogenesis and targeted by PPAR gamma. CELLULAR AND MOLECULAR LIFE SCIENCES. 2010; 67(23); 4049-4064. IF: 7.047! Carlet, M.; Janjetovic, K.; Rainer, J.; Schmidt, S.; Panzer-Grumayer, R.; Mann, G.; Prelog, M.; Meister, B.; Ploner, C.; Kofler, R.: Expression, regulation and function of phosphofructo-kinase/ fructose-biphosphatases (PFKFBs) in glucocorticoid-induced apoptosis of acute lymphoblastic leukemia cells. BMC CANCER. 2010; 10(10); 638. IF: 3.153! Castellano, S.; Milite, C.; Ragno, R.; Simeoni, S.; Mai, A.; Limongelli, V.; Novellino, E.; Bauer, I.; Brosch, G.; Spannhoff, A.; Cheng, DH.; Bedford, MT.; Sbardella, G.: Design, Synthesis and Biological Evaluation of Carboxy Analogues of Arginine Methyltransferase Inhibitor 1 (AMI-1). CHEMMEDCHEM. 2010; 5(3); 398-414. IF: 3.306! Bechter, K.; Reiber, H.; Herzog, S.; Fuchs, D.; Tumani, H.; Maxeiner, HG.: Cerebrospinal fluid analysis in affective and schizophrenic spectrum disorders: Identification of subgroups with immune responses and blood-CSF barrier dysfunction. JOURNAL OF PSYCHIATRIC RESEARCH. 2010; 44 (5); 321-330. IF: 3.827! Chamilos, G.; Bignell, EM.; Schrettl, M.; Lewis, RE.; Leventakos, K.; May, GS.; Haas, H.; Kontoyiannis, DP.: Exploring the concordance of Aspergillus fumigatus pathogenicity in mice and Toll-deficient flies. MEDICAL MYCOLOGY. 2010; 48(3); 506-510. IF: 2.329! Bellmann-Weiler, R.; Martinz, V.; Kurz, K.; Engl, S.; Feistritzer, C.; Fuchs, D.; Rupp, J.; Paldanius, M.; Weiss, G.: Divergent modulation of Chlamydia pneumoniae infection cycle in human monocytic and endothelial cells by iron, tryptophan availability and interferon gamma. IMMUNOBIOLOGY. 2010; 215(9-10); 842-848. IF: 4.114 ! Chavele, KM.; Shukla, D.; Keteepe-Arachi, T.; Seidel, JA.; Fuchs, D.; Pusey, CD.; Salama, AD.: Regulation of Myeloperoxidase-Specific T Cell Responses During Disease Remission in Antineutrophil Cytoplasmic Antibody-Associated Vasculitis The Role of Treg Cells and Tryptophan Degradation. ARTHRITIS AND RHEUMATISM. 2010; 62(5); 1539-1548. IF: 8.435! Berger, R.; Fiegl, H.; Goebel, G.; Obexer, P.; Ausserlechner, M.; Doppler, W.; Hauser-Kronberger, C.; Reitsamer, R.; Egle, D.; Reimer, D.; Muller-Holzner, E.; Jones, A.; Widschwendter, M.: Toll-like receptor 9 expression in breast and ovarian cancer is associated with poorly differentiated tumors. CANCER SCIENCE. 2010; 101(4); 1059-1066. IF: 3.846! Chirkova, A.; Erlacher, MD.; Clementi, N.; Zywicki, M.; Aigner, M.; Polacek, N.: The role of the universally conserved A2450-C2063 base pair in the ribosomal peptidyl transferase center. NUCLEIC ACIDS RESEARCH. 2010; 38(14); 4844-4855. IF: 7.836! The Biocenter! Publications 2010! Ciprandi, G.; De Amici, M.; Marseglia, G.; Fuchs, D.: Sublingual immunotherapy may affect serum neopterin: Preliminary findings. INTERNATIONAL IMMUNOPHARMACOLOGY. 2010; 10(11); 1474-1476. IF: 2.325! Ciprandi, G.; De Amici, M.; Tosca, M.; Fuchs, D.: Tryptophan metabolism in allergic rhinitis: The effect of pollen allergen exposure. HUMAN IMMUNOLOGY. 2010; 71(9); 911-915. IF: 2.872 ! Clementi, N.; Chirkova, A.; Puffer, B.; Micura, R.; Polacek, N.: Atomic mutagenesis reveals A2660 of 23S ribosomal RNA as key to EF-G GTPase activation. NATURE CHEMICAL BIOLOGY. 2010; 6 (5); 344-351. IF: 15.808! Diez-Ruiz, A.; Garcia-Saura, PL.; Garcia-Ruiz, P.; Gonzalez-Calvin, JL.; Gallego-Rojo, F.; Fuchs, D.: Bone Mineral Density, Bone Turnover Markers and Cytokines in Alcohol-Induced Cirrhosis. ALCOHOL AND ALCOHOLISM. 2010; 45(5); 427-430. IF: 2.599! Domokos, M.; Jakus, J.; Szeker, K.; Csizinszky, R.; Csiko, G.; Neogrady, Z.; Csordas, A.; Galfi, P.: Butyrate-Induced Cell Death and Differentiation Are Associated with Distinct Patterns of ROS in HT29-Derived Human Colon Cancer Cells. DIGESTIVE DISEASES AND SCIENCES. 2010; 55(4); 920-930. IF: 2.060! Eden, A.; Fuchs, D.; Hagberg, L.; Nilsson, S.; Spudich, S.; Svennerholm, B.; Price, RW.; Gisslen, M.: HIV-1 Viral Escape in Cerebrospinal Fluid of Subjects on Suppressive Antiretroviral Treatment. JOURNAL OF INFECTIOUS DISEASES. 2010; 202(12); 1819-1825. IF: 6.288! Engin, AB.; Ozkan, Y.; Fuchs, D.; Yardim-Akaydin, S.: Increased tryptophan degradation in patients with bronchus carcinoma. EUROPEAN JOURNAL OF CANCER CARE. 2010; 19(6); 803-808. IF: 1.138! Freissmuth, D.; Hiltgartner, A.; Stahl-Hennig, C.; Fuchs, D.; Tenner-Racz, K.; Racz, P.; Uberla, K.; Strasak, A.; Dierich, MP.; Stoiber, H.; Falkensammer, B.: Analysis of humoral immune responses in rhesus macaques vaccinated with attenuated SIVmac239 Delta nef and challenged with pathogenic SIVmac251. JOURNAL OF MEDICAL PRIMATOLOGY. 2010; 39(2); 97-111. IF: 0.862! Frenzel, A.; Labi, V.; Chmelewskij, W.; Ploner, C.; Geley, S.; Fiegl, H.; Tzankov, A.; Villunger, A.: Suppression of B-cell lymphomagenesis by the BH3-only proteins Bmf and Bad. " BLOOD. 2010; 115(5); 995-1005. IF: 10.558! Garczarczyk, D.; Szeker, K.; Galfi, P.; Csordas, A.; Hofmann, J.: Protein kinase C gamma in colon cancer cells: Expression, Thr(514) phosphorylation and sensitivity to butyrate-mediated upregulation as related to the degree of differentiation. HEMICO-BIOLOGICAL INTERACTIONS. 2010; 185(1); 25-32. IF: 2.832! Gourcilleau, D.; Bogeat-Triboulot, MB.; Le Thiec, D.; Lafon-Placette, C.; Delaunay, A.; Abu ElSoud, W.; Brignolas, F.; Maury, S.: DNA methylation and histone acetylation: genotypic variations in hybrid poplars, impact of water deficit and relationships with productivity. ANNALS OF FOREST SCIENCE. 2010; 67(2); IF: 1.326 ! Graber, D.; Moroder, H.; Steger, J.; Trappl, K.; Polacek, N.; Micura, R.: Reliable semi-synthesis of hydrolysis-resistant 3'-peptidyl-tRNA conjugates containing genuine tRNA modifications. NUCLEIC ACIDS RESEARCH. 2010; 38(19); 6796-6802. IF: 7.836! Greilberger, J.; Fuchs, D.; Leblhuber, F.; Greilberger, M.; Wintersteiger, R.; Tafeit, E.: Carbonyl Proteins as a Clinical Marker in Alzheimer's Disease and its Relation to Tryptophan Degradation and Immune Activation. CLINICAL LABORATORY. 2010; 56(9-10); 441-448. IF: 0.827! Grespi, F.; Soratroi, C.; Krumschnabel, G.; Sohm, B.; Ploner, C.; Geley, S.; Hengst, L.; Hacker, G.; Villunger, A.: BH3-only protein Bmf mediates apoptosis upon inhibition of CAP-dependent protein synthesis. CELL DEATH AND DIFFERENTIATION. 2010; 17(11); 1672-1683. IF: 9.050! Grundtman, C.; Bruton, J.; Yamada, T.; Ostberg, T.; Pisetsky, DS.; Harris, HE.; Andersson, U.; Lundberg, IE.; Westerblad, H.: Effects of HMGB1 on in vitro responses of isolated muscle fibers and functional aspects in skeletal muscles of idiopathic inflammatory myopathies. FASEB JOURNAL. 2010; 24(2); 570-578. IF: 6.515! Hackl, H.; Rommer, A.; Konrad, TA.; Nassimbeni, C.; Wieser, R.: Tetracycline Regulator Expression Alters the Transcriptional Program of Mammalian Cells. ! PLOS ONE. 2010; 5(9); IF: 4.411! Hagenbuchner, J.; Ausserlechner, MJ.; Porto, V.; David, R.; Meister, B.; Bodner, M.; Villunger, A.; Geiger, K.; Obexer, P.: The Anti-apoptotic Protein BCL2L1/Bcl-xL Is Neutralized by Pro-apoptotic PMAIP1/Noxa in Neuroblastoma, Thereby Determining Bortezomib Sensitivity Independent of Prosurvival MCL1 Expression. JOURNAL OF BIOLOGICAL CHEMISTRY. 2010; 285(10); 6904-6912. IF: 5.328! 99 ! The Biocenter! Publications 2010! Jenny, M.; Pedersen, NR.; Hidayat, BJ.; Schennach, H.; Fuchs, D.: Bovine colostrum modulates immune activation cascades in human peripheral blood mononuclear cells in vitro. " NEW MICROBIOLOGICA. 2010; 33(2); 129-135. IF: 0.688! Labi, V.; Erlacher, M.; Krumschnabel, G.; Manzl, C.; Tzankov, A.; Pinon, J.; Egle, A.; Villunger, A.: Apoptosis of leukocytes triggered by acute DNA damage promotes lymphoma formation. GENES & DEVELOPMENT. 2010; 24(15); 1602-1607. IF: 12.889! Jurgens, B.; Fuchs, D.; Reichenbach, J.; Heitger, A.: Intact indoleamine 2,3-dioxygenase activity in human chronic granulomatous disease. CLINICAL IMMUNOLOGY. 2010; 137(1); 1-4. IF: 3.932! Labi, V.; Villunger, A.: PUMA-mediated tumor suppression A tale of two stories. CELL CYCLE. 2010; 9(21); 4269-4275. IF: 4.999! Karlberg, M.; Ekoff, M.; Labi, V.; Strasser, A.; Huang, D.; Nilsson, G.: Pro-apoptotic Bax is the major and Bak an auxiliary effector in cytokine deprivation-induced mast cell apoptosis. CELL DEATH & DISEASE. 2010; 1(8); e43. IF: 0.000! Laschober, GT.; Ruli, D.; Hofer, E.; Muck, C.; Carmona-Gutierrez, D.; Ring, J.; Hutter, E.; Ruckenstuhl, C.; Micutkova, L.; Brunauer, R.; Jamnig, A.; Trimmel, D.; Herndler-Brandstetter, D.; Brunner, S.; Zenzmaier, C.; Sampson, N.; Breitenbach, M.; Frohlich, KU.; Grubeck-Loebenstein, B.; Berger, P.; Wieser, M.; Grillari-Voglauer, R.; Thallinger, GG.; Grillari, J.; Trajanoski, Z.; Madeo, F.; Lepperdinger, G.; Jansen-Durr, P.: Identification of evolutionarily conserved genetic regulators of cellular aging. AGING CELL. 2010; 9(6); 1084-1097. IF: 7.148! Keller, MA.; Watschinger, K.; Golderer, G.; Maglione, M.; Sarg, B.; Lindner, HH.; Werner-Felmayer, G.; Terrinoni, A.; Wanders, RJA.; Werner, ER.: Monitoring of fatty aldehyde dehydrogenase by formation of pyrenedecanoic acid from pyrenedecanal. JOURNAL OF LIPID RESEARCH. 2010; 51 (6); 1554-1559. IF: 6.115! Kloss-Brandstätter, Anita; Schäfer, Georg; Erhart, Gertraud; Hüttenhofer, Alexander; Coassin, Stefan; Seifarth, Christof; Summerer, Monika; Bektic, Jasmin; Klocker, Helmut; Kronenberg, Florian: Somatic mutations throughout the entire mitochondrial genome are associated with elevated PSA levels in prostate cancer patients. AMERICAN JOURNAL OF HUMAN GENETICS. 2010; 87(6); 802-812. IF: 11.680! Koenig, P.; Nagl, C.; Neurauter, G.; Schennach, H.; Brandacher, G.; Fuchs, D.: Enhanced degradation of tryptophan in patients on hemodialysis. CLINICAL NEPHROLOGY. 2010; 74(6); 465-470. IF: 1.058! Kravchenko, O.; Mitroshin, I.; Nikonov, S.; Piendl, W.; Garber, M.: Structure of a Two-Domain NTerminal Fragment of Ribosomal Protein L10 from Methanococcus jannaschii Reveals a Specific Piece of the Archaeal Ribosomal Stalk. JOURNAL OF MOLECULAR BIOLOGY. 2010; 399(2); 214-220. IF: 4.008! Krumschnabel, G.; Ebner, HL.; Hess, MW.; Villunger, A.: Apoptosis and necroptosis are induced in rainbow trout cell lines exposed to cadmium. " AQUATIC TOXICOLOGY. 2010; 99(1); 73-85. IF: 3.333! Kurz, K.; Gluhcheva, Y.; Zvetkova, E.; Konwalinka, G.; Fuchs, D.: Interferon-gamma-mediated pathways are induced in human CD34(+) haematopoietic stem cells. IMMUNOBIOLOGY. 2010; 215(6); 452-457. IF: 4.114! 100 ! Maglione, M.; Oberhuber, R.; Cardini, B.; Watschinger, K.; Hermann, M.; Obrist, P.; Hengster, P.; Mark, W.; Schneeberger, S.; Werner-Felmayer, G.; Pratschke, J.; Margreiter, R.; Werner, ER.; Brandacher, G.: Donor Pretreatment with Tetrahydrobiopterin Saves Pancreatic Isografts from Ischemia Reperfusion Injury in a Mouse Model. AMERICAN JOURNAL OF TRANSPLANTATION. 2010; 10(10); 2231-2240. IF: 6.051! Maier, E.; Kurz, K.; Jenny, M.; Schennach, H.; Ueberall, F.; Fuchs, D.: Food preservatives sodium benzoate and propionic acid and colorant curcumin suppress Th1-type immune response in vitro. FOOD AND CHEMICAL TOXICOLOGY. 2010; 48(7); 1950-1956. IF: 2.602! Mansha, M.; Carlet, M.; Ploner, C.; Gruber, G.; Wasim, M.; Wiegers, GJ.; Rainer, J.; Geley, S.; Kofler, R.: Functional analyses of Src-like adaptor (SLA), a glucocorticoid-regulated gene in acute lymphoblastic leukemia. LEUKEMIA RESEARCH. 2010; 34(4); 529-534. IF: 2.555 ! Mayersbach, P.; Fuchs, D.; Schennach, H.: Performance of a fully automated quantitative neopterin measurement assay in a routine voluntary blood donation setting. CLINICAL CHEMISTRY AND LABORATORY MEDICINE. 2010; 48(3); 373-377. IF: 2.069! Melichar, V.; Soelder, E.; Schroecksnadel, K.; Murr, C.; Arck, P.; Wildt, L.; Fuchs, D.: Urine neopterin concentrations as a marker for successful blastocyst implantation after assisted reproductive technologies. REPRODUCTIVE BIOMEDICINE ONLINE. 2010; 20(5); 694-698. IF: 2.285! The Biocenter! Publications 2010! Merkel, O.; Hamacher, F.; Laimer, D.; Sifft, E.; Trajanoski, Z.; Scheideler, M.; Egger, G.; Hassler, MR.; Thallinger, C.; Schmatz, A.; Turner, SD.; Greil, R.; Kenner, L.: Identification of differential and functionally active miRNAs in both anaplastic lymphoma kinase (ALK)(+) and ALK(-) anaplastic large-cell lymphoma. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 2010; 107(37); 16228-16233. IF: 9.771! Pafundo, DE.; Alvarez, CL.; Krumschnabel, G.; Schwarzbaum, PJ.: A Volume Regulatory Response Can Be Triggered by Nucleosides in Human Erythrocytes, a Perfect Osmometer No Longer. JOURNAL OF BIOLOGICAL CHEMISTRY. 2010; 285(9); 6134-6144. IF: 5.328! Moheno, P.; Morrey, J.; Fuchs, D.: Effect of dipterinyl calcium pentahydrate on hepatitis B virus replication in transgenic mice. JOURNAL OF TRANSLATIONAL MEDICINE. 2010; 8(6); IF: 3.508! Parajuli, N.; Muller-Holzner, E.; Bock, G.; Werner, ER.; Villunger, A.; Doppler, W.: Infiltrating CD11b (+)CD11c(+) cells have the potential to mediate inducible nitric oxide synthase-dependent cell death in mammary carcinomas of HER-2/neu transgenic mice. INTERNATIONAL JOURNAL OF CANCER. 2010; 126(4); 896-908. IF: 4.926! Mohien, CU.; Hartler, J.; Breitwieser, F.; Rix, U.; Rix, LR.; Winter, GE.; Thallinger, GG.; Bennett, KL.; Superti-Furga, G.; Trajanoski, Z.; Colinge, J.: MASPECTRAS 2: An integration and analysis platform for proteomic data. PROTEOMICS. 2010; 10(14); 2719-2722. IF: 4.815! Petrik, M.; Haas, H.; Dobrozemsky, G.; Lass-Florl, C.; Helbok, A.; Blatzer, M.; Dietrich, H.; Decristoforo, C.: Ga-68-Siderophores for PET Imaging of Invasive Pulmonary Aspergillosis: Proof of Principle. JOURNAL OF NUCLEAR MEDICINE. 2010; 51(4); 639-645. IF: 7.022! Morandell, S.; Grosstessner-Hain, K.; Roitinger, E.; Hudecz, O.; Lindhorst, T.; Teis, D.; Wrulich, OA.; Mazanek, M.; Taus, T.; Ueberall, F.; Mechtler, K.; Huber, LA.: QIKS - Quantitative identification of kinase substrates. PROTEOMICS. 2010; 10(10); 2015-2025. IF: 4.815! Pircher, H.; Matscheski, A.; Laich, A.; Hermann, M.; Moser, B.; Viertler, HP.; Micutkova, L.; Lindner, H.; Sarg, B.; Zwerschke, W.; Jansen-Durr, P.: A new method for the purification of bioactive insulinlike growth factor-binding protein-3. PROTEIN EXPRESSION AND PURIFICATION. 2010; 71(2); 160-167. IF: 1.644! Muhlmann, G.; Untergasser, G.; Zitt, M.; Zitt, M.; Maier, H.; Mikuz, G.; Kronberger, IE.; Haffner, MC.; Gunsilius, E.; Ofner, D.: Immunohistochemically detectable dickkopf-3 expression in tumor vessels predicts survival in gastric cancer. VIRCHOWS ARCHIV. 2010; 456(6); 635-646. IF: 2.336! Ploder, M.; Kurz, K.; Spittler, A.; Neurauter, G.; Roth, E.; Fuchs, D.: Early Increase of Plasma Homocysteine in Sepsis Patients with Poor Outcome. MOLECULAR MEDICINE. 2010; 16(11-12); 498-504. IF: 5.908! Nazarenko, I.; Jenny, M.; Keil, J.; Gieseler, C.; Weisshaupt, K.; Sehouli, J.; Legewie, S.; Herbst, L.; Weichert, W.; Darb-Esfahani, S.; Dietel, M.; Schafer, R.; Ueberall, F.; Sers, C.: Atypical Protein Kinase C zeta Exhibits a Proapoptotic Function in Ovarian Cancer. MOLECULAR CANCER RESEARCH. 2010; 8(6); 919-934. IF: 4.373 ! Podhraski, V.; Campo-Fernandez, B.; Worle, H.; Piatti, P.; Niederegger, H.; Bock, G.; Fyodorov, DV.; Lusser, A.: CenH3/CID Incorporation Is Not Dependent on the Chromatin Assembly Factor CHD1 in Drosophila. PLOS ONE. 2010; 5(4); IF: 4.411! Orth, D.; Ehrlenbach, S.; Brockmeyer, J.; Khan, AB.; Huber, G.; Karch, H.; Sarg, B.; Lindner, H.; Wurzner, R.: EspP, a Serine Protease of Enterohemorrhagic Escherichia coli, Impairs Complement Activation by Cleaving Complement Factors C3/C3b and C5. INFECTION AND IMMUNITY. 2010; 78(10); 4294-4301. IF: 4.098! Radford, DJ.; Wang, KQ.; McNelis, JC.; Taylor, AE.; Hechenberger, G.; Hofmann, J.; Chahal, H.; Arlt, W.; Lord, JM.: Dehdyroepiandrosterone Sulfate Directly Activates Protein Kinase C-beta to Increase Human Neutrophil Superoxide Generation. MOLECULAR ENDOCRINOLOGY. 2010; 24 (4); 813-821. IF: 4.889! Ott, HW.; Griesmacher, A.; Schnapka-Koepf, M.; Golderer, G.; Sieberer, A.; Spannagl, M.; Scheibe, B.; Perkhofer, S.; Will, K.; Budde, U.: Analysis of von Willebrand Factor Multimers by Simultaneous High- and Low-Resolution Vertical SDS-Agarose Gel Electrophoresis and Cy5-Labeled Antibody High-Sensitivity Fluorescence Detection. AMERICAN JOURNAL OF CLINICAL PATHOLOGY. 2010; 133(2); 322-330. IF: 2.506! Rederstorff, M.; Bernhart, SH.; Tanzer, A.; Zywicki, M.; Perfler, K.; Lukasser, M.; Hofacker, IL.; Huttenhofer, A.: RNPomics: Defining the ncRNA transcriptome by cDNA library generation from ribonucleo-protein particles. NUCLEIC ACIDS RESEARCH. 2010; 38(10); e113. IF: 7.836! Ruemmele, FM.; Muller, T.; Schiefermeier, N.; Ebner, HL.; Lechner, S.; Pfaller, K.; Thoni, CE.; Goulet, O.; Lacaille, F.; Schmitz, J.; Colomb, V.; Sauvat, F.; Revillon, Y.; Canioni, D.; Brousse, N.; de Saint-Basile, G.; Lefebvre, J.; Heinz-Erian, P.; Enninger, A.; Utermann, G.; Hess, MW.; Janecke, AR.; Huber, LA.: Loss-of-Function of MYO5B is the Main Cause of Microvillus Inclusion Disease: 15 Novel Mutations and a CaCo-2 RNAi Cell Model. HUMAN MUTATION. 2010; 31(5); 544-551. IF: 5.956! 101 ! The Biocenter! Publications 2010! Santidrian, AF.; Gonzalez-Girones, DM.; Iglesias-Serret, D.; Coll-Mulet, L.; Cosialls, AM.; de Frias, M.; Campas, C.; Gonzalez-Barca, E.; Alonso, E.; Labi, V.; Viollet, B.; Benito, A.; Pons, G.; Villunger, A.; Gil, J.: AICAR induces apoptosis independently of AMPK and p53 through up-regulation of the BH3-only proteins BIM and NOXA in chronic lymphocytic leukemia cells. BLOOD. 2010; 116(16); 3023-3032. IF: 10.558! Skvortsova, I.; Skvortsov, S.; Raju, U.; Stasyk, T.; Riesterer, O.; Schottdorf, EM.; Popper, BA.; Schiestl, B.; Eichberger, P.; Debbage, P.; Neher, A.; Bonn, GK.; Huber, LA.; Milas, L.; Lukas, P.: Epithelial-to-mesenchymal transition and c-myc expression are the determinants of cetuximabinduced enhancement of squamous cell carcinoma radioresponse. RADIOTHERAPY AND ONCOLOGY. 2010; 96(1); 108-115. IF: 4.337! Schachner, T.; Golderer, G.; Sarg, B.; Lindner, HH.; Bonaros, N.; Mikuz, G.; Laufer, G.; Werner, ER.: The amounts of alpha 1 antitrypsin protein are reduced in the vascular wall of the acutely dissected human ascending aorta. EUROPEAN JOURNAL OF CARDIO-THORACIC SURGERY. 2010; 37(3); 684-690. IF: 2.293! Sobieszek, A.; Sarg, B.; Lindner, H.; Matusovsky, OS.; Zukowska, M.: Myosin Kinase of Molluscan Smooth Muscle. Regulation by Binding of Calcium to the Substrate and Inhibition of Myorod and Twitchin Phosphorylation by Myosin. BIOCHEMISTRY. 2010; 49(19); 4191-4199. IF: 3.226! Schrettl, M.; Beckmann, N.; Varga, J.; Heinekamp, T.; Jacobsen, ID.; Jochl, C.; Moussa, TA.; Wang, S.; Gsaller, F.; Blatzer, M.; Werner, ER.; Niermann, WC.; Brakhage, AA.; Haas, H.: HapXMediated Adaption to Iron Starvation Is Crucial for Virulence of Aspergillus fumigatus. PLOS PATHOGENS. 2010; 6(9); e1001124. IF: 9.079! Schrettl, M.; Carberry, S.; Kavanagh, K.; Haas, H.; Jones, GW.; O'Brien, J.; Nolan, A.; Stephens, J.; Fenelon, O.; Doyle, S.: Self-Protection against Gliotoxin-A Component of the Gliotoxin Biosynthetic Cluster, GliT, Completely Protects Aspergillus fumigatus Against Exogenous Gliotoxin. PLOS PATHOGENS. 2010; 6(6); e1000952. IF: 9.079! Schrettl, M.; Ibrahim-Granet, O.; Droin, S.; Huerre, M.; Latge, JP.; Haas, H.: The crucial role of the Aspergillus fumigatus siderophore system in interaction with alveolar macrophages. MICROBES AND INFECTION. 2010; 12(12-13); 1035-1041. IF: 2.726! Schroecksnadel, K.; Grammer, TB.; Boehm, BO.; Marz, W.; Fuchs, D.: Total homocysteine in patients with angiographic coronary artery disease correlates with inflammation markers. THROMBOSIS AND HAEMOSTASIS. 2010; 103(5); 926-935. IF: 4.701! 102 ! Sobieszek, A.; Sarg, B.; Lindner, H.; Seow, CY.: Phosphorylation of caldesmon by myosin light chain kinase increases its binding affinity for phosphorylated myosin filaments. BIOLOGICAL CHEMISTRY. 2010; 391(9); 1091-1104. IF: 3.603! Soeno, Y.; Taya, Y.; Stasyk, T.; Huber, LA.; Aoba, T.; Huttenhofer, A.: Identification of novel ribonucleo-protein complexes from the brain-specific snoRNA MBII-52. RNA-A PUBLICATION OF THE RNA SOCIETY. 2010; 16(7); 1293-1300. IF: 6.051! Stasyk, T.; Holzmann, J.; Stumberger, S.; Ebner, HL.; Hess, MW.; Bonn, GK.; Mechtler, K.; Huber, LA.: Proteomic analysis of endosomes from genetically modified p14/MP1 mouse embryonic fibroblasts. PROTEOMICS. 2010; 10(22); 4117-4127. IF: 4.815! Stasyk, T.; Lutsik-Kordovsky, M.; Wernstedt, C.; Antonyuk, V.; Klyuchivska, O.; Souchelnytskyi, S.; Hellman, U.; Stoika, R.: A new highly toxic protein isolated from the death cap Amanita phalloides is an l-amino acid oxidase. FEBS JOURNAL. 2010; 277(5); 1260-1269. IF: 3.129! Sucher, R.; Gehwolf, P.; Oberhuber, R.; Hermann, M.; Margreiter, C.; Werner, ER.; Obrist, P.; Schneeberger, S.; Ollinger, R.; Margreiter, R.; Brandacher, G.: Tetrahydrobiopterin protects the kidney from ischemia-reperfusion injury. KIDNEY INTERNATIONAL. 2010; 77(8); 681-689. IF: 6.105! Schroecksnadel, S.; Jenny, M.; Kurz, K.; Klein, A.; Ledochowski, M.; Uberall, F.; Fuchs, D.: LPSinduced NF-kappa B expression in THP-1Blue cells correlates with neopterin production and activity of indoleamine 2,3-dioxygenase. BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS. 2010; 399(4); 642-646. IF: 2.595! Teis, D.; Saksena, S.; Judson, BL.; Emr, SD.: ESCRT-II coordinates the assembly of ESCRT-III filaments for cargo sorting and multivesicular body vesicle formation. EMBO JOURNAL. 2010; 29 (5); 871-883. IF: 10.124! Schwarze, F.; Meraner, J.; Lechner, M.; Loidl, A.; Stasyk, T.; Laich, A.; Loidl, P.: Cell cycledependent acetylation of Rb2/p130 in NIH3T3 cells. ONCOGENE. 2010; 29(42); 5755-5760. IF: 7.414! Teufel, L.; Pipal, A.; Schuster, KC.; Staudinger, T.; Redl, B.: Material-dependent growth of human skin bacteria on textiles investigated using challenge tests and DNA genotyping. JOURNAL OF APPLIED MICROBIOLOGY. 2010; 108(2); 450-461. IF: 2.365! The Biocenter! Publications 2010! Thauerer, B.; zur Nedden, S.; Baier-Bitterlich, G.: Vital role of protein kinase C-related kinase in the formation and stability of neurites during hypoxia. JOURNAL OF NEUROCHEMISTRY. 2010; 113 (2); 432-446. IF: 4.337 ! Thon, M.; Al, AQ.; Hortschansky, P.; Scharf, DH.; Eisendle, M.; Haas, H.; Brakhage, AA.: The CCAAT-binding complex coordinates the oxidative stress response in eukaryotes. NUCLEIC ACIDS RESEARCH. 2010; 38(4); 1098-1113. IF: 7.836! Tribus, M.; Bauer, I.; Galehr, J.; Rieser, G.; Trojer, P.; Brosch, G.; Loidl, P.; Haas, H.; Graessle, S.: A Novel Motif in Fungal Class 1 Histone Deacetylases Is Essential for Growth and Development of Aspergillus. MOLECULAR BIOLOGY OF THE CELL. 2010; 21(2); 345-353. IF: 5.861! van Breukelen, F.; Krumschnabel, G.; Podrabsky, JE.: Vertebrate cell death in energy-limited conditions and how to avoid it: what we might learn from mammalian hibernators and other stresstolerant vertebrates. APOPTOSIS. 2010; 15(3); 386-399. IF: 4.397! Wasim, M.; Carlet, M.; Mansha, M.; Greil, R.; Ploner, C.; Trockenbacher, A.; Rainer, J.; Kofler, R.: PLZF/ZBTB16, a glucocorticoid response gene in acute lymphoblastic leukemia, interferes with glucocorticoid-induced apoptosis. JOURNAL OF STEROID BIOCHEMISTRY AND MOLECULAR BIOLOGY. 2010; 120(4-5); 218-227. IF: 2.886! Watschinger, K.; Keller, MA.; Golderer, G.; Hermann, M.; Maglione, M.; Sarg, B.; Lindner, HH.; Hermetter, A.; Werner-Felmayer, G.; Konrat, R.; Hulo, N.; Werner, ER.: Identification of the gene encoding alkylglycerol monooxygenase defines a third class of tetrahydrobiopterin-dependent enzymes. PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 2010; 107(31); 13672-13677. IF: 9.771! Weiskopf, D.; Schwanninger, A.; Weinberger, B.; Almanzar, G.; Parson, W.; Buus, S.; Lindner, H.; Grubeck-Loebenstein, B.: Oxidative stress can alter the antigenicity of immunodominant peptides. JOURNAL OF LEUKOCYTE BIOLOGY. 2010; 87(1); 165-172. IF: 4.626! Yilmaz, A.; Verhofstede, C.; D'Avolio, A.; Watson, V.; Hagberg, L.; Fuchs, D.; Svennerholm, B.; Gisslen, M.: Treatment Intensification Has no Effect on the HIV-1 Central Nervous System Infection in Patients on Suppressive Antiretroviral Therapy. AIDS-JOURNAL OF ACQUIRED IMMUNE DEFICIENCY SYNDROMES. 2010; 55(5); 590-596. IF: 4.262! Yu, C.; Jiang, SJ.; Lu, JY.; Coughlin, CC.; Wang, YA.; Swietlicki, EA.; Wang, LH.; Vietor, I.; Huber, LA.; Cikes, D.; Coleman, T.; Xie, Y.; Semenkovich, CF.; Davidson, NO.; Levin, MS.; Rubin, DC.: Deletion of Tis7 Protects Mice from High-Fat Diet-Induced Weight Gain and Blunts the Intestinal Adaptive Response Postresection. JOURNAL OF NUTRITION. 2010; 140(11); 1907-1914. IF: 4.295! Zagrebelsky, M.; Schweigreiter, R.; Bandtlow, CE.; Schwab, ME.; Korte, M.: Nogo-A Stabilizes the Architecture of Hippocampal Neurons. JOURNAL OF NEUROSCIENCE. 2010; 30(40); 13220-13234. IF: 7.271! Zangerle, R.; Kurz, K.; Neurauter, G.; Kitchen, M.; Sarcletti, M.; Fuchs, D.: Increased blood phenylalanine to tyrosine ratio in HIV-1 infection and correction following effective antiretroviral therapy. BRAIN BEHAVIOR AND IMMUNITY. 2010; 24(3); 403-408. IF: 3.956! Zeimet, AG.; Reimer, D.; Schwentner, L.; Fuchs, D.; Wolf, D.; Fuith, LC.; Fiegl, H.; Doppler, W.; Concin, N.; Daxenbichler, G.; Marth, C.: Urinary neopterin does not reflect the local antitumor immune milieu in ovarian cancer. CANCER IMMUNOLOGY IMMUNOTHERAPY. 2010; 59(12); 1813-1823. IF: 4.293! Zeller, I.; Knoflach, M.; Seubert, A.; Kreutmayer, SB.; Stelzmüller, ME.; Wallnoefer, E.; Blunder, S.; Frotschnig, S.; Messner, B.; Willeit, J.; Debbage, P.; Wick, G.; Kiechl, S.; Laufer, G.; Bernhard, D.: Lead contributes to arterial intimal hyperplasia through nuclear factor erythroid 2-related factormediated endothelial interleukin 8 synthesis and subsequent invasion of smooth muscle cells. ARTERIOSCLEROSIS THROMBOSIS AND VASCULAR BIOLOGY. 2010; 30(9); 1733-1740. IF: 7.215! Wickstrom, SA.; Lange, A.; Hess, MW.; Polleux, J.; Spatz, JP.; Kruger, M.; Pfaller, K.; Lambacher, A.; Bloch, W.; Mann, M.; Huber, LA.; Fassler, R.: Integrin-Linked Kinase Controls Microtubule Dynamics Required for Plasma Membrane Targeting of Caveolae. DEVELOPMENTAL CELL. 2010; 19(4); 574-588. IF: 13.946! Wieland, M.; Berschneider, B.; Erlacher, MD.; Hartig, JS.: Aptazyme-Mediated Regulation of 16S Ribosomal RNA. CHEMISTRY & BIOLOGY. 2010; 17(3); 236-242. IF: 5.838! 103 ! The Biocenter! Publications 2010! Proceedings Papers! Leinert, C.; Stahl-Hennig, C.; Ecker, A.; Schneider, T.; Fuchs, D.; Sauermann, U.; Sopper, S.: Microbial translocation in simian immunodeficiency virus (SIV)-infected rhesus monkeys (Macaca mulatta). JOURNAL OF MEDICAL PRIMATOLOGY. 2010; 39(4); 243-251. IF: 0.862! Reviews! Chirkova, A.; Erlacher, M.; Micura, R.; Polacek, N.: Chemically Engineered Ribosomes: A New Frontier in Synthetic Biology. CURRENT ORGANIC CHEMISTRY. 2010; 14(2); 148-161. IF: 2.920! Clementi, N.; Polacek, N.: Ribosome-associated GTPases: The role of RNA for GTPase activation. RNA BIOLOGY. 2010; 7(5); 521-527. IF: 5.597! Hackl, H.; Stocker, G.; Charoentong, P.; Mlecnik, B.; Bindea, G.; Galon, J.; Trajanoski, Z.: Information technology solutions for integration of biomolecular and clinical data in the identification of new cancer biomarkers and targets for therapy. PHARMACOLOGY & THERAPEUTICS. 2010; 128(3); 488-498. IF: 8.694! Mangge, H.; Almer, G.; Truschnig-Wilders, M.; Schmidt, A.; Gasser, R.; Fuchs, D.: Inflammation, Adiponectin, Obesity and Cardiovascular Risk. CURRENT MEDICINAL CHEMISTRY. 2010; 17(36); 4511-4520. IF: 4.630! Huber, LA.: Do pharmacogenetics, genomics and epigenetics hold promise for molecular therapeutics and health? CURRENT OPINION IN MOLECULAR THERAPEUTICS. 2010; 12(3); 268-269. IF: 4.023! Ledochowski, M.; Schroecksnadel, S.; Fuchs, D.: Vitamin-C supplementation and coeliac disease. ACTA PAEDIATRICA. 2010; 99(12); 1756-1757. IF: 1.955! Podrabsky, JE.; Krumschnabel, G.: Cell death beyond worms, flies and humans: unusual model systems for cell death research. APOPTOSIS. 2010; 15(3); 243-248. IF: 4.397! Villunger, A.: Only the Strong Survive. IMMUNITY. 2010; 32(6); 729-731. IF: 24.221! Letters! Schroecksnadel, S.; Kurz, K.; Fuchs, D.: Antioxidant supplements for long-term health and to prevent disease. MATURITAS. 2010; 67(4); 375-375. IF: 2.286! Schubert, C.; Fuchs, D.: The relationship between alcohol intake and cellular immune activity in systemic lupus erythematosus may change from inhibitory to stimulatory within 2 months of study: findings from an integrative single-case study. CLINICAL RHEUMATOLOGY. 2010; 29(2); 229-230. IF: 1.687! Rederstorff, M.; Huttenhofer, A.: Small non-coding RNAs in disease development and hostpathogen interactions. CURRENT OPINION IN MOLECULAR THERAPEUTICS. 2010; 12(6); 684-694. IF: 4.023! Sucher, R.; Schroecksnadel, K.; Weiss, G.; Margreiter, R.; Fuchs, D.; Brandacher, G.: Neopterin, a prognostic marker in human malignancies. CANCER LETTERS. 2010; 287(1); 13-22. IF: 4.864! Wick, G.; Backovic, A.; Rabensteiner, E.; Plank, N.; Schwentner, C.; Sgonc, R.: The immunology of fibrosis: innate and adaptive responses. TRENDS IN IMMUNOLOGY. 2010; 31(3); 110-119. IF: 9.533! Editorials! Huber, C.; Huber, L.: Special Focus on Top-down Proteomics. PROTEOMICS. 2010; 10(20); 3564-3565. IF: 4.815! 104 ! 113 Publications in 2010! The Biocenter! Publications 2011! Original Articles! Aleksic, K.; Lackner, C.; Geigl, JB.; Schwarz, M.; Auer, M.; Ulz, P.; Fischer, M.; Trajanoski, Z.; Otte, M.; Speicher, MR.: Evolution of Genomic Instability in Diethylnitrosamine-Induced Hepatocarcinogenesis in Mice. HEPATOLOGY. 2011; 53(3); 895-904. IF: 10.885! Ciprandi, G.; De Amici, M.; Berardi, L.; Vignini, M.; Caimmi, S.; Marseglia, A.; Marseglia, G.; Fuchs, D.: Serum neopterin levels in spontaneous urticaria and atopic dermatitis. CLINICAL AND EXPERIMENTAL DERMATOLOGY. 2011; 36(1); 85-87. IF: 1.267! Augsten, M.; Hackl, H.; Ebner, B.; Chemelli, A.; Glatter, O.; Marsche, G.; Lang, U.; Desoye, G.; Wadsack, C.: Fetal HDL/apoE: a novel regulator of gene expression in human placental endothelial cells. PHYSIOLOGICAL GENOMICS. 2011; 43(22); 1255-1262. IF: 3.368! Ciprandi, G.; De Amici, M.; Tosca, M.; Alesina, R.; Marseglia, G.; Fuchs, D.: Serotonin in Allergic Rhinitis: a Possible Role for Behavioural Symptoms. IRANIAN JOURNAL OF ALLERGY, ASTHMA AND IMMUNOLOGY. 2011; 10(3); 183-188. IF: 0.742! Bennett, KL.; Funk, M.; Tschernutter, M.; Breitwieser, FP.; Planyavsky, M.; Mohien, CU.; Muller, A.; Trajanoski, Z.; Colinge, J.; Superti-Furga, G.; Schmidt-Erfurth, U.: Proteomic analysis of human cataract aqueous humour: Comparison of one-dimensional gel LCMS with two-dimensional LCMS of unlabelled and iTRAQ (R)-labelled specimens. JOURNAL OF PROTEOMICS. 2011; 74(2); 151-166. IF: 5.074! Ciprandi, G.; Tosca, M.; Fuchs, D.: Nitric oxide metabolites in allergic rhinitis: The effect of pollen allergen exposure. ALLERGOLOGIA ET IMMUNOPATHOLOGIA. 2011; 39(6); 326-329. IF: 0.779! Blatzer, M.; Binder, U.; Haas, H.: The metalloreductase FreB is involved in adaptation of Aspergillus fumigatus to iron starvation. FUNGAL GENETICS AND BIOLOGY. 2011; 48(11); 1027-1033. IF: 3.333! Blatzer, M.; Schrettl, M.; Sarg, B.; Lindner, HH.; Pfaller, K.; Haas, H.: SidL, an Aspergillus fumigatus Transacetylase Involved in Biosynthesis of the Siderophores Ferricrocin and Hydroxyferricrocin. APPLIED AND ENVIRONMENTAL MICROBIOLOGY. 2011; 77(14); 4959-4966. IF: 3.778! Blatzer, Michael; Barker, Bridget M.; Willger, Sven D.; Beckmann, Nicola; Blosser, Sara J.; Cornish, Elizabeth J.; Mazurie, Aurelien; Grahl, Nora; Haas, Hubertus; Cramer, Robert A.: SREBP coordinates iron and ergosterol homeostasis to mediate triazole drug and hypoxia responses in the human fungal pathogen Aspergillus fumigatus. PLOS GENETICS. 2011; 7(12); e1002374. IF: 9.543! Boasso, A.; Royle, CM.; Doumazos, S.; Aquino, VN.; Biasin, M.; Piacentini, L.; Tavano, B.; Fuchs, D.; Mazzotta, F.; Lo Caputo, S.; Shearer, GM.; Clerici, M.; Graham, DR.: Overactivation of plasmacytoid dendritic cells inhibits antiviral T-cell responses: a model for HIV immunopathogenesis. BLOOD. 2011; 118(19); 5152-5162. IF: 10.558! Capuron, L.; Schroecksnadel, S.; Feart, C.; Aubert, A.; Higueret, D.; Barberger-Gateau, P.; Laye, S.; Fuchs, D.: Chronic Low-Grade Inflammation in Elderly Persons Is Associated with Altered Tryptophan and Tyrosine Metabolism: Role in Neuropsychiatric Symptoms. BIOLOGICAL PSYCHIATRY. 2011; 70(2); 175-182. IF: 8.674! Csordas, A.; Kreutmayer, S.; Ploner, C.; Braun, PR.; Karlas, A.; Backovic, A.; Wick, G.; Bernhard, D.: Cigarette smoke extract induces prolonged endoplasmic reticulum stress and autophagic cell death in human umbilical vein endothelial cells. CARDIOVASCULAR RESEARCH. 2011; 92(1); 141-148. IF: 6.051! Dahl, V.; Lee, E.; Peterson, J.; Spudich, SS.; Leppla, I.; Sinclair, E.; Fuchs, D.; Palmer, S.; Price, RW.: Raltegravir Treatment Intensification Does Not Alter Cerebrospinal Fluid HIV-1 Infection or Immunoactivation in Subjects on Suppressive Therapy. JOURNAL OF INFECTIOUS DISEASES. 2011; 204(12); 1936-1945. IF: 6.288! Dhawan, A.; Shanker, R.; Laffon, B.; Tajes, JF.; Fuchs, D.; van der Laan, G.; van Broekhuizen, P.; Becker, H.; Moriske, HJ.; Teixeira, JP. F.; Corriere, M.; Herlin-Boime, N.; Engle, AB.; Coskun, E.; Karahalil, B.: NanoLINEN: Nanotoxicology Link Between India and European Nations. JOURNAL OF BIOMEDICAL NANOTECHNOLOGY. 2011; 7(1); 203-204. IF: 2.626! Dunnhaupt, S.; Barthelmes, J.; Hombach, J.; Sakloetsakun, D.; Arkhipova, V.; Bernkop-Schnurch, A.: Distribution of thiolated mucoadhesive nanoparticles on intestinal mucosa. INTERNATIONAL JOURNAL OF PHARMACEUTICS. 2011; 408(1-2); 191-199. IF: 3.607! Eberhart, K.; Rainer, J.; Bindreither, D.; Ritter, I.; Gnaiger, E.; Kofler, R.; Oefner, PJ.; Renner, K.: Glucocorticoid-induced alterations in mitochondrial membrane properties and respiration in childhood acute lymphoblastic leukemia. BIOCHIMICA ET BIOPHYSICA ACTA-BIOENERGETICS. 2011; 1807(6); 719-725. IF: 5.132! Eisendle, K.; Muller, H.; Ortner, E.; Talasz, H.; Graziadei, I.; Vogel, W.; Hopfl, R.: Pruritus of unknown origin and elevated total serum bile acid levels in patients without clinically apparent liver disease. J. OF GASTROENTEROLOGY AND HEPATOLOGY. 2011; 26(4); 716-721. IF: 2.410! 105 ! The Biocenter! Publications 2011! Erlacher, MD.; Chirkova, A.; Voegele, P.; Polacek, N.: Generation of chemically engineered ribosomes for atomic mutagenesis studies on protein biosynthesis. NATURE PROTOCOLS. 2011; 6(5); 580-592. IF: 8.362! Faserl, K.; Golderer, G.; Kremser, L.; Lindner, H.; Sarg, B.; Wildt, L.; Seeber, B.: Polymorphism in Vitamin D-Binding Protein as a Genetic Risk Factor in the Pathogenesis of Endometriosis. JOURNAL OF CLINICAL ENDOCRINOLOGY AND METABOLISM. 2011; 96(1); E233-E241. IF: 6.495! Faserl, K.; Sarg, B.; Kremser, L.; Lindner, H.: Optimization and Evaluation of a Sheathless Capillary Electrophoresis-Electrospray Ionization Mass Spectrometry Platform for Peptide Analysis: Comparison to Liquid Chromatography-Electrospray Ionization Mass Spectrometry. ANALYTICAL CHEMISTRY. 2011; 83(19); 7297-7305. IF: 5.874! Fuka, Gerhard; Kauer, Maximilian; Kofler, Reinhard; Haas, Oskar A.; Panzer-Grümayer, Renate: The leukemia-specific fusion gene ETV6/RUNX1 perturbs distinct key biological functions primarily by gene repression. PLOS ONE. 2011; 6(10); e26348. IF: 4.411! Geiermann, AS.; Polacek, N.; Micura, R.: Native Chemical Ligation of Hydrolysis-Resistant 3 'Peptidyl-tRNA Mimics. JOURNAL OF THE AMERICAN CHEMICAL SOCIETY. 2011; 133(47); 19068-19071. IF: 9.023! Girgin, G.; Sahin, TT.; Fuchs, D.; Yuksel, O.; Kurukahvecioglu, O.; Sare, M.; Baydar, T.: Tryptophan degradation and serum neopterin concentrations in intensive care unit patients. TOXICOLOGY MECHANISMS AND METHODS. 2011; 21(3); 231-235. IF: 0.844! Grespi, Francesca; Ottina, Eleonora; Yannoutsos, Nikolaos; Geley, Stephan; Villunger, Andreas: Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis. PLOS ONE. 2011; 6(3); e18051. IF: 4.411! Gruber, P.; Rechfeld, F.; Kirchmair, J.; Hauser, N.; Boehler, M.; Garczarczyk, D.; Langer, T.; Hofmann, J.: Barbituric acid derivative BAS 02104951 inhibits PKC epsilon, PKC eta, PKC epsilon/ RACK2 interaction, Elk-1 phosphorylation in HeLa and PKC epsilon and eta translocation in PC3 cells following TPA-induction. JOURNAL OF BIOCHEMISTRY. 2011; 149(3); 331-336. IF: 2.145! Grundtman, C.; Kreutmayer, SB.; Almanzar, G.; Wick, MC.; Wick, G.: Heat Shock Protein 60 and Immune Inflammatory Responses in Atherosclerosis. ARTERIOSCLEROSIS THROMBOSIS AND VASCULAR BIOLOGY. 2011; 31(5); 960-U38. IF: 7.215! 106 ! Haas, J.; Beer, AG.; Widschwendter, P.; Oberdanner, J.; Salzmann, K.; Sarg, B.; Lindner, H.; Herz, J.; Patsch, JR.; Marschang, P.: LRP1b shows restricted expression in human tissues and binds to several extracellular ligands, including fibrinogen and apoE - carrying lipoproteins. ATHEROSCLEROSIS. 2011; 216(2); 342-347. IF: 4.086! Hakim-Weber, Robab; Krogsdam, Anne-M.; Jørgensen, Claus; Fischer, Maria; Prokesch, Andreas; Bogner-Strauss, Juliane G.; Bornstein, Stefan R.; Hansen, Jacob B.; Madsen, Lise; Kristiansen, Karsten; Trajanoski, Zlatko; Hackl, Hubert: Transcriptional regulatory program in wild-type and retinoblastoma gene-deficient mouse embryonic fibroblasts during adipocyte differentiation. BMC RESEARCH NOTES. 2011; 4; 157. IF: 0! Halfinger, B.; Sarg, B.; Amann, A.; Hammerer-Lercher, A.; Lindner, HH.: Unmasking lowabundance peptides from human blood plasma and serum samples by a simple and robust twostep precipitation/immunoaffinity enrichment method. ELECTROPHORESIS. 2011; 32(13); 1706-1714. IF: 3.569! Halfinger, B.; Sarg, B.; Lindner, HH.: Evaluation of non-reductive beta-elimination/Michael addition for glycosylation site determination in mucin-like O-glycopeptides. ELECTROPHORESIS. 2011; 32 (24); 3546-3553. IF: 3.569! Hausmann, M.; Leucht, K.; Ploner, C.; Kiessling, S.; Villunger, A.; Becker, H.; Hofmann, C.; Falk, W.; Krebs, M.; Kellermeier, S.; Fried, M.; Scholmerich, J.; Obermeier, F.; Rogler, G.: BCL-2 Modifying Factor (BMF) Is a Central Regulator of Anoikis in Human Intestinal Epithelial Cells. JOURNAL OF BIOLOGICAL CHEMISTRY. 2011; 286(30); 26533-26540. IF: 5.328! Hegedus, N.; Sigl, C.; Zadra, I.; Pocsi, I.; Marx, F.: The paf gene product modulates asexual development in Penicillium chrysogenum. JOURNAL OF BASIC MICROBIOLOGY. 2011; 51(3); 253-262. IF: 1.395! Hofer, Edith; Laschober, Gerhard T.; Hackl, Matthias; Thallinger, Gerhard G.; Lepperdinger, Günter; Grillari, Johannes; Jansen-Dürr, Pidder; Trajanoski, Zlatko: GiSAO.db: a database for ageing research. BMC GENOMICS. 2011; 12; 262. IF: 4.206! Hohenstein, K.; Griesmacher, A.; Weigel, G.; Golderer, G.; Ott, HW.: Native multimer analysis of plasma and platelet von Willebrand factor compared to denaturing separation: Implication for the interpretation of satellite bands. ELECTROPHORESIS. 2011; 32(13); 1684-1691. IF: 3.569! The Biocenter! Publications 2011! Irschick, EU.; Philipp, S.; Shahram, F.; Schirmer, M.; Sedigh, M.; Ziaee, N.; Gassner, C.; Schennach, H.; Meyer, M.; Larcher, C.; Herold, M.; Schoenitzer, D.; Fuchs, D.; Schoenbauer, M.; Maass, M.; Huemer, HP.; Davatchi, F.: Investigation of bacterial and viral agents and immune status in Behcet's disease patients from Iran. INTERNATIONAL JOURNAL OF RHEUMATIC DISEASES. 2011; 14(3); 298-310. IF: 0.205! Jain, R.; Valiante, V.; Remme, N.; Docimo, T.; Heinekamp, T.; Hertweck, C.; Gershenzon, J.; Haas, H.; Brakhage, AA.: The MAP kinase MpkA controls cell wall integrity, oxidative stress response, gliotoxin production and iron adaptation in Aspergillus fumigatus. MOLECULAR MICROBIOLOGY. 2011; 82(1); 39-53. IF: 4.819! Jakel, H.; Weinl, C.; Hengst, L.: Phosphorylation of p27Kip1 by JAK2 directly links cytokine receptor signaling to cell cycle control. ONCOGENE. 2011; 30(32); 3502-3512. IF: 7.414! Jenny, M.; Klieber, M.; Zaknun, D.; Schroecksnadel, S.; Kurz, K.; Ledochowski, M.; Schennach, H.; Fuchs, D.: In vitro testing for anti-inflammatory properties of compounds employing peripheral blood mononuclear cells freshly isolated from healthy donors. INFLAMMATION RESEARCH. 2011; 60(2); 127-135. IF: 2.004! Jenny, M.; Schroecksnadel, S.; Fuchs, D.: Testing for Immunomodulatory Properties of Nanoparticles. JOURNAL OF BIOMEDICAL NANOTECHNOLOGY. 2011; 7(1); 11-12. IF: 2.626! Jenny, Marcel; Wondrak, Angela; Zvetkova, Elissaveta; Tram, Nguyen Thi Ngoc; Phi, Phan Thi Phi; Schennach, Harald; Culig, Zoran; Ueberall, Florian; Fuchs, Dietmar: Crinum latifolium leave extracts suppress immune activation cascades in peripheral blood mononuclear cells and proliferation of prostate tumor cells. SCIENTIA PHARMACEUTICA. 2011; 79(2); 323-335. IF: 0! Jrad-Lamine, A.; Henry-Berger, J.; Gourbeyre, P.; Damon-Soubeyrand, C.; Lenoir, A.; Combaret, L.; Saez, F.; Kocer, A.; Tone, S.; Fuchs, D.; Zhu, WT.; Oefner, PJ.; Munn, DH.; Mellor, AL.; Gharbi, N.; Cadet, R.; Aitken, RJ.; Drevet, JR.: Deficient Tryptophan Catabolism along the Kynurenine Pathway Reveals That the Epididymis Is in a Unique Tolerogenic State. JOURNAL OF BIOLOGICAL CHEMISTRY. 2011; 286(10); 8030-8042. IF: 5.328! Kapferer, I.; Schmidt, S.; Gstir, R.; Durstberger, G.; Huber, LA.; Vietor, I.: Gene-expression profiles of epithelial cells treated with EMD in vitro: analysis using complementary DNA arrays. JOURNAL OF PERIODONTAL RESEARCH. 2011; 46(1); 118-125. IF: 2.128! Kirschnek, S.; Vier, J.; Gautam, S.; Frankenberg, T.; Rangelova, S.; Eitz-Ferrer, P.; Grespi, F.; Ottina, E.; Villunger, A.; Hacker, H.; Hacker, G.: Molecular analysis of neutrophil spontaneous apoptosis reveals a strong role for the pro-apoptotic BH3-only protein Noxa. CELL DEATH AND DIFFERENTIATION. 2011; 18(11); 1805-1814. IF: 9.050! Kostareva, O.; Tishchenko, S.; Nikonova, E.; Kljashtorny, V.; Nevskaya, N.; Nikulin, A.; Sycheva, A.; Moshkovskii, S.; Piendl, W.; Garber, M.; Nikonov, S.: Disruption of shape complementarity in the ribosomal protein L1-RNA contact region does not hinder specific recognition of the RNA target site. JOURNAL OF MOLECULAR RECOGNITION. 2011; 24(4); 524-532. IF: 2.286! Kreutmayer, SB.; Messner, B.; Knoflach, M.; Henderson, B.; Niederegger, H.; Boeck, G.; Van der Zee, R.; Wick, G.; Bernhard, D.: Dynamics of heat shock protein 60 in endothelial cells exposed to cigarette smoke extract. JOURNAL OF MOLECULAR AND CELLULAR CARDIOLOGY. 2011; 51 (5); 777-780. IF: 5.499! Kurz, K.; Herold, M.; Winkler, C.; Klotz, W.; Russe, E.; Fuchs, D.: Effects of adalimumab therapy on disease activity and interferon-gamma-mediated biochemical pathways in patients with rheumatoid arthritis. AUTOIMMUNITY. 2011; 44(3); 235-242. IF: 2.138! Kurz, K.; Schroecksnadel, S.; Weiss, G.; Fuchs, D.: Association between increased tryptophan degradation and depression in cancer patients. CURRENT OPINION IN CLINICAL NUTRITION AND METABOLIC CARE. 2011; 14(1); 49-56. IF: 4.333! Kuster, L.; Grausenburger, R.; Fuka, G.; Kaindl, U.; Krapf, G.; Inthal, A.; Mann, G.; Kauer, M.; Rainer, J.; Kofler, R.; Hall, A.; Metzler, M.; Meyer, LH.; Meyer, C.; Harbott, J.; Marschalek, R.; Strehl, S.; Haas, OA.; Panzer-Grumayer, R.: ETV6/RUNX1-positive relapses evolve from an ancestral clone and frequently acquire deletions of genes implicated in glucocorticoid signaling. BLOOD. 2011; 117(9); 2658-2667. IF: 10.558! Lackner, Peter; Beer, Ronny; Broessner, Gregor; Helbok, Raimund; Dallago, Karolin; Hess, Michael W.; Pfaller, Kristian; Bandtlow, Christine; Schmutzhard, Erich: Nogo-A expression in the brain of mice with cerebral malaria. PLOS ONE. 2011; 6(9); e25728. IF: 4.411! Lange, A.; Hoeller, D.; Wienk, H.; Marcillat, O.; Lancelin, JM.; Walker, O.: NMR Reveals a Different Mode of Binding of the Stam2 VHS Domain to Ubiquitin and Diubiquitin. BIOCHEMISTRY. 2011; 50(1); 48-62. IF: 3.226! Leblhuber, F.; Schroecksnadel, K.; Beran-Praher, M.; Haller, H.; Steiner, K.; Fuchs, D.: Polyneuropathy and dementia in old age: common inflammatory and vascular parameters. JOURNAL OF NEURAL TRANSMISSION. 2011; 118(5); 721-725. IF: 2.597! 107 ! The Biocenter! Publications 2011! Loerting, T.; Bauer, M.; Kohl, I.; Watschinger, K.; Winkel, K.; Mayer, E.: Cryoflotation: Densities of Amorphous and Crystalline Ices. " JOURNAL OF PHYSICAL CHEMISTRY B. 2011; 115(48); 14167-14175. IF: 3.603! Logette, E.; Schuepbach-Mallepell, S.; Eckert, MJ.; Leo, XH.; Jaccard, B.; Manzl, C.; Tardivel, A.; Villunger, A.; Quadroni, M.; Gaide, O.; Tschopp, J.: PIDD orchestrates translesion DNA synthesis in response to UV irradiation. CELL DEATH AND DIFFERENTIATION. 2011; 18(6); 1036-+. IF: 9.050! Mair, SM.; Nairz, M.; Bellmann-Weiler, R.; Muehlbacher, T.; Schroll, A.; Theurl, I.; Moser, PL.; Talasz, H.; Fang, FC.; Weiss, G.: Nifedipine Affects the Course of Salmonella enterica Serovar Typhimurium Infection by Modulating Macrophage Iron Homeostasis. JOURNAL OF INFECTIOUS DISEASES. 2011; 204(5); 685-694. IF: 6.288! McDonald, Claire L.; Steinbach, Karin; Kern, Florian; Schweigreiter, Rüdiger; Martin, Roland; Bandtlow, Christine E.; Reindl, Markus: Nogo receptor is involved in the adhesion of dendritic cells to myelin. JOURNAL OF NEUROINFLAMMATION. 2011; 8; 113. IF: 5.785! Melum, E.; Franke, A.; Schramm, C.; Weismuller, TJ.; Gotthardt, DN.; Offner, FA.; Juran, BD.; Laerdahl, JK.; Labi, V.; Bjornsson, E.; Weersma, RK.; Henckaerts, L.; Teufel, A.; Rust, C.; Ellinghaus, E.; Balschun, T.; Boberg, KM.; Ellinghaus, D.; Bergquist, A.; Sauer, P.; Ryu, E.; Hov, JR.; Wedemeyer, J.; Lindkvist, B.; Wittig, M.; Porte, RJ.; Holm, K.; Gieger, C.; Wichmann, HE.; Stokkers, P.; Ponsioen, CY.; Runz, H.; Stiehl, A.; Wijmenga, C.; Sterneck, M.; Vermeire, S.; Beuers, U.; Villunger, A.; Schrumpf, E.; Lazaridis, KN.; Manns, MP.; Schreiber, S.; Karlsen, TH.: Genomewide association analysis in primary sclerosing cholangitis identifies two non-HLA susceptibility loci. NATURE GENETICS. 2011; 43(1); 17-19. IF: 36.377! Mlecnik, B.; Tosolini, M.; Kirilovsky, A.; Berger, A.; Bindea, G.; Meatchi, T.; Bruneval, P.; Trajanoski, Z.; Fridman, WH.; Pages, F.; Galon, J.: Histopathologic-Based Prognostic Factors of Colorectal Cancers Are Associated With the State of the Local Immune Reaction. JOURNAL OF CLINICAL ONCOLOGY. 2011; 29(6); 610-618. IF: 18.970! Moin, SF.; Rainer, M.; Waheed, H.; Stasyk, T.; Huber, LA.; Lottspeich, F.; Bonn, GK.: Purification and Characterization of a Phospholipase A(2) and Identification of a kappa Bungarotoxin from Bungarus sindanus sindanus (Sindhi Krait) Snake Venom. CURRENT ANALYTICAL CHEMISTRY. 2011; 7(3); 176-183. IF: 1.809! 108 ! Morettini, S.; Tribus, M.; Zeilner, A.; Sebald, J.; Campo-Fernandez, B.; Scheran, G.; Worle, H.; Podhraski, V.; Fyodorov, DV.; Lusser, A.: The chromodomains of CHD1 are critical for enzymatic activity but less important for chromatin localization. NUCLEIC ACIDS RESEARCH. 2011; 39(8); 3103-3115. IF: 7.836! Mueller, LA. J.; Kugler, KG.; Dander, A.; Graber, A.; Dehmer, M.: QuACN: an R package for analyzing complex biological networks quantitatively. BIOINFORMATICS. 2011; 27(1); 140-141. IF: 4.877! Nairz, M.; Schroll, A.; Moschen, AR.; Sonnweber, T.; Theurl, M.; Theurl, I.; Taub, N.; Jamnig, C.; Neurauter, D.; Huber, LA.; Tilg, H.; Moser, PL.; Weiss, G.: Erythropoietin Contrastingly Affects Bacterial Infection and Experimental Colitis by Inhibiting Nuclear Factor-kappa B-Inducible Immune Pathways. IMMUNITY. 2011; 34(1); 61-74. IF: 24.221! Ocak, M.; Helbok, A.; von Guggenberg, E.; Ozsoy, Y.; Kabasakal, L.; Kremser, L.; Decristoforo, C.: Influence of biological assay conditions on stability assessment of radiometal-labelled peptides exemplified using a (177)Lu-DOTA-minigastrin derivative. NUCLEAR MEDICINE AND BIOLOGY. 2011; 38(2); 171-179. IF: 2.620! O'hanlon, KA.; Cairns, T.; Stack, D.; Schrettl, M.; Bignell, EM.; Kavanagh, K.; Miggin, SM.; O'Keeffe, G.; Larsen, TO.; Doyle, S.: Targeted Disruption of Nonribosomal Peptide Synthetase pes3 Augments the Virulence of Aspergillus fumigatus. INFECTION AND IMMUNITY. 2011; 79(10); 3978-3992. IF: 4.098! Oppl, B.; Kofler, A.; Schwarz, S.; Rainer, J.; Kofler, R.: Establishing a sensitive and specific assay for determination of glucocorticoid bioactivity. WIENER KLINISCHE WOCHENSCHRIFT. 2011; 123 (7-8); 222-229, IF: 0.747 ! Pabinger, Stephan; Rader, Robert; Agren, Rasmus; Nielsen, Jens; Trajanoski, Zlatko: MEMOSys: Bioinformatics platform for genome-scale metabolic models. BMC SYSTEMS BIOLOGY. 2011; 5; 20. IF: 3.565! Pashkunova-Martic, I.; Kremser, C.; Galanski, M.; Arion, V.; Debbage, P.; Jaschke, W.; Keppler, B.: Lectin-Gd-Loaded Chitosan Hydrogel Nanoparticles: A New Biospecific Contrast Agent for MRI. MOLECULAR IMAGING AND BIOLOGY. 2011; 13(1); 16-24. IF: 3.139! The Biocenter! Publications 2011! Pinent, M.; Prokesch, A.; Hackl, H.; Voshol, PJ.; Klatzer, A.; Walenta, E.; Panzenboeck, U.; Kenner, L.; Trajanoski, Z.; Hoefler, G.; Bogner-Strauss, G.: Adipose Triglyceride Lipase and HormoneSensitive Lipase Are Involved in Fat Loss in JunB-Deficient Mice. ENDOCRINOLOGY. 2011; 152(7); 2678-2689. IF: 4.993! Schroecksnadel, S.; Sucher, R.; Kurz, K.; Fuchs, D.; Brandacher, G.: Influence of immunosuppressive agents on tryptophan degradation and neopterin production in human peripheral blood mononuclear cells. TRANSPLANT IMMUNOLOGY. 2011; 25(2-3); 119-123. IF: 1.912 ! Prokesch, A.; Bogner-Strauss, JG.; Hackl, H.; Rieder, D.; Neuhold, C.; Walenta, E.; Krogsdam, A.; Scheideler, M.; Papak, C.; Wong, WC.; Vinson, C.; Eisenhaber, F.; Trajanoski, Z.: Arxes: retrotransposed genes required for adipogenesis. NUCLEIC ACIDS RESEARCH. 2011; 39(8); 3224-3239. IF: 7.836! Schuster, C.; Berger, A.; Hoelzl, MA.; Putz, EM.; Frenzel, A.; Simma, O.; Moritz, N.; Hoelbl, A.; Kovacic, B.; Freissmuth, M.; Muller, M.; Villunger, A.; Mullauer, L.; Schmatz, AI.; Streubel, B.; Porpaczy, E.; Jager, U.; Stoiber, D.; Sexl, V.: The cooperating mutation or "second hit" determines the immunologic visibility toward MYC-induced murine lymphomas. BLOOD. 2011; 118(17); 4635-4645. IF: 10.558 ! Prokudin, I.; Stasyk, T.; Rainer, J.; Bonn, GK.; Kofler, R.; Huber, LA.: Comprehensive proteomic and transcriptomic characterization of hepatic expression signatures affected in p14 liver conditional knockout mice. PROTEOMICS. 2011; 11(3); 469-480. IF: 4.815! Rederstorff, M.; Huttenhofer, A.: cDNA library generation from ribonucleoprotein particles. NATURE PROTOCOLS. 2011; 6(2); 166-174. IF: 8.362! Sánchez-Cabo, Fátima; Rainer, Johannes; Dopazo, Ana; Trajanoski, Zlatko; Hackl, Hubert: Insights into global mechanisms and disease by gene expression profiling. METHODS IN MOLECULAR BIOLOGY. 2011; 719; 269-298. IF: 0! Schanda, Kathrin; Hermann, Martin; Stefanova, Nadia; Gredler, Viktoria; Bandtlow, Christine; Reindl, Markus: Nogo-B is associated with cytoskeletal structures in human monocyte-derived macrophages. BMC RESEARCH NOTES. 2011; 4; 6. IF: 0! Schiefermeier, N.; Teis, D.; Huber, LA.: Endosomal signaling and cell migration. CURRENT OPINION IN CELL BIOLOGY. 2011; 23(5); 615-620. IF: 13.540! Sigl, C.; Haas, H.; Specht, T.; Pfaller, K.; Kurnsteiner, H.; Zadra, I.: Among Developmental Regulators, StuA but Not BrlA Is Essential for Penicillin V Production in Penicillium chrysogenum. APPLIED AND ENVIRONMENTAL MICROBIOLOGY. 2011; 77(3); 972-982. IF: 3.778! Skvortsov, S.; Schafer, G.; Stasyk, T.; Fuchsberger, C.; Bonn, GK.; Bartsch, G.; Klocker, H.; Huber, LA.: Proteomics Profiling of Microdissected Low- and High-Grade Prostate Tumors Identifies Lamin A as a Discriminatory Biomarker. JOURNAL OF PROTEOME RESEARCH. 2011; 10(1); 259-268. IF: 5.460! Sonnleitner, E.; Gonzalez, N.; Sorger-Domenigg, T.; Heeb, S.; Richter, AS.; Backofen, R.; Williams, P.; Huttenhofer, A.; Haas, D.; Blasi, U.: The small RNA PhrS stimulates synthesis of the Pseudomonas aeruginosa quinolone signal. MOLECULAR MICROBIOLOGY. 2011; 80(4); 868-885. IF: 4.819! Sonnleitner, R.; Redl, B.; Merschak, P.; Schinner, F.: Mobilization of Metals from Pristine Mineral Soil by Nitrifying and Sulfur-Oxidizing Bacteria - The Leaching Potential of Indigenous Culture Enrichments. GEOMICROBIOLOGY JOURNAL. 2011; 28(3); 212-220. IF: 1.830! 2010) / ZIT: 0Scholl-Burgi, S.; Schroecksnadel, S.; Jenny, M.; Karall, D.; Fuchs, D.: Chronic Immune Stimulation May Cause Moderate Impairment of Phenylalanine 4-hydroxylase. PTERIDINES. 2011; 22(4); 120-125. IF: 0.404 ! Sonnleitner, R.; Redl, B.; Pipal, A.; Schinner, F.: Chemolithotrophic Metal Mobilization from Dolomite. GEOMICROBIOLOGY JOURNAL. 2011; 28(8); 651-659. IF: 1.830! Schroecksnadel, S.; Jenny, M.; Fuchs, D.: Myelomonocytic THP-1 Cells for In Vitro Testing of Immunomodulatory Properties of Nanoparticles. JOURNAL OF BIOMEDICAL NANOTECHNOLOGY. 2011; 7(1); 209-210. IF: 2.626! Sonnleitner, R.; Redl, B.; Schinner, F.: Microbial Mobilization of Major and Trace Elements from Catchment Rock Samples of a High Mountain Lake in the European Alps. " ARCTIC ANTARCTIC AND ALPINE RESEARCH. 2011; 43(3); 465-473. IF: 1.600! 109 ! The Biocenter! Publications 2011! Sperner-Unterweger, B.; Neurauter, G.; Klieber, M.; Kurz, K.; Meraner, V.; Zeimet, A.; Fuchs, D.: Enhanced tryptophan degradation in patients with ovarian carcinoma correlates with several serum soluble immune activation markers. IMMUNOBIOLOGY. 2011; 216(3); 296-301. IF: 4.114! Spudich, S.; Gisslen, M.; Hagberg, L.; Lee, E.; Liegler, T.; Brew, B.; Fuchs, D.; Tambussi, G.; Cinque, P.; Hecht, FM.; Price, RW.: Central Nervous System Immune Activation Characterizes Primary Human Immunodeficiency Virus 1 Infection Even in Participants With Minimal Cerebrospinal Fluid Viral Burden. JOURNAL OF INFECTIOUS DISEASES. 2011; 204(5); 753-760. IF: 6.288! Staudinger, T.; Pipal, A.; Redl, B.: Molecular analysis of the prevalent microbiota of human male and female forehead skin compared to forearm skin and the influence of make-up. JOURNAL OF APPLIED MICROBIOLOGY. 2011; 110(6); 1381-1389. IF: 2.365! Steinbach, Karin; McDonald, Claire L.; Reindl, Markus; Schweigreiter, Rüdiger; Bandtlow, Christine; Martin, Roland: Nogo-receptors NgR1 and NgR2 do not mediate regulation of CD4 T helper responses and CNS repair in experimental autoimmune encephalomyelitis. PLOS ONE. 2011; 6 (11); e26341. IF: 4.411! Sublette, ME.; Galfalvy, HC.; Fuchs, D.; Lapidus, M.; Grunebaum, MF.; Oquendo, MA.; Mann, JJ.; Postolache, TT.: Plasma kynurenine levels are elevated in suicide attempters with major depressive disorder. BRAIN BEHAVIOR AND IMMUNITY. 2011; 25(6); 1272-1278. IF: 3.956! Thurner, GC.; Abdelmoez, AA.; Wallnoefer, EA.; Rohr, I.; Klammsteiner, N.; Talasz, H.; Kremser, C.; Jaschke, W.; Debbage, P.: MRI Molecular imaging with albumin nanoparticles: achievements and challenges. INTERNATIONAL JOURNAL OF CLINICAL PHARMACOLOGY AND THERAPEUTICS. 2011; 49(1); 65-66. IF: 1.189! Tishchenko, S.; Nikonova, E.; Kostareva, O.; Gabdulkhakov, A.; Piendl, W.; Nevskaya, N.; Garber, M.; Nikonov, S.: Structural analysis of interdomain mobility in ribosomal L1 proteins. ACTA CRYSTALLOGRAPHICA SECTION D-BIOLOGICAL CRYSTALLOGRAPHY. 2011; 67(5); 1023-1027. IF: 6.326! Valente, S.; Tardugno, M.; Conte, M.; Cirilli, R.; Perrone, A.; Ragno, R.; Simeoni, S.; Tramontano, A.; Massa, S.; Nebbioso, A.; Miceli, M.; Franci, G.; Brosch, G.; Altucci, L.; Mai, A.: Novel Cinnamyl Hydroxyamides and 2-Aminoanilides as Histone Deacetylase Inhibitors: Apoptotic Induction and Cytodifferentiation Activity. CHEMMEDCHEM. 2011; 6(4); 698-712. IF: 3.306! 110 ! Vodisch, M.; Scherlach, K.; Winkler, R.; Hertweck, C.; Braun, HP.; Roth, M.; Haas, H.; Werner, ER.; Brakhage, AA.; Kniemeyer, O.: Analysis of the Aspergillus fumigatus Proteome Reveals Metabolic Changes and the Activation of the Pseurotin A Biosynthesis Gene Cluster in Response to Hypoxia. JOURNAL OF PROTEOME RESEARCH. 2011; 10(5); 2508-2524. IF: 5.460! Wallnofer, EA.; Thurner, GC.; Abdelmoez, AA.; Rohr, I.; Klammsteiner, N.; Talasz, H.; Kremser, C.; Jaschke, W.; Debbage, P.: MRI molecular imaging with nanoparticles: a technical platform for early diagnosis of cancer. INTERNATIONAL JOURNAL OF CLINICAL PHARMACOLOGY AND THERAPEUTICS. 2011; 49(1); 73-74. IF: 1.189 ! Westerman, BA.; Braat, AK.; Taub, N.; Potman, M.; Vissers, JH. A.; Blom, M.; Verhoeven, E.; Stoop, H.; Gillis, A.; Velds, A.; Nijkamp, W.; Beijersbergen, R.; Huber, LA.; Looijenga, LH. J.; van Lohuizen, M.: A genome-wide RNAi screen in mouse embryonic stem cells identifies Mp1 as a key mediator of differentiation. JOURNAL OF EXPERIMENTAL MEDICINE. 2011; 208(13); 2675-2689. IF: 14.776! Wiegmans, AP.; Alsop, AE.; Bots, M.; Cluse, LA.; Williams, SP.; Banks, KM.; Ralli, R.; Scott, CL.; Frenzel, A.; Villunger, A.; Johnstone, RW.: Deciphering the Molecular Events Necessary for Synergistic Tumor Cell Apoptosis Mediated by the Histone Deacetylase Inhibitor Vorinostat and the BH3 Mimetic ABT-737. CANCER RESEARCH. 2011; 71(10); 3603-3615. IF: 8.234 ! Reviews! Adell, MA. Y.; Teis, D.: Assembly and disassembly of the ESCRT-III membrane scission complex. FEBS LETTERS. 2011; 585(20); 3191-3196. IF: 3.601! Barisic, M.; Geley, S.: Spindly switch controls anaphase Spindly and RZZ functions in chromosome attachment and mitotic checkpoint control. CELL CYCLE. 2011; 10(3); 449-456. IF: 4.999! Chara, O.; Espelt, MV.; Krumschnabel, G.; Schwarzbaum, PJ.: Regulatory Volume Decrease and P Receptor Signaling in Fish Cells: Mechanisms, Physiology, and Modeling Approaches. JOURNAL OF EXPERIMENTAL ZOOLOGY. PART A, ECOLOGICAL GENETICS AND PHYSIOLOGY. 2011; 315A(4); 175-202. IF: 0! de Araujo, ME. G.; Huber, LA.; Stasyk, T.: Latex beads internalization and quantitative proteomics join forces to decipher the endosomal proteome. EXPERT REVIEW OF PROTEOMICS. 2011; 8(3); 303-307.IF: 4.406! The Biocenter! Publications 2011! Editorials! Grundtman, C.; Wick, G.: The autoimmune concept of atherosclerosis. CURRENT OPINION IN LIPIDOLOGY. 2011; 22(5); 327-334. IF: 6.636! Baumgartner, F.; Villunger, A.: Apoptosis: A Barrier Against Cancer No More? HEPATOLOGY. 2011; 54(4); 1121-1124. IF: 10.885! Hegedus, N.; Leiter, E.; Kovacs, B.; Tomori, V.; Kwon, NJ.; Emri, T.; Marx, F.; Batta, G.; Csernoch, L.; Haas, H.; Yu, JH.; Pocsi, I.: The small molecular mass antifungal protein of Penicillium chrysogenum - a mechanism of action oriented review. JOURNAL OF BASIC MICROBIOLOGY. 2011; 51(6); 561-571. IF: 1.395! Bock, FJ.; Villunger, A.: GSK3 TIPping Off p53 to Unleash PUMA. MOLECULAR CELL. 2011; 42 (5); 555-556. IF: 14.194! McDonald, CL.; Bandtlow, C.; Reindl, M.: Targeting the Nogo Receptor Complex in Diseases of the Central Nervous System. CURRENT MEDICINAL CHEMISTRY. 2011; 18(2); 234-244. IF: 4.630! Piatti, P.; Zeilner, A.; Lusser, A.: ATP-Dependent Chromatin Remodeling Factors and Their Roles in Affecting Nucleosome Fiber Composition. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES. 2011; 12(10); 6544-6565. IF: 2.279 ! Polacek, N.: The Ribosome Meets Synthetic Biology. CHEMBIOCHEM. 2011; 12(14); 2122-2124. IF: 3.945! Villunger, A.; Labi, V.; Bouillet, P.; Adams, J.; Strasser, A.: Can the analysis of BH3-only protein knockout mice clarify the issue of 'direct versus indirect' activation of Bax and Bak? CELL DEATH AND DIFFERENTIATION. 2011; 18(10); 1545-1546. IF: 9.050! Rechfeld, F.; Gruber, P.; Hofmann, J.; Kirchmair, J.: Modulators of Protein-Protein Interactions Novel Approaches in Targeting Protein Kinases and Other Pharmaceutically Relevant Biomolecules. CURRENT TOPICS IN MEDICINAL CHEMISTRY. 2011; 11(11); 1305-1319. IF: 4.112! Schrettl, M.; Haas, H.: Iron homeostasis-Achilles' heel of Aspergillus fumigatus? CURRENT OPINION IN MICROBIOLOGY. 2011; 14(4); 400-405. IF: 7.714! Schroecksnadel, S.; Maier, E.; Jenny, M.; Kurz, K.; Ueberall, F.; Fuchs, D.: The influence of food supplements like preservatives and colorants on immune regulation circuits in vitro. ALLERGOLOGIE. 2011; 34(4); 200-211. IF: 0.143! Schwarzbaum, PJ.; Krumschnabel, G.: Perspective - from describing to understanding environment-physiology relations: 50th birthday of a branch in ecophysiology. COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY A-MOLECULAR AND INTEGRATIVE PHYSIOLOGY. 2011; 158(1); 9-12. IF: 2.134! Werner, ER.; Blau, N.; Thoeny, B.: Tetrahydrobiopterin: biochemistry and pathophysiology. BIOCHEMICAL JOURNAL. 2011; 438(2); 397-414. IF: 5.016! Wiegers, GJ.; Kaufmann, M.; Tischner, D.; Villunger, A.: Shaping the T-cell repertoire: a matter of life and death. IMMUNOLOGY AND CELL BIOLOGY. 2011; 89(1); 33-39. IF: 3.741! 113 Publications in 2011! 111 ! The Biocenter! Publications 2012! Almanzar, G.; Öllinger, R.; Leuenberger, J.; Onestingel, E.; Rantner, B.; Zehm, S.; Cardini, B.; Van der Zee, R.; Grundtman, C.; Wick, G.: Autoreactive HSP60 epitope-specific T-cells in early human atherosclerotic lesions. J AUTOIMMUN. 2012; 39(4); 441-450.! Charoentong, P.; Angelova, M.; Efremova, M.; Gallasch, R.; Hackl, H.; Galon, J.; Trajanoski, Z.: Bioinformatics for cancer immunology and immunotherapy. CANCER IMMUNOL IMMUNOTHER. 2012; 61(11); 1885-1903.! Angel, TE.; Jacobs, JM.; Spudich, SS.; Gritsenko, MA.; Fuchs, D.; Liegler, T.; Zetterberg, H.; Camp, DG, 2nd.; Price, RW.; Smith, RD.: The cerebrospinal fluid proteome in HIV infection: change associated with disease severity. CLIN PROTEOMICS. 2012; 9(1); 3.! Charoentong, .P.; Tong, D.; Trajanoski, Z..; Zeilinger, R.: A Sequence Based Validation of Gene Expression Microarray Data. AM J BIOINFORM. 2012. 1:1-9! Auer, M.; Schweigreiter, R.; Hausott, B.; Thongrong, S.; Höltje, M.; Just, I.; Bandtlow, C.; Klimaschewski, L.: Rho-independent stimulation of axon outgrowth and activation of the ERK and Akt signaling pathways by C3 transferase in sensory neurons. FRONT CELL NEUROSCI. 2012; 6; 43.! Baydar, M.; Capan, Z.; Girgin, G.; Palabiyik, SS.; Sahin, G.; Fuchs, D.; Baydar, T.: Evaluation of tetrahydrobiopterin pathway in operating room workers: changes in biopterin status and tryptophan metabolism. BULL ENVIRON CONTAM TOXICOL. 2012; 89(6); 1125-1128.! Bellmann-Weiler, R.; Schroll, A.; Engl, S.; Nairz, M.; Talasz, H.; Seifert, M.; Weiss, G.: Neutrophil gelatinase-associated lipocalin and interleukin-10 regulate intramacrophage Chlamydia pneumoniae replication by modulating intracellular iron homeostasis. IMMUNOBIOLOGY. 2012; epub ahead of print.! Bock, FJ.; Krumschnabel, G.; Manzl, C.; Peintner, L.; Tanzer, MC.; Hermann-Kleiter, N.; Baier, G.; Llacuna, L.; Yelamos, J.; Villunger, A.: Loss of PIDD limits NF-"B activation and cytokine production but not cell survival or transformation after DNA damage. CELL DEATH DIFFER. 2012; epub ahead of print.! Bock, FJ.; Peintner, L.; Tanzer, M.; Manzl, C.; Villunger, A.: P53-induced protein with a death domain (PIDD): master of puppets? ONCOGENE. 2012; 31(45); 4733-4739.! Borrie, SC.; Baeumer, BE.; Bandtlow, CE.: The Nogo-66 receptor family in the intact and diseased CNS. CELL TISSUE RES. 2012; 349(1); 105-117.! Brunner, S.; Herndler-Brandstetter, D.; Arnold, CR.; Wiegers, GJ.; Villunger, A.; Hackl, M.; Grillari, J.; Moreno-Villanueva, M.; Bürkle, A.; Grubeck-Loebenstein, B.: Upregulation of miR-24 is associated with a decreased DNA damage response upon etoposide treatment in highly differentiated CD8(+) T cells sensitizing them to apoptotic cell death. AGING CELL. 2012; 11(4); 579-587.! 112 ! Chung, D.; Haas, H.; Cramer, RA.: Coordination of hypoxia adaptation and iron homeostasis in human pathogenic fungi. FRONT MICROBIOL. 2012; 3; 381.! Ciardi, C.; Jenny, M.; Tschoner, A.; Ueberall, F.; Patsch, J.; Pedrini, M.; Ebenbichler, C.; Fuchs, D.: Food additives such as sodium sulphite, sodium benzoate and curcumin inhibit leptin release in lipopolysaccharide-treated murine adipocytes in vitro. BR J NUTR. 2012; 107(6); 826-833.! Ciprandi, G.; Fuchs, D.: Tryptophan, neopterin, and nitrite in allergy. ALLERGY. 2012; 67(8); 1083.! Crespo, JA.; Stöckl, P.; Ueberall, F.; Jenny, M.; Saria, A.; Zernig, G.: Activation of PKCzeta and PKMzeta in the nucleus accumbens core is necessary for the retrieval, consolidation and reconsolidation of drug memory. PLOS ONE. 2012; 7(2); e30502.! Crespo, JA.; Stöckl, P.; Ueberall, F.; Jenny, M.; Saria, A.; Zernig, G.: Activation of PKCzeta and PKMzeta in the nucleus accumbens core is necessary for the retrieval, consolidation and reconsolidation of drug memory. PLoS One. 2012; 7 (2): e30502, IF: 4,092! Duszka, K.; Bogner-Strauss, JG.; Hackl, H.; Rieder, D.; Neuhold, C.; Prokesch, A.; Trajanoski, Z.; Krogsdam, A-M.: Nr4a1 is required for fasting-induced down-regulation of Ppar!2 in white adipose tissue. MOL ENDOCRINOL. 2013; 27(1); 135-149.! De Smet, CH..; Vittone, E.; Scherer, M.; Houweling, M.; Liebisch, G.; Brouwers, JF.; de Kroon, AI..; Duszka, K.; Bogner-Strauss, JG.; Hackl, H.; Rieder, D.; Neuhold, C.; Prokesch, A.; Trajanoski, Z.; Krogsdam, AM.: Nr4a1 is required for fasting-induced Pparg2 down regulation in white adipose. MOL ENDOCRINOL. 2012 (in press) ! Eigentler, A.; Pócsi, I.; Marx, F.: The anisin1 gene encodes a defensin-like protein and supports the fitness of Aspergillus nidulans. ARCH MICROBIOL. 2012; 194(6); 427-437.! The Biocenter! Publications 2012! Eisenstecken, E.; Gostner, JM.; Fuchs, D.; Überall, F.: Molekulare Stoffwechselsensorik bei durch Adipositas induzierter Entzündung. SCHWEIZERISCHE ZEITSCHRIFT FÜR GANZHEITSMEDIZIN / SWISS JOURNAL OF INTEGRATIVE MEDICINE. 2012; 24(4); 221-231.! Eitzinger, C.; Ehrlenbach, S.; Lindner, H.; Kremser, L.; Gottardi, W.; Debabov, D.; Anderson, M.; Nagl, M.; Orth, D.: N-chlorotaurine, a long-lived oxidant produced by human leukocytes, inactivates Shiga toxin of enterohemorrhagic Escherichia coli. PLOS ONE. 2012; 7(11); e47105.! Ek, W.; Sahlqvist, A-S.; Crooks, L.; Sgonc, R.; Dietrich, H.; Wick, G.; Ekwall, O.; Andersson, L.; Carlborg, Ö.; Kämpe, O.; Kerje, S.: Mapping QTL affecting a systemic sclerosis-like disorder in a cross between UCD-200 and red jungle fowl chickens. DEV COMP IMMUNOL. 2012; 38(2); 352-359.! Erlacher, MD.; Polacek, N.: Probing functions of the ribosomal peptidyl transferase center by nucleotide analog interference. METHODS MOL BIOL. 2012; 848; 215-226.! Fava, L.; Bock, F.; Geley, S.; Villunger, A.: Caspase-2 at a glance. J CELL SCI. 2012; epub ahead of print.! Feldman-Salit, A.; Wirtz, M.; Lenherr, ED.; Throm, C.; Hothorn, M.; Scheffzek, K.; Hell, R.; Wade, RC.: Allosterically gated enzyme dynamics in the cysteine synthase complex regulate cysteine biosynthesis in Arabidopsis thaliana. STRUCTURE. 2012; 20(2); 292-302.! Fischer, M.; Snajder, R.; Pabinger, S.; Dander, A.; Schossig, A.; Zschocke, J.; Trajanoski, Z.; Stocker, G.: SIMPLEX: cloud-enabled pipeline for the comprehensive analysis of exome sequencing data. PLOS ONE. 2012; 7(8); e41948.! Fischnaller, S.; Dowell, FE.; Lusser, A.; Schlick-Steiner, BC.; Steiner, FM.: Non-destructive species identification of Drosophila obscura and D. subobscura (Diptera) using near-infrared spectroscopy. FLY (AUSTIN). 2012; 6(4); 284-289.! Fuchs, D.: Einfluss von Konservierungsmitteln und Farbstoffen auf die leptinfreisetzung in vitro. ERNÄHRUNG/NUTRITION. 2012; 36; 209.! Fuchs, JE.; Huber, RG.; Von Grafenstein, S.; Wallnoefer, HG.; Spitzer, GM.; Fuchs, D.; Liedl, KR.: Dynamic regulation of phenylalanine hydroxylase by simulated redox manipulation. PLOS ONE. 2012; 7(12); e53005.! García-Lestón, J.; Roma-Torres, J.; Mayan, O.; Schroecksnadel, S.; Fuchs, D.; Moreira, AO.; Pásaro, E.; Méndez, J.; Teixeira, JP.; Laffon, B.: Assessment of immunotoxicity parameters in individuals occupationally exposed to lead. J TOXICOL ENVIRON HEALTH PART A. 2012; 75 (13-15); 807-818.! Gebetsberger, J.; Zywicki, M.; Künzi, A.; Polacek, N.: tRNA-Derived Fragments Target the Ribosome and Function as Regulatory Non-Coding RNA in Haloferax volcanii. ARCHAEA. 2012; 2012; 260909.! Gisslen, M.; Fuchs, D.; Hagberg, L.; Svennerholm, B.; Zetterberg, H.: Cerebrospinal fluid viral breakthrough in two HIV-infected subjects on darunavir/ritonavir monotherapy. SCAND J INFECT DIS. 2012; 44(12); 997-1000.! Goebel, G.; Berger, R.; Strasak, AM.; Egle, D.; Müller-Holzner, E.; Schmidt, S.; Rainer, J.; Presul, E.; Parson, W.; Lang, S.; Jones, A.; Widschwendter, M.; Fiegl, H.: Elevated mRNA expression of CHAC1 splicing variants is associated with poor outcome for breast and ovarian cancer patients. BR J CANCER. 2012; 106(1); 189-198.! Gostner, JM.; Wrulich, OA.; Jenny, M.; Fuchs, D.; Ueberall, F.: An update on the strategies in multicomponent activity monitoring within the phytopharmaceutical field. BMC COMPLEMENT ALTERN MED. 2012; 12; 18.! Fuchs, D.: Antioxidant intake and allergic disease. CLIN EXP ALLERGY. 2012; 42(10); 1420-1422.! Gostner, JM.; Schröcksnadel, S.; Becker, K.; Jenny, M.; Schennach, H.; Überall, F.; Fuchs, D.: Antimalarial drug chloroquine counteracts activation of indoleamine (2,3)-dioxygenase activity in human PBMC. FEBS OPEN BIO. 2012; 2; 241-245.! Fuchs, D.; Jamnig, H.; Heininger, P.; Klieber, M.; Schroecksnadel, S.; Fiegl, M.; Hackl, M.; Denz, H.; Amann, A.: Decline of exhaled isoprene in lung cancer patients correlates with immune activation. J BREATH RES. 2012; 6(2); 027101.! Graber, D.; Trappl, K.; Steger, J.; Geiermann, A-S.; Rigger, L.; Moroder, H.; Polacek, N.; Micura, R.: Deoxyribozyme-based, semisynthetic access to stable peptidyl-tRNAs exemplified by tRNAVal carrying a macrolide antibiotic resistance peptide. METHODS MOL BIOL. 2012; 848; 201-213.! 113 ! The Biocenter! Publications 2012! Gsaller, F.; Eisendle, M.; Lechner, BE.; Schrettl, M.; Lindner, H.; Müller, D.; Geley, S.; Haas, H.: The interplay between vacuolar and siderophore-mediated iron storage in Aspergillus fumigatus. METALLOMICS. 2012; 4(12); 1262-1270.! Knoflach, M.; Kiechl, S.; Mantovani, A.; Cuccovillo, I.; Bottazzi, B.; Xu, Q.; Xiao, Q.; Gasperi, A.; Mayr, A.; Kehrer, M.; Willeit, J.; Wick, G.: Pentraxin-3 as a marker of advanced atherosclerosis results from the Bruneck, ARMY and ARFY Studies. PLOS ONE. 2012; 7(2); e31474.! Haas, H.: Iron - A Key Nexus in the Virulence of Aspergillus fumigatus. FRONT MICROBIOL. 2012; 3; 28.! Kofler, H.; Kurz, K.; Grander, G.; Fuchs, D.: Specific immunotherapy normalizes tryptophan concentrations in patients with allergic rhinitis. INT ARCH ALLERGY IMMUNOL. 2012; 159(4); 416-421.! Haffner, MC.; Laimer, J.; Chaux, A.; Schäfer, G.; Obrist, P.; Brunner, A.; Kronberger, IE.; Laimer, K.; Gurel, B.; Koller, J-B.; Seifarth, C.; Zelger, B.; Klocker, H.; Rasse, M.; Doppler, W.; Bander, NH.: High expression of prostate-specific membrane antigen in the tumor-associated neo-vasculature is associated with worse prognosis in squamous cell carcinoma of the oral cavity. MOD PATHOL. 2012; 25(8); 1079-1085.! Hammerer-Lercher, A.; Moser, C.; Leichtfried, V.; Schobersberger, W.; Griesmacher, A.; Fuchs, D.: Comparison of a commercial urinary neopterin radioimmunoassay with high performance liquid chromatography. CLIN CHEM LAB MED. 2012; 50(6); 1075-1078.! Kurz, K.; Garimorth, K.; Joannidis, M.; Fuchs, D.; Petzer, A.; Weiss, G.: Altered immune responses during septicaemia in patients suffering from haematological malignancies. INT J IMMUNOPATHOL PHARMACOL. 2012; 25(1); 147-156.! Hannesdóttir, L.; Daschil, N.; Philipp, S.; Tymoszuk, P.; Müller-Holzner, E.; Klima, G.; Verdorfer, I.; Doppler, W.: MMTV-neu mice deficient in STAT1 are susceptible to develop ovarian teratomas. INT J DEV BIOL. 2012; 56(4); 279-283.! Kurz, K.; Fiegl, M.; Holzner, B.; Giesinger, J.; Pircher, M.; Weiss, G.; Denz, HA.; Fuchs, D.: Fatigue in patients with lung cancer is related with accelerated tryptophan breakdown. PLOS ONE. 2012; 7 (5); e36956.! Kurz, K.; Teerlink, T.; Sarcletti, M.; Weiss, G.; Zangerle, R.; Fuchs, D.: Asymmetric dimethylarginine concentrations decrease in patients with HIV infection under antiretroviral therapy. ANTIVIR THER (LOND). 2012; 17(6); 1021-1027.! Heidegger, I.; Ofer, P.; Doppler, W.; Rotter, V.; Klocker, H.; Massoner, P.: Diverse functions of IGF/ insulin signaling in malignant and noncancerous prostate cells: proliferation in cancer cells and differentiation in noncancerous cells. ENDOCRINOLOGY. 2012; 153(10); 4633-4643.! Hoefer, J.; Schäfer, G.; Klocker, H.; Erb, HHH.; Mills, IG.; Hengst, L.; Puhr, M.; Culig, Z.: PIAS1 is increased in human prostate cancer and enhances proliferation through inhibition of p21. AM J PATHOL. 2012; 180(5); 2097-2107.! 114 ! Kreutmayer, S.; Csordas, A.; Kern, J.; Maass, V.; Almanzar, G.; Offterdinger, M.; Ollinger, R.; Maass, M.; Wick, G.: Chlamydia pneumoniae infection acts as an endothelial stressor with the potential to initiate the earliest heat shock protein 60-dependent inflammatory stage of atherosclerosis. CELL STRESS CHAPERONES. 2012.! Ladurner, A.; Schmitt, CA.; Schachner, D.; Atanasov, AG.; Werner, ER.; Dirsch, VM.; Heiss, EH.: Ascorbate stimulates endothelial nitric oxide synthase enzyme activity by rapid modulation of its phosphorylation status. FREE RADIC BIOL MED. 2012; 52(10); 2082-2090.! Jäkel, H.; Peschel, I.; Kunze, C.; Weinl, C.; Hengst, L.: Regulation of p27 (Kip1) by mitogeninduced tyrosine phosphorylation. CELL CYCLE. 2012; 11(10); 1910-1917.! Lanzinger, M.; Jürgens, B.; Hainz, U.; Dillinger, B.; Raberger, J.; Fuchs, D.; Heitger, A.: Ambivalent effects of dendritic cells displaying prostaglandin E2-induced indoleamine 2,3-dioxygenase. EUR J IMMUNOL. 2012; 42(5); 1117-1128.! Keller, MA.; Watschinger, K.; Lange, K.; Golderer, G.; Werner-Felmayer, G.; Hermetter, A.; Wanders, RJA.; Werner, ER.: Studying fatty aldehyde metabolism in living cells with pyrene-labeled compounds. J LIPID RES. 2012; 53(7); 1410-1416.! Lassance, L.; Miedl, H.; Konya, V.; Heinemann, A.; Ebner, B.; Hackl, H.; Desoye, G.; Hiden, U.: Differential response of arterial and venous endothelial cells to extracellular matrix is modulated by oxygen. HISTOCHEM CELL BIOL. 2012; epub ahead of print.! Kern, F.; Sarg, B.; Stasyk, T.; Hess, D.; Lindner, H.: The Nogo receptor 2 is a novel substrate of Fbs1. BIOCHEM BIOPHYS RES COMMUN. 2012; 417(3); 977-981.! Ligeti, E.; Welti, S.; Scheffzek, K.: Inhibition and termination of physiological responses by GTPase activating proteins. PHYSIOL REV. 2012; 92(1); 237-272.! The Biocenter! Publications 2012! Linde, J.; Hortschansky, P.; Fazius, E.; Brakhage, AA.; Guthke, R.; Haas, H.: Regulatory interactions for iron homeostasis in Aspergillus fumigatus inferred by a Systems Biology approach. BMC SYST BIOL. 2012; 6; 6.! López-Berges, MS.; Capilla, J.; Turrà, D.; Schafferer, L.; Matthijs, S.; Jöchl, C.; Cornelis, P.; Guarro, J.; Haas, H.; Di Pietro, A.: HapX-mediated iron homeostasis is essential for rhizosphere competence and virulence of the soilborne pathogen Fusarium oxysporum. PLANT CELL. 2012; 24(9); 3805-3822.! Maglione, M.; Cardini, B.; Oberhuber, R.; Watschinger, K.; Jenny, M.; Gostner, J.; Hermann, M.; Obrist, P.; Margreiter, R.; Pratschke, J.; Brandacher, G.; Werner, ER.: Prevention of lethal murine pancreas ischemia reperfusion injury is specific for tetrahydrobiopterin. TRANSPL INT. 2012; 25 (10); 1084-1095.! Mahlknecht, P.; Stemberger, S.; Sprenger, F.; Rainer, J.; Hametner, E.; Kirchmair, R.; Grabmer, C.; Scherfler, C.; Wenning, GK.; Seppi, K.; Poewe, W.; Reindl, M.: An antibody microarray analysis of serum cytokines in neurodegenerative Parkinsonian syndromes. PROTEOME SCI. 2012; 10(1); 71.! Mikolcevic, P.; Rainer, J.; Geley, S.: Orphan kinases turn eccentric: a new class of cyclin Yactivated, membrane-targeted CDKs. CELL CYCLE. 2012; 11(20); 3758-3768.! Mikolcevic, P.; Sigl, R.; Rauch, V.; Hess, MW.; Pfaller, K.; Barisic, M.; Pelliniemi, LJ.; Boesl, M.; Geley, S.: Cyclin-dependent kinase 16/PCTAIRE kinase 1 is activated by cyclin Y and is essential for spermatogenesis. MOL CELL BIOL. 2012; 32(4); 868-879.! Mochalski, P.; Krapf, K.; Ager, C.; Wiesenhofer, H.; Agapiou, A.; Statheropoulos, M.; Fuchs, D.; Ellmerer, E.; Buszewski, B.; Amann, A.: Temporal profiling of human urine VOCs and its potential role under the ruins of collapsed buildings. TOXICOL MECH METHODS. 2012; 22(7); 502-511.! Montanez, E.; Karaköse, E.; Tischner, D.; Villunger, A.; Fässler, R.: PINCH-1 promotes Bcl-2dependent survival signalling and inhibits JNK-mediated apoptosis in the primitive endoderm. J CELL SCI. 2012; 125; 5233-5240.! Mueller, M.; Adell, MAY.; Teis, D.: Membrane abscission: first glimpse at dynamic ESCRTs. CURR BIOL. 2012; 22(15); R603-605.! Mansha, M.; Wasim, M.; Kofler, A.; Ploner, C.: Expression and glucocorticoid-regulation of “Bam”, a novel BH3-only transcript in acute lymphoblastic leukemia. MOL BIOL REP. 2012; 39(5); 6007-6013.! Murr, C.; Pilz, S.; Grammer, TB.; Kleber, ME.; Böhm, BO.; März, W.; Fuchs, D.: Low serum zinc levels in patients undergoing coronary angiography correlate with immune activation and inflammation. J TRACE ELEM MED BIOL. 2012; 26(1); 26-30.! Mansha, M.; Wasim, M.; Ploner, C.; Hussain, A.; Latif, AA.; Tariq, M.; Kofler, A.: Problems encountered in bicistronic IRES-GFP expression vectors employed in functional analyses of GCinduced genes. MOL BIOL REP. 2012; 39(12); 10227-10234.! Murr, C.; Pilz, S.; Grammer, TB.; Kleber, ME.; Meinitzer, A.; Boehm, BO.; März, W.; Fuchs, D.: Vitamin D deficiency parallels inflammation and immune activation, the Ludwigshafen Risk and Cardiovascular Health (LURIC) study. CLIN CHEM LAB MED. 2012; epub ahead of print.! Manzl, C.; Peintner, L.; Krumschnabel, G.; Bock, F.; Labi, V.; Drach, M.; Newbold, A.; Johnstone, R.; Villunger, A.: PIDDosome-independent tumor suppression by Caspase-2. CELL DEATH DIFFER. 2012; 19(10); 1722-1732.! Nikoulina, SE.; Fuchs, D.; Moheno, P.: Effect of orally administered dipterinyl calcium pentahydrate on oral glucose tolerance in diet-induced obese mice. DIABETES METAB SYNDR OBES. 2012; 5; 43-47.! Mellert, K.; Lamla, M.; Scheffzek, K.; Wittig, R.; Kaufmann, D.: Enhancing endosomal escape of transduced proteins by photochemical internalisation. PLOS ONE. 2012; 7(12); e52473.! Ottina, E.; Grespi, F.; Tischner, D.; Soratroi, C.; Geley, S.; Ploner, A.; Reichardt, HM.; Villunger, A.; Herold, MJ.: Targeting antiapoptotic A1/Bfl-1 by in vivo RNAi reveals multiple roles in leukocyte development in mice. BLOOD. 2012; 119(25); 6032-6042.! Micutkova, L.; Hermann, M.; Offterdinger, M.; Hess, MW.; Matscheski, A.; Pircher, H.; Mück, C.; Ebner, H-L.; Laich, A.; Ferrando-May, E.; Zwerschke, W.; Huber, LA.; Jansen-Dürr, P.: Analysis of the cellular uptake and nuclear delivery of insulin-like growth factor binding protein-3 in human osteosarcoma cells. INT J CANCER. 2012; 130(7); 1544-1557.! Ottina, E.; Tischner, D.; Herold, MJ.; Villunger, A.: A1/Bfl-1 in leukocyte development and cell death. EXP CELL RES. 2012; 318(11); 1291-1303.! 115 ! The Biocenter! Publications 2012! Peluso, MJ.; Ferretti, F.; Peterson, J.; Lee, E.; Fuchs, D.; Boschini, A.; Gisslén, M.; Angoff, N.; Price, RW.; Cinque, P.; Spudich, S.: Cerebrospinal fluid HIV escape associated with progressive neurologic dysfunction in patients on antiretroviral therapy with well controlled plasma viral load. AIDS. 2012; 26(14); 1765-1774.! Petrik, M.; Franssen, GM.; Haas, H.; Laverman, P.; Hörtnagl, C.; Schrettl, M.; Helbok, A.; LassFlörl, C.; Decristoforo, C.: Preclinical evaluation of two 68Ga-siderophores as potential radiopharmaceuticals for Aspergillus fumigatus infection imaging. EUR J NUCL MED MOL IMAGING. 2012; 39(7); 1175-1183.! Petrik, M.; Haas, H.; Schrettl, M.; Helbok, A.; Blatzer, M.; Decristoforo, C.: In vitro and in vivo evaluation of selected 68Ga-siderophores for infection imaging. NUCL MED BIOL. 2012; 39(3); 361-369.! Pfeifer, S.; Schreder, M.; Bolomsky, A.; Graffi, S.; Fuchs, D.; Sahota, SS.; Ludwig, H.; Zojer, N.: Induction of indoleamine-2,3 dioxygenase in bone marrow stromal cells inhibits myeloma cell growth. J CANCER RES CLIN ONCOL. 2012; 138(11); 1821-1830.! Rabensteiner, E.; Wolfram, D.; Backovic, A.; Böck, G.; Mayerl, C.; Parson, W.; Huss, H.; PizaKatzer, H.; Wick, G.: T-Regulatory Cells and Th17 Cells in Perisilicone-Implant Capsular Fbrosis. PLASTIC & RECONSTRUCTIVE SURGERY, 129 (2): 327e-337e (2012)! Rainer, J.; Lelong, J.; Bindreither, D.; Mantinger, C.; Ploner, C.; Geley, S.; Kofler, R.: Research resource: transcriptional response to glucocorticoids in childhood acute lymphoblastic leukemia. MOL ENDOCRINOL. 2012; 26(1); 178-193.! Ribe, EM.; Jean, YY.; Goldstein, RL.; Manzl, C.; Stefanis, L.; Villunger, A.; Troy, CM.: Neuronal caspase 2 activity and function requires RAIDD, but not PIDD. BIOCHEM J. 2012; 444(3); 591-599.! Schmidt, K.; Neubauer, A.; Kolesnik, B.; Stasch, J-P.; Werner, ER.; Gorren, ACF.; Mayer, B.: Tetrahydrobiopterin protects soluble guanylate cyclase against oxidative inactivation. MOL PHARMACOL. 2012; 82(3); 420-427.! Schmidt, O.; Teis, D.: The ESCRT machinery. CURR BIOL. 2012; 22(4); R116-120.! Schossig, A.; Wolf, NI.; Fischer, C.; Fischer, M.; Stocker, G.; Pabinger, S.; Dander, A.; Steiner, B.; Tönz, O.; Kotzot, D.; Haberlandt, E.; Amberger, A.; Burwinkel, B.; Wimmer, K.; Fauth, C.; GrondGinsbach, C.; Koch, MJ.; Deichmann, A.; Von Kalle, C.; Bartram, CR.; Kohlschütter, A.; Trajanoski, Z.; Zschocke, J.: Mutations in ROGDI Cause Kohlschütter-Tönz Syndrome. AM J HUM GENET. 2012; 90(4); 701-707.! Schroecksnadel, S.; Gostner, J.; Schennach, H.; Überall, F.; Fuchs, D.; Jenny, M.: Peripheral blood mononuclear cells versus myelomonocytic cell line THP-1 to test for immumodulatory properties of chemicals. J BIONANOSCI. 2012; 6; 134-141.! Schroecksnadel, S.; Kurz, K.; Weiss, G.; Fuchs, D.: Tryptophan catabolism during intracellular infection. J INFECT DIS. 2012; 205; 1617-1618.! Schroecksnadel, S.; Zaknun, C.; Schennach, H.; Jenny, M.; Fuchs, D.: Comparison of in vitro tests for antioxidant capacities and immunomodulatory properties of chemicals. J BIONANOSCI. 2012; 6; 127-133.! Schroecksnadel.; Kurz.; Weiss.; Fuchs, D.: Immune activation and neuropsychiatric symptoms in human immunodeficiency virus type 1 infection. NEUROBEHAVIORAL HIV MEDICINE. 2012; 2012 (4); 1.! Schubert, C.; Geser, W.; Noisternig, B.; Fuchs, D.; Welzenbach, N.; König, P.; Schüßler, G.; Ocaña-Peinado, FM.; Lampe, A.: Stress system dynamics during “life as it is lived”: an integrative single-case study on a healthy woman. PLOS ONE. 2012; 7(3); e29415.! Rieder, D.; Trajanoski, Z.; McNally, JG.: Transcription factories. FRONT GENET. 2012; 3; 221.! 116 ! Saeed, M.; Schwarze, F.; Loidl, A.; Meraner, J.; Lechner, M.; Loidl, P.: In vitro phosphorylation and acetylation of the murine pocket protein Rb2/p130. PLOS ONE. 2012; 7(9); e46174.! Sebald, J.; Morettini, S.; Podhraski, V.; Lass-Flörl, C.; Lusser, A.: CHD1 contributes to intestinal resistance against infection by P. aeruginosa in Drosophila melanogaster. PLOS ONE. 2012; 7(8); e43144.! Scheffzek, K.; Welti, S.: Pleckstrin homology (PH) like domains - versatile modules in proteinprotein interaction platforms. FEBS LETT. 2012; 586(17); 2662-2673.! Sgonc, R.; Gruber, J.: Age-Related Aspects of Cutaneous Wound Healing: A Mini-Review. GERONTOLOGY. 2012; epub ahead of print.! The Biocenter! Publications 2012! Skreka, K.; Schafferer, S.; Nat, I-R.; Zywicki, M.; Salti, A.; Apostolova, G.; Griehl, M.; Rederstorff, M.; Dechant, G.; Hüttenhofer, A.: Identification of differentially expressed non-coding RNAs in embryonic stem cell neural differentiation. NUCLEIC ACIDS RES. 2012; 40(13); 6001-6015.! Tischner, D.; Wiegers, GJ.; Fiegl, H.; Drach, M.; Villunger, A.: Mutual antagonism of TGF-beta and Interleukin-2 in cell survival and lineage commitment of induced regulatory T cells. CELL DEATH DIFFER. 2012; 19(8); 1277-1287.! Skreka, K.; Zywicki, M.; Karbiener, M.; Hüttenhofer, A.; Scheideler, M.; Rederstorff, M.: Expression Profiling of a Heterogeneous Population of ncRNAs Employing a Mixed DNA/LNA Microarray. J NUCLEIC ACIDS. 2012; 2012; 283560.! Tischner, D.; Gaggl, I.; Peschel, I.; Kaufmann, M.; Tuzlak, S.; Drach, M.; Thuille, N.; Villunger, A.; Jan Wiegers, G.: Defective cell death signalling along the Bcl-2 regulated apoptosis pathway compromises Treg cell development and limits their functionality in mice. J AUTOIMMUN. 2012; 38 (1); 59-69.! Stasyk, T.; Huber, LA.: Mapping in vivo signal transduction defects by phosphoproteomics. TRENDS MOL MED. 2012; 18(1); 43-51.! Sucher, R.; Fischler, K.; Oberhuber, R.; Kronberger, I.; Margreiter, C.; Ollinger, R.; Schneeberger, S.; Fuchs, D.; Werner, ER.; Watschinger, K.; Zelger, B.; Tellides, G.; Pilat, N.; Pratschke, J.; Margreiter, R.; Wekerle, T.; Brandacher, G.: IDO and regulatory T cell support are critical for cytotoxic T lymphocyte-associated Ag-4 Ig-mediated long-term solid organ allograft survival. J IMMUNOL. 2012; 188(1); 37-46.! Sucher, R.; Fischler, K.; Oberhuber, R.; Kronberger, I.; Margreiter, C.; Ollinger, R.; Schneeberger, S.; Fuchs, D.; Werner, ER.; Watschinger, K.; Zelger, B.; Tellides, G.; Pilat, N.; Pratschke, J.; Margreiter, R.; Wekerle, T.; Brandacher, G.: Indoleamine 2,3-dioxygenase (IDO) and Treg Support are Critical for CTLA4Ig-Mediated Long-term Solid Organ Allograft Survival. J IMMUNOL. 2012; 188(1); 37-46.! Taub, N.; Nairz, M.; Hilber, D.; Hess, MW.; Weiss, G.; Huber, LA.: The late endosomal adaptor p14 is a macrophage host-defense factor against Salmonella infection. J CELL SCI. 2012; 125; 2698-2708! Thallinger, GG.; Obermayr, E.; Charoentong, P.; Tong, D.; Trajanoski, Z.; Zeilinger, R.: A Sequence Based Validation of Gene Expression Microarray Data. AMERICAN JOURNAL OF BIOINFORMATICS. 2012; 1(1); 1-9.! Thauerer, B.; Baumer, B.; Fellner, L.; Kuzdas, D.; Ramberger, M.; Baier-Bitterlich, G.: Guanosine Protects Neuronal PC12 Cells from Serum Deprivation-induced Cell Death. PTERIDINES. 2012; 23 (1); 27-32.! Thauerer, B.; Zur Nedden, S.; Baier-Bitterlich, G.: Purine nucleosides: neuroprotectants in hypoxic brain. J NEUROCHEM. 2012; 121(3); 329-342.! endogenous Tischner, D.; Villunger, A.: Bcl-G acquitted of murder! CELL DEATH DIS. 2012; 3; e405.! Tischner, D.; Manzl, C.; Soratroi, C.; Villunger, A.; Krumschnabel, G.: Necrosis-like death can engage multiple pro-apoptotic Bcl-2 protein family members. APOPTOSIS. 2012; 17(11); 1197-1209.! Toton, E.; Lisiak, N.; Rubis, B.; Budzianowski, J.; Gruber, P.; Hofmann, J.; Rybczynska, M.: The tetramethoxyflavone zapotin selectively activates protein kinase C epsilon, leading to its downmodulation accompanied by Bcl-2, c-Jun and c-Fos decrease. EUR J PHARMACOL. 2012; 682 (1-3); 21-28.! Vaccari, M.; Boasso, A.; Fenizia, C.; Fuchs, D.; Hryniewicz, A.; Morgan, T.; Weiss, D.; Doster, MN.; Heraud, JM.; Shearer, GM.; Franchini, G.: Fatal pancreatitis in simian immunodeficiency virus SIV (mac251)-infected macaques treated with 2’,3’-dideoxyinosine and stavudine following cytotoxic-Tlymphocyte-associated antigen 4 and indoleamine 2,3-dioxygenase blockade. J VIROL. 2012; 86 (1); 108-113.! Villar, D.; Ortiz-Barahona, A.; Gómez-Maldonado, L.; Pescador, N.; Sánchez-Cabo, F.; Hackl, H.; Rodriguez, BAT.; Trajanoski, Z.; Dopazo, A.; Huang, THM.; Yan, PS.; Del Peso, L.: Cooperativity of stress-responsive transcription factors in core hypoxia-inducible factor binding regions. PLOS ONE. 2012; 7(9); e45708.! Villunger, A.; Labi, V.; Bouillet, P.; Adams, J.; Strasser, A.: Can the analysis of BH3-only protein knockout mice clarify the issue of 'direct versus indirect' activation of Bax and Bak? Cell Death Differ 2012. 18: 1545-1546.! Vlijm, R.; Smitshuijzen, JSJ.; Lusser, A.; Dekker, C.: NAP1-assisted nucleosome assembly on DNA measured in real time by single-molecule magnetic tweezers. PLOS ONE. 2012; 7(9); e46306.! Wandke, C.; Barisic, M.; Sigl, R.; Rauch, V.; Wolf, F.; Amaro, AC.; Tan, CH.; Pereira, AJ.; Kutay, U.; Maiato, H.; Meraldi, P.; Geley, S.: Human chromokinesins promote chromosome congression and spindle microtubule dynamics during mitosis. J CELL BIOL. 2012; 198(5); 847-863.! 117 ! The Biocenter! Publications 2012! Watschinger, K.; Fuchs, JE.; Yarov-Yarovoy, V.; Keller, MA.; Golderer, G.; Hermetter, A.; WernerFelmayer, G.; Hulo, N.; Werner, ER.: Catalytic residues and a predicted structure of tetrahydrobiopterin-dependent alkylglycerol mono-oxygenase. BIOCHEM J. 2012; 443(1); 279-286.! Wick, G.; Öllinger, R.; Almanzar, G.: The Vascular-Associated Lymphoid Tissue (VALT). In INFLAMMATION AND ATHEROSCLEROSIS. edited by Wick G; Grundtman C Springer Vienna; 2012; 77-86.! Wolfram, D.; Rabensteiner, E.; Grundtman, C.; Böck, G.; Mayerl, C.; Parson, W.; Almanzar, G.; Hasenöhrl, C.; Piza-Katzer, H.; Wick, G.: T regulatory cells and TH17 cells in peri-silicone implant capsular fibrosis. PLAST RECONSTR SURG. 2012; 129(2); 327e-337e.! Yasmin, S.; Alcazar-Fuoli, L.; Gründlinger, M.; Puempel, T.; Cairns, T.; Blatzer, M.; Lopez, JF.; Grimalt, JO.; Bignell, E.; Haas, H.: Mevalonate governs interdependency of ergosterol and siderophore biosyntheses in the fungal pathogen Aspergillus fumigatus. PROC NATL ACAD SCI USA. 2012; 109(8); E497-504.! Zaknun, D.; Schroecksnadel, S.; Kurz, K.; Fuchs, D.: Potential role of antioxidant food supplements, preservatives and colorants in the pathogenesis of allergy and asthma. INT ARCH ALLERGY IMMUNOL. 2012; 157(2); 113-124.! Zeilner, A.; Piatti, P.; Lusser, A.: Chromatin Dynamics and Higher-Order Chromatin Organization. In ENCYCLOPEDIA OF MOLECULAR CELL BIOLOGY AND MOLECULAR MEDICINE. Wiley-VCH Verlag GmbH & Co. KGaA; 2012.! Zoller, H.; Schloegl, A.; Schroecksnadel, S.; Vogel, W.; Fuchs, D.: Interferon-alpha therapy in patients with hepatitis C virus infection increases plasma phenylalanine and the phenylalanine to tyrosine ratio. J INTERFERON CYTOKINE RES. 2012; 32(5); 216-220.! Zywicki, M.; Bakowska-Zywicka, K.; Polacek, N.: Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis. NUCLEIC ACIDS RES. 2012; 40(9); 4013-4024.! 129 Publications in 2011! 118 ! The Biocenter! Grants! Division ! Grantee ! Title of Grant ! ! ! ! ! Agency! 119 ! The Biocenter! Grants! Division 120 ! ! Grantee ! Title of Grant ! ! ! Agency! The Biocenter! Grants! Division ! Grantee ! Title of Grant ! ! ! ! ! Agency! 121 ! The Biocenter! Grants! Division 122 ! ! Grantee ! Title of Grant ! ! ! Agency! The Biocenter! Grants! Division ! Grantee ! Title of Grant ! ! ! ! ! Agency! 123 ! The Biocenter! Grants! Division 124 ! ! Grantee ! Title of Grant ! ! ! Agency! The Biocenter! Grants! Division ! Grantee ! Title of Grant ! ! ! ! ! Agency! 125 ! The Biocenter! Grants! Division 126 ! ! Grantee ! Title of Grant ! ! ! Agency! The Biocenter! Grants! Division ! Grantee ! Title of Grant ! ! ! ! ! Agency! bm:bwk: Bundesministerium f. Bildung, Wissenschaft u. Kunst, BMGF: Bundesministerium f. Gesundheit u. Familie, BMSG: Bundesministerium f. Soziale Sicherheit u. Generationen, BM:WF: Bundesministerium f. Wissenschaft u. Forschung, CD Labor: Christian Doppler Labor,, DFG: Deutsche Forschungsgemeinschaft, EU-FP6: European Union Framework Programme 6, FFG: Österr. Forschungsförderung GmbH, FFF: Forschungsförderungsfonds, FWF: Fonds Förderung der Wissenschaft, IFTZ: Integriertes Forschungs- und Therapiezentrum Innsbruck, IV Tirol: Industriellenvereinigung Tirol, HFSPO: Human Frontier Science Programme Organization, MFI: Medizinische Forschungsförderung Innsbruck, MUI: Medizinische Universität Innsbruck, ÖGES: Österr. Ges. f. Endokrinologie u. Stoffwechsel, OeNB: Österreichische Nationalbank, Tiroler ZS: Tiroler Zukunftsstiftung, TWF: Tiroler Wissenschaftsfonds, WK Tirol: Wirtschaftskammer Tirol! 127 ! The Biocenter! Artwork in the CCB! On Friday, April 19, 2013, Gabriele Werner-Felmayer (GWF) from the Division of Medical Biochemistry, introduced Ms. Helene Keller (HK) and her recent work that she has created for the Biocenter. The art work „CON‘SEQUENCES“ condenses the issues elaborated during a recent symposium „Genetics as Culture in a Consumerist Age“, organized by GWF and colleagues. The artwork respresents the 22 human chromosomes plus the 2 sex chromosomes X and Y, made out of acryl tubes with internal LED lights, with texts on bioethical issues elaborated by GWF.! Pictures made during the Openeing ceremony by S.S. ! 128 ! TCCAGTGGTATTCAGGTCCACTGTTTCCTCATTGATTCTGTCTGGATGATCTATTCATTGCTGAAAGTGGAGTACTGAAGTCCCACACTATTGTTGTATTGCTATCTATTTCTCCTTTTAGTTCTGTTAATATTTCTTTATATATTTAGGTACTTCAATGTTGAG ATATATGTTTACTATTGTTTTATTCTTTTGATGAATTGACCCTGTTATCATTATATAATGACATTATCTCTTATGACAGATTTGATTCAAAGTCTATTTTTTCTGACATAAATATTGCTTACCCATTCTCTCTTTGTTTTCATTTGCATGGAATATTTTTTATTT TTCACTTGCAGTCAATATGTCTTCTTAAGGCTAAATTGAGTCCCCAGCAGGAATCATACTGTTTGATCTTGTTTTTTATTATCCATTCAGCCATGCTGTGTCCTTTGACTAGAGCATTTAATCCATTACATTTAAAGAAATTATTGATAGGTAAGAATTTACTAT TATTATTTTCAATTGTTTTCTAATTGTTTTGTAGTTCCTTATTTCCTCTCTTTCTGATTTGCTTTGTGATTGGTTGATTTTCTGTAGTGGTATGCTTTTTTTTTTTTTCTTTAAGTTCTGGGATACATGTGCAGAACACGCAGGTTTGTTACATAGGTACACATG CATGGTGGTTTGCTCCACCTATCAACCCGTCATCTAGGTTTTAAGCCCCGCATGCATTAGGTATTTGATTTCTTTTTCGTCATGTTTTGTGCACTGACTAGAGGTTTTTTGTGGTTACCATGAATCTTATATAAAAATCTTATCATTATAACATTCTATTTTAAA ATAACTTCAATCACATACAAAAATTATACTTTACTTTTCTCAAACAATAATTTTATGTGATTGACATCACACTTTATATCCTTTTATATTATGTCTACATTAACAAATTATTGTAGCTATAGTTATTTCTATTATATATGTCTTTTAAATTTAATAGTAGAGTTA GAGATTAAATACAACCACTACTATATTAGTGCATTCTGAATTTGACTATATATCTATCTTTACCTGTGTATATCTGTGTATATATACTTTCATACATTTTCATGTTGCTGGTTTTTGTCTTTTTGTTTCAACTTGAAGAACCTCCTTTAGCATTTATTGTAAGGT TCTTATGGTGATGAATTCCCACATTTTTTTTGTCTGGGAATGTCTTTATCCTTTCTTACTTCTGAAGGACAGTTTTTCGTAATATTGTTTCATAGTTATTTTTTCTTTCAGCATTTTGAATATATAATCTCAGTGCCTCCTGGTCTATAAAATTTCCTCTGAGAA CATTGATAGACTCATTGGGGTGCCCTCATATGTGAAGAGACTCTTTTACTAGTTTCAGGATTTCTCTTTGTCTTTAACTTTTGAGAATTTCATTATAATATGTCTTGGGATAATTTTGATTTTAACTTATTGTCATCCTTTGAGCTTCATAAGTCTGGATGTGCA CTTTCACCTAATTTTGGAAGTTTTCAGTCATTTCTCTAAATAAGCTGCCTTTTTTTTTTTCTTTTTTTTTTAAAGACATACGTAACTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCACATTGATAGTTCACTGCAACCTTGATCTCCTGGAGTCAAGAGATCA TACCTCGCTTCCTGAATAGTGAGGACTACAGGTATGTATCATCACACCTGGCTGATTTTTTTTTTTTTTTTTTTTTTGGAAGATGGTGGTCTTAGTATGTTGCCCAGGCTGGTTTTAAATTCCTATCCTCAAGCAAACCATCTGCTTTGCCTTCCCAAAGCACTG TGACAGACATGAGCCACTGAGCCCAGCCCTCTAAATAAGCTTTCTGTCTCATTTTCCCTTTCTTCTCATTCTAGAAATCCTATAATTCATATATTTCTATGCTTGATGGTGTCCCATAGGTCCCTTATGCTTTCTTCAATCTTTTATTTTATTCCTCTAATTGGC TTTCAAATGACTAATCTTTGAGTTCCCTAATTCTGTTTTATAATTGAGTCTATCAAATTTTGCAGTTCTATCATTATGTTCTTCGGCTCCAGGATTTTTGTTTGCTTCCTTTTTATGGATTCCATTTCTTTGTTAAACTTCTCATTTTGTTCATGCATTGCTTTC ATTTTGTTTCGTTTTCAGTATGTGTTCTCTTGAATCTCATTGAGCTTCAAGATGATTTTTTTGTCAGGCAATTTGTAGATCTCTATTTCTATAGGATTGATTACTGGAGCCTTTCTAGTTTCATTTGGTTGTTTTATTGTCCATAAAGCCTCACATTATTGCCTG AACTAAAGGAGCAAACACCTCTTTCAGTTTTTATAAGCTGGTTTTAGCATATAAAGACTTTCTCTTTTGGAGTCCTTGCAAAGACATGACTACCTTCAGGATCACAGATGAATGGGGTTGAAGCCAGGTCACCTAACTGCTGCCGGGTTTGCAGTGGAGCCTGTA GGCAGATCTATTACCAAGTGCTTGAATGGGCATGGATTCTATCTAGTCTCTTGGTGCACTTAACTGCCTCCACAGCCTTGGTCAGTAGGGGTTGCACCTGGACCAGCGTCTTATTCAGTGTCTGCCAACAGAAAGACTGTTACCAAATATACAGATGCTCAGATG ATCACTTCCTCTGGGTTTCGGGACGGCTTCCTGCTGTGTCACTGGTTAAATACCTGGGCAGGCAATACTGGCCCATGACTGCAACTGAGCTAGAATGGAGTTCTAGCTGGGAAAGAACTGAGTTACAGGGTTCTGTCAATTTCCACAGCTGAGACTCATGTCTGT GTTGCCCCTAGGGGCACAGATGGATGTCTCTGTTTTCAGGCTCAACTCTTAATTAAAAGTTACTTCCAAAATTCAAAAAATCCATTAAAAACCAGGCTTTCTGGGCTGCTTTCAGACTGCAGCTGACAAGGACTGGAGCCAGGTTCCATCTGAGGATCTGTTGTG CTGAGTTCAGCTGTTCTTCCAGTTGGGGGACAGATGTGTGTTTCTCTCCCTCAGTCCCTGGACAGGCACAACTGCTCTCAGACCAGAACTGAGTGAGGTTAGAACTGAGTTACAAGGCTGTTTCAGGGTGCATAGCAGGTACCGAGGCCAGCAGGCCTGCTATCC GCATGAGTAGGCATGAATGCTGCTGGGTTCCTTGTCAGATGGTTCTGGCAATAGGACCCATGCCAAATGGAAATGAACTCAATCCACAAGGGAATGGAGATATTTCGGGGTTTAGAGGCGGGACCACGGTTGGCAAGTCTGCAACCTGGGAATACTTCTGCCCTC AATCAACCTTCCTAGGTCTTGGGTAGCAACAAGTTTTAGTAACTTCCTGCCTGAATCCCAAAGCTCCCACAAAGGCACTTTTGTTCGTGAATGGCTGCAAAACCAGTGTTTCTATGGAAAGAATATGAGCCAGAAGAACTCCTATTCTACCATCTTGCTGATGTC CTAGAAATAATCATTACTGTGCTCACTAACACTGTTCCCTTTTCAGTTTCTTGACCTCCATAAATTTTCTGTCTCTTTTGAACTCTGTAAATAAAATTATTAATTCATTATATATATATCACTATTCTGTATTTAATAGCCTCCCATTTTCTGAGATTAATTTCT ATTATTTTTATTGACCTGGAGACTATGAATTAACAAAATGTTCAAAATAAAAGTTTAAAGAAAATTAGCACGCATATTTTCTTTTTTTTCTTTATCTTTCTAGAGATGTGTAATTCCTACATTACACAAAGAGAATTTGTAGGAGAAACCAGGAAAGGAAAACAG GGAAAAGACTTTTCTGATAAATACATGGTTTCATTTTCCTCTCCCTTCTTTGATGCAGAAGAGACCTTGATGTGTCCAAGAGTATATGAGGAGGTTAGATGTGCAGTCTCATTGACTGGAGAAGTGTCAGGAAGGAGGGGTTTATTTTTGCTTAGCTTTGCCCTG TCATTTTTCTTGTTGCATAAGCTTCTTATCGACATTAATTTTAGACTCCCAAGATGTTTTGCATAACATAGAATTATAATCTAGTGTCTAAAATAGTTGCAAACCATAGTTTCAAATACATTAGGAAGATGAATCATTTCCTTAACATGAACCACTGTGTTATTT ATGATTACTTACAAGGGAGAAGTGATACATAATTAAAGTATCATGTGACATACAAAAAAGAAATCAATGAAATTCAAACAATAAATGCTTCTTCTGTTTCTCGTGAAAGATAGATGAAATATGCAGCTCCTTCTCATATCCATTTTGAAATGAATGGGTCTTGAA CATAACTATGTTATTTCAGTAGTAAGTAGAAATATTTCAGTATCAGAAGGGAAGAAATGAAATGAAATCAATCTACATCACTTTGGATTTTTAACTCCTCTAAAAACGTCTTACTGGGTATACATTATTGTTGTCAAATCCATTTTAATTTGAATTTTACTGTGT TGTATGTGTATGCATGCACTTACTTTTGTTTTTAACTCTCTTAAATAGCTTCAAAATGAAAGTTTTGTAACCAAATTTGAGCAGCAAAGAAAAAGGAGAAAGGGATCAAATATCTCTAACATATTCTACTTCATACAGTTCTTGGGTTTCTTTTTGCCAAGCTTT TCATAGCAGCTACACCAGTACCATCATGAATACTAATGAAATGTAATAGAAGGCATCAGTCATGATCCATCCAGGCTAGGGACATAACCATATACAAAGTGATAGTTCTTCCAGCTTAATGAAGCCTTCTTAAAGAAAAACTGTTTACATTCAAATTTGGATAAG TGAGAGCTTGTAAGCTATGAGAGCTAGACTGTACAGTTTTTAGGGGCAGGCATTGGTACAGGGAAACTCTATTATCTTCTTTATTTTCCTTCCAAAATTGTGCCTCATCAAAGTCCTGGGCATAAAATGTTTACTGAACAAAGTTTCAAAGAAATGCCATAGGAA AAGCTTAAAACTGTAGAAATCGAAAGTAAAAGATTTTAAACAGATAGACAACAGTGTTTAGATAAGCAAATACTTTTTCTGCAATCCTTAAGGTTTGCTGCCAACCTATGGAGTTCAAATTAACATTTCTCTCAGAAGTAAGCCTCATCTTTCTACTATCTTTTT CTATGTTTCTACATTCTATATATTCCTCCTTTCCAATAACAAGTCTCAGGAGTGGTTTTGGAACTCACTGATTTTTGGATCAAGCTAATATAGGATGGCATTAATGTAAAGTAATGCTATTACTCAAATATCAGGGATACTATCGTGACAGCTATATCCCTGGAA CTGAATAAGCTTACAAAACTTACTCTGCAAGAAGCTCCTGCTGAAACTTGAAAAGCATGTCAACAGAGGCTCCAAATGACAGAAAATTGCAATTTGTTATAACATTAAAAGAGAACTTATAACTTATTCTGACATATAATACTTCCCATAACCTGGTCAGGCCTC TATTATTCAAGGTTTTCTAAAACCTCACTCTCATTATGAAGCTTTTCCAGACTCACTGCAAATAAAATTATCAGAGAAGAGACACATTCATATCTTACATGGCAATGTACTTGGCCACGAGTGCAAAGGTGCTTTGGCCTTGTATAAATTTAGTTACTAAATTTG CACATGCATGTAAGTTTTTGTTTAATTTTATTTTGTTTTCCTTACCATATATGATTTAAATTATGAACTTCTACAGTCAAAATAATTTTAACTAAATTTTTATATCTATCTTTGGGGAGGGAGTACAAAGAAGTATACTAGTCAAATAATGTTGCAATATTGCTG GACAAATAGCCAGAAAATCTCAGTGGTACCCAACTATGAGGATCTTATCTCACTCAGTCCAAATGTCAGCTAGCATGGTGCCACCTCAGCATATGCATCTTCAGAGTTGCTGAATTTTGTTTCTCCTGGTTCATGCTGGACCTAAGGCTGAAGAAACAGTAGCTA GGGGTACCTTCTTCTTATAGAGGAGATATGAAGGTCCCAGAGAGTGCAAGCCAAACTGTGTGATGTCTCTTAAGATCTATGCTTAATATTTGATCCCTACTGCATTCCTTCTGCACGTCCTACTGTAAAATCATGTCCCTTGACCTAACACAATTTCTATGGATT GACATGTACTATTGACATGGAATGGGAAGATCACAAGAGGTGAATATACCCTGATAAATATTCTAAATATACCATAGTGTACCCTCTTATTTAAAAATGTTCACATCTCTGGTCGGGTGAGGTGGCTCACATCTGTAATCCCAGCACTTTGGGAGGCCGACGCAG GATCACAAGGTCAGGGGATCGAGACCACCTTGGCCAACATGGTGAAACCCCATCTTTACTAAAATACAAAAAATTAACCGGGTGTGGTGGTGGGTGCTTGTAATCCCAGCTACTTGGGAGGCTGAGGCAGGGGTATCACGTGAACCCAGGAGGGAGAGTTTGCAG This report has been designed, layouted and edited by GCTGAGATCGCATCACTGCACTCCAGCCTAGCAACAGAGCAAGACTCCATTATTAATAATAATTAATTTATTAATTCATGTAAAACATAGAAAATGTGCAGCCATATAGGCTTATTTGCCTTCTTTTCCAGTCTTCTATGCTATAATTTTCCAGTCTTTTATGCT Siegfried Schwarz, by order of the Department Conference ATTGTCATATGTATTACACATACATAAATTAAAATATATTATAATTTTTACATTAAAAAACTATATGTAAACACAATAAACAAAATAATCAAACAAAATAAAAAATTTGTCTTCTATGTTTACTCATATATCTTTCATTTCTAATCCTCCATATTTCTTCCTAAA of THE BIOCENTER and with the help of Lukas A. Huber. ! CCATTTCTCCATCTGGTATCATTTTCCTTCAACCTGCAAGACTTTCTTGGTTTTGGCTTACCTGAAAATGGCTTTATTTTGCCTATGTTATTAAACAATGTTTCTGAATTTTGAAATTAACCCTTTATTTCTTGAATAATTAGAGATGGGGAAGTCTTCTGGTAG The contents are based on informations provided by the AGTTTTGAGGGAATAAATCAGGAGATTGATGTCGGGCATACTGAATTCAAGATACTAAAACCTCCAAGAAGATACATAAACCTGGTGTTTGAGAAAACAGTCAGAATTGGACATAAAGAATTATGGGTTGTCAACATATATTACAGATAGTATTTAGAGCTATGA directors and group leaders of the BIOCENTER. Gregor GATAGGACTCACATCTAGGACTATCATCAAGGGAGTGAGTGTAGTTAATGAAGTGAAGGAGGCTCTGAACTGTGTCTTAGAGCACTCCAACAATGTGAAGCTAGAGAAGAGGAGGAAACAGCAACAGAAAGTGAGGAGCAACTAATGAGTTAGGAGAAAACAAAC Retti is thanked for elaborating data on publications and AGTGTATGGTTTTCTACAAGCTATATAAATAATGAAAATGAAGAAGGAAAAAACAATAATATCAAGGGCTACAGACTGGAAAGATTGGGACAGAAAATTAACCATTAGAATTAATTGAACGCAGGTCACCGGCAACCTTGAAGTTTTGGTGAACTGGTGGAAGTA funds.! GTGTGATTGGAGTGGGTCATTAATTTTTAATAATGACAGTAGTGAATAGGTAAACATCCTATAGTGGTCACAAGAACATAATTGTGAATATAAATAACATTACATTCTTATTTATAACATTGTTTTATGATTTTCACATTATCCTGTTGGATTTATACCCAATAA The logo of the BIOCENTER (to the left) was created by Siegfried Schwarz in 2007 and is by acceptance by the ACCACTACTTTTTTGAGAACTGCCCTCTACCCTAGCCCCTGAAAATATATTATATGAAAATTCTCTCCCAGCTCTAATTGGTTTAACAAAATATATGACCCAACCCAATCACAAGGTCAGGGGATCGAGACCACCTTGGCCAACATGGTGAAACCCCATCTTTAC Department Conference officially used by the BIOCENTER.! Copyright: Biocenter, MUI, Lukas A. Huber (Director)! AATACAAAAAATTAACCGGGTGTGGTGGTGGGTGCTTGTAATCCCAGCTACTTGGGAGGCTGAGGCAGGGGTATCACGTGAACCCAGGAGGGAGAGTTTGCAGTGAGCTGAGATCGCATCACTGCACTCCAGCCTAGCAACAGAGCAAGACTCCATTATTAATAA Printed by AUMAYERdruck+verlag, www.aumayer.co.at, 2013! TTAATTTATTAATTCATGTAAAACATAGAAAATGTGCAGCCATATAGGCTTATTTGCCTTCTTTTCCAGTCTTCTATGCTATAATTTTCCAGTCTTTTATGCTATAATTGTCATATGTATTACACATACATAAATTAAAATATATTATAATTTTTACATTAAAAA ATATGTAAACACAATAAACAAAATAATCAAACAAAATAAAAAATTTGTCTTCTATGTTTACTCATATATCTTTCATTTCTAATCCTCCATATTTCTTCCTAAAATTCCATTTCTCCATCTGGTATCATTTTCCTTCAACCTGCAAGACTTTCTTGGTTTTGGCTT TGAAAATGGCTTTATTTTGCCTATGTTATTAAACAATGTTTCTGAATTTTGAAATTAACCCTTTATTTCTTGAATAATTAGAGATGGGGAAGTCTTCTGGTAGGGTAGTTTTGAGGGAATAAATCAGGAGATTGATGTCGGGCATACTGAATTCAAGATACTAAA TCCAAGAAGATACATAAACCTGGTGTTTGAGAAAACAGTCAGAATTGGACATAAAGAATTATGGGTTGTCAACATATATTACAGATAGTATTTAGAGCTATGAGATGATAGGACTCACATCTAGGACTATCATCAAGGGAGTGAGTGTAGTTAATGAAGTGAAGG CTCTGAACTGTGTCTTAGAGCACTCCAACAATGTGAAGCTAGAGAAGAGGAGGAAACAGCAACAGAAAGTGAGGAGCAACTAATGAGTTAGGAGAAAACAAACCGTAGTGTATGGTTTTCTACAAGCTATATAAATAATGAAAATGAAGAAGGAAAAAACAATAA CAAGGGCTACAGACTGGAAAGATTGGGACAGAAAATTAACCATTAGAATTAATTGAACGCAGGTCACCGGCAACCTTGAAGTTTTGGTGAACTGGTGGAAGTAAAAGTGTGATTGGAGTGGGTCATTAATTTTTAATAATGACAGTAGTGAATAGGTAAACATCC REPORT2010-12! BIOCENTER! biocenter.i-med.ac.at! Innsbruck Medical University!
