Development of a construct specific method for detection of BT Rice

Development of a construct specific
method for detection of BT Rice Example for the development of
detection methods for non authorized
genetically modified organisms
Dietrich Mäde
Christine Degner
(Landesamt für Verbraucherschutz Sachsen-Anhalt)
Lutz Grohmann
(Bundesamt für Verbraucherschutz und
Lebensmittelsicherheit)
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Status of Genetically Modified Rice in China
• Research and development of gm rice in China
–
–
–
–
–
–
Increased yield
Quality improvement
Disease resistance
Insect resistance
Herbicide resistance
Salt tolerance
• Field trials are carried out in China
• No event has been approved by the authorities yet
– Neither in China nor in the European Union
• No event has been commercialized
Wang, Y; Johnston, S.; Nature Biotechnology 25:717
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
The Starting Point - What was known?
• Rice expressing the Bacillus thuringiensis äendotoxin was found by an NGO
– Samples arrived in the State Office for Consumer
Protection Halle (Saale)
Greenpeace International (2005)
Risk of use of unauthorized gm rice by farmers in China
Risk of gm rice in the food supply
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Bt-Rice Derived from Cultivar
Minghui 63
Plasmid pFHBT1 used in line TT51-1 comprised the following elements:
• Rice actin promotor (ActI)
• 5´-intron
• Fused Bt coding sequence
– cryIA(b)
– cryIA(c)
•
• Both toxin genes were fused to improve the insect resistance
NOS terminator of Agrobacterium tumefaciens
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Sequence Determination of the Construct
• Generation of PCR products spanning the construct of the
samples FR0502519 and FR0502520
– Rice actin promotor to NOS terminator
• DNA sequencing of the PCR product
ca. 2.5 kb
NTC
conv. rice
Dietrich Mäde
FR0502520/2
FR0502519/2
FR0502520/1
FR0502519/1
Como, 26.06.2008
Landesamt für Verbraucherschutz
PCR Products for Verification of the
Sequence
• Overlapping sequences
between ActI and cryIA(b)
• cryIA(b) sequences
• Overlapping sequences
between cryIA(b) (c) and
NOS terminator
• NOS terminator sequences
PCR products from ActI to cryIA(b)
PCR products from cyIA(b) to NOS
DNA sequencing of the construct
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Verification of Rice “Bt63”
• BLAST search with the
sequences of the PCR products
• The sequenced fragments
matched to
– actI promotor
– 5´- intron of actI
– 1344 bp of the N-terminal
part cryIA(b) and
– 486 bp of the C-terminal part
of cryIA(c)
– NOS terminator
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Overlapping Sequence at the 3´ end of
the Construct
cryIA(b)/(c)gene
TCGTGGGTGTTAGAAACTTTAGTGGGACT
GCTGGAGTGATTATCGACAGATTCGAGTTCA
TTCCAGTTACTGCAACACTCGA
spacer
GGCTGAATAAGTCGA
NOS-terminator
GGTACCGAGCTCGAATTTCCCCG
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Primer and Probe Localisation
• Oligo design with Primer Express 2.0
• Test of several primer probe combinations on DNA
dilutions
cryIA(b)/(c)gene
TCGTGGGTGTTAGAAACTTTAGTGGGACT
GCTGGAGTGATTATCGACAGATTCGAGTTCA
rice T51F
riceT51
TTCCAGTTACTGCAACACTCGAGGCTGAATAA
probe
riceT51R
GTCGAGGTACCGAGCTCGAATTTCCCCG
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Method is Independent from the real-time
PCR instrument
FR0502519
FR0502520
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Specificity Tests
positive
• rice “Bt63”
(Chinese grains)
• rice sample
FR0502519
(Greenpeace)
• Rice sample
FR0502520
(Greenpeace)
Como, 26.06.2008
•
•
•
•
•
•
negative
• Maize lines
rice LL62
– T25
soybean
– Bt11,
GTS40-3-2
– Bt10
cotton 531
– Bt176
potato EH92– MON810
527-1
canola GS40/90 – MON863
– NK603
canola GT73
– TC1507
– GA21
– CBH351
– DAS59122
– MIR604
– MON89034
Dietrich Mäde
Landesamt für Verbraucherschutz
Sensitivity
• Absolute LOD (p=90%):
– 7 copies in presence of DNA of conventional rice
– 7 copies in presence of DNA of maize
• Relative LOD:
– <0,1% “Bt63” rice in conventional rice
• Rice reference gene: gos9
(Hernandez et al.; J Agric Food Chem 53:7003)
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Robustness in the Routine Diagnostics
There is no detectable influence of
– Laboratory and personnel
– Primer and probe lot
– Enzyme kit
– Extraction method
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Stability of samples
– Analysis of one sample with ~0,02% gm rice
from 2006 was positively tested in 2008
– 6 extractions on 3 different days were
analysed with the same positive result
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Application of the Method
• The CRL performed a method verification study
– http://gmo-crl.jrc.it/doc/Bt63_Rice_verification_report_final.pdf
• The method is recommended for official testing purposes
according to Decision 2008/289/EC
• This applies to rice grains and all rice products
originating in or consigned from China.
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Collaborative Validation Study
• 17 participants from Germany and Austria
• Coded samples:
– Positive rice noodles (4 samples)
– Conventional Rice flour spiked with
• 0.1% (2 samples)
• 0.05% “Bt63” (2 samples)
– Plasmid DNA carrying the construct (Eurofins,
Freiburg, Germany)
• 20 copies per reaction (2 samples)
• 5 copies per reaction (2 samples)
– Conventional rice and rice noodles as negative
controls (4 samples)
– Stabilisation solution for plasmid DNA as negative
control (2 samples)
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Results of the Collaborative Validation Study
• All samples containing “Bt63” rice were detected
by the participants
• All labs detected the samples containing 20
copies
• 94% of the reactions containing the 5 copies
were positive
– Influence of the statistical distribution
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz
Conclusions
• The construct specific method is validated and
applicable
– Other events containing the same construct will be
detected as well.
• Some points to consider:
– Field trials must be conducted under conditions which
minimize the risk of out-crossing and contamination of
agricultural production.
• Appropriate legal framework
• Education and communication to the farmers
– Detailed information on field trials must made
available through Biosafety Clearing House
• In case of the presence of unauthorised GMO´s in the food or
feed chain, official bodies must have access to detection
methods and control samples.
Como, 26.06.2008
Dietrich Mäde
Landesamt für Verbraucherschutz