Virus Reviews and Research - Sociedade Brasileira de Virologia

Transcrição

Virus Reviews and Research
Journal of the Brazilian Society for Virology
Volume 18, September 2013, Supplement 1
Annals of XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology
September, 01 - 04, 2013, Náutico Praia Hotel & Convention Center, Porto Seguro, Bahia, Brazil
Editors
Fernando Rosado Spilki
Edson Elias da Silva
BRAZILIAN SOCIETY FOR VIROLOGY BOARD OF DIRECTORS
(2013-2014)
Officers
President: Dr Eurico de Arruda Neto
Vice-President: Dr Bergmann Morais Ribeiro
First Secretary: Dr Mauricio Lacerda Nogueira
Second Secretary: Dra Luciana Jesus da Costa
First Treasurer: Dr Luis Lamberti Pinto da Silva
Second Treasurer: Dra Clarice Weis Arns
Executive Secretary: Dr Fabrício Souza Campos
Councillors
Dra Maria Luisa Barbosa
Dra Viviane Fongaro Botosso
Dra Maria Angela Orsi
Area Representatives
Basic Virology (BV)
Dra Paula Rahal, UNESP (2013 – 2014)
Dr Davis F. Ferreira, UFRJ (2013 – 2014)
Environmental Virology (EV)
Dra Célia Regina Barardi, UFSC (2013 – 2014)
Dr Fernando Rosado Spilki, Feevale (2013 – 2014)
Human Virology (HV)
Dr Luiz Tadeu Figueiredo, USP-RP (2013 – 2014)
Dra Nancy Bellei, UNIFESP (2013 – 2014)
Immunobiologicals in Virology (IV)
Dra Sílvia Cavalcanti, UFF (2013 – 2013)
Dr Edson Elias da Silva, Fiocruz (2013 – 2014)
Plant and Invertebrate Virology (PIV)
Dr Paulo Brioso, UFRJ (2013 – 2014)
Dr Tatsuya Nagata, UNB (2013 – 2014)
Veterinary Virology (VV)
Dr Paulo Brandão, USP (2013 – 2014)
Dra Rita Cubel, UFF (2013 – 2014)
Address
Universidade Feevale, Instituto de Ciências da Saúde
Estrada RS-239, 2755 - Prédio Vermelho, sala 205 - Laboratório de Microbiologia Molecular
Bairro Vila Nova - 93352-000 - Novo Hamburgo, RS - Brasil
Phone: (51) 3586-8800
E-mail: F.R.Spilki - [email protected]
http://www.sbv.org.br/vrr
Organizing Committee
Bergmann Morais Ribeiro, UNB
Célia R. M. Barardi, UFSC
Clarice Weis Arns, UNICAMP
Davis Fernandes Ferreira, UFRJ
Edson Elias da Silva, Fiocruz
Eurico de Arruda Neto, USP – Presidente da SBV e do XXIV CBV
Fabrício Souza Campos, UFRGS
Fernando Rosado Spilki, Universidade FEEVALE
Francisco Murilo Zerbini, UFV
Lauro Juliano Marin, UESC
Luciana Jesus Costa, UFRJ
Luis Lamberti Pinto da Silva, USP
Luiz Tadeu Figueiredo, USP
Maria Angela Orsi, LANAGRO
Maria Luisa Barbosa, Instituto Adolfo Lutz
Maurício Lacerda Nogueira, FAMERP
Nancy Bellei, UNIFESP
Paula Rahal, UNESP
Paulo Sergio Torres Brioso, UFRRJ
Paulo Eduardo Brandão, USP
Rita de Cássia Nasser Cubel Garcia, UFF
Silvia Maria Baeta Cavalcanti, UFF
Tatsuya Nagata, UNB
Viviane Fongaro Botosso, Instituto Butantan
Board of Examiners - Hélio Gelli Pereira Award
Dr Mauricio Lacerda Nogueira (President)
Dr Luis Lamberti Pinto da Silva
Dr Paulo Eduardo Brandão
XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology, Porto Seguro, Bahia, Brazil
Virus Reviews and Research, Volume 18, Supplement 1, 2013
Financial Support
General Information
CAPES
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
CNPQ
Conselho Nacional de Desenvolvimento Cientifico e
Tecnológico
FAPESB
Fundação de Amparo à Pesquisa do Estado da Bahia, Secretaria
de Ciência, Tecnologia e Inovação
Ministério da Saúde
FAPESP
Fundação de Amparo à Pesquisa do Estado de São Paulo
Exhibitors
BIOSAFE
Instituto Evandro Chagas
NOVA ANALÍTICA
POLIMATE
QIAGEN
SARSTEDT
SIGMA-ALDRICH
SÍNTESE
VECO
Organizers
Office Marketing Eventos
Secretary Office Hours
September, 1st - 8am - 8pm
September, 2nd - 7am - 7:30pm
September, 3rd - 7am - 7:30pm
September, 4th - 7am - 5pm
Name Badge
Name badges will be required for access in all activities,
including lunch.
Media Desk (for lecturers only)
The media desk will be open as scheduled for the secretary
office of the meeting.
Data - files with presentations - must be delivered at the
media desk at least 2 hours before the scheduled time for the
presentation. Please note that the use of personal computers
by presenters will not be allowed.
Lounge area
A lounge area will be available for lecturers, invited persons
and SBV staff.
Certificates
The registration desk of presentation/participation will be
available at the registration desk of the event on the last day of
the meeting. Identification cards will be required.
Travel Agency
INTERVIAGEM is the official tour operator of the XXIV Brazilian
Congress of Virology.
We prepared special tours around Porto Seguro for your
entertainment in your free time. Have fun!
* YES TOURS is the official local tour agency.
Booking and information:
[email protected] / (73) 3288.7335
RECIFE DE FORA (REEFS)
R$ 120,00 reais per person
TRANCOSO
TOUR BY COROA ALTA AND RIVER
ECO PARQUE (WATER PARK)
ARRAIAL D’AJUDA BY NIGHT
Poster Presentations
The posters must be fixed after 1pm and before 5pm of the day
of presentation and must be removed after the session.
Local: Beat Beach Sea-side Bar
Sesison 1: September 2nd, 7-9 pm, posters numbered 01 to 336.
Session 2: September 3rd, 7-9 pm, posters numbered 337 to
650
Sunday, September 1
XXIV Brazilian Congress of Virology
Scientific Program
Room 1
Satellite Symposium 1: CAPES-SBV MEETING: Brazilian priorities for planning a cooperation network in
Virology
Chair: Paulo Michel Roehe
•
9:00-9:05 Welcome - Paulo Michel Roehe, UFRGS, Porto Alegre, RS, Brazil
•
9:05-9:15 Suggestions for an agenda of cooperation in virology - Eurico Arruda, FMRP-USP, Ribeirão
Preto, SP, Brazil
•
9:15-9:30 Virology as a CAPES priority - Maria Angelica Miglino, Veterinary Medicine Area
Coordinator, CAPES, Brasília, DF, Brazil
•
9:30-9:45 Priorities in veterinary virology - Clarice Weiss Arns, UNICAMP, Campinas, SP, Brazil
•
9:45-10:00 Priorities in plant virology - Paulo Sérgio Brioso, UFRRJ, Seropédica, RJ, Brazil
9: 00 am - 12:00 pm
•
10:00-10:15 Priorities in human virology - Mauricio Lacerda Nogueira, FAMERP, São José do Rio
Preto, SP, Brazil
•
10:15-10:45 Coffee-Break
•
10:45-11:00 Priorities in environmental virology - Celia Regina Barardi, UFSC, Florianópolis, SC,
Brazil
•
11:00-11:15 Priorities in the production of biopharmaceuticals in virology - Edson Elias Silva,
FIOCRUZ, Rio de Janeiro, RJ, Brazil
•
11:15-11:30 Priorities in Basic Virology - Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil.
•
11:30-11:55 Questions and discussion among participants and audience
•
11:55-12:00 Closing remarks and adjourn - Maria Angelica Miglino, Veterinary Medicine Area
Coordinator, CAPES, Brasília, DF, Brazil
Room 2
Satellite Symposium 2: Impact of viroids or virus diseases on agribusiness
•
Some applied contributions to prevent yield losses due to viruses diseases in a vegetative propagation
system: The potato as a study case - José Alberto Caram de Souza Dias, IAC, Campinas, SP, Brazil
•
Viroids in Brazil: current status, economic importance and control measures - Marcelo Eiras, Instituto
Biológico, São Paulo, SP, Brazil
•
Effects of viruses in the production of tropical fruits - Paulo Ernesto Meissner Filho, Embrapa
Mandioca e Fruticultura, Cruz das Almas, BA, Brazil
Chair: Paulo Sérgio Torres Brioso, UFRRJ, Seropedica, RJ, Brazil
2:00 pm - 4:00 pm Room 3
Satellite Symposium 3: Selected topics on respiratory viruses
•
Respiratory syncytial virus epidemics in an equatorial city - Fernanda Edna Moura, UFC, Fortaleza,
CE, Brazil
•
Escape mutants of human respiratory syncytial virus resistant to palivizumab - Edison Luiz Durigon,
Biomedical Sciences Institute, USP, São Paulo, Brazil
•
Evolution of parainfluenza viroses - Viviane Fongaro Botosso, Butantan Institute, São Paulo, SP, Brazil
•
Newcastle disease virus in poultry and free-living birds: an update - Adriano de Oliveira Torres
Carrasco, Universidade Estadual do Centro Oeste, UNICENTRO, Guarapuava, PR, Brazil
Co-chairs: Viviane Fongaro Botosso, Butantan Institute and Edison L. Durigon, ICB-USP, São Paulo, SP, Brazil
4:00 pm - 4:30 pm Coffee Break
Room 1
Pre-Congress Conference
4:30 pm - 5:30 pm
•
High throughput prospection for emerging viruses - Andreas Nitsche, Robert Koch Institute, Division
of Highly Pathogenic Viruses, Berlim, Germany
Chair: Clarissa Damaso, UFRJ, Rio de Janeiro, RJ, Brazil
Opening Ceremony
•
Keynote Conference: The quest for a pan-influenza vaccine - Peter Palese, Mount Sinai School of
7:00 pm - 9:00 pm
Medicine, NY, USA
Chair: Eurico de Arruda Neto, USP, Ribeirão Preto, SP, Brazi
9:00 pm - 11:00 pm Reception and Visit to Exhibits
Monday, September 2
7:30 am - 8:30 am
8:30 am - 10:30 am
Room 1
Mini-course 1: Basic concepts in classical virology
•
Mário Celso Sperotto Brum, UNIPAMPA, Uruguaiana, RS, Brazil
Room 2
Mini-course 2: Proteomic applications in virology
•
Alessandra Vidotto, FAMERP, São José do Rio Preto, SP, Brazil
Room 3
Mini-course 3: Fundamentals of virology diagnostics – Basic concepts in virology diagnostics
•
Leonardo José Richtzenhain, USP, São Paulo, SP, Brazil
Room 4
Mini-course 4: Introduction to the general aspects of RNA virus entry, mechanisms of replication, and exit
•
Davis Fernandes Ferreira and Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil
Room 2
Round Table 1: Assessment of Plant Virus Genetic Variability and its Role in Virus-host Interactions
•
Mechanisms of plant virus evolution: from basic to applied research - Fernando Lucas Melo, UNB,
Brasília, DF, Brazil
•
Assessing the relative contribution of mutation and recombination on the genetic variability of plant
virus populations - Alison Talis Martins Lima, UFV, Viçosa, MG, Brazil
•
Proteomic as a tool to study plant virus interactions - Nelson Arno Wulff, Fundo de Defesa da
Citricultura, Araraquara, SP, Brazil
Chair: Francisco Murilo Zerbini Jr., UFV, Viçosa, MG, Brazil
Room 3
Round Table 2: Viral Diseases in Aquaculture
•
Development of immunoassays to detect infectious myonecrosis virus (IMNV) in shrimps - Aguinaldo
R. Pinto, UFSC, Florianópolis, SC, Brazil
•
Virus-host interactions and diagnostics of IPNV - Juan Kuznar Hammarstrand, Universidad de
Valparaíso, Quinta Región de Valparaíso, Chile
•
Adenoviral genomes from human and other animal hosts in shrimp - Fernando Rosado Spilki,
Feevale, Novo Hamburgo, RS, Brazil
Chair: Fernando Rosado Spilki, Feevale, Novo Hamburgo, RS, Brazil
Room 1
Round Table 3: Biology and Immunology of Flavivirus Infections
•
Role of inflammatory mediators in dengue infection - Daniele da Glória de Souza, UFMG, MG, Brazil
•
A tetravalent dengue nanoparticle stimulates antibody production in mice - Luiz Felipe Leomil
Coelho, UNIFAL, Alfenas, MG, Brazil
•
Bioinformatics sequence and genome analysis in HCV - Paula Rahal, UNESP, São José do Rio Preto, SP,
Brazil
Chair: Paula Rahal, UNESP, São José do Rio Preto, SP, Brazil
Room 4
Oral Presentations Human Virology - 1
Convenor: Edison Luiz Durigon, ICB-USP, São Paulo, SP, Brazil
10:30 am - 11:00 am Coffee-break and Visit to Exhibits
Room 1
Conference 1:
11:00 am - 12:00 pm
•
Viruses in Veterinary Medicine Detected by Metagenomic Approaches - Anne-Lie Blomstrom, Swedish
University of Agricultural Sciences, Uppsala, Sweden
Chair: Paulo Eduardo Brandão, USP, São Paulo, SP, Brazil
12:00 pm- 2:00 pm
2:00 pm - 3:00 pm
Lunch-break and Visit to Exhibits
Room 1
Conference 2:
•
Towards a Cure for HIV Infection - Monsef Benkirane, Institut de Génétique Humaine CNRS,
Montpellier, France
Chair: Luciana Jesus da Costa, UFRJ, Rio de Janeiro, RJ, Brazil
Room 1
Round Table 4: Update on Viral Vaccines
•
Enhancement of antitumor immunity by fusion of herpes simplex 1 Glycoprotein D and HPV E7 Protein
- Luís Carlos de Souza Ferreira, ICB – USP, São Paulo, SP, Brazil
•
New adjuvants for viral vaccines - Paulo Lee Ho, Butantan Institute, São Paulo, SP,
•
News on polio vaccination - Edson Elias Silva, Fiocruz, Rio de Janeiro, RJ, Brazil
•
Update on dengue vaccines - Benedito Antônio Lopes da Fonseca, FMRP-USP, Ribeirão Preto, SP,
Brazil
Chair: Benedito Antônio Lopes da Fonseca, FMRP-USP, Ribeirão Preto, SP, Brazil
Monday, September 2
3:00 pm - 5:00 pm
5:00 pm - 5:30 pm
5:30 pm - 7:00 pm
7:00 pm - 9:00 pm
9:00 pm - 12:00 am
Room 3
Round Table 5: Emerging and Potentially Zoonotic Infectious Diseases
•
Bovine spongiform encephalitis in Brazil - Amauri Alfieri, UEL, Londrina, PR, Brazil
•
Phylogeography of rabies virus - Pedro Carnieli Junior, Instituto Pasteur, São Paulo, SP, Brazil
•
Hepatitis E in Brazil, a water-borne viral infection or zoonosis? - Marcelo Alves Pinto, Fiocruz, Rio de
Janeiro, RJ, Brazil
Chair: Amauri Alfieri, UEL, Londrina, PR, Brazil
Room 2
Round Table 6: Novel Issues on Environmental Contamination by Viruses
•
Norovirus in food - Nigel Cook, University of Wisconsin, USA
•
Virus stability in water matrices - Christophe Gantzer, University Henry Poincaré, Nancy, France
•
Use of human gut-specific bacteriophage B124-14 as environmental marker of anthropic pollution Huw Taylor, University of Brighton, England
Chair: Fernando Rosado Spilki, Feevale, Novo Hamburgo, RS, Brazil
Room 4
Oral Presentations on Basic Virology
Convenor: Davis Fernandes Ferreira, UFRJ, Rio de Janeiro, RJ, Brazil
Coffee-break and Visit to Exhibits
Room 2
Helio Gelli Pereira Award Oral Presentations
Chair: Maurício Lacerda Nogueira, FAMERP, São José do Rio Preto, SP, Brazil
Room 1
Career Development Workshop
•
The experience of a researcher at the veterinary immunobiologicals industry: insights into the role of
PhDs in Brazilian industry- Fernando Rosado Spilki, FEEVALE, Novo Hamburgo, RS, Brazil
•
A small professional tale from a biologist: how to become a well suceeded virologist- Paulo Lee Ho,
Butantan Institute, São Paulo, SP Brazil
•
The interface between academic research and industry: search for antiviral agents - Renato Santana
de Aguiar, UFRJ, Rio de Janeiro, RJ, Brazil
Chair: Paulo Sérgio Torres Brioso, UFRRJ, Seropédica, RJ, Brazil
Room 3
Oral Presentations on Human Virology – 2 and Immunobiologicals
Convenor: Viviane Botosso, Butantan Institute, São Paulo, SP, Brazil
Room 4
Oral Presentations on Environmental Virology
Convenor: Célia Regina Barardi, UFSC, Florianópolis, SC, Brazil
Beat Beach Sea-side Bar
Poster Session 1
Evening Social/Mixer
Tuesday, September 3
Room 1
•
Mario Celso Sperotto Brum, UNIPAMPA, Uruguaiana, RS, Brazil
Room 2
•
Alessandra Vidotto, FAMERP, São José do Rio Preto, SP, Brazil
7:30 am – 8:30 am
Room 3
Mini-course 3: Fundamentals of virology diagnostics – Serological diagnostics in virology
•
Leonardo José Richtzenhain, USP, São Paulo, SP, Brazil
Room 4
•
Room 3
Round Table 7: Virus-host Molecular Interactions in Plant and Invertebrate Viruses
•
Generation of infectious full-length cDNA clones of plant viruses? - Wilhelm Jelkmann, University of
Heidelberg, Germany
•
The dynamic transcriptome of a large and complex insect pathogenic virus, the baculovirus Autographa
californica Nucleopolyhedrovirus (AcMNPV), in cells of the host Trichoplusia ni- Gary Blissard, Cornel
University, Ithaca, NY, USA
•
Molecular insights to strain-specific resistance to Potato virus Y in potato - Jari Valkonen, University
of Helsinki, Finland
Chair: Bergmann Morais Ribeiro, UnB, Brasília, DF, Brazil
Room 2
Round Table 8: Virus-Cell Interactions
•
Role of innate immunity receptors in infection and activation of endothelial cells by dengue virus Luciana B. de Arruda, UFRJ, Rio de Janeiro, RJ, Brazil
•
Cellular signaling pathways as target for the prospection of anti-flaviviruses therapeutics - Cláudio
Bonjardim, UFMG, Belo Horizonte, MG, Brazil
8:30 am - 10:30 am
•
Biochemical analysis of distinctive and unique human respiratory syncytial virus proteins: polymerase
cofactor P, M2-1 antitermminator, and nonstructural NS1 - Gonzalo de Prat Gay, Fundación Instituto Leloir
- CONICET, Buenos Aires, Argentina
•
Beyond the structural function of dengue virus capsid protein: the role of its interaction with lipids in
virus entry and replication- Andrea T. Da Poian, UFRJ, Rio de Janeiro, RJ, Brazil
Chair: Luciana B. de Arruda, UFRJ, Rio de Janeiro, RJ, Brazil
Room 1
Round Table 9: Phylogeography of Dengue in Brazil: The Story of the Emergence of Endemic Disease
•
DEN1 and DEN2 phylogeography of in Brazil 2 - Betania Drumond, UFJF, MG, Brazil
•
Dengue 3 phylogeography in Brazil- Josélio Maria Galvão de Araújo, UFRN, Natal, RN, Brazil
•
DEN4 asian genotype in Brazil - Davis Fernandes Ferreira, UFRJ, Rio de Janeiro, RJ, Brazil
Chair: Maurício Lacerda Nogueira, FAMERP, São José do Rio Preto, SP, Brazil
Room 4
Oral Presentations on Veterinary Virology
Convenor: Rita de Cássia Nasser Cubel Garcia, UFF, RJ, Brazil
10:30 am - 11:30 am Coffee-break and Visit to the Exhibits
Room 1
Conference 3:
11:00 am - 12:30 pm
•
Virus-Host Interaction and Invasion of the Central Nervous System - Katherine Spindler, University of
Michigan, Ann Arbor, Michigan, USA
Chair: Eurico de Arruda Neto, USP, Ribeirão Preto, SP, Brazil
12:30 pm - 2:00 pm Lunch Break and Visit to Exhibits
2:00 pm - 7:00 pm
FREE TIME
9:00 pm -2:00 am
Congress Party
7:00 pm -9:00 pm
Beat Beach Sea-side Bar
Poster Session 2
Room 1
•
Mario Celso Sperotto Brum, UNIPAMPA, Uruguaiana, RS, Brazil
7:30 am – 8:30 am
8:30 am - 9:30 am
Room 2
•
Alessandra Vidotto, FAMERP, São José do Rio Preto, SP, Brazil.
Room 3
Mini-course 3: Fundamentals of virology diagnostics molecular diagnostics in virology
•
Fabio Gregori, USP, São Paulo, SP, Brazil
Room 4
•
Room 1
Conference 4:
•
Advances in Potyvirus Biology - Jari Valkonen, University of Helsinki, Finland
Chair: Francisco Murilo Zerbini Junior, UFV, Viçosa, MG, Brazil
Wednesday, September 4
9:30 am - 10:00 am Coffee-break and Visit to Exhibits
10:00 - am
Noon - 1:30 pm
1:30 pm - 2:30 pm
Room 1
General Assembly of the Brazilian Society for Virology (SBV) and Helio Gelli Pereira Awards Ceremony
Lunch Break and Visit to the Exhibits
Room 1
Conference 5:
•
Viral and host control of vesicular stomatitis virus gene expression – Sean P. Whelan, Harvard, Boston,
MA, USA
Chair: Luis Lamberti Silva, USP, Ribeirão Preto, SP, Brazil
Room 3
Round Table 10: Recent Progress in Avian Virology
•
Avian gyrovirus 2: is it a real avian pathogen? – Ana Cláudia Franco, UFRGS, Porto Alegre, RS, Brazil
•
New IBV genogroups in Brazil- Nilo Ikuta, ULBRA, Canoas, RS, Brazil
•
Vaccinal viruses in wild birds: How come? - Clarice Weis Arns, Unicamp, Campinas, SP, Brazil
Chair: Clarice Weis Arns, Unicamp, Campinas, SP, Brazil
2:30 pm - 4:30 pm
Room 1
Round Table 11: Viral Infections of the Central Nervous System
•
Herpesvirus infection of the CNS – Graciela Andrei, Laboratory of Virology and Chemotherapy, KU
Leuven, Leuven, Belgium
•
Genetics of host susceptibility to CNS viral infection - Katherine Spindler, University of Michigan, Ann
Arbor, MI, USA
•
Enteroviral CNS infections in Brazil- Edson Elias da Silva, Fiocruz, Rio de Janeiro, RJ
Chair: Edson Elias da Silva, Fiocruz, Rio de Janeiro, RJ
Room 2
Round Table 12: Frontiers on HIV Host-cell Interaction and Pathogenesis
•
HIV-1 drug resistance acquired through superinfection – Amilcar Tanuri, UFRJ, Rio de Janeiro, RJ,
Brazil
•
Resistance to HIV and persistence – Monsef Benkirane, Institut de Génétique Humaine CNRS,
Montpellier, France
•
Mechanisms of reactivation of HIV latency– Renato Santana de Aguiar, UFRJ, Rio de Janeiro, RJ, Brazil
Chair: Renato Santana de Aguiar, UFRJ, Rio de Janeiro, RJ, Brazil
Room 4
Oral Presentations on Plant and Invertebrate Virology
Convenor: Thor Vinícius Martins Fajardo, Embrapa Uva e Vinho, Bento Gonçalves, RS, Brazil
Helio Gelli Pereira Award
September, 2nd from 5:30pm - 7:00pm
The evaluation of several papers for the Award “Helio Gelli Pereira” will take a place on Spetember, 2nd from 5:30pm - 7:00pm
at room 2. Presenters will have 10 minutes for oral presentation, and the end of the presentation will be added five minutes to
evaluator’s questions.
Prêmio “Hélio Gelli Pereira”
CHRYSANTHEMUM STUNT VIROID IN BRAZIL: SURVEY, IDENTIFICATION, BIOLOGICAL AND MOLECULAR
CHARACTERIZATION AND DETECTION METHODS
Gobatto, D., Chaves, L.R.A., Harakava, R., Marque, M.J., Daròs, J.A., Eiras, M.
STUDY OF HUMAN VIRUS IN SURFACE WATER SURFACE: Quantification, integrity, infectivity and molecular
characterization.
Fongaro G., Nascimento, M.A., Viancelli, A., Petrucio, M.M.M., Tonetta, D., Retherbuch, G., Silva, A.DÁ., Esteves, P.A., Barardi,
C.R.M.
Characterization of norovirus infections in children admitted in a pediatric hospital for
gastroenteritis in Belém, Northern Brazil.
Siqueira, J.A.M., Da Costa, L.A., Dos Santos, M.G., De Carvalho, T.C.N., Justino, M.C.A., D’Arc, J.P.M., Gabbay, Y.B.
Rare G3P[3] rotavirus strain detected in Brazil: Possible human–canine interspecies transmission
Luchs, A., Cilli, A., Morillo, S.G., Carmona, R.C.C., Timenetsky, M.C.S.T.
Pag.
15
15
15
16
Oral Presentation
Room 4
8:30 - 10:30 am
Oral Presentation on Human Virology - 1
HV14 - UNEXPECTED DETECTION OF BOVINE G10 ROTAVIRUS IN A BRAZILIAN CHILD WITH DIARRHEA
Luchs, A., Timenetsky, M.C.S.T.
23
HV103 - Araraquara Viral RNA Load in Patients with Hantavirus Cardiopulmonary Syndrome
Machado, A.M., Souza, W.M., Pádua, M., Machado, A.R.S.R., Figueiredo, L.T.M.
24
hv86 - THE EFFECT OF HOST IL28B GENOTYPE ON CLINICAL OUTCOMES OF HEPATITIS A AND B
Toutinho, R.S., Fabrício-Silva, G.M., De Oliveira, J.C., Lewis-Ximenez, L.L., De Almeida, A.J., Pinto, M.A., Pôrto, L.C.M.S.,
De Paula, V.S.
HV290 - DETECTION AND GENOTYPING OF NOROVIRUS IN BLOOD AND STOOL SAMPLES OF CHILDREN
HOSPITALIZED WITH ACUTE GASTROENTERITIS IN BELÉM, PARÁ, BRAZIL.
Reymão, T.K.A., Fumian, T.M., Justino, M.C.A., Linhares, A.C., Mascarenhas, J.D.P., Lucena, M.S., Siqueira, J.A.M., Barros,
R., Gonçalves, M., Soares, L.S., Abreu, E., Gabbay, Y.B.
HV336 - COMPARATIVE ANALYSIS OF RASSF1A PROMOTER METHYLATION LEVELS BETWEEN HEPATOCELLULAR
CARCINOMA (HCC) AND NON-HCC TISSUES FROM BRAZILIAN HEPATITIS C VIRUS CHRONIC CARRIERS.
Rosa, A.G.S., Niel, C., Villela-Nogueira, C.A., Pannain, V., Araujo, N.M.
Monday, September 2
HV395 - LABORATORY-BASED ROTAVIRUS SURVEILLANCE DURING THE VACCINATION PROGRAM, BRAZIL,
2010–2012.
Carvalho-Costa, F.A., Leite, J.P.G., Volotão, E.M., Assis, R.M.S., Fialho, A.M., Andrade, J.S.R., Resque, H.R., Silva, M.F.M.,
Gomez, M.M., Rose, T.L.
Oral Presentation on Basic Virology
BV11 - EVOLUTIONARY HISTORY AND SPATIOTEMPORAL DYNAMICS OF RODENT-BORNE HANTAVIRUS
Souza, W.M., Bello, G., Amarilla, A.A., Alfonso, H.L., Aquino, V.C., Figueiredo, L.T.M.
Room 4
3:00 - 5:00 pm
Pag
BV74 - FOLLOWING THE STEPS OF AN EMERGING VIRUS ON ITS WAY INTO THE CELL BY LASER-SCANNING
CONFOCAL FLUORESCENCE MICROSCOPY
Carvalho, C.A.M., Silva, J.L., Gomes, A.M.O.
BV161 - THE ROLE OF LIPD RAFT IN SIGNALING EVENTS MEDIATED BY THE NON STRUCTURAL PROTEIN 1 OF
DENGUE VIRUS IN HEPG2 CELLS
Silveira, P.F., Ribeiro, E.M.C., Simoes, L.P., Pimenta, P.F.P., Bonjardim, C.A., Silva, B.M.
BV219 - JATROPHA CURCAS EXTRACT INHIBITS HIV-1 INDUCING INTERNALIZATION OF CD4 RECEPTOR
Silveira, P.P., Cunha, R.D., Barbizan, T., Pianowski, L.F., Tanuri, A., Aguiar, R.S.
BV226 - AN ANTIBODY DEPENDENT DENGUE INFECTION ENHANCEMENT IS MEDIATED BY HOMOLOGOUS
ANTI-ENVELOPE IgGs: IN VIVO AND IN VITRO OBSERVATIONS
Amorim, J.H., Fabris, D.L.N., Alves, R.P.S., Bizerra, R.S.P., Rodrigues, J.F., Ferreira, L.C.S.
BV250 - Investigation of Yellow Fever Virus-Induced Endoplasmic Reticulum Stress
Sanches, D., Rocha, C.M., Campos, S.P.C., Gaspar, L.P., Freire, M.S., Gonçalves, B.S., Chiarini, L.B., Silva, J.L., Gomes, A.M.O.,
Oliveira, A.C.
23
24
25
25
Pag
18
18
18
19
19
20
Oral Presentation on Human Virology - 2 and Immunobiologicals in Virology
Room 3
5:30 - 7:00pm
HV455 - ANALYSIS OF THE SPATIAL DISTRIBUTION OF DENGUE IN AEDES AEGYPTI MOSQUITOES IN A
NEIGHBORHOOD FROM SÃO JOSÉ DO RIO PRETO (SP)
Parra, M.C.P., Fávaro, E.A., Ozanic, K., Dibo, M.R., Chiaravalloti-Neto, F., Eiras, A.E., Nogueira, M.L., Mondini, A.
HV462 - EPSTEIN-BARR VIRUS AND CHRONIC ADENOTONSILLAR HYPERTROPHY.
Pestana, F.N., Arruda, E., Proença-Modena, J.L., Saturno, T.H., Escremim de Paula, F.E., Souza, J.M., Tamashiro, E.,Valera,
F.C., Anselmo-Lima, W.T.
HV627 - DIVERSITY OF ENTEROVIRUS ASSOCIATED WITH INFECTIONS OF THE CENTRAL NERVOUS SYSTEM IN
SÃO PAULO STATE, BRAZIL, 2004-2012.
Machado, B.C., Russo, D.H., Sousa, C.A., Timenetsky, M.C.S.T., Vieira, H.R., Carmona, R.C.C.
iv78 - A novel LAV tetravalent Dengue virus vaccine tested in African Green Monkeys.
Piper, A., Ribeiro, M., Smith, K., Briggs, C., Huitt, E., Spears, C., Quiles, M., Thomas, M., Brown, D., Hernandez, R.
Monday, September 2
IV419 - EXPERIMENTAL INFECTION IN CYNOMOLGUS MONKEYS (Macaca fascicularis) WITH HUMAN
ROTAVIRUS A
Bentes, G.A., Volotão, E.M., Guimarães, J.R., Lanzarini, N.M., Silva, A.S., Ganime, A.C., Leite, J.P., Pinto, M.A.
IV495 - CAMELID NANOBODIES, AN ALTERNATIVE TO DIAGNOSIS HANTAVIRUS INFECTION
Pereira, S.S., Fernandes, C.F., Prado, N.D.R., Morais, M.S.S., Luiz, M.B., Moreira, L.S., Mazzarotto, G.A.C.A., Strottmann,
D.M., Soares, A.M., Santos, C.N.D., Stabeli, R.G.
Oral Presentation on Environmental Virology
Room 4
5:30 - 7:00 pm
EV43 - GIANT VIRUSES ISOLATION FROM DIFFERENT BRAZILIAN HABITATS: URBAN AND NATURAL
ENVIRONMENTS
Boratto, P.V.M., Campos, R.K., Silva, L.C., Ferreira, P.C.P., Kroon, E.G., Abrahão, J.S.
EV61 - DETECTION OF HUMAN ADENOVIRUSES IN SURFACE WATER AND SEDIMENTS IN SANGRADOURO RIVER,
SANTA CATARINA, BRAZIL
Elmahdy, E.M.I., Schissi, C.D., Nascimento, M.A., Fongaro, G., Barardi, C.R.
ev233 - ENVIRONMENTAL SURVEILLANCE OF POLIOVIRUSES IN RIO DE JANEIRO IN SUPPORT TO THE
ACTIVITIES OF GLOBAL POLIO ERADICATION INITIATIVE.
Pereira, J.S.O., Silva, E.M., Silva, L.R., Oliveira, S.S., Costa, E.V., Da Silva, E.E.
ev409 - ROTAVIRUS DIVERSITY IN TREATED AND UNTREATED SEWAGE WATER FROM SIX DIFFERENTS CITIES
OF URUGUAY
Colina, R., Tort, L.F.L., Victoria, M., Garcia, M., Lizasoain, A., Leite, J.P.G., Cristina, J.
ev450 - Quantitative detection and recovery of infectious Enterovirus in different treated
sewage sludge matrices
Barbosa, M.R.F., Bonanno, V.M.S., Garcia, S.C., Yanagi, Y., Sato, M.I.Z., Hachich, E.M.
ev501 - DETECTION OF HUMAN BOCAVIRUS IN RAW WATER SAMPLES OF RIO DOS SINOS WATERSHED, RIO
GRANDE DO SUL, BRAZIL
Kluge, M., Henzel, A., Spilki, F.R.
Pag
26
26
26
27
27
28
Pag
20
21
21
22
22
22
Oral Presentation on Veterinary Virology
vv207 - MOLECULAR CHARACTERIZATION OF CANINE CORONAVIRUS STRAINS CIRCULATING IN PUPPIES
WITH ENTERITIS BY PARTIAL “S” GENE SEQUENCING
Bottino, F.O., Costa, E.M., Castro, T.X., Cubel Garcia, R.C.N.
Room 4
8:30 - 10:45 am
Tuesday, September 3
vv62 - ARBOVIRUSES IN WILD BIRDS IN THE STATE OF SÃO PAULO
Sousa, E., Criado, M.F., Saturno, T.H., Prates, M.C.M., Kawanami, A.E., Oliveira, J.P., Teles, P.H.F., Werther, K., Arruda, E.
vv224 - EXPERIMENTAL VACCINE TO BOHV-1 AND BOHV-5 FUNCTIONALIZED TO CARBON NANOTUBES
ENHANCES THE IMMUNE RESPONSE IN MOUSE MODEL
Barbosa, A.A.S., Leocádio, V.A.T., Souza, J.G., Laguardia-Nascimento, M., Daian, D.S.O., Da Fonseca, F.G., Barbosa-Stancioli,
E.F.
vv270 - Vaccinia virus:transmission through experimentally infected milk in a mouse model
Rehfeld, I.S., Fraiha, A.L.S., Matos, A.C.D., Souza, I.R., Costa, A.G., Furtado, A.M.B., Guedes, M.I.M.C., Lobato, Z.I.P.
vv327 - INFECTION OF FARMED MARINE SHRIMP WITH WHITE SPOT SYNDROME VIRUS IN THE STATE OF
SANTA CATARINA, BRAZIL
Lenoch, R., Espíndola, J.C., Claus, M.P., Barreiros, M.A.B., Alfieri, A.F., Alfieri, A.A.
vv494 - DIVERSITY OF G AND P GENOTYPES DETECTED IN BRAZILIAN PIG HERDS DURING 2005-2013
Lorenzetti, E., Campanha, J.E.T., Medeiros, T.N.S., Silva, D.R., Molinari, B.L.D., Rodrigues, W.B., Pereira, F.L., Balbo, L.C.,
Massi, R.P., Alfieri, A.A.
VV496 - MOLECULAR DETECTION OF INFLUENZA A VIRUS IN DOGS
Balbo, L.C., Silva, A.P., Bodnar, L., Beutemmüller, E.A., Facimoto, C.T., Miyabe, F.M., Massi, R.P., Headley, S.A., Alfieri, A.A.
VV634 - CHICKEN ANEMIA VIRUS AND AVIAN GYROVIRUS 2 DNA AS CONTAMINANTS IN POULTRY VACCINES
Varela, A.P.M., Santos, H.F., Cibulski, S.P., Scheffer, C.M., Schmidt, C., Lima, F.E.S., Esteves, P.A., Franco, A.C., Roehe, P.M.
Oral Presentation on Plant and Invertebrate Virology
Room 4
2:30 - 4:30 pm
Wednesday, September 4
PIV7 - DETECTION OF FOUR VIRUSES IN APPLES AND PEARS BY REAL TIME RT-PCR USING 5’-HYDROLYSIS
PROBES
Nickel, O., Fajardo, T.V.M.
PIV277 - STUDY OF THE STATE OF VIRAL INFECTION IN APIARIES IN THE AREA OF THE PAMPA GAUCHO.
Golin, R.O., Cañedo, A.D., Oliveira, M.C.P.V., Costa, M.F., Barcelos, C. de L.
PIV328 - INFECTION OF TOMATO PLANTS BY THE BEGOMOVIRUS Tomato chlorotic mottle virus
(ToCMoV) INCREASES THE EXPRESSION OF UBIQUITINATION PATHWAY GENES
Lacerda, A.L.M., Fonseca, L.N., Boiteux, L.S., Brasileiro, A.C.M., Ribeiro, S.G.
PIV373 - Infectious cDNA clones of the crinivirus Tomato chlorosis virus are competent for
systemic plant infection and whitefly-transmission
Orílio, A.F., Fortes, I.M., Navas-Castillo, J.
PIV394 - CHARACTERIZATION OF DNAJ PROTEINS REVEALS THEIR ROLE DURING PEPPER YELLOW MOSAIC
VIRUS INFECTION IN SUSCEPTIBLE HOSTS
Valente, D.D., Xavier, A.S., Bruckner, F.P., Nogueira, D.R.S., Zerbini, F.M., Alfenas-Zerbini, P.
PIV408 - POPULATION GENETIC STRUCTURE OF Tomato leaf deformation virus INFECTING TOMATO
CROPS IN ECUADOR AND PERU
Paz-Carrasco, L., Lima, A.T.M., Castillo-Urquiza, G.P., Ramos-Sobrinho, R., Vivas-Vivas, L., Zerbini, F.M., Alfenas-Zerbini, P.
PIV459 - Evolution of pe-38 gene in Baculoviridae
Fernandes, J.E.A., Ardisson-Araújo, D.M., Melo, F.L., Ribeiro, B.M.
Pag
31
32
32
33
33
34
34
35
Pag
28
29
29
30
30
30
31
XXIV Brazilian Congress of Virology & VIII Mercosur Meeting of Virology
15
CHRYSANTHEMUM STUNT VIROID IN BRAZIL:
SURVEY,
IDENTIFICATION,
BIOLOGICAL
AND MOLECULAR CHARACTERIZATION AND
DETECTION METHODS
Gobatto, D., Chaves, L.R.A., Harakava, R., Marque, M.J.,
Daròs, J.A., Eiras, M.
Brazil
1. Instituto Biológico, CEP 04014-002, São Paulo, SP,
2. Athena 7 Diagnóstico, Atibaia, Brazil
3. Instituto de Biología Molecular y Celular de Plantas,
Consejo Superior de 8 Investigaciones Científicas-Universidad
Politécnica de Valencia, Spain
In Brazil, ornamental flowers and plants market moves
in the wholesale and retail more than 2 billion 12 dollars,
annually, and chrysanthemum stands out as one of the
most valuable commercial species. The 13 stunting
disease induced by Chrysanthemum stunt viroid (CSVd)
has become a serious problem in 14 chrysanthemum
production systems worldwide. CSVd incites colour
breaking and retards flowering, but in 15 many
situations, not induces visible symptoms, facilitating its
spread in the field, and passing unnoticed 16 when cross
international borders. In Brazil, there are few studies
on this pathogen, with a single report of 17 its possible
occurrence in chrysanthemum in the State of São Paulo.
This work aimed to: (i) carry out a 18 survey, identify and
characterize viroids present in chrysanthemum crops in
the State of São Paulo; (ii) 19 challenge of chrysanthemum
varieties with a CSVd isolate; and (iii) develop diagnostic
methods to 20 strengthen quarantine and indexing
programs. Our survey showed that the CSVd is widely
disseminated in 21 chrysanthemum crops in São Paulo
State. All varieties of chrysanthemum evaluated were
susceptible, 22 without symptoms. The development of
oligonucleotides for conventional RT-PCR and RT-qPCR
will 23 allow the use of these techniques for diagnosis
with high sensitivity, 100.000 times more sensitive than
24 sPAGE. Dot-blot was sensitive and useful for diagnosis
of large number of samples. The complete genome 25
sequencing of a CSVd isolate showed high percentage
of nucleotide identity compared with other isolates 26
deposited in databases. This is the first identification
and molecular characterization of the CSVd in Brazil.
STUDY OF HUMAN VIRUS IN SURFACE
WATER
SURFACE:
Quantification,
integrity, infectivity
and molecular
characterization.
Fongaro G., Nascimento, M.A., Viancelli, A., Petrucio,
M.M.M., Tonetta, D., Retherbuch, G., Silva, A.DÁ.,
Esteves, P.A., Barardi, C.R.M.
September, 1 – 4, 2013 – Porto Seguro, Bahia, Brazil
Universidade Federal de Santa Catarina, Departamento
de Microbiologia, Imunologia e Parasitologia.
This study aimed to quantify human viruses, HAdV,
JCPyV, HAV and RVA in surface waters used for human
consumption, as well as evaluate the integrity, infectivity
and perform a molecular characterization of HAdV
present in these matrices. Three sites in the city of
Florianópolis-SC were selected: Site 1) Peri Lagoon;
Site 2) Source water; Site 3) Public supply water
system. Water samples were collected, processed and
viral quantification was determined by qPCR. Viral
integrity was evaluated by enzymatic assay (DNase I)
and infectivity by plaque assay (PA) and integrated cell
culture using enzymatic assay and transcribed mRNA
(ICC-et-RT-qPCR). The results found that 93% (67/72)
of the samples were positive for HAdV, 45.8% (33/72)
for RVA, 13.8% (10/72) for JCPyV and 12.5% (9/72) for
HAV. The evaluation of HAdV integrity and infectivity of
the samples showed that in Peri Lagoon 83% (10/12)
were undamaged and 75% (9/12) infectious; Source
water 66% (8/12) were undamaged and 58% (7/12)
infectious; Public supply water system 58% (7/12) were
undamaged and 25% (3/12) infectious. HAdV-2 was the
prevalent serotype of the HAdV. When PA and ICC-etRT-qPCR were compared, ICC-et- RT-qPCR was accurate,
efficient, sensitive and rapid.
Characterization
of
norovirus
infections in children admitted in a
pediatric hospital for gastroenteritis in
Belém, Northern Brazil.
Siqueira, J.A.M., Da Costa, L.A., Dos Santos, M.G., De
Carvalho, T.C.N., Justino, M.C.A., D’Arc, J.P.M., Gabbay,
Y.B.
Seção de Virologia, Instituto Evandro Chagas, Secretaria
de Vigilância em Saúde, Ministério da Saúde, Ananindeua,
PA, Brasil
Several viruses have been associated with acute
gastroenteritis (AGE), and group A rotavirus (RVA) and
norovirus (NoV) are the most prevalent. This study aimed
to assess their prevalence among children hospitalised
for diarrhoea during a three-year surveillance study.
From May 2008-April 2011, overall positivity rates
of 21.6% (628/2904) and 35.4% (171/483) were
observed for RVA and NoV, respectively. The seasonality
observed indicated distinct patterns when both
viruses were compared. This finding may explain why
hospitalisation for AGE remains constant throughout
the year. Continuous AGE monitoring is needed to better
assess the patterns of infection.
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award
16
Rare G3P[3] rotavirus strain detected
in
Brazil:
Possible
human–canine
interspecies transmission
Luchs, A., Cilli, A., Morillo, S.G., Carmona, R.C.C.,
Timenetsky, M.C.S.T.
Adolfo Lutz Institute, Virology Center, Enteric Diseases
Laboratory, São Paulo, SP, Brazil
An unusual strain of human rotavirus G3P[3] (R2638
strain) was detected from a 1-year-old child patient
during the epidemiological survey of rotavirus in the
state of São Paulo, Brazil in 2011. The aim of this study
was to carry out sequence analyses of the two outer
capsid proteins (VP4 and VP7) of the R2638 strain
detected in order to obtain further information of
the genetic relationships between human and animal
rotaviruses. Rotavirus G3P[3] was detected using a
commercial immunoenzymatic assay, SDS-PAGE, and
genotyped by RT-PCR. The analysis of the genetic
relationship between human and animal rotaviruses
was carried out by sequencing the VP7 and VP4 genes.
The VP7 gene of the R2638 strain displayed the highest
nucleotide identity to the canine strains A79-10 (96.6%)
and CU-1 (96.2%) isolated in USA. The VP4 sequence
showed the highest nucleotide identity to P[3] canine
rotavirus strain RV52/96 isolated in Italy at 94.1%.
Furthermore, the VP4 genes of P[3] strains could be
discriminated into two phylogentically distinct clusters.
The present study reinforces the hypothesis that
animal’s rotaviruses might be able to cross the species
barriers, and the lack of systematic surveillance of
rotavirus infection in small animals hinders the ability
to establish firm epidemiologic connections. Moreover,
in 2006 rotavirus vaccine was included in the Brazilian
Immunization Program, and selective vaccine pressure
could increase the circulation of uncommon strains. This
is the first report of G3P[3] in over 20-year period of
monitoring in Brazil.
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award
Oral Presentation
18
Oral Presentation
BV11
EVOLUTIONARY
HISTORY
AND
SPATIOTEMPORAL DYNAMICS OF RODENT-BORNE
HANTAVIRUS
Souza, W.M., Bello, G., Amarilla, A.A., Alfonso, H.L.,
Aquino, V.C., Figueiredo, L.T.M.
BV74 - FOLLOWING THE STEPS OF AN EMERGING
VIRUS ON ITS WAY INTO THE CELL BY LASERSCANNING
CONFOCAL
FLUORESCENCE
MICROSCOPY
Carvalho, C.A.M., Silva, J.L., Gomes, A.M.O.
1. Instituto Oswaldo Cruz - Fundação Oswaldo Cruz,
IOC - FIOCRUZ, Av.Brasil, 4365, Manguinhos, Rio de Janeiro
- RJ, Brasil - CEP: 21040-360
2. Faculdade de Medicina de Ribeirão Preto, FMRPUSP, Av. Bandeirantes, 3900 - Monte Alegre - Ribeirão Preto
- SP - 14049-900
3. Faculdade de Ciências Farmacêuticas de Ribeirão
Preto, FCFRP USP-RP, Av. do Café, s/nº. -Campus
Universitário - Ribeirão Preto - SP - 14040-903
Universidade Federal do Rio de Janeiro, UFRJ, Avenida
Carlos Chagas Filho, 373 (CCS) - Cidade Universitária, Rio
de Janeiro/RJ
Hantavirus (Family Bunyaviridae) are mostly associated
to rodents and transmitted to man by inhalation of
aerosolized infected excreta of these animals. The human
infection by Hantavirus can lead to severe diseases such
as hemorrhagic fever with renal syndrome (HFRS) in
Asia and Europe, and pulmonary syndrome (HPS) in
the Americas. To determine the origin, spreading and
evolutionary dynamics of rodent-borne hantavirus,
were collected 190 N gene sequences of rodent-borne
hantavirus identified from 30 countries over the past
25 years (1985 to 2010). Recombinant sequences and
identify identical sequences were not included in the
study. Nucleotide sequences were aligned and the spatiotemporal and demographic dynamics of dissemination
of rodent-borne hantavirus was reconstructed using the
Bayesian Markov Chain Monte Carlo (MCMC) approach
using the BEAST 1.7.4 program. It was estimated that
the N gene of hantavirus carried by rodents evolved at
a rate of 6.8 x 10-4 (2.5 x 10-4 - 1 x 10-3) nucleotide
substitutions per site per year and that rodent-borne
hantaviruses originated around 2,000 years ago.
However, the rodent-borne hantavirus had a large
period of slow growth and about 500 years ago started a
rapid spread worldwide that coincides with the human
traveling between continent. Hantaviruses associated
to Murinae and Arvicolinae subfamilies, probably, were
originated in Asia 500-700 years ago spreading toward
Siberia, Europe, Africa and North America. Hantaviruses
associated to Neotominae subfamily, probably, emerged
500-600 years ago in Central America and spread
toward North America. Finally, hantaviruses associated
to Sigmodontinae occurred in Brazil 400 years ago and
were, probably, originated from Neotominae-associated
virus from northern South America. These data offer
subsidies to understand the time-scale and worldwide
dissemination dynamics of rodent-borne hantaviruses.
Financial support: FAPESP
Arboviral infections are a major public health problem
worldwide. Of the 210 different species of arboviruses
circulating in Brazil, Mayaro virus (MAYV) is the fourth
in number of infected individuals, behind only dengue,
yellow fever and Oropouche viruses. Although Mayaro
fever in humans is even more debilitating than dengue
and its urbanization from the Amazon region is imminent,
the disease is largely neglected and many details of the
replication cycle of the virus are still unclear, including
the early events of infection. The aim of this work was
to analyze the behavior of MAYV particles during their
entry into host cells. To this purpose, MAYV was labeled
with the lipophilic fluorescent probe DiD without
impairment to viral infectivity and the fluorescent
signals were tracked in the host cells by laser-scanning
confocal fluorescence microscopy in real time. Our
results show that MAYV entry into cells occurs by an
endocytic mechanism involving fast internalization of
the endocyted cargo, since fluorescent signals from
labeled virus particles could be visualized inside the cell
a few seconds after virus binding to receptors on the cell
surface. Following DiD fluorescence dequenching at the
single particle level, we could capture the moment of the
fusion between the viral envelope and the endosomal
membrane, that was shown to occur faster (around 3
min post-binding) than for other arboviruses. This work
provides unique kinetic insights into the entry of virus
particles in living cells. Understanding the dynamics of
virus infection may provide important insights to the
development of antiviral strategies. Financial support:
CAPES, CNPq, FAPERJ, FINEP, INBEB and PRONEX.
BV161 - THE ROLE OF LIPD RAFT IN SIGNALING
EVENTS MEDIATED BY THE NON STRUCTURAL
PROTEIN 1 OF DENGUE VIRUS IN HEPG2 CELLS
Silveira, P.F., Ribeiro, E.M.C., Simoes, L.P., Pimenta, P.F.P.,
Bonjardim, C.A., Silva, B.M.
1. Universidade Federal de Ouro Preto, UFOP, Campus
Morro do Cruzeiro, Ouro Preto, Minas Gerais
2. Rede de pesquisa em virologia do interior do estado
de minas, INTRAVIRUS, Minas Gerais
3. Universidade Federal de Minas Gerais, UFMG,
Campus Pampulha, Belo Horizonte, Minas Gerais
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Oral Presentation
19
Oral Presentation
4. Fundação Oswaldo Cruz, FIOCRUZ, Augusto de
Lima, 1715, Belo Horizonte, Minas Gerais
The Dengue virus express non-structural proteins
which are involved primarily with the intracellular viral
multiplication steps. However, there are several reports
that these proteins can interact with cellular proteins
and substantially change their functions and, therefore,
control the rates of cell multiplication and the secretedprotein expression profile, such as cytokines and
chemokines. One of these non-structural proteins are
NS1. After your synthesis, NS1 associates to membranes
where it remains as the only viral protein in infected
cells. In addition, in vivo assays have shown that NS1
can accumulate in the liver of animals and changes some
cellular functions. Data obtained by our group, suggest
that the expression of NS1 changes the activation profile
of MAP kinases MEK/ERK and NF-kB pathway proteins.
These signaling pathways, like many others, are activated
at level of plasma membrane in response to extracellular
stimuli that can be mediated by GPI-anchored proteins
that are associated with membrane micro domains
named lipid rafts in wich, according to data from
literature; NS1 is also associated by a GPI-anchor. To
investigate the importance of lipid rafts in triggering of
signaling events mediated by NS1 we are analyzing the
distribution of caveolina-1 (the main marker of rafts) in
cells expressing NS1 or DENV-infected by western blot
of membrane fractions extracts. Our preliminary data
have shown that the expression of NS1 can promotes
changes in the distribution of caveolina-1 in HepG2 cells,
suggesting that this protein may be causing changes in
cellular signaling pathways. To refine these results we
are generating cells silenced for caveolina-1 that will
be very useful to assess the involvement of lipid rafts in
signaling events mediated by expression of NS1 in liver
cells. The identification of role of lipid rafts into signaling
events elicited by NS1 can be useful to understand the
complex relations between cells and Dengue virus.
Supported by: UFOP, FAPEMIG, CNPq and CAPES.
BV219 - JATROPHA CURCAS EXTRACT INHIBITS
HIV-1 INDUCING INTERNALIZATION OF CD4
RECEPTOR
Silveira, P.P., Cunha, R.D., Barbizan, T., Pianowski, L.F.,
Tanuri, A., Aguiar, R.S.
1. Laboratório de Virologia Molecular UFRJ, LVM/
UFRJ, Av. Carlos Chagas Filho 373, CCS, Bloco A, Sala 121
Cidade Universitária, CEP: 2
2. Kyolab Pesquisas Farmacêuticas, Kyolab, Rua Isaura
Ap. Oliveira Barbosa Terini n° 231 Jd. Itapuã - Valinhos-SP
Highly active antiretroviral therapy (HAART) has been
used as standard treatment to HIV-1 infection; however,
virus resistance contributes to therapeutic failure.
Therefore, searching for new class of drugs to reduce
HIV-1 infection has been the best alternative to control
multi-resistant virus since an effective vaccine against
HIV-1 is not available. Here, we screened extracts from
Jatropha curcas to evaluate cytotoxicity and antiviral
activity against HIV-1 in lymphocytes CD4+ (MT-4
cells).Our results showed that the fraction THS eluted
in hexane decreased HIV-1 infection up to 80% in a
dose-dependent manner. The maximum inhibition of
HIV-1 infection was observed at 260µg/ml of THS. Cell
viability experiments were showing no toxicity in these
concentrations. Although there was no effect of this
compound in the production and release of the virus,
THS blocked HIV-1entry into the cell but did not impair
HIV pseudotyped with VSVG envelope proteins. These
results suggested that THS specifically affects HIV-1
entry mediated by CD4 internalization. Flow cytometry
analysis showed that CD4 receptor was downregulated
from the plasma membrane in MT-4cells after 10 min
of treatment with THS. Confocal microscopy confirmed
that this compound promotes CD4 internalization into
cellular vesicles. The treatment with PKC inhibitor
(GO6983) revert the effects of CD4 internalization
suggesting that THS effect is dependent on PKC activity.
In fact, variants of CD4 harboring mutations that are not
longer phosphorylated (serines and threonines residues
in the cytoplasmic tail) showed no internalization in the
presence of THS. In conclusion, THS extract it’s a new
antiviral class that can be potentially used to block new
HIV transmission by CD4 depletion. This property makes
THS extract a potential microbicide candidate that could
be used in prevention strategies.
BV226 - AN ANTIBODY DEPENDENT DENGUE
INFECTION ENHANCEMENT IS MEDIATED BY
HOMOLOGOUS ANTI-ENVELOPE IgGs: IN VIVO
AND IN VITRO OBSERVATIONS
Amorim, J.H., Fabris, D.L.N., Alves, R.P.S., Bizerra, R.S.P.,
Rodrigues, J.F., Ferreira, L.C.S.
Instituto de Ciências Biomédias - Universidade de São
Paulo, ICB - USP, Av. Professor Lineu Prestes, 1374
The main correlate of protection for dengue virus (DENV)
infection is the generation of neutralizing antibodies
against the envelope glycoprotein, particularly the
domain III (EDIII), which is involved with host cell
receptor recognition. The protection correlate is mainly
determined in vitro by virus neutralization assays carried
out with non- Fc receptor bearing cells. In order to
investigate this point, the DENV2 EDIII was obtained as a
purified recombinant protein retaining native biological
properties. This protein was used as a vaccine antigen,
co-administered with or without different adjuvants
20
Oral Presentation
in BALB/c mice. Animals immunized with inactivated
DENV or non-immunized mice were studied as controls.
The induced antibody responses were studied and
immunized mice were challenged with a homotypic
DENV2 (JHA1) strain. The antibodies generated before
and after infection were tested regarding neutralization
activity. Immunized mice developed a Th2 immune
response pattern with high levels of IgGs capable of
neutralizing the virus in in vitro assays carried out with
non-Fc receptor bearing cells. However, under in vivo
infection challenges, we found that animals immunized
with EDIII developed hematological disturbances, tissue
damage and increased tissue viral load earlier than nonimmunized mice. As a consequence, immunized mice
died earlier than non-immunized mice. In addition,
sera from EDIII-immunized mice were shown to induce
increased levels of infection in Fc-receptor bearing cells.
The present results indicate that a strictly humoral and
homologous immune response directed against DENV
EIII causes a homotypic ADE by increasing the infection
level of Fc bearing cells and accelerating the onset of
damage symptoms in vivo. The contribution presented
in this work is the first evidence that the process of
developing dengue vaccines should be reviewed.
BV250 - Investigation of Yellow Fever VirusInduced Endoplasmic Reticulum Stress
Sanches, D., Rocha, C.M., Campos, S.P.C., Gaspar, L.P.,
Freire, M.S., Gonçalves, B.S., Chiarini, L.B., Silva, J.L.,
Gomes, A.M.O., Oliveira, A.C.
1. Universidade Federal do Rio de Janeiro, UFRJ, Av
Carlos Chagas Filho, 373, CCS, Cid Universitária, Rio de
Janeiro
2. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil,
4365 - Manguinhos, Rio de Janeiro
The yellow fever is a hemorrhagic disease of great
relevance in Africa and South America, where it occurs
as small outbreaks. It is caused by the yellow fever
virus (YFV), a flavivirus such as the Dengue Virus, both
being transmitted by mosquitos. During its life cycle, the
YFV uses the endoplasmic reticulum for translation of
viral proteins and assembly of new viral particles. The
accumulation of misfolded proteins in this organelle
triggers the endoplasmic reticulum stress (ERS), which
leads to the dissociation of the binding immunoglobulin
protein (BiP) from ATF6, PERK e IRE1. Once released,
these factors become active and start to mediate the
ERS. ATF6 is transported to Golgi, where is cleaved.
PERK and IRE1 homodimerize, are phosphorylated and
become active. PERK phosphorylates and inactivates
eIF2a. IRE1 is a RNAse that alternatively splices XBP1
mRNA, leading to the production of a response for
ERS. One of these responses is the overexpression of
the nuclear transcription factor CHOP, which regulates
the expression of pro and anti-apoptotic genes. In this
study, we investigate the ERS induced by the infection
of VERO cells by YFV through western-blotting and
fluorescence microscopy. We infected VERO cells with
YFV, using a multiplicity of infection of 1. We analyzed
cell viability by the LIVE/DEAD assay and we observed
that by 72 hours post infection, cells undergo cell death.
The ERS induction was noticed by CHOP overexpression.
Moreover, we observed phosphorylation of eIF2a, ATF6
cleavage and spliced XBP1 18 hours post infection. BiP
expression levels remained unaltered. Apoptosis was
analyzed by the TUNEL assay and it was observed 72
hours post infection. Our results suggest that the YFV
induces ERS in VERO cells through PERK, ATF6 cleavage,
XBP1 splicing and CHOP overexpression. Financial
Support: Capes, CNPq, FAPERJ, Pronex, INBEB
EV43 - GIANT VIRUSES ISOLATION FROM
DIFFERENT BRAZILIAN HABITATS: URBAN AND
NATURAL ENVIRONMENTS
Boratto, P.V.M., Campos, R.K., Silva, L.C., Ferreira, P.C.P.,
Kroon, E.G., Abrahão, J.S.
Universidade Federal de Minas Gerais, UFMG, Av.
Antônio Carlos, 6627 - Bloco F4-258 - Pampulha
The nucleocytoplasmic DNA large viruses (NCDLV) are a
group formed by the largest viruses known . In the last
years, an increase in their study was observed, given that
some of them have many interesting features that set
this group apart from other viruses, Mimiviridae and the
Marseilleviridae families belong to NCDLV, and have been
isolated from some locations as cooling towers, antartic
lakes, oceans, etc. However, despite Acanthamoeba spp.
(its natural host) presents a global distribution, there is
a lack of information regarding these viruses in some
regions of the world. Brazil is a country with many habitats
where this study can be performed, representing an open
field for giant viruses study. Therefore, the objective of
this work was to perform the isolation of giant viruses
from three Brazilian regions marked by different levels
of pollution and urbanization. We collected about 425
samples of water and soil from three regions differently
affected by human activity: the artificial lake of Pampulha
in Belo Horizonte (high pollution level), Central Lake
in Lagoa Santa ( intermediary pollution level) and the
Serra do Cipó National Park (low pollution level). These
samples were enriched, filtered (membranes of 0.2 μm)
and then, the isolation of giant viruses was attempted
in amoebae of Acanthamoeba castellanii specie, by the
observation of cytopatic effect. Other tests were also
performed, including real-time PCR (for Mimiviridae
and Marseilleviridae), helicase and polymerase genes
sequencing optical and electronic microscopy. Four
21
Oral Presentation
viruses were isolated by the described methods. The
PCR analysis and the sequencing method grouped
all of them in the Mimiviridae family. In conclusion,
this work showed that giant viruses also can be found
in environments regardless the pollution level. This
reinforces the probably ubiquitous character of these
viruses, although some areas still need to be explored
to confirm this hypothesis. Financial Support: CNPq,
FAPEMIG, CAPES, MAPA.
EV61 - DETECTION OF HUMAN ADENOVIRUSES
IN SURFACE WATER AND SEDIMENTS IN
SANGRADOURO RIVER, SANTA CATARINA, BRAZIL
Elmahdy, E.M.I., Schissi, C.D., Nascimento, M.A., Fongaro,
G., Barardi, C.R.
Universidade Federal de Santa Catarina, UFSC,
Departamento de Microbiologia, Imunologia e Parasitologia
Sediments are suggested to play an important role in
transmission of enteric viruses in the environment
because of the sorption to and desorption from these
biosolids which can control the transport of viruses
and other waterborne pathogens through the water
column. Human Adenovirus (HAdV) is highly prevalent
in both sewage and biosolids and it has been included in
all three of the U.S. Environmental Protection Agency’s
contaminant candidate lists, which prioritize currently
unregulated drinking water contaminants (EPA, 2012).
The Sangradouro River located in Florianopolis, Santa
Catarina, Brazil receives the Peri lagoon water during
the rainy episodes and also inadequate disposal of
wastewater and sewage from neighborhood houses
and hostels. In this study, HadV were quantified either
in surface water or sediment samples by real-time
PCR (qPCR) along the Sangradouro River. A total of
48 samples were collected in six points with different
sediment characteristics during the summer season
of 2013. Two liters of surface water samples were
concentrated by negatively charged membranes and 20g
of sediment samples were concentrated and clarified
using glycine buffer followed by polyethylene glycol
(PEG) precipitation. The HAdV genome was detected
in 17/24 (70.8%) ranging from 105 to 108 genome
copies (gc) per liter and 10/24 (41.7%) ranging from
and 109 to 1010 gc/L in surface water and sediment
samples, respectively. Higher concentrations of gc of
HadV in sediment samples may be due to its organic
material composition which plays an important role in
the protection of viruses against sunlight inactivation.
On the basis of this preliminary study, we conclude that
the HAdV can be potentially found in high amounts in
sediments due to its stronger affinity to biosolids. This
study will continue by searching other enteric viruses
in these samples, looking for seasonal contribution of
the enteric virus prevalence and also infectivity assays
for future risk assessment studies. Financial support:
CNPq/TWAS and CNPq Universal 470808/2009-8.
ev233 - ENVIRONMENTAL SURVEILLANCE OF
POLIOVIRUSES IN RIO DE JANEIRO IN SUPPORT TO
THE ACTIVITIES OF GLOBAL POLIO ERADICATION
INITIATIVE.
Pereira, J.S.O., Silva, E.M., Silva, L.R., Oliveira, S.S., Costa,
E.V., Da Silva, E.E.
Fundação Oswaldo Cruz/Laboratório de Enterovírus ,
Fiocruz, Av. Brasil, nº 4365, Pav. Hélio e Peggy Pereira, sala
B217, Manguinhos - RJ.
Poliomyelitis is an acute infectious disease that
occurs following an infection caused by one of three
poliovirus serotypes (serotypes 1, 2, and 3). Since the
implementation of global polio eradication initiative, the
incidence of wild poliovirus transmission has dramatically
dropped (> 99%). However, wild polioviruses remain
endemic in three countries (Afghanistan, Pakistan and
Nigeria) but cases of re-emergency have been reported
in previously polio-free countries (ex. Somalia and
Kenya). Environmental surveillance of polioviruses has
been used as a supplementary tool in monitoring the
circulation of wild poliovirus and/or vaccine derived
poliovirus (VDPV), even in the absence of acute flaccid
paralysis (AFP) cases. This study aimed to isolate and
characterize poliovirus and Non-Polio Enteroviruses
(NPEV) from wastewater samples collected at one of
the stations of sewage treatment (ETE Alegria/ Cedae),
located in Rio de Janeiro city. From December 2011 to
June 2012 and from September to December 2012, 31
samples were collected and concentrated. Isolation
in RD and L20B cell cultures, followed by RT-PCR was
able to detect enteroviruses in 27/31 samples (87%).
Poliovirus was isolated in 8/27 positive samples
(29.6%): Sabin1= 1 sample, Sabin 2 = 5 samples, Sabin
3 = 2 samples. The remaining isolates were NPEV. All
polioviruses were classified as Sabin-like based on the
nucleotide sequences of the VP1 gene. VDPVs were not
detected. The following NPEV have been identified: 1
Echovirus 3; 11 Echovirus 6, 7 Echovirus 7, 2 Echovirus
20; 4 Coxsackievirus B4 and 2 Coxsackievirus B5.
Environmental surveillance has been used successfully
in monitoring the circulation of enteroviruses and it
is of crucial importance in the final stages of the WHO
global polio eradication initiative. Our results show
the continuous circulation of Sabin-like poliovirus and
non-polio enteroviruses in the analyzed area during the
study period.
22
Oral Presentation
ev409 - ROTAVIRUS DIVERSITY IN TREATED
AND UNTREATED SEWAGE WATER FROM SIX
DIFFERENTS CITIES OF URUGUAY
Colina, R., Tort, L.F.L., Victoria, M., Garcia, M., Lizasoain,
A., Leite, J.P.G., Cristina, J.
ev450 - Quantitative detection and
recovery of infectious Enterovirus in
different treated sewage sludge matrices
Barbosa, M.R.F., Bonanno, V.M.S., Garcia, S.C., Yanagi, Y.,
Sato, M.I.Z., Hachich, E.M.
1. Regional Norte, Universidad de la República, UdelaR,
Gral. Rivera 1350, 50000, Salto, Uruguay
2. Fundacao Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365,
Manguinhos, 21040-360, Rio de Janeiro, Brazil
3. Centro de Investigaciones Nucleares - UdelaR,
UdelaR,
Companhia Ambiental do Estado de São Paulo, Cetesb,
Av. Prof. Frederico Hermann Jr., 345
Transmission of Group A Rotavirus (RVA) between
human
populations
through
surface
waters
contaminated with sewage water (SW) is a serious
health problem worldwide. The aim of this study was
to determine and characterize the contamination of
SW in different areas of Uruguay by RVA. We analyze
the presence of RVA in SW collected samples from
six different cities located on the North, west and east
region of Uruguay. The SW samples were collected from
four cities without sewage treatment plant (STP) placed
on the north and west region that discharge directly its
SW in the Uruguay River (SW-UR), while the others two
cities from the east region have STP with UV treatment
system (SW-STP). In all the 6 cities, 42ml of SW were
collected, and viral concentration was made by using an
ultracentrifugation protocol. In the case of SW-UR, the
samples were collected during an entirely year (from
02/11 to 02/12), fortnightly in each city. In the case of
SW-STP, the samples were collected bimonthly (from
09/11 to 06/12), and the collection was made at affluent
and effluent in each STP. Viral RNA extraction was
conducted from the previously concentrated viruses,
performed by commercial kit according to manufactures
instructions and cDNA was generated using random
hexamer primers. Worldwide standardized specific
Nested Multiplex PCR protocol directed against outer
capsid protein genes VP4 and VP7 were conducted for
RVA genotype determination. The RT-PCR analysis of
the SW-UR samples (n=126) showed a positivity of 41%
(n=51) and in the case of SW-STP (n=20), 40% were
positive at affluent and 10% at effluent. The diversity of
genotypes detected were as follow: 1) SW-UR: G2, P[6],
P[9]; 2) SW-STP: G2, P[8], P[4]. VP4 and VP7 consensual
fragment of the positive samples are under sequencing
process to confirm the genotypes through phylogenetic
analysis. These results are the first evidence of the
environmental dissemination and diversity of RVA in
different regions of Uruguay. Financial support: Polos
de Desarrollo Universitario, Univerisdad de la República
(UdelaR). Comisión Sectorial de Investigación Científica
(CSIC) UdelaR
Treated sewage sludge is increasingly applied to
agricultural land as fertilizer, and as a beneficial
alternative to conventional means of disposal. However,
the reuse is often restricted due to the presence of toxic
metals and pathogens that can lead to the contamination
of ground water and food chain. The objectives of
this study were to determine the concentration of
Enterovirus in treated sewage sludge from different
treatment processes and to evaluate the effectiveness of
the method concentration by the recovery of poliovirus
1 (PV-1). Treated sewage sludge samples were collected
from four wastewater treatment plants (WWTP) in São
Paulo, Brazil, with four different sampling events at each
plant. Two samples were collected each month from
November 2011 to June 2012. The equivalent of 12g
of total solids (gTS) of sample was eluted in 3% beef
extract. The solids were separated by centrifugation
and the viruses in the supernatant were concentrated
by organic flocculation. The pellet was resuspended in
phosphate buffer and treated with chloroform. For the
recovering evaluation the samples were spiked with
approximately 400 plaque forming units (PFU) of PV1. Eluted viruses were enumerated by the single-layer
plaque assay using the human rhabdomyosarcoma
(RD) cell line. The mean recovery efficiency of the
method was 32%, with significant difference (p<0.05)
values comparing the four treatment processes. The
mean concentration of indigenous Enterovirus and the
mean recovery efficiency of the samples, considering
each treatment process were the following: dewatering
(41.4PFU/gTS, 52.2%), composting (<0.25PFU/gTS,
38.9%), mesophilic anaerobic digestion,FeCl3, and
organic polymer (5.4PFU/gTS, 20.6%), mesophilic
anaerobic digestion, FeCl3, and lime (<0.25PFU/gTS,
16.2%). The method evaluated is considered simple and
presented recovery percentages variable from 11.5%
to 85.3%. However it should be taken into account that
such performance suffers the influence of the sample
matrix.
ev501 - DETECTION OF HUMAN BOCAVIRUS
IN RAW WATER SAMPLES OF RIO DOS SINOS
WATERSHED, RIO GRANDE DO SUL, BRAZIL
Kluge, M., Henzel, A., Spilki, F.R.
23
Oral Presentation
Universidade Feevale, FEEVALE, ERS 239, 2755 - Novo
Hamburgo - RS, 93352-000
Human bocavirus (HBoV), a member of the Parvoviridae
family, was first described in 2005 when it was isolated
from respiratory tract secretions of young children with
acute respiratory disease. Although HBoV is frequently
associated with respiratory infections in children, it
has also been detected in stool samples, leaving unclear
its role as a causative agent of gastroenteritis. Since
HBoV can be excreted through feces, its presence in
water should be considered as a possible source of
transmission. Therefore, the aim of this study is to
evaluate the presence of HBoV in raw water samples
collected from ten drinking water treatment plants
localized within the Rio dos Sinos watershed, Rio Grande
do Sul, Brazil. 500 ml of each sample was collected and
concentrated using an adsorption-elution method,
followed by the extraction of the viral DNA. The presence
of HBoV genome was detected by conventional PCR
using primers designed to align in highly conserved
regions of the HBoV genome, targeting the nonstructural
protein NP1. The reaction products were submitted to
electrophoresis on 2% agarose gel in a TBE buffer, stained
with SYBR Safe DNA Gel stain (Invitrogen) and visualized
by UV light. So far, 29 water samples were analyzed from
January to October 2011 and 5 of them were positive to
HBoV genome. Those samples were previously tested
for enteroviruses and rotaviruses by conventional PCR
and they all resulted negative for those viruses. These
preliminary results suggest that HBoV may be included
as an additional marker of fecal contamination in water
samples and further studies are necessary to evaluate its
risks for public health. Financial support: CNPq, Feevale,
Capes, FAPERGS
HV14 - UNEXPECTED DETECTION OF BOVINE
G10 ROTAVIRUS IN A BRAZILIAN CHILD WITH
DIARRHEA
Luchs, A., Timenetsky, M.C.S.T.
Instituto Adolfo Lutz, IAL, Av Dr Arnaldo, 355 Centro
de Virologia 01246-902
Rotavirus group A (RVA) G3 genotype has broadest
host range. The aims of this study were to carry out
Bayesian phylogenetic analyses using the nucleotide
sequences of VP7 gene available in GenBank in order
to investigate the evolutionary dynamic between RVA
G3 strains originating in humans, wild and domestic
animals; quantify the mutation rates; and estimate
the most recent common ancestors. For 5 bovines,
3 simians, 2 environmental, 8 canines, 22 equines, 3
felines, 5 rabbits, 5 porcines, 2 caprines, 3 murines, and
199 human G3 strains; the entire or partial VP7 ORF
sequences and the year of isolation could be retrieved
from GenBank. The Bayesian inference method available
in the software BEAST v. 1.6.2 was used in order to
analyze the phylogenetic relationship. Based on 257
sequences, the mutation rate was estimated to be 1.7318
x 10-3 (1.4374-2.075 x 10-3) nt substitution/site/year.
The TMRCA inferred for G3 strain was calculated to be
1786 (1765-1810). It was possible to separate three
distinct Lineages of G3 by phylogenetic analysis. All of
them contain animals and humans strains; however,
Lineage II contains the majority of human G3 strains,
and they are associated with urban environments.
Phylogeography and temporal analysis, suggested
that G3 strain emerged in Asia and scattered through
the globe in rural environments. The urban context of
RVA G3 circulation was later observed 100-110 years
ago, and the data analyzed also suggested that the
urbanization process took place in Asia, and posteriorly
in Europe and the Americas. The Bayesian Phylogenetic
analysis suggests that a transmission between human
and animals may be the ancestral characteristic of the G3
strain, and its urbanization is a later phenomenon. The
most recent common ancestor of this strain was dated
back to 1786; however the emergence of the majority
human urban Lineage II could be tracked back to around
1904. This data suggests that the urbanization of the RVA
and its fixation on human population may be associated
with the industrialization process associated with the
change from rural settlements towards a predominantly
urban population. Also, urbanized strains are apparently
more prevalent than rural strains. The complexity that
naturally arises from this changing environment is an
ideal situation to the emergence of a new zoonotic virus,
as indicated by the recent epidemics of SARS-COV, and
H1N1. Financial Support: PPG-CCD-SES/SP; IAL
hv86 - THE EFFECT OF HOST IL28B GENOTYPE ON
CLINICAL OUTCOMES OF HEPATITIS A AND B
Toutinho, R.S., Fabrício-Silva, G.M., De Oliveira, J.C.,
Lewis-Ximenez, L.L., De Almeida, A.J., Pinto, M.A., Pôrto,
L.C.M.S., De Paula, V.S.
1. Instituto Oswaldo Cruz - FIOCRUZ, IOC FIOCRUZ, Av. Brasil 4365
2. Universidade Estadual do Rio de Janeiro, UERJ,
Despite advances in therapy and vaccine development,
viral hepatitis infections still account for morbidity
and mortality worldwide. Genetic diversity of host
immune response, such as IL28B SNPs, may contribute
to explain the variability in the outcome of hepatitis A
and B infection. Host IL28B genotype has significant
influence on treatment response to chronic hepatitis
patients. Whether IL28B genotype influences directly
as an antiviral agent, in non-treated patients, is still
24
Oral Presentation
unknown. For these reasons, this study aim to compare
the genetic profile of IL28B SNPs to different outcomes
of hepatitis A and B viral infection. For this purpose,
samples from patients with different hepatitis clinical
outcomes, confirmed by serology, were genotyped for
IL28B by TaqMan real time PCR. In the total, 144 samples
were enrolled into 3 cohorts: 100 acute, 23 chronic and
21 fulminant hepatitis. Concerning acute samples, 86
belongs to hepatitis A and 14 hepatitis B group. Between
fulminant samples, 6 belong to hepatitis A, 2 from hepatitis
B and 13 non-viral hepatitis patients. Genotyping results
of IL28B17, 60 and 75 were confronted with different
characteristics factors (hepatitis type, group, clinical
outcome, viral/non-viral). Statistic results showed that
only clinical outcome were significant associated with
IL28B haplotypes and alleles (p<0.05), independently
of the hepatitis type. IL28B60T and IL28B75G variant
alleles were more frequent in chronic patients (60.6%)
than in fulminant ones (39.4%). IL28B17TT haplotype
and the absent of IL28B17G variant allele were more
frequent in acute patients than in chronic (87.8%/12.2%)
and fulminant ones (87.8%/12.2% and 71.1%/28.9%,
respectively). IL28B60CC haplotype and the absent
of IL28B60T variant allele were more frequent in
acute patients than in chronic ones, 93.9% and 6.1%,
respectively. IL28B75AA haplotype and the absent of
IL28B75G variant allele were more frequent in acute
patients (93.5%) than in chronic ones (6.5%). With the
high resolution molecular typing of clinical groups was
verified that there is evidence of the influence of IL28B
SNPs with the outcome of hepatitis A and B. This study
is the first that shows association between hepatitis A
and B outcomes with IL28B in Brazil. Understanding
how the host factor influences the immune response
to viral infection provides new opportunities to control
these diseases and for the development of effective
therapeutics, which justifies the study of this locus.
HV103
Araraquara
Viral
RNA
Load
in
Patients
with
Hantavirus
Cardiopulmonary Syndrome
Machado, A.M., Souza, W.M., Pádua, M., Machado,
A.R.S.R., Figueiredo, L.T.M.
Centro de Pesquisa em Virologia - FMRP -USP, CPV FMRP - USP, Av. Bandeirantes 3900 - Monte Alegre - Ribeirão
Preto - SP
Hantaviruses
(Bunyaviridae)
are
rodent-borne
emerging viral with a worldwide distribution and with
high lethality in Americas. In the Americas, hantaviruses
are known to cause Hantavirus pulmonary syndrome
(HPS), this one is an increasing health problem in Brazil,
especially in Central Plateau and Southeastern, where
circulates the Araraquara virus, which may be the most
virulent hantavirus of world. To understand the role that
viral load plays in the pathogenesis in patients with HPS,
we quantified Araraquara virus S segment viral RNA in
blood samples from 20 acutely ill patients, divided into
teen samples from patients in acute period, and teen
samples obtained from survivors (convalescent phase).
To detection and quantitation of Araraquara virus RNA
of S segment was used a one-step SYBR Green realtime RT-PCR. From the sera of 20 human HPS patients,
the hantavirus genome was amplified in 10 sera by
quantitative RT-PCR, including 2 samples that have not
been amplified previously by conventional RT-PCR.
These 2 samples had low viral loads (3,67x104 and
2,64x104 copies/ml of serum) that were likely below
the detection capacity of conventional RT-PCR. The
analysis of viral load demonstrated high plasma levels
of viral RNA during acute infection phase (2,64x104 and
3,78x106 copies/ml). We observed that high plasmatic
viral load of Araraquara virus are inversely correlated
with IgG antibody concentration. In 10 survivors who
had samples obtained after the acute phase, not was
observed detection of viral RNA, however high levels of
IgG antibody was observed. These results suggest that
patients with high viral loads on admission are more
likely to have severe disease.
HV290 - DETECTION AND GENOTYPING OF
NOROVIRUS IN BLOOD AND STOOL SAMPLES
OF CHILDREN HOSPITALIZED WITH ACUTE
GASTROENTERITIS IN BELÉM, PARÁ, BRAZIL.
Reymão, T.K.A., Fumian, T.M., Justino, M.C.A., Linhares,
A.C., Mascarenhas, J.D.P., Lucena, M.S., Siqueira, J.A.M.,
Barros, R., Gonçalves, M., Soares, L.S., Abreu, E., Gabbay,
Y.B.
Norovirus (NoV) are currently considered the major
cause of acute gastroenteritis (AGE) in children less than
5 years old, causing more than 1 million hospitalizations/
year and around 200,000 deaths/year in this age group.
The most common symptoms of the infection by NoV
are diarrhea, vomiting and fever. However, studies
have demonstrated other extra-intestinal symptoms,
like disseminated intravascular coagulation, seizures,
encephalopathy, and necrotizing enterocolitis, and until
now, little is known about its ability to spread outside
the gut. The present study, aims to investigate the role of
NoVs causing viremia in children hospitalized for AGE, as
well as to correlate the presence of NoVs RNA in serum
with clinical severity and stool viral load. Paired stool
and serum samples were collected from 85 pediatric
patients under 6 years hospitalized for AGE from March
to September 2012 in Belem, Brazil. Enzyme-linked
immunosorbent assay (EIA) and reverse transcription
quantitative PCR (RT-qPCR) were used to detect and
25
Oral Presentation
quantify NoVs, respectively. Phylogenetic analysis of the
partial ORF2 region was used to genotype the strains
detected. NoVs were detected in 34.1% (29/85) of stool
samples. By qRT-PCR, we found a high rate of NoVs RNA
in serum samples (34.5%) among NoVs-positive AGE
cases, and was associated with a longer hospitalization
(6.5 vs. 4.0 days; p = 0.006), as well as with a higher stool
viral load (3.9x1011 vs. 1.1x1011 GC/g; p = 0.0472).
NoVs strains were classified as GII.4 (90% of genotyped
strains) and GII.7 (10%). The same genotype was found
in paired stool and serum samples. Detection and
molecular characterization of NoVs GII in paired stool
and serum samples suggest that the dissemination of
NoVs to the blood stream is not uncommon, but the role
of viruses spread outside the gut and the relationship
with disease severity need to be further addressed.
This is the first study conducted in Brazil concerning
the detection of NoV in serum samples. Future studies
on children with NoV-positive AGE and viremia should
be conducted for a clearer understanding of the NoVs
pathogenesis. Finnancial support: CNPQ/IEC/SVS
HV336 - COMPARATIVE ANALYSIS OF RASSF1A
PROMOTER METHYLATION LEVELS BETWEEN
HEPATOCELLULAR CARCINOMA (HCC) AND NONHCC TISSUES FROM BRAZILIAN HEPATITIS C
VIRUS CHRONIC CARRIERS.
Rosa, A.G.S., Niel, C., Villela-Nogueira, C.A., Pannain, V.,
Araujo, N.M.
1. Fundação Oswaldo Cruz, FIOCRUZ, Avenida Brasil,
4365, Manguinhos, Rio de Janeiro, RJ, Brasil
2. Universidade Federal do Rio de Janeiro, UFRJ,
Hepatocellular carcinoma (HCC) is one of the most
common tumors worldwide. HCC is frequently diagnosed
after the development of clinical deterioration at which
time survival is measured in months. Hepatitis C virus
(HCV) infection is a major cause of chronic hepatitis and
a major risk factor for HCC in Brazil. Hypermethylation
of promoter regions of tumor suppressor genes has
been shown to facilitate the development of human
cancers, including HCC. This study was performed to
determine whether occurrence of aberrant methylation
of RASSF1A gene promoter might be associated with
hepatocarcinogenesis in Brazilian HCV chronic carriers.
Methylation levels were measured by bisulphite
pyrosequencing of DNA extracted from formalin-fixed,
paraffin-embedded liver tissues. Twenty-five samples,
including 15 HCC, two cirrhotic and eight normal liver
tissues were analyzed. In each sample, the percent
of methylation was determined for six promoter CpG
islands (1 to 6). At each of them, low, intermediate
and high levels of methylation were measured for
normal liver, cirrhotic and HCC tissues, respectively.
Mean percents of methylation were as follows. CpG1:
14.7% (normal tissues), 29.4% (cirrhotic) and 59.2%
(HCC); CpG2: 11.3%, 26.4% and 65.4%; CpG3: 12.4%,
31.2% and 72.3%; CpG4: 11.1%, 29.1% and 57.9%;
CpG5: 16.6%, 34.9% and 61.3%; CpG6: 16.4%, 35.7%
and 60.0%. Understanding epigenetic changes in HCVassociated HCC will help to elucidate the pathogenesis
and may lead to the identification of molecular markers
for liver cancer prognosis, diagnosis and treatment.
HV395
LABORATORY-BASED
ROTAVIRUS
SURVEILLANCE DURING THE VACCINATION
PROGRAM, BRAZIL, 2010–2012.
Carvalho-Costa, F.A., Leite, J.P.G., Volotão, E.M., Assis,
R.M.S., Fialho, A.M., Andrade, J.S.R., Resque, H.R., Silva,
M.F.M., Gomez, M.M., Rose, T.L.
Instituto Oswaldo Cruz - Fiocruz – Rio de Janeiro – RJ,
IOC, Av. Brasil, 4365, Manguinhos, RJ CEP 21040360
Diarrheal diseases are the second leading cause of death
in children worldwide, enteric viruses are responsible
for about 40% of the cases. Group A rotaviruses (RVA)
are frequently detected in children with acute diarrhea,
and have worldwide distribution. In Brazil, a monovalent
vaccine (Rotarix) is part of the immunization schedule,
starting in 2006. This study aims to assess the current
epidemiological picture of RVA diarrhea; 3,841 fecal
samples obtained in the period 2010-2012 from patients
from 14 Brazilian states were studied. Polyacrylamide gel
electrophoresis and enzyme immunoassay were utilized
for RVA detection. Positive samples were genotyped
by seminested multiplex RT-PCR. RVA was detected
in 18.4% (n = 707) of the patients. Concerning RV-A
genotypes, the following rates were observed: G2P[4],
n=440 (62.2%); G3P[8], n=85 (12%); G not typed (NT)
P[8], n=38 (5.4%); G9P[8], n=32 (4.5%); G2P[NT], n=13
(1.8%); G1P[6], n=12 (1.7%); G1P[8], n=9 (1.3%); GNT
P[6], n=9 (1.3%); G3P[6], n=7 (1%); G4P[8], n=7 (1%);
G3P[NT], n=6 (0.8%); G9P[NT], n=2 (0.3%); G1P[9],
n=1 (0.1%); G2P[6], n=1 (0.1%); GNTP[4], n=1 (0.1%);
GNTP[NT], n=44 (6.2%). Among children less than
1 year-old, the rates of RVA detection were 107/598
(17.9%) in 2010, 52/393 (13.2%) in 2011, and 43/326
(13.2%) in 2012. A shift in the rate of detection of the
distinct genotypes was observed during the study
period. G2P[4]/G2P[NT]/GNTP[4] was detected in
86.7% (366/422) of RV-A positive subjects in 2010, in
50.3% (75/149) in 2011, and only 9.6% (13/136) in
2012. This finding was accompanied by an increase in
the detection rate of the G3P[8]/G3P[NT] genotype:
2.4% (10/422) in 2010, 22.1% in 2011 (33/149), and
41.2% (56/136) in 2012. Therefore, in 2012, G2 has not
been the predominant genotype for the first time since
its emergence in 2006. Certainly, the shift observed in
26
Oral Presentation
RVA genotypes circulation during the study period has
epidemiological implications, particularly with respect
to Rotarix effectiveness.
HV455 - ANALYSIS OF THE SPATIAL DISTRIBUTION
OF DENGUE IN AEDES AEGYPTI MOSQUITOES IN A
NEIGHBORHOOD FROM SÃO JOSÉ DO RIO PRETO
(SP)
Parra, M.C.P., Fávaro, E.A., Ozanic, K., Dibo, M.R.,
Chiaravalloti-Neto, F., Eiras, A.E., Nogueira, M.L.,
Mondini, A.
1. Faculdade de Medicina de São José do Rio Preto,
FAMERP, Av. Brigadeiro Faria Lima, 5416, São Pedro, São
José do Rio Preto
2. Unversidade Estadual Paulista, UNESP,
3. Universidade de São Paulo, USP,
Dengue is an important arboviral infection with
worldwide distribution and Aedes aegypti mosquitoes
are the main vectors of dengue viruses (DENV 1-4)
in Brazil. São José do Rio Preto, which is located at
the northwestern region of São Paulo State, has been
presenting high incidences of the disease every year and
the geographic information systems (GIS) can contribute
for a better comprehension of dengue distribution and
for more effective surveillance measures in cities that
present an endemic circulation of the disease. Adult
trap information combined with spatial analysis can
provide fundamental information of DENV spread and
transmission. The aim of our study was to associate
viral surveillance in mosquitoes with spatial analysis to
identify possible hot spots of DENV transmission. We
have placed MosquititoTM traps twice a week in an area
that comprises 25 census tracts and 102 blocks from May
to October 2012. The specimens were pooled and labeled
according to genus/species, gender and collection site.
The geocoding was performed with TerraView open
software (DPI/INPE). Our analysis was performed with
mosquitoes collected from the epidemiological week 10
until the epidemiological week 44. Approximately 340
traps were positive for the presence of Aedes aegypti
mosquitoes, among 1,332 traps that were installed in
the study area. We were able to detect DENV-1, DENV-2
and DENV-4 in four adult traps of three different census
tracts. One of these tracts can be considered a hot spot
for dengue transmission because we were able to find
an infected adult male, which is an indication of local
vertical transmission. In this tract, DENV transmission
would occur without the presence of infected human
subjects. Our preliminary data indicate that census
tracts can present different risks of dengue transmission
and control measures should be applied according to
viral surveillance in mosquitoes and humans alike.
HV462 - EPSTEIN-BARR VIRUS AND CHRONIC
ADENOTONSILLAR HYPERTROPHY.
Pestana, F.N., Arruda, E., Proença-Modena, J.L., Saturno,
T.H., Escremim de Paula, F.E., Souza, J.M., Tamashiro,
E.,Valera, F.C., Anselmo-Lima, W.T.
Faculdade de Medicina de Ribeirão Preto , FMRP-USP,
Av. Bandeirantes, 3900 - Monte Alegre - Ribeirão Preto
Epstein-Barr virus (EBV), the main cause of infectious
mononucleosis, is a herpesvirus that infects B
lymphocytes of 95% of humans. Chronic adenotonsillar
hypertrophy (CAH) is a poorly understood disease
and the most frequent indication for tonsillectomy
in the world. This study assessed the EBV infection
in palatine tonsils, adenoids, nasal secretions and
peripheral blood in patients with CAH undergoing
tonsillectomy at the University of Sao Paulo Hospital in
Ribeirao Preto, Brazil. A total of 180 patients with CAH,
without symptoms of acute respiratory infections, who
underwent tonsillectomy in 2011-2012 were enrolled.
EBV detection and quantification were done by qPCR.
EBV genome was detected in 137 (76%) of patients.
Overall, 122 (68%) had detectable EBV in palatine
tonsil tissue samples, 110 (61%) in adenoids, 76 (42%)
in respiratory secretions, 51 (28%) in the peripheral
blood and 10 (7.3%) in all four tested sites. The median
tissue viral loads were 1.72x105 and 2.37x105 genome
copies/g in palatine tonsils and adenoids, respectively.
The median EBV loads in respiratory secretions and
peripheral blood were respectively 7.65 x 102 and 7.28
x 102. Approximately 55% of the patients had EBV viral
loads higher than 105 copies/g of adenotonsillar tissue.
There was no relationship of high viral loads in all of the
tested samples with the different degrees of tonsillar
hypertrophy. The results suggest that EBV infection is not
a cause of chronic adenotonsillar hypertrophy and is not
related with the grades of palatine tonsils hypertrophy.
However, the presence of high viral loads of EBV in
the palatine tonsils and adenoids was associated with
simultaneous detection of EBV in respiratory secretions
and peripheral blood. This suggests that these lymphoid
tissues may function as reservoirs of EBV-infected
cells, and that children with hypertrophic tonsils are
important sources of EBV shedding, which assures the
virus transmission to susceptible hosts.
HV627 - DIVERSITY OF ENTEROVIRUS ASSOCIATED
WITH INFECTIONS OF THE CENTRAL NERVOUS
SYSTEM IN SÃO PAULO STATE, BRAZIL, 2004-2012.
Machado, B.C., Russo, D.H., Sousa, C.A., Timenetsky,
M.C.S.T., Vieira, H.R., Carmona, R.C.C.
Instituto Adolfo Lutz, IAL, Ave. Dr. Arnaldo, 355,
01246-902
27
Oral Presentation
Human enteroviruses (HEVs) are responsible for a wide
spectrum of clinical diseases. HEVs comprise a large
genus in the Picornaviridae family, with 113 serotypes
delineated into four species (A–D) based mostly on their
phylogenetic relationships. Members of the enterovirus
B species cause a central nervous system (CNS) infection,
like encephalitis, meningoencephalitis and mainly
aseptic meningitis. The aim of this study was to establish
the occurrence of HEVs in patients with infectious of
the CNS in São Paulo State, Brazil. This retrospective
study was conducted in convenient surveillance clinical
specimens (cerebralspinal fluid and/or stool, swab anal,
and brain biopsy) collected from 922 patients with
infections of the CNS, in a period of 2004 to 2012. We
investigated the presence of enterovirus (EVs) in these
samples by cell culture to isolate the viral agent. The
samples that showed citopathic effect (CPE) in the cell
culture were submitted by Indirect Immunofluorescence
(IFA), using monoclonal antibodies (Chemicon, USA),
RT-PCR and VP1 partial sequencing to identification
of EVs isolated. Entroviruses were identified in 15.2%
(140/922) of all CNS infectious; corresponding to 92.1%
(n=129/140) of aseptic meningitis, 1.4% (n=2/140) of
encephalitis, 2.9% (n=4/140) of meningoencephalitis,
and 3.6% (n=5/140) other viral neurological infections.
Echoviruses (E) were isolated most frequently, with 90
cases (64.3%), Coxsackievirus B (CV-B), with 11 cases
(7.8%), and 39 cases with EVs untypeable (27.9%). E-6
was the most commonly identified serotype (23.6%;
n=33/140), followed by E-30 (20.7%; n=29/140), E-18
(12.1%; n=17/140), CV-B5 (5.7%; n=8/140), E-11 (2.9;
n=4/140), E-4 (3.6%; n=5/140), CV-B4 (1.4%; n=2/140),
E-9, E-13 and CV-B1(0.7%; n=1/140). EVs were detected
in all the period of the year with the highest rate in the
spring and summer months. Data obtained in this study
contribute to the knowledge about HEVs circulation
implicated in CNS infections over a 9-year period in São
Paulo State. Financial support: FAPESP: 2012/50234-5.
iv78 - A novel LAV tetravalent Dengue virus
vaccine tested in African Green Monkeys.
Piper, A., Ribeiro, M., Smith, K., Briggs, C., Huitt, E.,
Spears, C., Quiles, M., Thomas, M., Brown, D., Hernandez,
R.
1. North Carolina State University , NC STATE, 128
Polk Hall, Raleigh, NC, USA 27695
2. Arbovax, Arbovax, 617 Hutton Street, Suite 101,
Raleigh NC 27606
Arbovax, in collaboration with NC State, has developed
a novel strategy to produce a Dengue virus (DV) live,
attenuated tetravalent vaccine by creating viral mutants
with truncated transmembrane domains. These are
host range mutants (HR) and grow well in insect cell
culture but poorly in mammalian cells. Thus, these HR
viruses are attenuated for growth in mammals. For DV
the use of live, attenuated virus vaccines (LAV) yields
the best chance of developing: 1). A safe and effective
vaccine that will protect against all four DV serotypes
2). Initiate the desired immune response, neutralizing
antibodies as well as an effective cellular response and
3). Produce a balanced immune response. Recent work
in the dengue field revealed that for DV, neutralizing
antibodies are preferentially made against epitopes
only found in the native, live-virus configuration. The
Arbovax vaccine method creates live virus vaccines for
all four serotypes with altered transmembrane domains
that are embedded within the virus’s protective outer
membrane, so that all virus ectodomains, or outside
surfaces that are available to the host’s immune system
and are indistinguishable from those of the wild-type
Dengue virus. By this method, the best possible substrate
for immune response is generated, an attenuated virus
with wild-type virus structure. This tetravalent vaccine
formulation was tested in African Green Monkeys and
found to be safe, immunogenic, and demonstrated
limited interference upon vaccination and post challenge.
100% of the animals sero-converted to DV 1,2, 3 and
4 prior to challenge on day 62. All vaccinated animals
showed an anamnestic response of >3 fold increase over
control animals. These host range tetravalent vaccine
strains contain the homologous non-structural proteins
recently found to be critical for the development of a
complete protective response in humans. This vaccine is
scheduled to move to Phase I clinical trials.
IV419
EXPERIMENTAL
INFECTION
IN
CYNOMOLGUS
MONKEYS
(Macaca
fascicularis) WITH HUMAN ROTAVIRUS A
Bentes, G.A., Volotão, E.M., Guimarães, J.R., Lanzarini,
N.M., Silva, A.S., Ganime, A.C., Leite, J.P., Pinto, M.A.
Instituto Oswaldo Cruz/Fundação Oswaldo Cruz,
IOC/Fiocruz, Av. Brasil, 4365, Pav. Helio e Peggy Pereira,
Manguinhos, Rio de Janeiro/RJ
Rotavirus is the most common cause of severe acute
diarrhea in infants and young children worldwide. The
incidence of rotavirus disease is similar in developed
and developing countries but the mortality is higher
in the former countries. Their double-stranded RNA
consists of 11 segments, which encode six viral capsid
proteins (VP1, 2, 3, 4, 6 and 7) and six nonstructural
proteins (NSP1-6). Rotavirus is classified into seven
serogroups (A-G) based upon the antigenic properties of
VP6, an inner capsid protein, of which groups A, B and
C are human pathogens. Rotavirus spreads from person
to person, mainly by faecal-oral transmission. Detectable
rotavirus antigenaemia and viremia suggests that
28
Oral Presentation
rotavirus escapes from the intestinal tract. In this study,
we report the experimental infection of nine infantjuvenile cynomolgus monkeys (Macaca fascicularis)
using a human rotavirus A (RV-A Wa) produced in
cell culture. The aim was to assess the suitability of
the cynomolgus as a model of rotavirus infection and
diarrhea. Six animals were inoculated orally with RV-A
Wa by catheter, and three animals were administrated
orally with saline solution (control group). Clinical and
corporal temperatures were monitored every day. The
blood was collected in 0, 1st, 3rd, 7th and 10th days post
infection (dpi) for measurement of total white blood cells,
hematocrit and electrolytes levels. Faeces were collected
daily from the 0 to the 10th dpi. Both samples were tested
to the rotavirus presence by RT-PCR and qPCR. The
study was approved in Ethics Commission for the Use
of Animals – CEUA/Fiocruz (LW-35/11). The monkeys
inoculated with rotavirus had the subclinical infection
form. Every biochemistry and hematological parameters
had low alterations comparing animals inoculated with
control group animals, but any statistical significance
was observed in these parameters, and majority animals
had no signals, except one animal, which had occurrence
of diarrhea for three days. Nevertheless, the infection
occurred in all inoculated animals, the RNA rotavirus was
detected in faeces and serum. This monkey model can be
used in future to evaluate the efficacy of immunoglobulin
Y immunotherapy in rotaviruses disease.
IV495 - CAMELID NANOBODIES, AN ALTERNATIVE
TO DIAGNOSIS HANTAVIRUS INFECTION
Pereira, S.S., Fernandes, C.F., Prado, N.D.R., Morais,
M.S.S., Luiz, M.B., Moreira, L.S., Mazzarotto, G.A.C.A.,
Strottmann, D.M., Soares, A.M., Santos, C.N.D., Stabeli,
R.G.
1. Fundação Oswaldo Cruz Rondônia, Porto Velho,
Brazil, FIOCRUZ RONDÔNIA, RUA DA BEIRA, 7671, BR
364, KM 3,5
2. Centro de Pesquisa em Medicina Tropical, Porto
Velho, Brazil, CEPEM, Avenida Guaporé 215, Lagoa, Porto
Velho RO
3. Instituto Carlos Chagas - Fiocruz Paraná, Brazil,
ICC/FIOCRUZ PARANÁ, Algacyr Munhoz Mader, 3775,
Curitiba/PR,
4. Centro de Estudos de Biomoléculas Aplicadas à
Saúde, CeBio, Rua da Beira 7671 Br 364 Km 3,5 sentido
Cuiabá
Hantaviruses that belong to the Bunyaviridae family
can cause Hantavirus pulmonary syndrome (HPS) in
the American continent. The infection in human occurs
through inhalation of aerosolized excreta from chronically
infected rodents and the association of the disease with
different rodent reservoirs in several geographic areas
suggests the development of region-specific antigens.
HPS is characterized by fever and vascular leakage,
resulting in noncardiogenic pulmonary edema followed
by shock. With a case-fatality rate about 50%, a rapid and
accurate diagnosis during the early course of the disease
is essential to reducing the high mortality rate associated
with hantavirus infection. Camelids produce, in addition
to conventional antibodies, IgG composed exclusively of
heavy chains, in which the antigen binding site is formed
only by the single domain, called VHH or nanobody. This
work proposes the use of camelid nanobodies against
Araucaria hantavirus recombinant nucleoprotein
(rNH) of a Brazilian hantavirus to develop alternative
methods to diagnosis and confirm hantavirus infection.
To generate VHHs, the phage display technology was
employed. VHH domains were isolated by RT-PCR using
cDNA obtained after RNA extraction from peripheral
lymphocytes of an immunized Lama glama. Amplicons
were cloned into PHEN1 phagemid vector and TG1 E.
coli strain to construct a VHH immune library with a
titer of 2,3 x1018 cfu/mL. Subsequently, VHH domains
were displayed fused to M13KO7 phage coat protein
III and the selection steps performed on immobilized
rNH protein. After two round of selection, 69 individual
clones recognized specifically rNH protein by ELISA. The
positive clones were sequenced, analyzed and the 11
sequences that showed different profiles deposited into
GenBank. One of the selected VHHs was purified by NiNTA affinity cromatography and recognized specifically
the rNH by ELISA, western blotting and surface plasmon
resonance. These findings support the idea that selected
VHHs could be an alternative tool to diagnosis hantavirus
infections. FINANCIAL SUPPORT: CNPQ
PIV7 - DETECTION OF FOUR VIRUSES IN APPLES
AND PEARS BY REAL TIME RT-PCR USING
5’-HYDROLYSIS PROBES
Nickel, O., Fajardo, T.V.M.
Embrapa Uva e Vinho, CNPUV, Caixa Postal 130,
95.700-000 Bento Gonçalves, RS
Apple latent viruses such as Apple stem pitting virus,
Apple stem grooving virus, Apple chlorotic leaf spot virus
and Apple mosaic virus are commonly found in apples
and pears. They are main targets of virus elimination
procedures from elite and pre-basic material that
usually require evaluation of health by processing a large
number of samples. Real time RT-PCR offers substantial
advantages over conventional RT-PCR for plant virus
diagnosis such as immediate availability of results
which obviates laborious gel analysis, reduced sample
manipulation that reduces amplicon contamination and
high sample processing capacity. The objective of this
29
Oral Presentation
work was to design primers and probes for a real time
RT-PCR protocol for detection of ASPV, ACLSV, ASGV and
ApMV. Specific probes labeled with FAM/TAMRA and
primers were designed by searching for highly conserved
nucleotide fragments in the respective coat protein genes
of the four viruses using software CLC Sequence Viewer
6, and used to detect the viruses in tissues of apples and
pears. Total RNA was extracted from apple and pear
bark scrapings and adsorbed on to silicium dioxyde.
The StepOnePlus Real Time PCR System was used for
thermocycling. Results were analysed graphically using
proprietary StepOne Software v2.2.2. Related to the
previously known viral status based on RT-PCR and/
or biological indexing of the analyzed apple samples,
89.2% (25/28), 96.4% (27/28), 100% (28/28) and 88%
(22/25) of infections by ASGV, ASPV, ACLSV and ApMV,
respectively were confirmed. In pears, recognition of
known pre-existing ASPV infections by primers and
probe was 100%. Viral infections were confirmed in
a selection of the main commercial cvs. of apples and
pears. These results demonstrate the sensitivity and
reliability of the designed primers and probes for
detection of these pathogens. Real Time RT-PCR using
labeled probes represents a valuable tool to increase
feasibility of processing large numbers of samples and it
is therefore well adapted for control of sanitary quality
such as required by healthy plant propagation material
certification programs. Financial support: CNPq Proc. Nr.
479609/2011-0
PIV277 - STUDY OF THE STATE OF VIRAL
INFECTION IN APIARIES IN THE AREA OF THE
PAMPA GAUCHO.
Golin, R.O., Cañedo, A.D., Oliveira, M.C.P.V., Costa, M.F.,
Barcelos, C. de L.
Universidade Federal do Pampa, UNIPAMPA,
In recent years, we have seen a sharp and worrying
decline of the global bee populations, a phenomenon
known as Colony Collapse Disorder (CCD), that is
seriously threatening beekeeping and crops that depend
on bees for pollination. Among the reasons cited for this
decline as suspects, are the viruses. Because the swarms
are densely populated and have a high rate of contact
between the colony members, relating each other for
communication and feeding, bee colonies provide great
opportunities for viral transmission. The virus can affect
all developmental bee stages, including eggs, brood and
adults, and drastically reducing honey production and
pollination. Among the family of viruses that affect the
bees is the Iflaviridae family, with no scientific records in
the hives of Apis mellifera in the state of Rio Grande do
Sul. This study aims to identify the viruses of this family
that are present in beehives of different state cities. Adult
workers of Apis mellifera and dead pups were collected
from six hives of two apiaries. These individuals were
processed at molecular biology laboratory of the Federal
University of Pampa, Sao Gabriel campus, where we
performed extraction of total RNA, cDNA synthesis and
PCR with specific primers for viral detection, as well as
a multispecies primer that detects three Iflavirus types
(Deformed Wing Virus, Kacugo Viruses and Varroa
Destructor Virus). Positive results were obtained for
the presence of Varroa destructor virus (VDV-1) with a
specific primer for this one, as well as viral amplification
in different samples using the multispecific primer,
suggesting the presence of other viruses. This is the first
record of VDV-1 in South America hives. These results
allow a better understanding of the problems that affect
or may affect the region apiaries, as well as provides
subsidies for new viral detections in Apis mellifera.
Financial support:CNPq
PIV328 - INFECTION OF TOMATO PLANTS BY THE
BEGOMOVIRUS Tomato chlorotic mottle
virus (ToCMoV) INCREASES THE EXPRESSION
OF UBIQUITINATION PATHWAY GENES
Lacerda, A.L.M., Fonseca, L.N., Boiteux, L.S., Brasileiro,
A.C.M., Ribeiro, S.G.
1. Embrapa Recursos Genéticos e Biotecnologia,
CENARGEN, Parque Estação Biológica - PqEB - Av. W5
Norte (final) 70770-917 – Brasilia
2. Embrapa Hortaliças, CNPH, Rodovia Brasília/
Anápolis BR 060 Km 09 Gama - DF CEP 70351-970
Ubiquitination is a post-translational modification that
controls the degradation of protein in eukaryotes. The
substrate targeted by ubiquitin molecules are degraded
by the 26S proteasome complex. The ubiquitination
pathway involves an enzymatic cascade that tags the
substrate by the attachment of ubiquitin molecules
with participation of E1 ubiquitin activating enzyme, an
E2 ubiquitin conjugation enzyme and an E3 ubiquitin
ligase, that confers specificity to the substrate. Several
plant viruses show ability to disturb the ubiquitination
pathway by inducing, inhibiting or modifying enzymes,
mainly E3 ligases. The aim of the present work is to
study expression of genes involved in the ubiquitination
pathway during the tomato-begomovirus interaction.
An mRNA-Seq from cDNAs libraries of inoculated and
non-inoculated tomato near isogenic lines Santa Clara
(susceptible) and LAM 157 (resistant) was performed
and seven genes of the ubiquitination pathway were
identified: one E3 ubiquitin-protein ligase, three F-box
proteins, two RING finger proteins and one Ubiquitinconjugating enzyme E2-like protein. These genes showed
significant up-regulation (log2 fold change > 2.0) when
plants were inoculated with ToCMoV (Tomato chlorotic
30
Oral Presentation
mottle virus). These results were further confirmed by
reverse transcription qPCR (qRT-PCR). The expression of
these genes is currently being evaluated in a time course
assay following virus inoculation. Since it has been
described that the silencing of ubiquitination pathway
genes enhanced the begomovirus Tomato yellow leaf
curl virus infection, the next step of this study will be
the silencing of these ubiquitin pathway genes using
VIGS (Virus-induced gene silencing). After confirmation
of silencing effectiveness, plants will be inoculated
with ToCMoV and the resulting phenotype evaluated.
Financial support: Fundo Embrapa/Monsanto, CNPq,
INCT-Interações Planta-Praga, FapDF
PIV373 - Infectious cDNA clones of the
crinivirus Tomato chlorosis virus are
competent for systemic plant infection
and whitefly-transmission
Orílio, A.F., Fortes, I.M., Navas-Castillo, J.
Inst. Hortofruticultura Subtropical y Mediterránea
La Mayora, IHSM-UMA-CSIC, Estación Experimental “La
Mayora”, 29750 Algarrobo-Costa, Málaga, Spain.
Tomato chlorosis virus (ToCV) is a crinivirus (genus
Crinivirus, family Closteroviridae) that causes important
emerging diseases in tomato and other crops. ToCV is
limited to the phloem, is not transmitted mechanically
and naturally is transmitted in a semipersistent
manner by the whiteflies Bemisia tabaci, Trialeurodes
vaporariorum and T. abutilonea. The ToCV genome
consists of two molecules of linear, positive-sense
RNA encapsidated into long flexuous virions with a
complex structure. Here we present the construction of
infectious cDNA clones of the ToCV genome (RNA1 and
RNA2) under the control of the CaMV 35S promoter in
a binary plasmid. Agroinfiltration of N. benthamiana
leaves with clones of both RNAs resulted in systemic
infection. Tomato plants also were infected by grafting
them with agroinfected N. benthamiana plants, showing
the typical symptoms caused by this virus consisting in
chlorotic spots on the lower leaves that extend towards
the top of the plant and evolves to interveinal yellowing.
Furthermore, the viral progeny generated in tomato
was transmitted to new tomato plants by B. tabaci. The
infectious clones obtained constitute a genetic system
that will allow to identify the viral genes involved in
replication, movement in the host plant, transmission
and pathogenicity by reverse genetics.
PIV394 - CHARACTERIZATION OF DNAJ PROTEINS
REVEALS THEIR ROLE DURING PEPPER YELLOW
MOSAIC VIRUS INFECTION IN SUSCEPTIBLE
HOSTS
Valente, D.D., Xavier, A.S., Bruckner, F.P., Nogueira,
D.R.S., Zerbini, F.M., Alfenas-Zerbini, P.
1. Universidade Federal de Viçosa, UFV, Laboratório de
Microbiologia Industrial/ BIOAGRO
2. Universidade Federal de Viçosa, UFV, Laboratório de
Virologia Vegetal Molecular/ BIOAGRO
During co-evolution between virus and host, a complex
interaction has been developed involving several
mechanisms of pathogen attack and host defense. Host
defense responses cause up- and downward shifts in
gene expression. To understand the process of tomato
infection by the potyvirus Pepper yellow mosaic virus
(PepYMV), a subtractive library identified several genes
as differentially expressed during the early stages of
viral infection. Among the induced genes was the one
encoding a DnaJ (HSP40) protein. Members of the DnaJ
multigene family contain a highly conserved 70-amino
acid signature region, the J domain, and assist as cochaperones of HSP70s in various cellular processes.
The involvement of HSP proteins in the enhancement
or inhibition of pathogenesis in a wide range of viral
infections has been described. Our own previous
data demonstrate that DnaJ induction contributes to
the early stages of PepYMV infection. To advance our
understanding of the role of this protein during PepYMV
infection, the complete sequence of two genes encoding
Solanum lycopersicum homologs of DnaJ (SlDj1 and
SlDj2)were cloned. Both SlDj1 as SlDj2 proteins have
the conserved J, G/F and C-terminal domains but
the zinc finger domain is present only in SlDj1. The
subcellular localization of SlDj was analyzed by confocal
microscopy using a SlDj-GFP fusion. In healthy plants
the subcellular localization of SlDj1 and SlDj2 is nuclear
and cytoplasmatic while in PepYMV-infected plants, 12
days after inoculation, SlDj1 and SlDj2 are localized only
in the cytoplasm. SlDj did not interact directly with any
individual viral protein in a two-hybrid assay. It is likely
that in the context of infection these proteins interact
either with the intermediates of the processing of the
viral polyprotein, or indirectly through a bridge protein.
Financial support: CNPq, CAPES, FAPEMIG and INCT
Planta-praga.
PIV408 - POPULATION GENETIC STRUCTURE OF
Tomato leaf deformation virus INFECTING
TOMATO CROPS IN ECUADOR AND PERU
Paz-Carrasco, L., Lima, A.T.M., Castillo-Urquiza, G.P.,
Ramos-Sobrinho, R., Vivas-Vivas, L., Zerbini, F.M.,
Alfenas-Zerbini, P.
1. Dep. Fitopatologia/BIOAGRO, Universidade Federal
de Viçosa, DFP/BIOAGRO/UFV, Avenida Peter Henry Rolfs,
s/n. Campus Universitário. 36570-000, Viçosa, MG.
31
Oral Presentation
2. Lab Fitopatología/Estación Experimental del
Litoral del Sur, INIAP, Km 26 Vía Durán-Tambo, al Oeste de
Guayaquil, Cantón Yaguachi, Guayas, Ecuador
3. Departamento de Microbiologia, Universidade
Federal de Viços, UFV, Avenida Peter Henry Rolfs, s/n.
Campus Universitário. 36570-000, Viçosa, MG
The family Geminiviridae is characterized by a particle
morphology of twinned incomplete icosahedra and
a genome comprised of circular, single-stranded
DNA. Whitefly-transmitted geminiviruses (genus
Begomovirus) are responsible for serious agricultural
threats in Latin America. We have recently reported the
widespread occurrence of a monopartite begomovirus,
Tomato leaf deformation virus (ToLDeV), in Ecuador.
Here, we determined the genetic structure of ToLDeV
populations based on the analysis of 67 full-length
genome sequences of isolates collected from Ecuador
(determined in this study) and 9 additional sequences
of isolates from Peru (previously available from
Genbank). Subdivision analysis indicated a markedly
genetic differentiation between isolates collected from
both countries (FST: 0.42929). Overall, the Ecuadorian
subpopulation showed lower genetic variability than
that from Peru (π = 0.00853 and 0.05174, respectively).
Interestingly, while the CP, TrAP and Ren genes from
the Peruvian subpopulation were about 2.5 times more
variable than those from the Ecuadorian subpopulation,
its Rep and markedly the AC4 genes were much more
variable (about 10 and 18 times more variable than
those of isolates from Ecuador, respectively). Neutrality
tests (Fu and Li’s D* and F*) indicated positive selection
acting on the AC4 gene of isolates from Peru. However
the evidence was weak, since no positively selected sites
were detected by the SLAC or PARRIS methods. A single
recombination event involving an isolate from Peru as a
minor parent was detected by RDP in all 63 haplotypes
from Ecuador analyzed in this study. The contrasting
molecular variability levels between isolates of ToLDeV
from Peru and Ecuador suggest a more recent foundation
of this latter subpopulation. Financial support: FAPEMIG,
INIAP, CAPES
PIV459 - Evolution of pe-38 gene in
Baculoviridae
Fernandes, J.E.A., Ardisson-Araújo, D.M., Melo, F.L.,
Ribeiro, B.M.
Universidade de BRasília, UnB, Campus Universitário
Darcy Ribeiro - Asa Norte - Brasília
Baculoviridae is a family of dsDNA viruses that infects
a few orders of insects. They are divided into four
genera,
Alphabaculovirus
(Lepidopteran-specific
nucleopolyhedrovirus), Betabaculovirus (Lepidopteran-
specific GV), Gammabaculovirus (Hymenopteran-specific
NPV) and Deltabaculovirus (Dipteran-specific NPV). It
was a found a gene in the genome of some baculovirus
(BC) that contains a RING-finger domain with ubiquitinligase (E3) activity, the pe-38 gene. It has been associated
to viral transcription and viral DNA replication. Despite
this importance, the evolutionary history of this gene in
the BCs family remains unclear. Therefore, the objective
of this work was to determine the evolutionary events
that shaped the current pe-38 gene distribution among
BCs. Initially, the BLAST program was used to search for
pe-38 orthologous in BC genomes available in GenBank.
We found that pe-38 orthologous were present only
in the group 1 Alphabaculovirus and in four related
Betabaculovirus. Interestingly, the genome of the
Choristoneura occidentallis granulovirus (ChocGV) lacks
the pe-38 gene, but presented the flanking upstream
region of its in other GV genomes. In this region, we find
a gene that has orthologous in NPV genome. This finding
may indicate a non-homologous recombination event
between the Choristoneura occidentallis granulovirus
(ChocGV) and an ancestral NPV took place and that the
pe-38 gene present in the NPV may have originated in
GVs. To confirm that hypothesis, the phylogeny of the pe38 gene was reconstructed by using the PhyML program.
It was found that the diversity between the GV proteins
was greater than the one found in NPV, indicating that
the proteins of GVs have been diverging for a longer
time. Additionally, we also found that pe-38 gene of BCs
showed a significant similarity with a plant gene called
makorin, an ubiquitin ligase. Therefore, it is reasonable
to assume that pe-38 gene of BCs was acquired from a
plant genome by an ancestral GV. Financial Support:
CNPq.
vv62 - ARBOVIRUSES IN WILD BIRDS IN THE STATE
OF SÃO PAULO
Sousa, E., Criado, M.F., Saturno, T.H., Prates, M.C.M.,
Kawanami, A.E., Oliveira, J.P., Teles, P.H.F., Werther, K.,
Arruda, E.
1. Universidade de São Paulo, USP, Av. Bandeirantes,
3900 - Vila Monte Alegre 14049-900, Ribeirão Preto-SP
2. Universidade Estadual Paulista, UNESP, Via
de Acesso Prof.Paulo Donato Castellane s/n 14884-900 Jaboticabal, SP
Zoonotic arboviruses of the families Togaviridae and
Flaviviridae, are maintained in nature in complex cycles
involving arthropod vectors that feed on animal blood.
Emergence and reemergence of such arboviruses are
natural phenomena related to their adaptation and
evolution. The present study aimed at searching for
genomic RNA of the arboviruses Mayaro (MAYV), of
the family Togaviridae; and Chikungunya (CHIKV) and
32
Oral Presentation
West Nile (WNV), of the family Flaviviridae, in wild birds
necropsied at the Department of Veterinary Pathology,
UNESP, Jaboticabal, SP, Brazil. Fifty two samples of brain,
liver, spleen and blood of 52 wild birds were analyzed.
Pea-size tissue fragments and blood clots were placed in
Trizol (Invitrogen) and stored at -70°C until processed.
RNA was extracted by the Trizol manufacturer’s protocol
and reverse transcription was carried out to obtain
cDNA, which was amplified by Real-Time RT-PCR (OneStep SYBR-Green). MAYV RNA was detected in 10% of
the birds tested: 1 crested caracara (Polyborus plancus,
brain and spleen); 1 roadside hawk (Buteo magnirostris,
spleen); 1 burrowing owl (Speotyto cunicularia, brain);
2 black vulture (Coragyps atratus, one of them in liver,
brain, blood and spleen; and another in liver, brain and
blood). CHIKV RNA was detected in 11% of the tested
birds: 1 crested caracara (Polyborus plancus, brain,
liver and blood); 1 roadside hawk (Buteo magnirostris,
liver, spleen and blood); 1 burrowing owl (Speotyto
cunicularia, brain, liver and blood); 2 black vultures
(Coragyps atratus, one of them in liver and spleen and
another in liver); and 1 dove (Columba livia, brain, liver
and spleen). WNV RNA was detected in 6% of the tested
birds: 1 crested caracara (Polyborus plancus, spleen and
blood); 1 black vulture (Coragyps atratus, blood and
spleen); and 1 toucan (Ramphastos toco, blood, liver and
spleen). These results show that important arboviruses
with high potential public health impact infect wild birds,
suggesting that they may play potentially important
epidemiological roles as reservoirs of such agents, thus
creating possibilities for their emergence as causes of
human infection in the studied region. Financial Support:
FAPESP and CNPq.
vv207 - MOLECULAR CHARACTERIZATION OF
CANINE CORONAVIRUS STRAINS CIRCULATING
IN PUPPIES WITH ENTERITIS BY PARTIAL “S” GENE
SEQUENCING
Bottino, F.O., Costa, E.M., Castro, T.X., Cubel Garcia,
R.C.N.
Universidade Federal Fluminense, UFF, Rua Prof.
Hernani Melo 101, São Domingos, Niterói, RJ, Brasil
Canine coronavirus (CCoV) is an important agent of
gastroenteritis in puppies. To date, CCoVs are classified
in two genotypes, CCoV-I and CCoV-II. Recently, CCoVII genotype was divided in two subtypes: CCoV-IIa
(classical strains) and IIb (TGEV-like strains). The aim of
this study was to realize the molecular characterization
of CCoV strains detected in 25 fecal samples from
diarrheic puppies in Rio de Janeiro. Genomic RNA was
extracted using the PureLink™ Spin Column-Based Kit
(Invitrogen®). The reverse transcription was performed
with random primer (Invitrogen®) and Superscript III
enzyme (Invitrogen®). Differential primers directed
to the spike (S) gene were used in PCR assays for CCoV
genotyping/subtyping: EL1F/EL1R (3538-3883) to
amplify CCoV-I whereas S5F/S6R(3486-4179) and
CEPol-1/TGSP-2 (20168-20537) for CCoV-IIa and CCoVIIb. The amplicons were purified and subjected to direct
sequencing using BigDye Terminator Cycle chemistry.
Nucleotide and amino acid (AA) similarity with Genbank
database was assessed using BLAST tool. By RT-PCR,
single infection was detected in 16 samples: 6 CCoV-I,
9 CCoV-IIa and 1 CCoV-IIb. Nine samples were positive
for more than one genotype/subtype: CCoV-I/IIa (7),
CCoV-I/IIb (1) and CCoV-IIa/IIb (1). Sequence analysis
of 22/25 strains revealed that they shared high identity
with other CCoV prototypes. However, nonsynonymous
substitutions were found in these strains that were not
described before: two AA changes (residues 1207,1264)
in CCoV-I, 13 in CCoV-IIa (residues 1174, 1218, 1244,
1264, 1265, 1282, 1305, 1334, 1336, 1339, 1359,
1363, 1370) and five in CCoV-IIb (residues 5,6,7,8,18).
The CCoV-IIb strains exhibited the insertion of three
nucleotides at the 5’end of the S gene which resulted
in addition of AA at residue five as also found in UCD1 strain. These results show that mixed CCoV infections
are usual in Rio de Janeiro and further studies are
needed to clarify the importance of these AA changes
in CCoV evolution. Financial support: FAPERJ, CAPES,
CNPq, PROPPI-UFF
vv224 - EXPERIMENTAL VACCINE TO BOHV-1
AND BOHV-5 FUNCTIONALIZED TO CARBON
NANOTUBES ENHANCES THE IMMUNE RESPONSE
IN MOUSE MODEL
Barbosa, A.A.S., Leocádio, V.A.T., Souza, J.G., LaguardiaNascimento, M., Daian, D.S.O., Da Fonseca, F.G., BarbosaStancioli, E.F.
Universidade Federal de Minas Gerais, UFMG,
Avenida Presidente Antônio Carlos, 6627, CEP 31.270-901,
Belo Horizonte - MG
Bovine herpesviruses 1 and 5 (BoHV-1 and 5) are closely
related alphaherpesviruses infecting cattle and coinfection is likely to occur. Both viruses are associated
with neurological, respiratory and reproductive disease,
causing great economic losses. Vaccination has been the
recommended in control programs, although to date
there is no vaccine capable of establishing a protective
immune response against both viruses. Recombinant
proteins have been widely used for production of helpful
molecules employed in prevention and treatment of
several diseases. Carbon Nanotubes (CNT) has been
broadly studied due to their exceptional properties
such as biocompatibility, high aspect ratio and cell
internalization ability, and CNT functionalized with
33
Oral Presentation
antigens have immunogenic potential, as shown in
previous studies. In this work, we have used the CNT
technology to build experimental immunogens against
BoHV-1 and 5. These molecules functionalized or not
to the CNT, were used in a prime-boost immunization
protocol in C57Bl-6 mice, comparing to recombinants
alone or added with alum and inactivated commercial
vaccine. Following that, mice TCD4+ and CD8+
lymphocytes activation was analyzed by flow citometry,
quantifying the marker CD25. The proteins recognition
profile by IgG and IgM from bovines naturally infected
with BoHV-1 and 5 was also accessed. Mice immunized
with the recombinant proteins functionalized to the
CNT plus the adjuvant alum, showed a higher profile of
activated CD4+ and CD8+ cells than the other groups.
The recombinant proteins were recognized by the IgG
and IgM antibodies from bovines naturally infected with
both viruses, showing that the CNT doesn’t interfere
with the recognition profile of the molecules. Since our
experimental immunogens were successfully recognized
by sera from infected bovines and showed a better
cellular response in mouse model, they could be tested
as vaccine prototype against BoHV-1 and 5 infections in
bovine model in a near future.
samples were collected at days 0, 2, 5, 8, 10, 20 and 30 p.i.
for PCR and serology tests. The fecal and blood samples
were pooled and analyzed per group. No clinical signs
or macroscopic lesions were observed. Sera from mice
of groups G2 and G3 showed neutralizing antibodies
titers at days 20 and 30 p.i. Furthermore, viral DNA was
detected in some samples at different times of collection.
Oral swabs positive samples were detected in G3 and G4,
in at least one mouse, from days 2 to 10 p.i. Moreover,
pooled feces and blood samples were DNA positive, in at
least one group, at days 6, 8 and 30 p.i. and at 2, 10 and
30 p.i., respectively. It has been shown that mice could be
infected after oral inoculation with VACV contaminated
milk, as shown by the DNAmia and fecal positive samples.
These partial results suggests that VACV contaminated
milk may be able a route of transmission through oral
ingestion. Financial support: FAPEMIG, CNPq, CAPES,
PROGRAD-UFMG and PRPq-UFMG
vv270
Vaccinia
virus:transmission
through experimentally infected milk in
a mouse model
Rehfeld, I.S., Fraiha, A.L.S., Matos, A.C.D., Souza, I.R.,
Costa, A.G., Furtado, A.M.B., Guedes, M.I.M.C., Lobato,
Z.I.P.
1. Universidade Federal do Paraná, UFPR, R. Pioneiro,
2153 – Jardim Dallas – Palotina/PR
2. Instituto Federal Catarinense, IFC, BR280, Km 27,
bairro Colégio Agrícola-Araquari-SC
3. Universidade Estadual de Londrina, UEL, Rodovia
Celso Garcia Cid, Pr 445 Km 380-Londrina-PR
Universidade Federal de Minas Gerais - Escola de
Veterinária, UFMG - EV, Av. Antônio Carlos, 6627, São Luis,
cep: 31270-901, Belo Horizonte, MG, Brasil
White spot syndrome is a viral infection responsible for
considerable economic damage to the global shrimpfarming industry. Initially, the infection manifests
epidemically, with high mortality rates. Later, the infection
remains endemic, interfering with the productivity of
the tanks. In Brazil’s southern region, the infection was
first identified in 2005 and had a significant impact on
the production of farmed marine shrimp. This study
was conducted to evaluate the presence of white spot
syndrome virus (WSSV) both in farmed marine shrimp
(Litopenaeus vannamei) and in natural reservoirs on the
northern Santa Catarina coast. In the period between
2005 and 2008, 440 samples of different L. vannamei
tissues were collected from 12 regularly monitored
shrimp farms. The samples were stratified by age, and
the collected samples were representative of post-larvae
arriving at the farm, of animals with 30, 60, and 90 days
of cultivation, and of animals at harvest. Additional
samples, independent of regular sampling, were
acquired from lots with high mortality rates. In addition,
210 samples of native animals that were present in the
reservoirs and harvest channels of the farms, including
mangrove and fiddler crabs (Aratus pisoni and Uca
Bovine vaccinia (BV) is a re-emerging zoonosis caused by
Vaccinia virus (VACV) and is involved in several outbreaks
in dairy cattle and humans throughout Brazil, which is
one of the most important milk producers in the world.
Previous studies have described the presence of viable
viral particles in milk samples of cows experimentally and
naturally infected with VACV. However, it is not known if
the VACV infectious particles presented in infected milk
could be transmissible. Therefore, the aim of this work
was to study the possibility of transmission of VACV by
experimentally infected milk. Fourty female BALB/c
mice with 4 weeks of age were divided in four groups:
G1, G2, G3 e G4. The G1 was the negative control group.
The mice of the other groups were inoculated orally with
100µL ̸ mouse of contaminated milk containing 107 PFU
̸ mL of VACV-GP2. Clinical examination was performed
during the 30 days post-infection (d.p.i). Feces and oral
swab samples were collected in alternate days, from day
0 to day 30 and then submitted to PCR. Blood and sera
vv327 - INFECTION OF FARMED MARINE SHRIMP
WITH WHITE SPOT SYNDROME VIRUS IN THE
STATE OF SANTA CATARINA, BRAZIL
Lenoch, R., Espíndola, J.C., Claus, M.P., Barreiros, M.A.B.,
Alfieri, A.F., Alfieri, A.A.
34
Oral Presentation
thayeri), Atlantic blue crabs (Callinectes sapidus),
zooplankton, fish, and native shrimp (Penaues schmitti),
were included. Identification of WSSV was performed
by PCR according to the methodology described by the
World Organisation for Animal Health (OIE). WSSV was
identified at 9 (75.0%) of the 12 farms evaluated. The
infection was asymptomatic at one farm (11.1%), and
eight farms (88.9%) had animals presenting with clinical
signs, with mortality rates ranging from 75 to 100%. Of
the 440 samples of L. vannamei collected, 93 (21.13%)
were positive for WSSV. The virus was also identified in
22 (10.47%) tissue samples from mangrove crab, fiddler
crab, Atlantic blue crab, zooplankton, and native shrimp,
suggesting their role as natural reservoirs. These results
demonstrate the wide distribution of WSSV in farmed
marine shrimp and in natural reservoirs in the region
and during the period studied.
vv494 - DIVERSITY OF G AND P GENOTYPES
DETECTED IN BRAZILIAN PIG HERDS DURING
2005-2013
Lorenzetti, E., Campanha, J.E.T., Medeiros, T.N.S., Silva,
D.R., Molinari, B.L.D., Rodrigues, W.B., Pereira, F.L.,
Balbo, L.C., Massi, R.P., Alfieri, A.A.
Universidade Estadual de Londrina, UEL, Rod. Celso
Garcia Cid, Pr445 Km380 CEP 86057-970, Londrina-PR
Group A rotavirus (RVA) infection cause neonatal
diarrhea in many animal species worldwide. The
genotypes G3, G4, G5, G11, P[6]-Gottfried, and P[7] are
commonly identified in piglets. However, several unusual
genotypes, such as G1, G2, G6, G8, G9, G10, G12, G26,
P[1], P[5], P[6]-M37-like, P[8], P[11], P[13], P[19], P[23],
P[26], P[27], P[32], and P[34] have also been identified
in pigs. This study was developed to identify the G and P
genotypes of 73 wild-type PoRVA strains of Brazilian pig
herds. All diarrheic stool samples from suckling piglets
collected during 2005 to 2013 were submitted to PAGE
technique and one RVA positive fecal sample in PAGE
from each pig herd was selected to realize the RT-PCR
assay using rotavirus VP7 (G type) and VP4 (P type)
consensus primers. The RT-PCR amplicons of the 73
PoRVA strains were sequenced and analyzed using the
BLASTn and RotaC v2.0 software. The sequence analysis
of 73 wild-type PoRVA strains revealed the presence of
the following G and P genotype combinations: G4P[6]M37-like (32.87%), G9P[23] (12.32%), G5P[13] (8.21%),
G5P[6]-M37-like (8.21%), G9P[7] (8.21%), G3P[6]M37-like (6.84%), G9P[6]-M37-like (4.1%), G5P[7]
(2.73%), G3P[13] (2.73%), G9P[23] (2.73%), G4P[7]
(1.36%), G11P[23] (1.36%), G1P[7] (1.36%), G3P[23]
(1.36%), G4P[13] (1.36%), G5P[X] (1.36%), G3P[X]
(1.36%) and GXP[6]-M37-like (1.36%). Common and
uncommon genotypes of RVA detected in piglets were
identified in the PoRVA strains analyzed in this study
showing the high diversity of genotypes circulating in
Brazilian pig herds during the period of 2005 to 2013.
The P[6]-Gottfried is one of the most common genotype
detected in pigs, while in this study was only detected
the genotype P[6]-M37-like, commonly detected in
human hosts, in combination with G3, G4, G5, and
G9 genotypes. The commercial vaccine for neonatal
diarrhea control in piglets is composed by OSU (G5P[7])
and Gottfried (G4P[6]) PoRVA strains, while in this study
were detected genotypes different from vaccine. These
findings strongly suggest the evidence that evolution
of human rotaviruses is tightly intermingled with the
evolution of animal rotaviruses. Financial Support:
FINEP, CAPES, CNPq, and Fundação Araucária/PR.
VV496 - MOLECULAR DETECTION OF INFLUENZA
A VIRUS IN DOGS
Balbo, L.C., Silva, A.P., Bodnar, L., Beutemmüller, E.A.,
Facimoto, C.T., Miyabe, F.M., Massi, R.P., Headley, S.A.,
Alfieri, A.A.
Celso Garcia Cid, PR 445 Km 380, Campus Universitário
Londrina
2. Universidade do Norte do Paraná, UNOPAR, Av.
Paris, 675 - Jd. Piza.CEP 86041-140 - Cx. P. 401 Londrina Paraná
Influenza A viruses belong to the Orthomyxoviridae
family and usually cause respiratory illness in various
species, such as humans, domestic poultry, pigs, and
horses. The subtype H3N8 is known to cause respiratory
disease in equines. However, an influenza A subtype
H3N8 has been reported as an emerging respiratory
pathogen of dogs in the United States in 2004. This novel
virus, called canine influenza A virus (CIV), share ≥96%
nucleotide sequence identity to equine influenza A virus
subtype H3N8, suggesting transmission between horses
and dogs without reassortment with other strains. This
report investigated the death of three mongrel dogs
with nonspecific clinical signs. One dog was seven years
old and was icteric. The other two dogs were about 5
months old and were taken from the street presenting
hemorrhagic diarrhea. Pathological lesions of the
first dog included hepatitis, pulmonary hemorrhage,
and meningoencephalitis. Significant pathological
alterations of the other two dogs included depletion of
intestinal lymphoid tissue and hemorrhagic enteritis.
Fragments of the lungs and kidneys were collected and
tested by RT-PCR using the primers M52C and M253R.
PCR assays amplified the partial segment 7 of Influenza
A virus (244 bp) from all pulmonary tissues evaluated.
These data suggest the circulation of CIV in the canine
population of Brazil. Since the history of the three dogs is
35
Oral Presentation
unknown, the source of infection either by contact with
other infected dogs or horses remains obscure.
VV634 - CHICKEN ANEMIA VIRUS AND AVIAN
GYROVIRUS 2 DNA AS CONTAMINANTS IN
POULTRY VACCINES
Varela, A.P.M., Santos, H.F., Cibulski, S.P., Scheffer, C.M.,
Schmidt, C., Lima, F.E.S., Esteves, P.A., Franco, A.C.,
Roehe, P.M.
1. Universidade Federal do Rio Grande do Sul, UFRGS,
Av. Sarmento Leite 500, sala 208, Porto Alegre, CEP 90050170
2. FEPAGRO – Saúde Animal , IPVDF, Estrada do
Conde 6000, Eldorado do Sul, CEP 92990-000, Rio Grande
do Sul
3. EMBRAPA Suínos e Aves , EMBRAPA, BR 153 Km
110, CEP: 89700-000, Concordia, Santa Catarina
In view of the potential role of vaccines as a source of
pathogen dissemination, this study was set up in order
to detect AGV2 and CAV genomes in vaccines for poultry.
Thirty five largely employed, commercially available
vaccines produced by eight different manufacturers
against various avian pathogens, and farming were
evaluated. Total DNA was extracted from 500 µL of each
of the vaccines with PureLinkTM Genomic DNA Mini
Kit (Life Technologies). Approximately fifty nanograms
of DNA were used in the assays. A quantitative duplex
TaqMan® real-time PCR (Wendlant et al.; this event) was
performed using AGV2- and CAV-specific primers and
probes. Amplification and detection were performed in
a StepOneTM Real-Time PCR system (Life Technologies).
Copies of AGV2 genomes were detected in 9 of the
vaccines evaluated, in amounts which varied from 93
to 156,187 copies/50ng. Regarding CAV, viral genomes
were detected in 10 of the vaccines tested, of which
three were in fact CAV vaccines and six vaccines to other
pathogens. The three CAV vaccines showed distinct
numbers of copies of CAV genome, corresponding to
2,175,381; 54,238 and 2,386 genome copies/50ng.
The remaining non-CAV vaccines contained between 7
and 173 copies of CAV genome molecules/50ng. Four
of the examined vaccines contained DNA of both CAV
and AGV2. These results revealed that both CAV and
AGV2 genomes may be detected in poultry vaccines.
In addition, although CAV contamination of biological
has been reported previously, this is the first report of
AGV2 DNA as contaminant of vaccines. These findings
highlight the need for preventive measures to avoid
contamination of vaccines with such viruses. Financial
support: CAPES, CNPq, FINEP
BASIC VIROLOGY -BV
37
Basic Virology: BV
BV22 - Antiviral Activity Against Influenza,
Herpes And Rubella Virus Observed In The
Hemolymph Of Podalia Sp (Lepidoptera:
Megalopygidae)
Carvalho, N.D., Figueiredo, C.A., Oliveira, M.I., Silva, P.E.,
Curti, S.P., Mendonça, R.M.Z., Moraes, R.H.P., Mendonça,
R.Z.
IOC - FIOCRUZ, Av.Brasil, 4365, Manguinhos, Rio de Janeiro
- RJ, Brasil - CEP: 21040-360
2. Faculdade de Medicina de Ribeirão Preto, FMRPUSP, Av. Bandeirantes, 3900 - Monte Alegre - Ribeirão Preto
- SP - 14049-900
Preto, FCFRP USP-RP, Av. do Café, s/nº. - Campus
Universitário - Ribeirão Preto - SP - 14040-903
Hantavirus (Family Bunyaviridae) are mostly associated
to rodents and transmitted to man by inhalation of
aerosolized infected excreta of these animals. The human
infection by Hantavirus can lead to severe diseases such
as hemorrhagic fever with renal syndrome (HFRS) in
Asia and Europe, and pulmonary syndrome (HPS) in
the Americas. To determine the origin, spreading and
evolutionary dynamics of rodent-borne hantavirus,
were collected 190 N gene sequences of rodent-borne
hantavirus identified from 30 countries over the past
25 years (1985 to 2010). Recombinant sequences and
identify identical sequences were not included in the
study. Nucleotide sequences were aligned and the spatiotemporal and demographic dynamics of dissemination
of rodent-borne hantavirus was reconstructed using the
Bayesian Markov Chain Monte Carlo (MCMC) approach
using the BEAST 1.7.4 program. It was estimated that
the N gene of hantavirus carried by rodents evolved at
a rate of 6.8 x 10-4 (2.5 x 10-4 - 1 x 10-3) nucleotide
substitutions per site per year and that rodent-borne
hantaviruses originated around 2,000 years ago.
However, the rodent-borne hantavirus had a large
period of slow growth and about 500 years ago started a
rapid spread worldwide that coincides with the human
traveling between continent. Hantaviruses associated
to Murinae and Arvicolinae subfamilies, probably, were
originated in Asia 500-700 years ago spreading toward
Siberia, Europe, Africa and North America. Hantaviruses
associated to Neotominae subfamily, probably, emerged
500-600 years ago in Central America and spread
toward North America. Finally, hantaviruses associated
to Sigmodontinae occurred in Brazil 400 years ago and
were, probably, originated from Neotominae-associated
virus from northern South America. These data offer
subsidies to understand the time-scale and worldwide
dissemination dynamics of rodent-borne hantaviruses.
BV44 - Alteration On Protein Expression Of
Superoxide Dismutase 1 On Liver Of Balb/C
Mice After Infection By Caraparu Virus
(Bunyaviridae)
Camini, F.C., Ferreira, P.N., Almeida, L.T., Bernardes,
C.S., Silva, M., Pedrosa, M.L., Pinto, C.A., Ferreira, P.C.P.,
Magalhães, J.C., Magalhães, C.L.B.
Morro do Cruzeiro, Ouro Preto, MG
Campus Pampulha, Belo Horizonte, MG
3. Universidade Federal de São João Del Rey, UFSJ,
Campus Alto Paraopeba, Ouro Branco, MG
4. Rede de Pesquisa em Virologia do Interior de Minas
Gerais, INTRAVÍRUS, Minas Gerais
Oxidative stress occurs when there is an imbalance
between oxidants and antioxidants leading to potential
cellular damage. Most cells can tolerate a mild degree
of oxidative stress, because they have sufficient
antioxidant enzymes, like superoxide dismutase (SOD).
The SOD detoxifies the superoxide anion (O2-), the main
“Reactive Oxygen Species” (ROS), which is metabolized
to hydrogen peroxide (H2O2). The down regulation of
SOD has been recognized to be an important contributor
to many viral pathogenesis, leading to intense oxidative
stress. Caraparu virus (CARV) is a member of group C,
family Bunyaviridae. In countries of South America,
group C bunyaviruses are among the common agents
of human febrile illness, and have caused multiple
notable outbreaks of human disease in recent decades;
nevertheless, little is known about the pathogenic
characteristics of these viruses. The purpose of this
study was to investigate the effect of CARV in protein
expression of SOD1 (the most abundant cytoplasmatic
isoform) on liver of infected mice. Balb/c mice were
infected subcutaneous with 5log10 PFU of CARV and
control animals were inoculated with MEM. Animals
were euthanized 3, 7 and 14 dpi and liver samples were
collected. CARV was detected in liver of infected mice
and histopathology revealed acute hepatitis. Western
Blot analysis showed that, on CARV-infected mice there
was a significant reduction in protein expression levels
of SOD1 at days 3 and 7 (~ 20 and 15%, respectively),
compared with control animals. However, protein levels
of SOD1 in CARV-infected mice on day 14 showed an
increased (~14%) compared to controls mice. Our data
indicates that following to CARV, liver mice display a
lowered abundance of the antioxidant SOD1 and the up
regulation appears to be due to later event on disease
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Basic Virology: BV
38
Basic Virology: BV
progression. This study can contribute to further
evaluate the role of oxidative stress and antioxidants
defenses on hepatic pathogenesis of CARV, as well as
other Bunyaviridade members. FINANCIAL SUPPORT:
FAPEMIG, UFOP, CNPq
BV45 - Caraparu Virus (Bunyaviridae)
Infection Increase Gene Expression Of
Inducible Nitric Oxide Synthase And
Tumor Necrosis Factor-Alpha On Liver Of
Balb/C Mice
Almeida, L.T., Ferreira, P.N., Camini, F.C., Bernardes,
C.S., Silva, M., Pedrosa, M.L., Pinto, C.A., Ferreira, P.C.P.,
Magalhães, J.C., Magalhães, C.L.B.
Morro do Cruzeiro, Ouro Preto, MG
Campus Pampulha, Belo Horizonte, MG
3. Universidade Federal de São João Del Rey, UFSJ,
Campus Alto Paraopeba, Ouro Branco, MG
Gerais, INTRAVÍRUS, Minas Gerais
Caraparu virus (CARV) is an arthropod borne virus of
the family Bunyaviridae, initially isolated in Pará State,
Brazil. In humans, CARV causes a disease characterized
by dengue-like symptoms. Although there is no literature
report demonstrating that CARV cause hepatic disease
in humans, in experimentally infected mice CARVinfection induces hepatitis; however the pathogenesis of
CARV associated with liver injury remains incompletely
defined. The nitric oxide (NO) has been shown to be
a key factor in several diseases viral. Its formation
is catalyzed by NO synthase (NOS), which exists in 3
isoforms - constitutively expressed neural NOS (nNOS),
endothelial NOS (eNOS), and inducible NOS (iNOS).
While the isoforms eNOS and nNOS contributes to the
maintenance of normal physiology of cell, iNOS acts as a
key molecule in combating viral infections. Additionally,
the expression of iNOS is transcriptionally regulated
by a number of proinflammatory cytokines, including
TNF-α. Several studies using animal models have been
used to study the role of NO in the pathogenesis of
inflammatory liver injury. Then, using a quantitative
RT-PCR technique, we investigated whether the mRNA
expression of iNOS and TNF-α could be altered on
hepatic pathogenesis triggered by CARV. Balb/c mice
were infected subcutaneous with 5log10 PFU of CARV
and control animals were inoculated with MEM. Animals
were euthanized 3, 7 and 14 dpi and liver samples
were collected. CARV was detected on liver of infected
mice and histopathology revealed acute hepatitis. The
mRNA expression of iNOS and TNF-α were significantly
increased on liver of CARV-infected mice at 3 and 7 days
pi, with levels returning to those in control mice by day
14. Thus, elucidating the inflammatory mechanisms
against the infection by CARV and expand features
related to its pathogenesis are important because this
disease is a problem of public health and potential
emergent. FINANCIAL SUPPORT: FAPEMIG, UFOP, CNPq
BV47 - Production Of Recombinant Dengue
Virus Nonstructural Protein Ns1 In Pichia
Pastoris.
Divino, F.C.P., De Paula, S.O., Cardoso, S.A., Oliveira,
M.D., Monteiro, J.M.C., Honda, E.R., Oliveira, L.L.
1. Universidade Federal de Viçosa, UFV, Av. P H Rolfs,
s/n - Campus Universitário, Viçosa - MG, 36570-000
2. Centro de Pesquisas em Medicina Tropical, CEPEM,
Porto Velho/ RO, Brazil
Dengue is a viral disease transmitted to humans mainly
by the Aedes aegypti mosquito. The disease is caused by
any of four closely related members of the Flaviviridae
family (DENV-1, DENV-2, DENV-3 and DENV-4). The NS1
glycoprotein of 46-50 kDa is found on the cell surface
and secreted extracellularly. It has been co-localized
with markers of RNA replication in association with
membrane structures that are likely sites of replication.
Mutations at glycosylation sites of the NS1 dramatically
affect viral replication in early stages demonstrating a
decrease in RNA synthesis. Our group has been working
on expression of differents viral proteins in eukaryotic
systems, in this study the gene of dengue-1 NS1 was
optimized to increase the levels of proteins expression
in Pichia pastoris yeast. The synthetic genes were cloned
into the expression pPICZαA vector and the recombinant
plasmid obtained was used to transform Pichia pastoris
KM71 strain. The integration of the vector into genome
yeast was confirmed by PCR, using specific primer. After
induction with methanol, the expression of recombinant
NS1 was analyzed by SDS-PAGE, a band corresponding to
recombinant protein was observed in the supernatant.
Thus, our results show that the strategy adopted
provides a good alternative for the production of dengue
antigens, with potential for use in a recombinant dengue
vaccine, and diagnostics. Financial support: CAPES,
CNPq, FAPEMIG
BV50 - Hrsv-Ns1 Inhibitor Discovery
Through
Fluorescence
Spectroscopy
Titration With Flavonoids
Gomes, D.E., Cornélio, M.L., Fossey, M.A., Souza, F.P.
Universidade Estadual Paulista (IBILCE - S.J. Rio
Preto), UNESP, Rua Cristóvão Colombo, 2265. Jardim
Nazareth - São José do Rio Preto
39
Basic Virology: BV
Human Respiratory Syncytial Virus (hRSV) is the
principle cause of acute respiratory infections in
children, like bronchiolitis and pneumonia. The hRSV
a paramyxovirus class has a single strand RNA with 10
genes which codifies 11 proteins. An important factor
that contributes to hRSV replication is the immune
system evasion provided by Non-Structural Protein 1
(NS1) with 139 amino acids and 15kDa. Such protein
plays an important role inhibiting or neutralizing
several steps of IFN pathway, as well as, silencing the
ribonucleoproteic complex of hRSV. The aim of this study
was to develop the fluorescence spectroscopy titration
between NS1 and flavonoids to propose a inhibitor for
this protein. The expression of NS1 was performed
through pJexpress401-NS1 transformed into BL21(DE3) bacteria at 0,5mM of IPTG and its purification
was achieved by affinity chromatography (nickel
resin), with imidazole gradient from 40 to 500mM. A
set of fluorescence measurements were performed to
describe the interaction between flavonoids and NS1,
and before that UV-VIS absorption spectra determined
the concentration of NS1 and flavonoids. According to
the result a fluorescence quenching process occurred
which is an indication of interaction. Calculations of
binding constant (Kb) and number of sites (n) were
determined. The Kb constant in general was about 105M-1 indicating a strong interaction, and n found to be
one. The results were able to discriminate the driven
force of interaction having the following sequence
from the stronger to the weaker: Miricetin> Quercetin>
Kaempferol-3βD-glucoyranoside> Kaempferol. The
results showed that NS1 has one binding site for each
one of the flavonoids tested here. In conclusions the data
reveals the interaction between flavonoids and NS1,
and thus, may be considered as a potential inhibitor for
NS1, which futures tests on blocking its function on the
immune system subversion is ongoing
BV68 - Development Of A Biosensor For
Dengue Virus Using Gold Nanorods
Technology
Versiani, A.F., Caires, A.J., Ladeira, L.O., Da Fonseca, F.G.
1. Universidade Federal de Minas Gerais, UFMG, Av.
Antônio Carlos, 6627 - Pampulha 31270-901 - Belo Horizonte,
MG, Brazil
2. Laboratório de Virologia Básica e Aplicada, ICB,
LVBA
3. Laboratório de Nanomateriais, ICEx
Dengue is the most important arboviral disease in
the world, and in the last twenty years significant
increases in the epidemic activity, expansion of the
geographical distribution, continuous transmission
of several serotypes and emergency of the Dengue
Haemorrhagic Fever (DHF) in areas where the disease
was not previously prevalent were observed. In terms
of epidemiological impact, Dengue (DENV) infections
represent the most important infectious disease in
Brazil. Consequently, the development of a rapid and
efficient diagnostic test is considered a high priority.
Nanotechnology is a field of interdisciplinary research
involving chemistry, engineering, biology and medicine
- with great potential for use in methods of detection,
diagnosis and treatment. The Gold Nanorods (AuNR)
are of particular interest, especially considering their
optical properties and chemistry of the surface, which
allows easy connection to organic molecules adapted
to specific needs. The aim of this work is to develop
a biosensor for rapid diagnosis for DENV through
serological analysis by UV-visible spectroscopy. In order
to build this tool, AuNR were previously functionalized
with intermediary reagents to allow interaction with the
envelope protein of DENV serotype 3. This interaction
was confirmed by UV-visible spectroscopy, transmission
electron microscopy and atomic force microscopy. After
checking the functionalization, monoclonal antibodies
were associated to the tool and interaction demonstrated
by UV-visible spectroscopy. The functionalized AuNR
were then tested by ELISA, confirming their reactivity to
DENV monoclonal antibodies and sera from immunized
animals. This biosensor proved to be a rapid alternative
for screening positive patients, showing high sensitivity
and specificity. Further tests are necessary to adapt
the scale experiments for possible commercialization.
Financial support: CAPES, CNPq
BV72 - Antiviral Activity Of Siparuna
Guianensis Leaves Crude Extracts Against
Bovine Herpesvirus.
Simoni, I.C., Fernandes, M.J.B., Ferreira, T.P.S., Guimarães,
L.G.L.
1. Instituto Biológico, Centro de Pesquisa e
Desenvolvimento de Sanidade Animal, São Paulo, SP, Brasil
2. Universidade Federal de São João Del Rei, Depto de
Ciências Naturais, MG
3. Universidade Federal do Tocantins
Siparuna guianensis Aublet (Siparunaceae) also called
negramina is a medicinal plant used in folk medicine by
South-American Indians as a natural remedy for fevers.
The negramina has also presented anti-inflammatory,
insecticide and vermicide properties. Constituents
found in this genus were alkaloids, steroids, essential
oils and a mixture of diglycosyl and monoglycosyl
flavonoids derivatives of quercetin and kaempferol.
No information about its antiviral property was found
encouraging us to study the in vitro activity against
bovine herpesvirus. The fresh leaves from wild plants of
40
Basic Virology: BV
Siparuna guianensis were collected in Gurupi, Tocantins.
The metanolic extracts (CME) from dried leaves were
obtained by extraction with methanol for 7 days at room
temperature. After filtration of the solvent, the organic
phase was collected and concentrated under in vacuum
to dryness using rotary evaporator. The vegetal material
was lyophilized and stored at 4 C for subsequent
analysis. The antiviral activity bioassays were evaluated
by two methods. First, serially dilutions of CME were
added to MDBK cell line and then the cells were infected
with 100 TCDI of bovine herpesvirus strain Colorado;
or the CME in non-toxic concentration was added to cell
and after it was inoculated with logarithmical dilutions
of virus. Controls without CME and/or virus were made
and acyclovir was also used. In all bioassays, after
incubation at 37 C for 72 hours cells were fixed and
stained with 0.4% cristal violet solution for 30 minutes.
The activities were calculated as the difference between
the treated and control virus titer and expressed by viral
inhibition index (VII) or based on 595 nm absorbance
of cristal Violet staining. CME presented total inhibition
of virus infection with VII 7.5 in maximum non-toxic
concentration at 250 ug/mL and mantained antiviral
activity until 20 ug/mL.
BV77 - Experimental Murine Model For The
Pathogenesis Study Of Dengue Viruses
Barreto-Vieira, D.F., Jácome, F.C., Rasinhas, A.C., Silva,
M.A.M., Barth, O.M.
Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365,
Manguinhos, Rio de Janeiro, Brasil
A great difficulty to study dengue virus (DENV) infection in
humans and for a virus vaccine developing is the absence
of a suitable animal model which presents a disease with
similar aspects of the Dengue haemorrhagic fever and
Dengue shock syndrome. In the majority of models the
animals are immunocompromised and/or inoculated
by routes like the intracerebral, with neuroadapted
DENV. Tissues of adult BALB/c mice infected with nonneuroadapted DENV-1 and DENV-2 serotypes from
patient sera were analyzed. The tissue fragments were
processed following the standard techniques of fotonic
and transmission electron microscopy. In primary
infection with DENV-1 and DENV-2 morphogical
alterations were observed inside hepatic, lung, kidney
and cerebellum tissues. DENV-1 particles and specific
DENV antigen was observed in C6/36 cells inoculated
with the supernatant of spleen and lung macerates and
with the animal sera. Ultrastructural studies of alveolar
macrophages of animals infected with DENV-2 showed
DENV-like particles inside the rough endoplasmic
reticulum and Golgi complex, suggesting viral replication.
DENV particles were ultrastructurally identified, and
immunolocalized inside C6/36 cells, inoculated with the
supernatant (liver, lung kidney and cerebellum) of tissue
macerates. The corporal temperature in the majority
of mice increased after the second day post-infection.
Elevated enzyme levels of alanine aminotransferase and
aspartate aminotrasferase were observed. In secondary
infections morphological alterations were observed
in liver, lung and heart. The tissue injuries were more
severe than those seen in animals with signs of primary
infection. DENV-1 particles, specific DENV-1 antigen and
DENV-1 RNA were present in C6/36 cells inoculated with
the animal sera. These studies confirm the susceptibility
of BALB/c mice to infection and reinfection by DENV-1
and DENV-2 and those they can be used as a model for
testing of drugs and vaccine candidates against DENV.
Financial support: Faperj/ CNPq/IOC/Fiocruz
BV81 - Antiviral Effect Of Lambda-2t On
Vaccinia Virus Replication
Fernandes, M.C., Duarte, M.E.R., Noseda, M.D., Damaso,
C.
1. Universidade Federal do Rio de Janeiro, UFRJ, Av.
Pedro Calmon, 550 - Cidade Universitária, Rio de Janeiro - RJ,
21941-901
2. Universidade Federal do Paraná, UFPR, R. Quinze
de Novembro, 1299 - Centro, Curitiba - PR, 80060-000
Vaccinia virus (VACV) is the prototypic member of the
genus Orthopoxvirus of the Poxviridae family. Different
VACV strains are used as smallpox vaccine in several
countries but adverse effects following vaccination are
frequently described. One of these strains is VACV-IOC
(Instituto Oswaldo Cruz), which was successfully used in
the Brazilian vaccination campaign. Nevertheless, there
is no antiviral therapy available to treat infections caused
by these viruses. In addition, there are frequent reports
of Cantagalo virus (CTGV) infection in dairy cattle and
milkers in Brazil, which is also a strain of vaccinia virus.
CTGV was originally isolated from pustular lesions in
cows in 1999 and is related to VACV-IOC. In search for
efficient antiviral drugs, we present the results of the
antiviral effect of Lambda-2T (LT) on the replication of
different strains of VACV. LT is a sulfated galactan from
the carrageenan family, extracted from red seaweed
Gigartina skotsbergii. VACV-IOC (300 PFU) was incubated
with different concentrations of LT during adsorption on
BSC-40 cells for 2 hours at 4oC. We observed that LT, at
low concentrations (5µg/mL), was able to reduce viral
plaque formation in 80% after 48 hours of infection.
When administrated 3 hours after adsorption, inhibition
caused by 5µg/mL LT was even greater, nearly 90%.
LT was also efficient in reducing viral titters in 80% at
10µg/mL, but no effect was observed on the formation
of comet tails, suggesting that the drug has no effect on
41
Basic Virology: BV
the production of extracellular virus. However, similar
experiments with CTGV demonstrated that this strain is
less sensitive to the effect 10µg/mL when added 3 hours
post-infection. Plaque formation was inhibited by 30%
at 48 hours PI. The mechanism by which LT affects the
replication of these viruses, when added 3 hours PI, is
still unknown and reflects differences in virus gene
expression or release. Future experiments will address
this issue in detail. Financial support: CNPq, Capes,
Faperj, INPeTAm, PIBIC-UFRJ.
BV83 - Caffeine Inhibts Hcv Replication In
Vitro
Batista, M.N., Carneiro, B.M., Braga, A.C.S., Rahal, P.
Universidade Estadual Paulista Julio de Mesquita
Filho, IBILCE/UNESP, Rua Cristóvão Colombo, 2265 Bairro:
Jardim Nazareth 15054-000 - SJRP
Hepatitis C is a liver infection caused by hepatitis C virus
(HCV), which infects hepatocytes. Usually the infection
does not generate an adequate host immune response
causing, in most cases, a chronic condition. Hepatitis
C has been considered the major worldwide cause of
cirrhosis and hepatocellular carcinoma. PEG-INF in
association with ribavirin is the standard treatment.
However, it shows a low sustained virological response
for some genotypes along with severe side-effects and
high costs, therefore new treatments are being sought.
Caffeine shows promising effects against HCV chronic
infection, since it improves liver cellular pathways,
including detoxification pathways. Furthermore, caffeine
consumption delay fibrosis evolution in HCV infected
patients, and induces death of liver cancer cells. Moreover,
caffeine can interferes on cell pathways used to HCV life
cycle. The aim of this work was to test inhibitory effect
of caffeine on the cell-culture-derived HCV particles
(HCVcc) replication in vitro. Hepatocellular carcinoma
cell lineage (Huh-7.5) were cultured and transfected/
infected with subgenomic replicon (SGR-JFH1-FEO) or
complete genome of HCV genotype 2a (J6/JFH1 RLUC).
Initially the cells expressing the SGR-JFH1-FEO were
transferred to 96 wells plates and after 24 hours different
caffeine concentrations were added: 10mM to 1uM on
10-fold dilution series. Cells were incubated for 24h,
48h and 72h followed by MTT cytotoxicity assay. Viral
RNA expression was evaluated by Luciferase reporter
assay. Protein expression was evaluated by Western
blotting using NS3 antibody. We observed in samples
treated with caffeine a dose-dependent inhibition effect
on subgenomic and full-length replication systems.
Caffeine inhibited SGR-JFH1-FEO 82%(sd:10%) and
HCVcc 76%(sd:12%) on its higher viable concentration.
In conclusion, caffeine inhibits HCV replication in vitro
and it has a potential as a new antiviral therapy against
HCV alone or in association with conventional drug
treatment. Financial support: FAPESP/ CAPES
BV84 - Effect Of Inactivated Parapoxovis
Virus In Cytokine Expression In Mice
Anziliero, D., Spilki, F.R., Flores, E.F., Weiblen, R.
1. Universidade Federal de Santa Maria, UFSM,
Avenida Roraima, 1000, Predio 20, sala 4200
2. Universidade Feevale
Inactivated Parapoxvirus ovis (iPPVO) is an
immunomodulator with activity on the innate immune
response. Thus study investigated the profile of cytokine
mRNA and protein synthesis in response to in vivo iPPVO
inoculation. Mice were inoculated intraperitoneally with
iPPVO (n=4) or with MEM (control, n=4). At intervals after
inoculation (24, 48, 72, 96hpi), spleen and serum samples
were collected for determination of cytokine mRNA
expression by qPCR, protein concentration by ELISA
and by a bioassay (INF-α/β). Type I interferon antiviral
activity could be determined by inhibition of cytopathic
effect and plaque reduction assay at 6 and 12hpi, with
a significant antiviral activity above 90% of reduction
in viral plaque formation by EMCV. iPPVO treatment
induced a significant increased in mRNA expression
from all cytokines assayed. The proinflammatory
cytokines IL-1β, TNF-α and IL-8 could be detected by a
peak in fold increase over the control group of 5.4-fold
(24hpi), 3-fold (48hpi) and 10-fold (48hpi), respectively.
Our data support previous studies describing Th1 type
response as predominant, represented in this study by
a 15-fold increase in INF-γ and 6-fold IL-12 mRNA over
the control group. Auto regulatory cytokines (Th2),
mainly IL-10 and IL-4 could be detected at end points
studied (72 and 96hpi) at peaks of 4.7-fold and 4.9-fold
increase, respectively. Furthermore, significant high
levels of cytokines, except for IL-8 and IL4 (not assayed)
could be detected in serum samples at protein level (pg/
ml) by ELISA. The profile of protein detection by ELISA
was similar of that obtained by qPCR for the respective
mRNAs, especially for those of highest response as IL-12
(1035pg/ml) and INF-γ (460pg/ml). We conclude that
iPPVO induces a complex cytokine response, strongly
represented by Th1 cytokines that are followed by auto
regulatory Th2 cytokines. These effects may contribute
for the increased resistance to certain pathogens
observed in animal treated with iPPVO. CAPES/FAPERGS.
BV87 - Activity Of Toxins Of Crotalus
Durissus Terrificus On Hcv Replication
Shimizu, J.F., Russo, R.R., Cintra, A.C.O., Sampaio, S.V.,
Aquino, V.H., Rahal, P., Jardim, A.C.G.
1. Instituto de Biociências, Letras e Ciências Exatas,
42
Basic Virology: BV
IBILCE/UNESP, Rua Cristóvão Colombo, 2265, Jardim
Nazareth, 15054-000, São José do Rio Preto
Preto, FCFRP/USP, Av. do Café, s/nº. - Campus Universitário
- Ribeirão Preto - SP - 14040-903
Hepatitis C affects thousands of people worldwide. There
is no vaccine for hepatitis C virus (HCV) and the current
therapy is not effective for all treated patients, present
high costs and severe side effects. Many compounds
extracted from animal toxins have demonstrated
therapeutic potential, some with antiviral activity. In
Brazil there is a diversity of venomous serpents, which
the potential of its venom’s complexes is unclear. In this
context, compounds extracted from snake venom can
provide an alternative to the development of new antiviral
therapies. In this work, we evaluated the effect of the
complex crotoxin and its subunits crotapotin and PLA2CB extracted from the venom of C. durissus terrificus
on HCV replication. Huh 7.5 cell line stably expressing
subgenomic replicon (SGRluc-FEO) were treated for 48
hours with different concentrations of compounds and
replication levels were accessed by Luciferase assays.
Cellular cytotoxicity was mesuared by MTT assay and
the percentage of cell viability was determined. Those
analyses showed that crotoxin and crotapotin at nontoxic concentrations showed a weak inhibitory effect
on HCV replication. Alternatively, treatment of cells
with PLA2-CB has shown to be the most effective in
inhibiting HCV replication. At concentration with 80%
cell viability the replication levels were reduced to 7.2%
of PBS control. Therefore, our data demonstrates that
the venom of C. durissus terrificus can be promising
to inhibit viral replication. However, more studies are
needed to understand how these compounds act in the
machinery of HCV.
BV94 - Cloning And Expression Of M2-1
Protein From Human Respiratory Syncytial
Virus (Hrsv) And Structural Prediction By
Molecular Modeling.
Teixeira, T.S.P., Gomes, D.E., Souza, F.P.
Instituto de Biociências, Letras e Ciências Exatas,
IBILCE/UNESP, Rua Cristóvão Colombo 2265, Jardim
Nazareth, S. J. do Rio Preto - SP, 15054-000
The hRSV is one of the main agents of lower respiratory
tract infection in children under 2 years old and is
responsible for thousands of deaths per year worldwide.
The protein M2-1 is a key protein for properly
transcription and viral particle assembly. Several studies
relate their structure to its function, but there is no
description of the interaction between M2-1 protein
and inhibitors. The main drugs available on the market
are more effective when used before the infection. Thus,
inhibitors of M2-1 protein would allow the treatment of
infections already in course. Flavonoids are polyphenols
widely distributed in the plant kingdom that has been
shown to inhibit virus replication in different tests in
vitro. The objective of this work is to clone, express and
obtain a model of M2-1 protein to study its interaction
with flavonoids. The M2-1 gene was amplified by
PCR, cloned in pET-28a(+) vector and transformed in
Escherichia coli BL21 C43 (DE3) strain. The induction
was performed according to Esperante, et al. 2011, and
the protein was purified with affinity chromatography
resin. The initial structure of the protein was generated
by I-Tasser server and refined with GROMACS program.
SiteMap program was used to predict binding sites
and the molecular docking was performed with
GLIDE program through GLIDE XP method. The gene
amplification gave a band of ~603pb and we purified
8,69uM of protein/liter, with a 260:280nm ratio of 0,78.
The region between residues Pro32-Ser170 presents
high potential for small ligands interaction. The docking
in this region showed that flavonoids accommodate
their rings (or glycosylation) between the domains of
oligomerization and RNA interaction. The main forces of
interaction of glycosylated flavonoids with the protein are
hydrogen bond and electrostatic interactions, and nonglycosylated flavonoids interacts mainly by hydrogen
bond and hydrophobic interaction. Further steps include
the study of the protein interaction with flavonoids and
crosslink the theoretical and experimental data to come
with possible inhibitors of M2-1 protein.
BV95 - The Evaluation Of Trichilia Catigua
Extracts In The Replication Of Herpes
Simplex Virus
Espada, S.F., Faccin-Galhardi, L.C., Lopes, N., Godoi,
A.M., Mello, J.C.P., Linhares, R.E.C., Nozawa, C.
Celso Garcia Cid Pr 445 Km 380
2. Universidade Estadual de Maringá, UEM, Av.
Colombo, 5.790
Catuaba plant (Trichilia catigua) possesses substances
with known antioxidant and antimicrobial activities.
Empirically, it has been shown to present medicinal
benefits such as, digestive, for physical and mental
fatigue, insomnia, anxiolytic and anti-inflammatory. The
aim of this study was to evaluate the antiviral activity of
the crude extract and fractions obtained from T. catigua
in the replication of the herpes simplex virus type 1
(HSV-1). HSV infection is worldwide, endemic in urban
areas and has been mostly associated with orolabial
manifestations, but can be severe in immunodeficient
individuals. The antiviral activity was determined by
43
Basic Virology: BV
the time-of-addition protocol of the crude extract (CE),
aqueous and ethyl acetate fractions (FAq, FAc), at the
concentrations varying from 1.5µg/ml to 100.0µg/
ml, before (-2h), during (0h) and after (1h and 2h) the
viral infection, by plaque reduction assay, in HEp-2
cell cultures. The 50% cytotoxic concentration (CC50),
determined by MTT test, for CE, FAq and FAc was
>400µg/ml for all the compounds. The 50% inhibitory
concentrations (IC50) for CE, FAq and FAc were 4.59µg/
ml, 12.5µg/ml and 11.12µg/ml, respectively. The
selectivity index (SI = CC50/IC50) were >87.15 for CE,
>32 for FAq and >35.97 for FAc. The percentages of
viral inhibition (%VI) were 93.7, 90.8 and 100% for CE,
FAq and FAc, respectively, at the highest concentrations
tested when treatment was performed simultaneously
(time 0h) with the infection. Regarding prophylactic
and therapeutic activity no significant results were
obtained. The results for virucidal test and inhibition of
adsorption assay also demonstrated that CE, FAq and FAc
affected the viral particles and inhibited HSV-1 binding
to cells by the following %VI 42.55% and 100.0% for CE;
39.53% and 100.0% for FAq and 97.32% and 100.0% for
FAc, respectively, at the highest concentrations tested.
This experiment showed that the crude extract and
the fractions of T. catigua demonstrated low toxicity,
desirable selectivity and action in the early stages of
HSV-1 replication.
BV96 - Htra1 Overexpression In High-Risk
Hpv-Positive And Hpv Negative Cell Lines.
Stuqui, B., Termini, L., Sichero, L., Villa, L.L., Rahal, P.,
Calmon, M.F.
UNESP/IBILCE, R- Cristóvão Colombo, 2265, B- Jardim
Nazareth, São José do Rio Preto
2. Instituto do Câncer do Estado de São Paulo, ICESP,
Av. Dr. Arnaldo, 251 - Cerqueira César - São Paulo
3. Instituto Nacional de Ciência e Tecnologia- Instituto
do HPV, INCT-HPV, R- Dr Cesário Mota Júnior, Consolação,
São Paulo
The Human Papillomavirus is the most prevalent virus
among sexually transmitted infections and it is associated
with some malignancies. One of the mechanisms used in
cell transformation by E6 protein from high-risk HPVs
is the interaction of its carboxy-terminal domain, known
as PDZ, with PDZs domains presents in some cellular
proteins, triggering them to degradation. A protein that
is associated with various pathological conditions and
has PDZ domain is the protease HtrA1. This protein is
poorly expressed in some cancers, suggesting a tumor
suppressor role. The aim of this study was to evaluate the
effect of the HTRA1 overexpression in HPV 16 positive
(HF698) and HPV negative (C33) cell lines. The cell lines
were transfected with vector containing the HTRA1 ORF
or empty vector. The mRNA and protein overexpression
was confirmed by qPCR and immunohistochemical,
respectively, in both cell lines transfected with HTRA1
expression vector. The cell lines transfected were
subjected a cell proliferation and viability assays. C33
cells expressing HtrA1 grew significantly fewer colonies
and showed reduction viability than cells without HtrA1
expression. On the other hand, in HPV-positive cell line
there was an increase in the number of colonies in cells
expressing HtrA1 compared to cells lacking HtrA1 and
there was no difference between cells expressing or
lacking HtrA1 in the cell viability assay. These results
suggest that the different patterns observed in the two
cell lines studied may be due the HPV presence in HF698
and it absence in C33. Therefore, the HPV proteins could
influences in HTRA1 activity. We will analyse if the E6
transcriptional silencing by siRNA will result in HtrA1
protein increase. Furthermore, additional studies, as
apoptosis and cell cycle assays, will be performed to
assess HtrA1 function in HF698 and C33 cell lines.
Financial support: FAPESP, CAPES
BV97 - Differences In The Formation Of
Actin Tail In Vaccinia Virus And Cotia Virus
Infected Bsc-40 Cells
Ribeiro, M.D., Afonso, P.P., Schnellrath, L.C., Damaso, C.
Universidade Federal do Rio de Janeiro, UFRJ, Av
Carlos Chagas Filho, 373, Prédio do CCS Bl C - 028
Cotia virus SPAn232 (COTV) is a Brazilian poxvirus
isolated in 1961 and represents a new genus of the
Poxviridae. We have previously observed that COTV
infection induces the formation of shorter actin tails
which have different formats when compared to those
induced by vaccinia virus strain WR (VACV-WR; genus
Orthopoxvirus). Actin tails are important to propel
extracellular virus particles away from infected cells.
Proteins have been described as essential to this process,
such as N-WASP, WIP, Nck and Grb2, in addition to the
kinases of the Abl and Src families that phosphorylate
tyrosine residues (tyr) of the viral protein A36. Our
current interest is to study the differences in the
induction and formation process of actin tails during
COTV and VACV-WR infections. Initially, we evaluated
the recruitment of some essential proteins to the
actin tails by infecting cells with VACV-WR (MOI=5) or
COTV (MOI=10). After 16 h cells were processed for
immunofluorescence using antibodies against N-WASP,
Abl, Src and phospho-Tyr. Our results showed that these
proteins were recruited to the tips of VACV-WR-induced
actin tails, consistent with previous studies. N-WASP and
p-Tyr, but not Src, seem to be recruited to the tip of COTV
44
Basic Virology: BV
actin tails. Src and/or Abl kinase inhibitors, Imatinib
and Desatinib, reduce poxvirus spread in monolayers,
which can be evaluated by comet assays. Cells were
infected (250 PFU) and after 1 h different concentrations
of each drug were added and plaques were placed at a
fixed angle of 5 degrees for 72 h when were fixed and
stained. Imatinib showed no cytotoxicity until 60 ug/
ml after 24 h using neutral red uptake assay, and reduce
comet formation induced by VACV-WR at the non-toxic
concentration of 30 ug/ml for 72 h. Experiments with
COTV are currently being performed. Desatinib was not
toxic until 40 ug/ml after 24 h, but at this concentration
destroyed monolayers after 72 h, and other virus assays
are in progress. Finnancial Support: FAPERJ, CNPq,
INPeTAm
BV99 - Biological Differences Of Clinical
Specimens Of Cantagalo Virus Isolated
During Outbreaks In Rondônia
Rezende, B.C., Damaso, C.
Universidade Federal do Rio de Janeiro, UFRJ, Av.
Carlos Chagas Filho, 373 - CCS, Cidade Universitária, Rio de
Janeiro - RJ
Cantagalo virus (CTGV) was isolated in 1999 from
vesicular lesions in dairy cattle in Rio de Janeiro state and
characterized as a strain of vaccinia virus (VACV). The
outbreaks have caused important economical problems
in several states, particularly in Rondônia (RO). ST-246
is a potent antiviral drug that affects orthopoxvirus
spread and release and sulfated galactan (SG) is a
polysaccharide extracted from the algae Botryocladia
occidentalis which is known to inhibit the entry of
virus in cells. In this work, we studied the diversity of
the isolates from RO concerning their sensibility to
the above mentioned antiviral drugs. Therefore, BSC40 cells were infected with CTGV or different clinical
isolates from RO for 48 hours (h) when virus plaque
diameter was determined. The size of poxvirus plaques
is directly related to the cell-to-cell spread of the virus
and may reflect genotypic diversity. The mean diameter
of CTGV isolate CM-01 (1999) virus plaques is 707.8
µm. On the other hand, isolates collected in 2009 from
Jaru, Governador Jorge Teixeira and Espigão D’Oeste in
RO presented the mean diameter of 680.6 µm, 679.8 µm
and 650.6 µm, respectively. Isolates from Governador
Jorge Teixeira in 2012 presented plaques of 925.0 µm. To
evaluate the effect of ST-246 on the replication of these
CTGV isolates, we infected BSC-40 cells with 300 PFU
and after adsorption we added different concentrations
of ST-246 for 48 h. Our results showed an inhibition of
89.8% for CTGV and 92.5% for the isolate from Urupá
at 0,01 µM. To evaluate the effect of GS in adsorption,
we infected cells with 300 PFU of CTGV or isolate from
Urupá in the presence of SG for 2 h at 4ºC and 48 h postinfection viral plaques were counted. We verified an
inhibition of 87.2% for CTGV and 88.8% for the isolate
from Urupá at 0,1µg/ml. These data suggest that there is
a diversity of circulating CTGV isolates in RO that need to
be better characterized.
BV102 - Structural Analysis Of A Vaccine
Platform Based On Ms2 Virus-Like Particles
Vicente-Santos, A.C., Barroso, S.P.C., Peabody, D., Ferreira,
D.F., De Mesquita, J.F., Silva, J.L., Oliveira, A.C.
Universidade Federal do Rio de Janeiro, UFRJ, Av. Carlos
Chagas Filho, 373, CCS, bloco E, sala 10, CEP. 21941902
Virus-like particles (VLPs) can be considered as dense
arrays of one or more repetitive subunits of a protein
and this characteristic confers highly advantageous
properties for their use as vaccines platforms. The
platforms used here are VLPs of the bacteriophage MS2,
an E. coli phage. We evaluated the structural stability of
VLPs containing highly immunogenic peptides related
to the infectious cycle of HIV-1 by submitting them to
high hydrostatic pressure (HHP) and other chemical and
physical denaturant agents and evaluating the changes
by means of light scattering, small-angle x-ray scattering
(SAXS) intrinsic and extrinsic fluorescence and circular
dichroism (CD). We analyzed the morphology of VLPs
by transmission electron microscopy. In addition, the
structure prediction of the coat protein with peptide
insertions was done by homology modeling approach.
The results obtained so far were performed with VLPs
formed by a single chain dimer of the coat protein,
the native coat protein, two constructions with a Flag
epitope and with VLPs containing peptides of the
extracellular loop of CCR5 cell co-receptor and the V3
loop of gp120 of HIV-1. The spectral center of mass and
light scattering data indicate that there are differences
in the structure and stability of VLPs with insertion of
the epitopes, except for results using HHP, in which the
construction with inserts showed the largest shift of the
center of mass. CD measurements indicate no changes in
secondary structure between dimer and native protein,
but single chain constructs with Flag epitope had a
different behavior. SAXS data show that the effect of 3
hours of pressurization was not able to promote the
VLPs disassembly. Our results demonstrate that the
VLPs assembled from coat protein containing peptides
insertions behave differently from the ones assembled
from native coat protein, however they showed structural
stability under most of the conditions used, suggesting
that these particles are very promising for application
as a vaccine platform. Financial support: CAPES-FAPERJCNPq-PRONEX-INBEB
45
Basic Virology: BV
BV104 - Characterization Of Clones Of The
Brazilian Smallpox Vaccine Strain
Medaglia, M.L.G., Lucas, C.O., Arruda, L.B., Damaso, C.
Universidade Federal do Rio de Janeiro, UFRJ, Avenida
Carlos Chagas s/n Ilha do Fundão, Rio de Janeiro
Smallpox is a pustular disease exclusive to humans
caused by variola virus (Poxviridae, Orthopoxvirus
genus). Vaccination with vaccinia virus (VACV) led to its
eradication in 1980. Nevertheless, some countries still
maintain routine vaccination for restricted personnel.
However, the high rates of post-vaccinal complications
demand the development of safer vaccines. The isolation
of attenuated clones from efficacious vaccine strains has
been a current approach. The Brazilian smallpox vaccine
was produced by the Instituto Oswaldo Cruz-RJ using
the VACV strain IOC, and several of its biological features
remain unknown. Hence, we plaque purified two
clones of VACV-IOC, clones B141 and B388, for further
characterization. Both showed similar viral yield in
BSC-40 cells, whereas clone B141 progeny was 5.7-fold
higher in HEp-2 cells. In addition, both clones showed
comparable levels of extracellular virus titers and size of
actin tails, even though the production of actin tails by
clone B141 was 1.3-fold lower. Mice infected with either
VACV-IOC clone via tail scarification produced similar
and less severe primary lesions compared to the virulent
strain VACV-WR, which presented 100-fold higher viral
yield at the primary lesion. In addition, no secondary
lesions were observed in B141 or B388 infected mice.
By this route of immunization, both VACV-IOC clones
induced similar titers of specific IgG and neutralizing
antibodies 21 days post-immunization (4,000 and 1:30,
respectively). Moreover, both induced priming of IFN-γ,
TNF-α or IL-2 producing T cells, as well as polyfunctional
cell subsets. Mice survived intranasal infection with
doses as high as 107 PFU of either VACV-IOC clones with
no weight loss. Virus replication was limited to trachea
and lungs, whereas the infection of VACV-WR spread to
spleen and liver. Finally, mice immunized with either
B141 or B388 survived following lethal challenge with
VACV-WR and did not present weight loss, clinical signs
of disease or viral yield in lungs and liver.
BV105 - Estudo Da Estrutura Da Proteína
Sh Do Vírus Sincicial Respiratório
Humano: Análise Funcional Da Estrutura
Pentamérica
Por
Ferramentas
De
Bioinformática
Araujo, G.C., Oliveira, R.J., Araujo, A.S., Souza, F.P.
1. Universidade Estadual Paulista “Júlio de Mesquita
Filho”, UNESP, Rua Cristóvão Colombo, 2265
2. Universidade Federal do Triângulo Mineiro, UFTM,
Av. Frei Paulino, 30
The human Respiratory Syncytial Virus (hRSV) is the
major cause of lower respiratory tract illnesses in
children and elderly people worldwide. Its genome
encodes 11 proteins including the surface protein F, G
and SH which are responsible for entry and distribution
of virus in the host cell. Among the surface protein, little
is known about the function of SH protein. Knowing
their structure and function is essential to a better
understanding of its mechanism. The aim of this study was
modeling and caracterization of the RSV SH protein and
analysis of structural behavior in different environment:
water and phopholipid bilayer for understanding and
evaluating the formation of its pentameric structure.
The SH protein model was generated by I-TASSER
server, and its funcional and structural caracteriscts
was analyzed by PredictProtein and PsiPred. Molecular
Dynimics Simulation were performed for analysis of
hidrophobicit of protein central region, studies of the
protein behavior on the membrane and pentamer
formation. The results showed that SH protein model
prediction resulted in a linear model with a helix-alpha
between amino acid 20-42 and the anlysis performed by
PsiPred indicated this region as transmembrane region.
Molecular Dynamics Simulation showed that in solution
the protein changes its linear conformations for globular
conformation confirming the hydrophobicity of the
central domain. The presence of the SH protein itself or
of the pentamer in bilayer resulted in a decrease of the
area per lipid, giving the chains less mobility and greater
alignment. The pentamer simulation showed passage
of water molecules through the pore in an environment
where histidine residues H22 and H51 are protonated,
indicating the dependence of this activity with the
medium pH. Based on this analysis, it was proposed
the structure tertiary and quaternary of the SH protein
and analyze its influence on the environment consisting
of the bilayer for understanding its function in viral
infectivity.
BV107 - P34 Peptide Inhibits The Entry Of
Equine Arteritis Virus Into Rk13 Cells
Fernandes, M.H.V., Silva, D.S., Castro, C.C., Corrêa, R.A.,
Motta, A.S., Fischer, G., Vargas, G.D., Lima, M., Hübner,
S.O.
1. Universidade Federal de Pelotas, UFPel, Universidade
Federal de Pelotas – UFPel – CP 354 – 96010-900 – Pelotas –
RS – Br
UFRGS, Porto Alegre/RS, Brasil
46
Basic Virology: BV
The P34 is a peptide produced by Bacillus sp P34, a
bacteria isolated from the intestine of the fish Leporinus
sp. that lives in the Amazon basin. P34 has antibacterial,
fungicidal and antiviral activity related. In our previous
studies, the P34 peptide showed the ability to inhibit
the equine arteritis virus (EAV), then we intended to
evaluate its mechanism of action against this virus. It
was searched if the P34 inhibited the EAV infection by
occupying the same receptors used by the EAV to infect
RK13 cells. Confluent monolayers of RK13 cell cultures
were infected with 100 TCID50 of EAV or with 100
TCID50 of EAV mixed with the peptide P34 (2,29 μg/mL)
and incubated at 37 ºC for 1 h. Following incubation, the
virus or the mixture were aspirated, cells were washed
and fresh E-MEM was added. The peptide P34 was
also added to RK13 cells for 1 h and after this the virus
infectivity was assessed by inoculating 100 TCID50 of
EAV for 1 h at 37 °C onto those cells. After incubation for
72 h the plates were frozen-thawed and viral titers were
measured. The infection of RK13 cells with 100 TCID50 of
EAV resulted in a titer of 106,5 TCID50/100µl. RK13 cells
treated for 1 h with the peptide P34, before the addition
of 100 TCID50 of EAV, did not influence virus infectivity
since there was no significant titer reduction when
compared with the EAV control inoculation. However,
when the peptide P34 and 100 TCID50 of EAV were both
added to the cells, no infectious virus was detected even
after 72 h. These results suggest that P34 inhibits the
entry of EAV into RK13 cells, apparently influencing viral
binding, penetration or entrance. Besides, the P34 does
not interact with RK13 cell surfaces and the hindrance
of cellular receptors and/or of viral attachment proteins
are not involved in its antiviral mechanism. Financial
support: CNPq and CAPES
BV113 - In Vitro Anti-Dengue Virus Activity
Of Extracts Isolated From Roots Of
Maytenus Sp
Rodrigues, R.A.L., Rodrigues, V.G., Duarte, L.P., Silva,
G.D.F., Filho, S.A.V., Kroon, E.G.
against Dengue virus (DENV) and infection prevention
and control is based on public politics against virus
vector. In the last decade, the research for new medicines
has been through great improvement, especially after the
introduction of biological models in vitro done in large
scale, which allowed a consistent statistic analysis of the
results. Previous studies have shown that Celastraceae
family have species with relevant antimicrobial activity.
Members of this genus are used in folk medicine for
gastric diseases, and as antiseptic, anti-asthmatic, antitumor, antiviral, and anti-inflammatory agents. In the
present study, two hexane-ethyl ether (SEH, FSEH), two
ethyl acetate extracts (SEAT, FSEAT) and one methanol
extract (SEM), obtained from roots of Maytenus sp, were
evaluated against DENV-2. Roots were colected at Ouro
Preto municipality – MG, and the samples had been
obtained by continuous extraction using hexane/ethyl
ether (1:1), ethyl acetate and methanol as solvents, in
Soxhlet apparatus. The in vitro cytotoxicity and antiviral
activity were evaluated by the MTT colorimetrical
method. The results were expressed by the cytotoxicity
concentration of 50% (CC50), effective concentration
of 50% (EC50) and values of selective index (SI =
CC50/EC50). FSEAT, SEM and SEAT exhibited antiviral
activity with EC50 values of 12,19 ± 1,3mg/ml, 12,43
± 1,1mg/ml, 17,42 ± 2,7mg/ml and SI of 7,21, 8,93 and
13,22, respectively. The results obtained in this work
demonstrate that chemical constituents of those samples
are promissory as anti-dengue agents. These active
samples will be submitted to phytochemical studies in
order to isolate some promising substance responsible
for the antiviral effect. Financial support: CNPq, CAPES,
FAPEMIG, Pronex-Dengue, INCT-Dengue
BV114 - Prospective Study Of Bats As Natural
Resevoir Of Flavivirus In Zona Da Mata,
Minas Gerais, Brazil
Carvalho, C.M., Sacchetto, L., Siqueira, T.R., Souza, R.F.,
Nobre, P., Trindade, G.S., Santos, M.B., Drumond, B.P.
1. Universidade Federal de Minas Gerais, ICB, ICB/
UFMG, Av. Presidente Antônio Carlos, 6627, Pampulha, Belo
Horizonte, MG, Brasil
2. Universidade Federal de Minas Gerais, ICEx, DQ,
DQ/UFMG, Av. Presidente Antônio Carlos, 6627, Pampulha,
Belo Horizonte, MG, Brasil
3. Universidade Federal de Ouro Preto, UFOP, DEFAR/
UFOP, Ouro Preto, MG
1. Universidade Federal de Juiz de Fora, UFJF, Rua
José Lourenço Kelmer, s/n - Campus Universitário Bairro São
Pedro
2. Universidade Federal de Minas Gerais- Minas Gerais,
UFMG, Av. Antônio Carlos, 6627 - Pampulha
3. Grupo de Pesquisa em Ecologia de Vírus - Minas
Gerais/Brazil, ECOVIR
Gerais, INTRAVIRUS
Dengue is considered the most important arboviral
disease of humans and it is estimated that 100 million
dengue cases occur every year around the world.
However, there is no therapeutic agent or specific vaccine
Bats (Chiroptera) are very abundant, diverse, and
geographically dispersed vertebrates, They have been
increasingly recognized as reservoir hosts for zoonotic
viruses. More than 66 viruses have been detected or
47
Basic Virology: BV
isolated from naturally infected bats, as Rabies virus,
Hantavirus, Influenza, Coronavirus, SARS coronavirus
and Flavivirus, including Chikungunya virus, Japanese
encephalitis virus, West Nile virus (WNV), St Louis
encephalitis virus (SLEV) and Dengue virus (DENV).
Members of the genus Flavivirus, cited above and Yellow
fever virus (YFV) are important human pathogens. At
least eleven flaviviruses occur in Brazil and nine of them
cause disease in human. Minas Gerais is characterized by
occurrence of great epidemics of dengue and also yellow
fever outbreaks have been reported in this state. Besides
the importance of bats, there are very few studies
regarding their role as reservoir of zoonotic viruses,
excepting rabies, in Brazil and Minas Gerais. Therefore,
the aim of this study was to investigate bats as natural
hosts of flaviviruses in Zona da Mata, Minas Gerais (ZMMG). Tissue samples (heart, lungs, kidney, intestine,
liver and spleen) were obtained from 17 bats collected
in the Mata do Krambeck and Serra do Papagaio (ZMMG) and preserved in RNAlater (QiagenTM). Twentyfive mg of liver and spleen were pooled, macerated
and used for RNA extraction. Each sample was tested
by reverse transcription followed by polymerase chain
reaction (RT-PCR) in order to detect SLEV, YFV, WNV and
DENV 1 to 4. Although none of the samples presented
the expected amplicons for each of the viruses tested,
further analyses will be carried on to test the presence
of viruses in other organs including flaviviruses and
coronaviruses. This is the first prospective study of bats
as hosts for zoonotic viruses in this region that may
contribute to the knowledge of ecological and biological
aspects of zoonotic viruses in this region. Financial
Support: FAPEMIG, CNPq, CAPES, UFJF, PROPESQ/UFJF
BV118 - Interaction Of Yellow Fever Virus
And Dengue Virus With Megakaryoblasts
Campos, S.P.C., Castro, M.G., Sanches, D., Rodrigues,
M.F., Paredes, B.D., Silva, J.S., Gomes, A.M.O., Oliveira,
A.C.
Carlos Chagas Filho, 373, CCS, Cidade Universitária - 21941902 - RJ
Dengue Virus (DENV) and Yellow Fever Virus (YFV) have
great importance in economy and public health in Africa,
South America and Asia. They are the etiologic agents of
acute hemorrhagic fevers that are related to hemostasis
dysfunction, with coagulation factors consumption and
thrombocytopenia. The low platelet count is related to
the evolution of the disease severity. Platelets play a
crucial role in hemostasis and are cytoplasmic fragments
of megakaryocytes. Each megakaryocyte produces from
5.000 to 10.000 platelets. To better clarify the processes
in which viral infection leads to thrombocytopenia, we
aim to study the interaction between DENV and YFV
with megakaryocyte precursors. We infected MEG-01
cells (Human Megakaryoblastic cell line) with DENV2 and YFV 17 DD in a multiplicity of infection of 1. We
confirmed YFV infection by detecting intracellular
YFV proteins since 24h post infection (p.i.) by confocal
microscopy. We analyzed the production of infectious
particles by plaque assay and observed increasing
production until 96h p.i. and followed by decrease. We
analyzed cell viability by extracellular activity of LDH
and trypan blue exclusion. We observed higher LDH
activity from 96h p.i. with YFV but not with DENV-2. A
decrease of cell number was evident after 72h p.i., but
we only observed an increase of cell mortality from
120h p.i. for both viruses. We observed mitochondrial
physiology changes during DENV and YFV infection by
measuring oxygen consumption. We also did not observe
changes on the cell differentiation profile until 96h p.i.,
observing reduction on infected 4N cell population
144h p.i. compared to control. Our data suggest that
YFV can infect and replicate in MEG-01 cells. Our data
also suggest that DENV-2 and YFV infections inhibit cell
growth until 72h and induce cell death from 120h p.i.,
with mitochondrial alterations without changing the
kinetics of cell differentiation until 96h p.i., reducing the
4N cell population 144h p.i.
BV124 - The Involvement Of Virulence
Factors In Autophagy During Poxvirus
Infection
Schnellrath, L.C., Attias, M., Damaso, C.
Carlos Chagas Filho, 373, Prédio do CCS, Bloco C/ sala C-028
Poxviruses, which the family prototype is vaccinia virus
(VACV), encode a wide variety of virulence factors that are
related to their host range spectrum and pathogenicity.
Among these factors, a great part is involved in the
antiviral response triggered by interferons (IFNs). This
signaling pathway leads to an increased expression of
the double stranded RNA-dependent protein kinase
(PKR), inhibiting protein synthesis in infected cells
through phosphorylation of eukaryotic initiation factor
2 (eIF2). Correlation between induction of autophagy
and activation of PKR has been reported. VACV expresses
proteins that prevent dsRNA-PKR interactions.
Therefore, this study sought to investigate if the absence
of these proteins could lead to the induction of autophagy
during infection. In cells which the action of IFN-related
pathways was not counteracted by VACV, infection led to
phosphorylation of both PKR and eIF2. Protein synthesis
shut-off was also observed by metabolic labeling. We
observed a non-productive infection with approximately
3-log inhibition of virus yield. By immunofluorescence
48
Basic Virology: BV
assays we detected a punctate pattern of LC3 after 8
hours post-infection. The evident colocalization of LC3
and LAMP was assessed by confocal microscopy. We
also observed the formation of autophagossomes in
the cytoplasm using transmission microscope. 3MA,
an inhibitor of autophagy, confirmed the existence of
the process, since its presence blocked the number of
cells with punctate pattern of LC3 in nearly 95% during
infection. Otherwise, the addition of 3-MA was not able
to recover the virus replication. In other cell types such
as human cancer cell line and mouse fibroblast cells,
although replication was deficient in both, infection
was unable to induce autophagy. The pattern of LC3
was indistinguishable from non-infected cells by
immunofluorescence. Nevertheless, the restriction in
virus replication is not sufficient for the induction of
this process in some cell lines. Financial Support: CNPq,
FAPERJ, CAPES, INCT-IMPeTAm.
BV125 - Screening For Antiviral Activity
Of Extracts From Yeast, Filamentous
Endophytic Fungi And Plants Of Various
Brazilian Ecosystems Against Dengue
Virus (Denv-2)
Silva, L.K.S., Silva-Fernandes, A.T., Almeida, G.M.F.,
Rodrigues, R.A.L., Marinho, P.E.S., Ruiz, A.C.G., Johann,
S., Vieira, M.L.A., Rosa, L.H., Rosa, C., Kroon. E.G.
Antônio Carlos, 6627, Campus Pampulha, CEP: 31270-901.
Belo Horizonte, Minas
Dengue is a significant public health threat, with 50
to 100 million cases per year and approximately 3.5
billion of people at infection risk. Over the past 30 years
infection rates have dramatically increased, in part
due to urbanization. Dengue virus (DENV) infections,
transmitted by Aedes mosquitoes, can be caused by
any of the four DENV serotypes (DENV1-4). There is
no vaccine or effective antiviral treatment available for
DENV, and mosquitoes control measures have largely
failed to curb dengue incidence in most parts of the
world. Therefore, novel approaches for protection are
required, and it is very important to develop antiviral
drugs against this virus. The aim of this study was to
discover new antiviral compounds from extracts of yeast,
filamentous endophytic fungi and plants of different
Brazilian ecosystems. Cytotoxicity and antiviral activity
assays were conducted in LLCMK-2 cell lines using MTT
assay. Virucidal assays were also conducted in LLCMK-2
cell lines using crystal violet coloration assay. The results
were expressed by the 50% cytotoxic concentration
(CC50), 50% effective concentration (EC50), values
of selective index (SI = CC50/EC50) and 50% virucide
concentration (VC50). Altogether 176 extracts were
tested and 27 showed antiviral activity against DENV2. Fourteen extracts showed a SI lower than four, six
extracts showed a SI between 4 and 10, and seven extracts
showed a SI higher as 10. All 27 extracts which showed
antiviral activity were tested in the virucidal assay and
only one was not virucide. In conclusion, about 15% of
the extracts tested showed an antiviral activity against
DENV-2, as shown by their CC50 and CE50, and 96% had
a virucide activity.
BV127 - Diferencial Induction Of 2’5’oas Gene
Family By Dengue Virus 2 (Denv-2) Infection
In Human Cells
Silva, L.K.S., Almeida, G.M.F., Oliveira, D.B., Botelho,
L.M., Ferreira, P.C.P., Kroon, E.G.
Universidade Federal de Minas Gerais, UFMG,
Universidade Federal de Minas Gerais, Av. Antônio Carlos
6627, Pampulha, Belo Ho
The 2’5’OAS gene family comprises four different genes
named OAS1, OAS2, OAS3 and OASL, found on human
chromosome 12, that can produce up to ten different
variants by alternative splicing. These genes were always
associated to induction by IFNs and to antiviral activity,
but even though 2’5’OAS genes are regulated directly
by IFN treatment, some of them can also be induced
by IFN independent stimuli. It has already been shown
that some 2’5’OAS genes are induced directly by viral
infections and dsRNA in cells lacking a proper type I and
III IFN response, characterizing these isoforms as viral
stress-inducible genes (VSIG) in addition to interferon
stimulated genes (ISGs). 2’5’OAS genes have also been
implicated in a proper host innate response against
Dengue viruses. To determine how these genes are
upregulated by Dengue virus (DENV) infections, A549
cells were infected with DENV-2 or Vesicular stomatitis
virus (VSV) as a control at a MOI of 1, or treated with
inactivated viruses, and total RNA was extracted 24
hours later. Reverse transcription reactions were made
and the resulting cDNA was used for 2’5’OAS genes and
IFN expression evaluation. As expected, VSV infections
resulted in the induction of all four 2’5’OAS genes in
these cells. However, DENV-2 infections resulted in
the upregulation of OASL and OAS2 genes, but not of
OAS1 and OAS3. Inactivated viruses did not induced
significative levels of these genes, and both viruses
infections resulted in the induction of type I IFNs which
could only be partially correlated to the 2’5’OAS genes
upregulation detected. The fact that DENV-2 infections
induces only small levels of OASL and OAS2 genes, while
VSV infections induces all 2’5’OAS genes at the same
time, can be seen as evidence for the presence of innate
immune evasion mechanisms in DENV-2 infected cells.
Further studies are necessary to fully comprehending
49
Basic Virology: BV
the relationship between DENV and the 2’5’OAS system
of their hosts.
BV130 - Determination Of The Cytokine
Levels In The Supernatants Of Spleen
Cell Cultures Of Mice Immunized With
Tetravalent Synthetic Peptides Derived
From Dengue Virus Envelope Domain I And
Ii
Almeida, L.G.N., Fumagalli, M.J., Rodrigues, N.F.,
Livonesi, M.C., Costa, L.C.F., Santos, M.C.S.G., Malaquias,
L.C.C., Coelho, L.F.L., Rocha, R.P.
1. Universidade Federal de Alfenas, Unifal, Laboratório
de Vacinas, Departamento de Microbiologia e Imunologia
2. Universidade Federal de Alfenas, Unifal, Dep. de
Análises Clínicas e Toxicológicas, Faculdade de Ciências
Farmacêuticas
Dengue is a major public health problem worldwide,
especially in the tropical and subtropical regions of
the world. Infection with a single Dengue virus (DENV)
serotype causes a mild, self-limiting febrile illness called
dengue fever. However, a subset of patients experiencing
secondary infection with a different serotype progresses
to the severe forms of the disease, dengue hemorrhagic
fever/dengue shock syndrome. These forms are
characterized by spontaneous bleeding and plasma
leakage after an excessive immune activation of T cells
and macrophages. In this study, we immunized mice
with three tetravalent and conserved synthetic peptides
named Pep01, Pep02 and Pep03. Positive and negative
controls were mice infected with 4 x 104 plaque forming
units of DENV-1 and PBS treated animals, respectively.
Spleen cells from immunized animals, positive and
negative controls were obtained and infected with 0,01
MOI of each serotype in separate or mock-infected with
supernatant derived from C6/36 non-infected cells. After
72 hours, the supernatants were harvest and used for
cytokine determinations. Levels of IL-5, IL-10, TNF-alpha
and IFN-gamma were determined by standard sandwich
ELISA. Spleen cells derived from mice immunized with
the synthetic peptides showed a high expression of IL-10
(p<0.01) and a lower expression of TNF-alpha and IFNgamma (p<0.001) after infection with all DENV serotypes
if compared to positive control. The cytokine IL-5 was not
detected in any group analyzed. These peptides are good
candidates to dengue vaccine because they are able to
reduce levels of pro-inflammatory cytokines (TNF-alpha
and IFN-gamma) involved in dengue hemorrhagic fever
development. Furthers studies will be conducted to best
analyze the T cell activity induced by these peptides.
Financial support: FAPEMIG; CNPq.
BV134 - Yellow Fever Virus-Induced
Mitochondrial Dysfunction: Changes In
Mitochondrial Energetic Metabolism And
Apoptosis Induction
Sanches, D., Campos, S.P.C., Rocha, C.M., Freire, M.S.,
Silva, J.L., Gomes, A.M.O., Oliveira, A.C.
Carlos Chagas Filho, 373, CCS, Cid Universitária, Rio de
Janeiro
4365 - Manguinhos, Rio de Janeiro
Flaviviruses cause diseases like Dengue and Yellow
fever. These viruses are transmitted by mosquitoes
mainly in South America, Central America and Asiatic
southeast, where they have a particular importance for
public health. Virus-induced apoptosis is related to a
cytopathological consequence of an infection in vivo or
in vitro. During apoptosis, mitochondrial pathway has
been described as a crucial step during viruses-induced
apoptosis. Once the mitochondrial pathway is activated,
loss of mitochondrial membrane potential (Δ�m) occurs
and caspases can be activated, culminating in apoptotic
process. Here, we investigate the role of mitochondrial
cell death pathway during Yellow Fever Virus (YFV)
infection and its consequence to mitochondrial
energetic metabolism. We infected Vero cells with YFV
using a MOI=1. We analyzed the cell viability using
Live/Dead and LDH assay. Apoptosis was analyzed by
PhosphatidylSerine (PS) exposure and TUNEL, while
the role of mitochondrial pathway was followed by Δ�m
through fluorescence microscopy. The importance of
mitochondrial pathway was investigated by Bongkrekic
acid, an adenine nucleotide translocator (ANT) inhibitor.
The mitochondrial energetic metabolism was studied
by oxygraphy. Apoptosis was observed after 72 hours
post infection (h.p.i.) through TUNEL and PS exposure.
The dependence of caspases activation during the
apoptosis process was also observed, using z-Vad-fmk,
a pancaspase inhibitor. We also observed loss of Δ�m
72 h.p.i. demonstrating that the apoptotic mitochondrial
pathway is being activated and apoptosis is dependent
of ANT activity. Oxygraphy results show a slighter
increase of routine respiration, but a significant increase
of oligomycin-sensitive oxygen consumption at 48
h.p.i., that indicate an increase in oxygen consumption
rate coupled to ATP synthesis. Our results suggest that
the mitochondrial pathway is activated, contributing
partially for the caspase-dependent cell death process
induced by YFV. Our data also suggest changes on
mitochondrial energetic metabolism associated to virus
infection. Support: CNPq, CAPES, FAPERJ, INBEBB,
PRONEX
50
Basic Virology: BV
BV137 - Nanoparticles With Entrapped
Inactivated Dengue Virus Are Able To
Stimulate Antibody Production In Mice
Fumagalli, M.J., Almeida, L.G.N., Gomes, A.B.V.T.,
Martins, R.S., Malaquias, L.C.C., Coelho, L.F.L., Rodrigues,
N.F.
Universidade Federal de Alfenas, UNIFAL, Laboratório
de Vacinas, Departamento de Microbiologia e Imunologia
to the severe form of the disease, dengue hemorrhagic
fever/dengue shock syndrome. Currently, there are
no licensed vaccines or antiviral drugs to prevent or
treat dengue infections. Polymeric nanoparticles with
adsorbed or entrapped antigens represent a novel
method for controlling the release of immunogens and to
optimizing the immune response via selective targeting
of the antigen presenting cells. In this study we used
a murine model to evaluate the IgG production after
administration of bovine serum albumin with entrapped
inactivated DENV serotypes. This formulation induced
a production of anti-DENV IgG antibodies (p < 0.01) in
the immunized mice as demonstrated by indirect ELISA.
Further investigation will be necessary to determine
if these antibodies have neutralizing activity against
the four DENV serotypes. Financial support: FAPEMIG;
CNPq.
BV140 - An Ex Vivo Cellular Model For The
Study Of T Cell Cross-Reactivity After A
Secondary Infection By Dengue Virus
Rocha, P.R., Livonesi, M.C., Costa, L.C.F., Santos, M.C.S.G.,
Rodrigues, N.F., Malaquias, L.C.C., Coelho, L.F.L.
Universidade Federal de Alfenas, UNIFAL, Rua Gabriel
Monteiro da Silva, 700. Centro - Alfenas/MG.
to the severe forms of the disease, dengue hemorrhagic
fever/dengue shock syndrome. These forms are
characterized by spontaneous bleeding and plasma
leakage after an excessive immune activation of T cells
and macrophages. In this study we proposed an ex vivo
cellular model to evaluate the T cell cross-reactivity after
a secondary infection with all serotypes of DENV. This
model uses spleen cells derived from immunocompetent
mouse infected with a low viral dose of non-adapted
DENV-1 strain via the subcutaneous route. The spleen
cell culture from DENV-1 infected mice infection showed
a significant expression of the IFN gama and TNF-α
(p<0.001) and a not detectable amount of IL-5 and IL10 after infection with all serotypes in vitro. Thus, this
model could be useful to study mechanism of dengue
virus infection, pathogenesis as well as to evaluate
candidate vaccines. Financial support: FAPEMIG; CNPq.
BV159 - Evaluation Of Antiviral Activity
Against Dengue-2 Virus Of Hs-1 Peptide
From Hypsiboas Semilineatus
Monteiro, J.M.C., Safar, N.V.H., Oliveira, M.D., Cardoso,
S.A., Oliveira, L.L., De Paula, S.O.
Universidade Federal de Viçosa, UFV, Avenida PH
Rolfs, s/n, Campus Universitário
Dengue virus is an arbovirus of the family Flaviviridae,
which has been the most prevalent arthropod-borne
viral diseases among the world population. There are
four serologic types of dengue virus (DENV 1-4), which
cause long lasting immune responses, but different ones.
Several studies reveal that some peptides from skin of
amphibians have antimicrobial and antiviral activities.
As such, sequences of these peptides were synthesized
and tested in vitro in order to obtain biologically active
compounds to develop drugs with wide spectrum and
multiple applicability. Effective drugs against dengue
virus haven’t been developed yet. As such, the present
study aimed to evaluate the antiviral activity against
dengue-2 virus of the synthetic peptide, called HS-1,
which sequence was previously obtained from the skin
of the anuran Hypsiboas semilineatus. In the citotoxicity
assay, a twofold serial dilution of the peptide, started
at 1mg/mL, were tested on monolayers of VERO cells,
and after that, neutralization assays were performed
to investigate the mechanism of action of the HS-1
peptide. The first neutralization assay was carried out
to determine whether the HS-1 peptide could confer
protection to cell receptors against viral infection, for
this, the peptide was pre-incubated with VERO cells. In
the second neutralization assay the peptide was preincubated with Dengue-2 virus to evaluate the ability of
this peptide to act directly on viral particle. To evaluate
the capacity of the HS-1 peptide to inhibit the virus
adsorption, a third neutralization assay was performed,
in this assay the viruses were incubated with the cells
at 4°C, at this temperature the virus adsorbed on the
cells surface but doesn’t internalize. The results suggest
that the HS-1 peptide acts both in the viral particle
(disrupting the particle or preventing the adsorption)
and in the protection of cell receptors. In subsequent
51
Basic Virology: BV
studies HS-1 peptide will be tested with other serotypes
of dengue virus.
BV167 - Identification Of Transcription
Factors Involved In Il-6 Expression Induced
By The Non Structural Protein 1 Of Dengue
Virus In Hepg2 Cells
Freitas, B.F., Silveira, P.F., Ribeiro, E.M.C., Pimenta, P.F.P.,
Bonjardim, C.A., Silva, B.M.
Morro do Cruzeiro, Ouro Preto, Minas Gerais
Antônio Carlos, 6627, Belo Horizonte, Minas Gerais
3. Fundação Oswaldo Cruz, FIOCRUZ, Augusto de
Lima, 1715, Belo Horizonte, Minas Gerais
4. Rede de pesquisa em virologia do interior do estado
de minas, INTRAVIRUS, Minas Gerais
Dengue virus nonstructural protein 1 (NS1) is a
glycoprotein involved with viral RNA replication
that seems to play several important roles in dengue
pathogenesis. The NS1 association with host cellular
proteins have been reported and suggesting an
involvement of NS1 in signal transduction events and
in modulation of expression of some cellular genes
that could facilitate virus replication or contribute to
pathogenesis. However, very little is known on this issue,
especially regarding NS1 involvement in regulation of
some important signal transduction pathways elicited
by dengue infection, such as NF-κB and MAPK. To
study the effects of NS1 expression on these pathways
we cloned a DENV1 NS1 coding sequence in a pCDNA3
plasmid that was used to generate stable NS1-expressing
cells. We observed, upon FBS treatment, that the NS1
expression increases the nuclear translocation of NFκB p65 protein, which was paralleled by a DNA-Protein
complex formation. Luciferase assays allowed us to
show an increase in NF-κB transcriptional activities in
the NS1-expressing cells when compared to parental
cells. We also observed, by ELISA and qPCR, alteration of
IL-6 expression in NS1-expressing cells. To identify the
mechanism of modulation of IL-6 expression in these
cells we performed luciferase assays to identify the
responsive elements of IL-6 promoter region that could
have an altered function in these cells. Our preliminary
results suggest that the AP1 transcription factor seems
to be the principal element involved in IL-6 expression in
this model. Taken together, these findings may contribute
to the understanding of NS1 biological roles in dengue
pathogenesis. Supported by: UFOP, FAPEMIG, CNPq and
CAPES.
BV170 - Structural And Physicochemical
Analysis Of Hepatitis C Virus Core-
Derived Peptides Involved In The Virus
Nucleocapsid Assembly In Vitro
Braga, V.L.A., Mendes-Silva, A., Albernaz, F.P., Bianconi,
M.L., Peabody, D.S., Silva, J.L., Gomes, A.M.O., Souza,
T.L.F., Oliveira, A.C.
Carlos Chagas Filho, 373, CCS, Bl E, sl 08, Cid Universitária,
RJ, RJ
2. Universidade do Novo México, UNM, Albuquerque,
NM 87131
In the order of 170 million people are infected worldwide
with the Hepatitis C Virus (HCV), which represents a
public health problem. The HCV core protein (HCVCP)
is involved in viral and cellular processes and is
responsible for the interaction with the viral RNA and
capsid assembly. Three regions of the core protein are
specifically important during nucleocapsid assembly:
the amino acids 22-39 (VKFPGGGQIVGGVYLLPR),
50-67
(RKTSERSQPRGRRQPIPK),
and
85-102
(PWPLYGNEGMGWAGWLLSPRG). To better understand
the structural and physicochemical aspects of their
interactions with the RNA and viral envelope during
HCV assembly we used membrane models (micelles and
vesicles), and non specific nucleic acids. The micelles
used so far were sodium dodecyl sulfate, n-octyl-betaD-glucopyranoside,
Hexadecyltrimethylammonium
bromide and n-dodecylphosphocholine, and the vesicles
were composed by sphingomyelin, phosphocholine and
cholesterol. The nucleic acids used were poly (GC) and
p53 consensus, and we followed the interaction process
by fluorescence spectroscopy, circular dichroism and
isothermal titration calorimetry. In the presence of
different micelles, only the peptide 85-102 was able
to adopt a alpha-helix structure as verified by circular
dichroism. Analyses of tryptophan intrinsic fluorescence
and acrylamide quenching reveal that the interaction
between peptide 85-102 and micelles involves a partial
internalization of the tryptophan residue. Calorimetric
measurements reveal different heat profiles for the
interactions of micelles and the different peptides and
showed similar thermodynamics of the interaction
of peptide 50-67 with different DNAs. Fluorescence
polarization data showed that, in the range of
concentrations used, the presence of the peptides does
not prevent the formation of nucleocapsid-like particles
(NLPs) by the interaction between core protein and
nucleic acids. Our data reveal new information that may
assist the understanding of HCVCP regions involved in
the HCV assembly, which is a central target for drugs for
the Hepatitis C treatment.
52
Basic Virology: BV
BV171 - Cellular Localization Analysis Of
The Hepatitis C Virus Core Protein During
Nucleocapsid-Like Particles Assembly
Braga, V.L.A., Mendes-Silva, A., Carvalho, C.A.M., Silva,
J.L., Gomes, A.M.O., Souza, T.L.F., Oliveira, A.C.
RJ, RJ
Hepatitis C virus (HCV) infection is a major cause of
chronic liver disease worldwide, infecting around 3%
of world population. HCV capsid protein (HCVCP)
is involved in several viral and cellular processes,
including the assembly process. This work aims to
gain more information about the cellular localization
and the assembly process of HCV in different cells
models through confocal microscopy and fluorescence
correlation spectroscopy (FCS) and using the HCVCP
fused with the Green Fluorescent Protein (GFP)
(HCVCPGFP). With this mean, we constructed vectors
to express the full-length HCVCPGFP, composed by 191
amino acids (HCVCP191GFP), in HepG2 and Huh7 cells.
Also, we constructed, by deletions of HCVCP191GFP, two
other forms of the HCV core protein, composed by 124
and 179 amino acids, HCVCP124GFP and HCVCP179GFP,
respectively. In HepG2 cells, the data obtained by confocal
microscopy showed that, 24 hours post transfection,
the HCVCP191GFP is placed in the nucleus, more
concentrated in the nucleolus. In Huh7 cells, analysis
of nuclear distribution indicates that HCVCP191GFP is
also located in the nucleus and, interestingly, this protein
seems to be sited on lipid droplets surface. The nuclear
distribution analyses of truncated forms are in progress.
Our data intend to reveal a new approach to understand
the assembly of Hepatitis C virus capsid, which is an
important target for drugs to impair the Hepatitis C
virus replication.
BV175 - Development Of A Molecular Tool
For In Vitro Production Of Ns3 Protease Of
Hepatitis C Virus.
Valentin, E.S., Ramos, J.A., Ürményi, T.P., Tanuri, A.,
Rondinelli, E., Silva, R., Hoffmann, L.
1. Universidade Federal do Rio de Janeiro, Inst de
Biofísica, UFRJ, IBCCF, Av. Carlos Chagas Filho, 373, CCS, bl
G, sl G1050, Ilha do Fundão, RJ, 21941902
2. Inst Nac para Pesquisa Translacional em Saúde e
Ambiente, INCTINPeTAm/CNPq/MCT, Av. Carlos Chagas
Filho, 373, CCS, Ilha do Fundão, RJ, 21941902
3. Instituto Federal de Educação, Ciência e Tecnologia
do RJ, IFRJ, R. Sen. Furtado, 121, Maracanã, Rio de Janeiro RJ, 20270021
Biologia, UFRJ, IB, Av. Carlos Chagas Filho, 373, bloco A, sala
A1-050, Ilha do Fundão, RJ, 21941902
5. Universidade Federal do Rio de Janeiro, Depto
Clínica Médica, UFRJ, Rua Rodolpho Paulo Rocco, 255, Ilha
do Fundão, HUCFF, RJ, 21941913
INTRODUCTION: Hepatitis C is a health problem in Brazil
with 3 million people infected. Only 50% of the treated
patients, with the conventional therapy (pegylated
interferon and ribavirin, PEG-IFN/RBV), achieve success.
Nowadays, other therapeutic targets are being studied,
specially the viral protease inhibitors (PIs). OBJECTIVE:
The aim of this work is to develop a molecular tool for
phenotypic assay. MATERIAL AND METHODS: The
vector pET17b containing NS3 helicase domain and
the accessory protein NS4A was constructed. NS3
protease variants were cloned into this vector through
homologous recombination. In vitro production of the
NS3 protease was performed using transcription and
translation in vitro assay. In cooperation with University
Hospital Clementino Fraga Filho, UFRJ, samples from
patients with chronic hepatitis C were collected at
different times during PEG-INF/RBV treatment. Of the
68 patients with genotype 1 studied in a previous work,
in 3 of them we have identified resistance mutations,
which confer resistance to these viral protease inhibitors.
Serum from these 3 patients was collected and the viral
RNA extracted. Reverse transcription and NS3 PCR
amplification was done for every time point. Each PCR
product was cloned in the vector described above. Clones
were confirmed by sequencing and submitted to in vitro
transcription and translation reactions. NS3 protease
was subsequent characterized using NS3 antibodies
in a Western Blotting. RESULTS: Clones from all three
patients were obtained and confirmed by sequencing.
We are standardizing protein production by in vitro
transcription and translation. CONCLUSIONS: These
in vitro assays will be a tool to phenotypically test the
NS3 protease variant. It is a cell-free technique, which
is less costly and complex and subject to eventual use in
routine laboratories, and it is possible to predict if the
patient will benefit by the PI therapy. Financial Support:
FAPERJ/PPSUS/MS, INCT-INPeTAm/CNPq/MCT, CNPq
and CAPES.
BV179 - Generation And Characterization
Of Stable Clones Of Hepatocytes With
Controlled Expression Of Dengue Virus
Ns1 Protein
Lima-Reis, A.L., Silveira, P.F., Ribeiro, E.M.C., Pimenta,
P.F.P., Bonjardim, C.A., Silva, B.M.
Universitário Morro do Cruzeiro Ouro preto - MG
53
Basic Virology: BV
Antônio Carlos, 6627 Belo Horizonte - MG
3. Fundação Oswaldo Cruz, FIOCRUZ, Av. Augusto de
Lima, 1715 Belo Horizonte - MG
4. Rede de Pesquisa em Virologia do interior do estado
de minas, intravirus, MG
Dengue virus (DENV) is a enveloped virus with a single
positive strand RNA genome of about 11 kilobases,
which encodes 3 structural and 7 nonstructural proteins
including the NS1 protein. NS1 is a highly conserved
48kDa membrane-associated glycoprotein that was
initially described as essential for RNA replication. It
can be found in the cell as a monomer, associated with
cellular organelle membranes and co-localizing with
the viral replication complex, and as a heterodimer in
a membrane GPI-anchored form, colocalizing with lipid
rafts. Its association with various organelles and cellular
proteins involved in signal transduction pathways
suggest thatNS1 could play an important role in dengue
pathogenesis. Data obtained by our group, by using liver
cells expressing NS1 in a constitutive form, showed that
NS1 changes the activation profile of MAP kinases and
NF-kB, as well as the profile of expression of interleukin
IL-6 in liver cells. To better understand this role of NS1
in intracellular signaling pathways modulation, we
are generating stable HepG2 cells expressing NS1 in a
controlled manner. For this, we cloned the DENV1 NS1
coding sequence into pMEP4, an eukaryotic-expression
vector that express inserted genes in response to
addition of metals in the culture medium. HepG2 cells
were calcium phosphate transfected and then ring
cloned after selection with Geneticin. Our first qPCR
analysis showed a controlled accumulation of NS1 mRNA
after induction with cadmium chloride. In addition, we
observed an increase of NF-kB transcriptional activity
in cells induced to express NS1 protein, corroborating
our previous results by using stable NS1-expressing
cells. Now we are analyzing the NS1 expression by
western blot and immunofluorescence microscopy. Next
we will analyze the effects of NS1 expression over viral
multiplication. The generation and characterization of
these clones will be useful to identify some molecular
mechanisms of usurpation of the cellular machinery and
subversion of the immune system used by Dengue virus,
such as modulation of other signaling pathways and
other genes involved in the pathogenesis of dengue.
BV187 - Effect Of The P34 Peptide Against
Feline Herpesvirus Type-1 In Vitro
Silva, S.D., Corrêa, R.A., Castro, C.C., Fernandes, M.H.V.,
Lima, M., Fischer, G., Vargas, G.D., Motta, A.S., Hübner,
S.O.
1. universidade Federal do Rio Grande do Sul, UFRGS,
354
2. Universidade Federal de Pelotas, UFPel, Caixa Postal
Herpesviruses are cosmopolite agents causing several
infections to humans and animals, especially in
immunocompromised individuals. Since their discovery,
the antimicrobial peptides receive special attention
as an important therapeutic alternative in the field of
prevention and treatment of infections against a large
number of microorganisms. The P34 antimicrobial
peptide is produced by a species of Bacillus isolated from
the intestinal contents of the fish fish Piau-com-pinta
(Leporinus sp.) in the Amazon basin, and its inhibitory
activity was detected against gram positive and gram
negative bacteria, besides antiviral action against
bovine herpesvirus and equine arteritis virus (EAV),
according to recent studies from our research group.
Aiming to evaluate the antiviral effect of P34 peptide
against feline herpesvirus type-1 (FHV-1), virus titration
was performed in triplicate on confluent CRFK cell
monolayers in the presence or absence of P34 peptide.
There was significant reduction on virus titer, resulting
in inhibition of 94,4%. Tests were also performed to
evaluate whether P34 has a virucidal effect on FHV1 by incubation in the presence or absence of peptide.
After 6 hours virus infectivity was analyzed by virus
titrations. There was no significant reduction of the
title of FHV-1 in the presence of P34, unlike to observed
with EAV. The results demonstrate that P34 peptide has
a diverse activity, with antiviral action against to FHV-1
and virucidal action directed to EAV, although both are
enveloped. Given the promising results, further studies
are being conducted to evaluate the potential use of P34
peptide in vivo.
BV191 - Inhibition Of Hepatitis C Virus
Replication By Dicer Substrate Rna
Carneiro, B.M., Braga, A.C.S., Batista, M.N., Harris, M.,
Rahal, P.
1. University of Leeds, Uni Leeds, University of Leeds,
Woodhouse Lane, Leeds, UK
2. IBILCE - Universidade Estadual Paulista, IBILCE/
UNESP, Rua Cristovão Colombo, 2265 - São José do Rio Preto/
SP
Hepatitis C virus (HCV) frequently establishes persistent
infections in the liver, leading to the development of
chronic hepatitis, and, potentially, to liver cirrhosis and
hepatocellular carcinoma at later stages. No vaccine
is available for HCV and the current treatment, which
consists of administering pegylated interferon-α and
ribavirin, has limited efficacy against certain HCV
genotypes, and also produces significant adverse
effects. The objective of this study was to test the
54
Basic Virology: BV
ability of five Dicer substrate RNAs (DsiRNA) to inhibit
HCV replication. DsiRNA molecules were designed to
target five distinct regions of the HCV genome – 5’ UTR
and coding regions for NS3, NS4B, NS5A, NS5B. These
molecules were transfected into Huh7.5 cells that were
stably harboring an HCV subgenomic replicon expressing
a firefly luciferase/neoR reporter (pSGR-FEO-JFH1)
and tested on HCVcc-infected cells. All of the DsiRNAs
inhibited HCV replication using either the subgenomic
system or HCVcc-infected cells. DsiRNAs inhibited the
replication of subgenomic replicon in 90% compared to
the negative control. Huh7.5-infected cells when treated
with dicer substrate RNA reached almost the same level
of inhibition of subgenomic system. When DsiRNAs
were transfected before infection with HCVcc, inhibition
levels reached 99.5%. Also, DsiRNAs were tested for 21
days to check the selection of resistant clones. After this
time, only few colonies were observed with some of the
DsiRNAs tested. DsiRNA has been found to be a more
potent molecule than canonical 21 nt siRNAs for the
inhibition of HCV replication. It has also been found to
exhibit low levels of selection of resistant clones in vitro.
New studies are necessary on in vivo models, and better
delivery methods are needed. Thus, DsiRNA molecules
may be an option for treatment of chronically infected
HCV patients in the future. Financial suport: FAPESP/
CAPES
BV192 - Delivery Of Shrna Molecules By
Lentivirus Vectors For Treatment Of
Hepatitis C Virus In Vitro
Carneiro, B.M., Braga, A.C.S., Batista, M.N., Harris, M.,
Rahal, P.
1. IBILCE - Universidade Estadual Paulista, IBILCE/
UNESP, Rua Cristovão Colombro, 2265 - São José do Rio
Preto/SP
2. University of Leeds, Uni Leeds, University of Leeds,
Woodhouse Lane, Leeds, UK
Chronic Hepatitis C virus (HCV) infection affects 2.2% of
the world’s population and is known to be the leading
factor necessitating liver transplantation in patients in
developed countries. There is no vaccine available and
current treatment has limited efficacy and also produces
significant adverse effects. Molecular therapies using
RNAi pathway has demonstrated to be highly efficient on
inhibition of HCV in vitro. However, RNAses present in
human or animal serum easily degrade RNAi molecules.
Therefore, new delivery methods for siRNAs or shRNA
are needed. The objective of this study was to develop
a viral vector capable to infect HCV positive cells and
delivery a shRNA molecule designed to inhibit virus
replication. Four shRNA sequences (one negative control
and three directed to virus genome) were cloned on a
self-inactivating (SIN) lentiviral vector containing a CMV
promoter. The shRNA target were 5’UTR (2 molecules)
and NS5A coding sequences of HCV genome. HEK 293T
cells were transfected using PEI with the following
plasmids DNA: envelope plasmid (pRSV-REV harboring
the gene encoding VSV-G), the packaging plasmid (pCAGHIVgp) and CMV-shRNA-eGFP plasmid. Supernatant
was harvested 48h and 72h post-transfection, briefly
centrifuged, and used to infect Huh7.5 cells stable
expressing HCV subgenomic replicon containing a
firefly luciferase gene reporter (SGR-JFH1-FEO). Three
days post-infection, cells were lysed and luciferase
levels read on a plate reader. Results shown that HCV
replication could be knocked down by 99% (relative
to negative control) by infection with lentiviral vectors.
In vivo studies are still necessary, therefore, lentiviral
cell delivery of shRNAs directed to HCV genome has
demonstrated to be promising tool for HCV therapy.
Financial support: FAPESP/CAPES
BV193 - Inhibition Of Hcv Using Sirna
Targeted To The Virus And Heat Shock
Proteins
Braga, A.C.S., Carneiro, B.M., Batista, M.N., Rahal, P.
Universidade Estadual Paulista, UNESP, Rua Cristóvão
Colombo, 2265, CEP 15054-000 - São José do Rio Preto, SP
Hepatitis C is a consequence of infection through hepatitis
C virus (HCV) and it is estimated that approximately
170 million people are chronically infected worldwide.
Studies have shown the existence of interactions between
viral and host proteins during the HCV replication cycle,
and these interactions may be used for the development
of new therapies against hepatitis C. Heat shock proteins
(HSPs) consist of cellular proteins that interact with
HCV proteins, and the inhibition of these host proteins
could reduce viral replication. In this study we inhibit
the cellular proteins Hsp90 and Hsp27 alone and in
combination with the inhibition of viral regions 5’UTR,
NS3 and NS5A using the RNAi pathway. We used a stable
culture Huh7 expressing subgenomic HCV replicon
SGR-JFH1 for transfection of siRNAs molecules. After
72 hours of incubation the culture was analyzed by
Western blot and qPCR. All siRNA molecules directed to
viral genome showed inhibition of viral replication and
the best response was obtained by inhibiting the 5’UTR
region. Inhibition of Hsp27 gene showed no reduction
in levels of viral replication, but the inhibition of Hsp90
cellular proteins, successfully reduced virus replication.
The use of this molecule in combination with siRNA
5’UTR resulted in viral replication inhibition. In a longterm treatment, siRNA targeting the 5’UTR region was
found to be very efficient in reducing the HCV, and
siRNA targeting Hsp90 led to cell death, a result which
55
Basic Virology: BV
affirms the important role of this protein in cell survival.
Finally, this study suggests that the combination therapy
of siRNAs can be an effective alternative for treating
hepatitis C in patients with HCC, since the reduction of
Hsp90 expression was successful for both tumor and
HCV suppression.
BV199 - Tracing The History Of Denv-2 In The
Americas
Mir, D., Romero, H., Bello, G.
1. Universidad de la República, Montevideo, Uruguay,
UdelaR, Iguá 4225 Esq. Mataojo C.P. 11400 Montevideo
2. Instituto Oswaldo Cruz, Rio de Janeiro, Brazil,
FIOCRUZ, Av. Brasil, 4365 - Manguinhos, Rio de Janeiro CEP: 21040-360
A common observation in phylogenetic studies of dengue
virus (DENV) is that of lineage replacement. One of the
best documented replacement event occurred in the
1980s when the Asian-American (AS-AM) genotype of
DENV-2 was introduced for the first time in the Americas,
displacing the local American (AM) genotype. The DENV2 AS-AM genotype has been continuously evolving in the
Americas since its introduction, leading to several waves
of dengue epidemics and the emergence of different
viral lineages in the region. In this study, we investigated
the spatiotemporal dissemination pattern of the DENV-2
at a regional level and identify those countries and viral
lineages that are most likely to disseminate and seed
new epidemics. To address these questions, we apply
a full probabilistic model within a Bayesian framework
that utilizes both the temporal and spatial information
of the sampled sequences to a comprehensive data set
of 341 DENV-2 E gene sequences of the AS-AM genotype
isolated from 28 different American countries over a
period of 29 years (1983 to 2011). Our phylogenetic
analysis reveals that genetic diversity of DENV-2 AS-AM
genotype circulating in the Americas can be organized in
four major genetically distinct lineages that arise, spread
and die out with different dynamics across regions. The
spatial diffusion pattern obtained indicates a primary
spread axis between the Greater and the Lesser Antilles
and secondary axes linking the Caribbean with both
South and Central America. According to this model,
the Caribbean acts as a reservoir and source of DENV2 lineages that are subsequently disseminated to
continental regions which act as sinks. Whilst Suriname
and Guyana seems to represent important transit points
for DENV-2 dissemination from the Lesser Antilles to
South America, Venezuela and Brazil were the main
secondary hubs of dissemination to other South American
countries and Nicaragua was the most important hub of
DENV-2 spreading within Central America.
BV200 - Possible Model For Overexpression
Of Anxa1 In Cells Positives For Hpv16
Marilia, F.C., Laura, S., Villa, L.L., Vassallo, J., Rahal, P.
1. Instituto do Câncer do Estado de São Paulo, ICESP,
Av. Arnaldo , 251, 8° andar- São Paulo-SP
UNESP-IBILCE, Rua Cristóvão Colombo, 2265
3. Universidade de São Paulo, USP, Av. Dr. Arnaldo,
255
4. Hospital A.C. Camargo, Rua Professor Antônio
Prudente, 211
Overexpression of ANXA1 was demonstrated in penile
squamous cell carcinoma samples and its protein
expression is strongly associated with high risk HPV
infection. It is known that ANXA1 and p53 are substrates
for the E6AP-mediated ubiquitylation. In one hypothetical
model, the protein E6 from HPV16 redirects E6AP away
from annexin A1, increasing the stability of annexin A1,
and thereby contributing to viral pathogenesis. To test
this hypothesis, it was evaluated the expression of p53
and ANXA1 proteins in HPV16 positive cell lines (SiHa,
CasKi and HF698), HPV negative cell line (C33) and in
keratinocytes transfected with plasmids containing the
oncogenes E6, E7 and E6/E7 from HPV16. In addition,
it was evaluated if the E6 transcriptional silencing by
dsiRNA would result in any change in the p53 and ANXA1
mRNA or protein levels. We observed that ANXA1 was
overexpressed in HPV positive cells compared to HPV
negative cells. Besides, in the keratinocytes expressing
E6 protein, the expression of p53 protein decreased
and the expression of ANXA1 protein increased. In
the keratinocytes expressing only E7 protein, it was
not observed difference in the expression of p53 and
ANXA1 proteins. In SiHa transfected with dsiRNA
HPV16 E6, the level of E6 mRNA decreased compared
to SiHa transfected with scrambled dsiRNA but there
was no difference in the mRNAs levels of ANXA1 and
p53 between cells expressing and lacking HPV16 E6.
However, expression of p53 protein increased in cells
transfected with dsiRNA HPV16 E6 compared to cells
transfected with scrambled dsiRNA and the expression
of ANXA1 protein diminished in cells transfected with
dsiRNA HPV16 E6 compared to cells transfected with
scrambled dsiRNA. So, probably, in cells HPV16 positive
the protein E6 from HPV16 redirect E6AP away from
annexin A1 being that E6–E6AP complex functions as an
E3 ubiquitin ligase in the ubiquitylation and degradation
of p53. Financial support: FAPESP
BV201 - Expression Of Innate Immune Genes
In Human Cells Infected By Bunyavirus
56
Basic Virology: BV
Ferreira, J.G.G., Batista, I.C.A., Pereira, Patrícia V.B.,
Oliveira, C.C., Oliveira, D.B., Almeida, G.M.F., Oliveira,
J.G., Ferreira, P.C.P., Calzavara-Silva, C.E.
Antônio Carlos, 6627, Pampulha - Belo Horizonte - MG,
31270-901
2. Centro de Pesquisas René Rachou, CPqRR/
FIOCRUZ, Avenida Augusto de Lima, 1715, Barro Preto Belo Horizonte - MG 30190-002
The virulence of the pathogenic Bunyaviruses is
directly linked to the roles of viral virulence factors
and their capacity to counteract the host pathways.
These viruses use cellular proteins to promote their
own replication/transcription and,in response, host
induces transcriptional reprogramming to activate
antiviral affects.In order to verify the early steps of Apeu
virus (APEV) and Thayna virus (THAV) induced innate
immune system activation, we performed TaqMan-based
qPCR assays using cDNA obtained from mRNA extracted
from A549 cells after 4hs or 8hs of infection with APEV,
TAHVand VSVvirus (ssRNAcontrol virus), besides a
mock control. We verified that APEV is recognized
by TLR9, differently of TAHV, which followsVSV due
to TLR7 recognition. However, APEV follows VSV
decreasing TICAM1 expression after 4hs of infection.It is
also possible to note an early induction of TLR pathway
by VSV when compared to APEV and TAHV. TAHV and
mainly VSV, but no APEV, increased expression of IRF5,
notably after 8hs of infection. All the viruses were able to
increase the expression of TLR3, IRF3 and 7. TRAF3 was
slightly more expressed (4hs and 8hs) in cells infected
by APEV, but not by VSV and TAHV. The TICAM and IRF3
expression levels were normalized after 8hs of infection.
We also observed and 8-fold increase of IRF5 expression
after 8hs of incubation with VSV. Also, VSV inducedIFNb1
expression just after 4hs of infection, meanwhile TAHV
induced IFNβ increased levels only after 8hs of infection.
At this time,IFNβ expression levels in VSV-infected
cells started to diminish,but remained higher than the
other viruses. Finally, APEV, even after 8hs of infection,
was unable to induce a significant increase of IFNb1
expression. We concluded that these viruses are able to
triggers different recognition and intracellular signaling
pathways leading to differences in the immune responses
and, consequently, determining the pathogenic potential
of each tested viruses.
BV204 - Screening Of 5,200 Natural Extracts
And Identification Of Several Compounds
With Antiviral Activity Against Yellow
Fever Virus
Carvalho, A.G.O., Kassar, T.C., Bertani, G.R., Gil, L.H.V.G.
1. Aggeu Magalhães Research Center, Oswaldo Cruz
Foundation , CPqAM/Fiocruz, Av. Professor Moraes Rego, s/n
- Campus da UFPE - Cidade Universitária | Recife/PE
2. Federal University of Pernambuco, UFPE, Av. Prof.
Moraes Rego, 1235 - Cidade Universitária, Recife - PE - CEP:
50670-901
The yellow fever virus, prototype flavivirus genus, causes
a spectrum of illness ranging from inapparent infection
to acute hemorrhagic disease that can be fatal. The only
ways to prevent yellow fever virus are the vaccination
and education of the population in the prevention of
the disease. Antiviral drugs are not available to the
population and about 200,000 cases of yellow fever are
estimated per year in the world. Traditional methods for
antiviral screening are laborious, time-consuming and
difficult to use in high-throughput assays. In this study,
we realize a high-throughput screening of 5,200 extracts
from a library comprising 6,000 different natural
substrates. This screening was performed by using a
BHK-21 cell line expressing the YFV bicistronic replicon
(BHK-21-repYFV17D-LucNeoIres), which contains
the firefly luciferase reporter gene and neomycin
phosphotransferase gene. The evaluation of the antiviral
activity of the substrate can be made based on the
measurement of the activity of the firefly luciferase
reporter gene responding in a concentration-dependent
manner. Ninety-four extracts showed an inhibition of
50% or more of replicon replication based on reporter
gene expression, at concentrations of 20 and 40 µg/
mL. The antiviral activity of screened substrates were
confirmed in cell culture infected with a YFV expressing
Gaussia luciferase reporter gene (YFV-GLuc). Of the 71
extracts tested with the recombinant virus, 59 extracts
showed ability to reduce the reporter virus replication
to values above 50%. Therefore, the use of YFV replicon
cell line enables successful high-throughput screening
of natural compounds with potential antiviral activity
against yellow fever virus.
BV237 - Autophagy Induction During Cotia
Virus Infection
Afonso, P.P., Attias, M., Damaso, C.
Instituto de Biofísica Carlos Chagas Filho, IBCCFUFRJ, Av. Carlos Chagas Filho, 373
Cotia virus SPAn 232 (COTV) is a poxvirus isolated in
1961 from sentinel mice in Cotia, Brazil. Our group has
recently characterized COTV as a new poxvirus genus
and we are currently interested in studying new aspects
of virus-host cell interactions. In some cell lines, COTV
induced classical features of autophagy. By transmission
electron microscopy, we observed the presence of
myelinic figures in the cytoplasm of COTV-infected cells
57
Basic Virology: BV
which resemble autophagosomes in different maturation
stages. Some of them are next to immature and mature
virus particles and others enclose mature virus particles.
These structures accumulate during late stages of the
virus cycle and are not visualized in non-infected cells.
Analysis by immunofluorescence assay reveals that the
autophagic protein LC3 is present in a punctuate pattern
in COTV-infected cells and this pattern is only observed at
the post-replicative stage of the virus cycle. The number
of cells showing punctuate LC3 is similar between in cells
infected with COTV and in starved or rapamycin-treated
cells. LC3 colocalized with the autophagic cargo-binding
protein p62 and also colocalized with LAMP-2 (lysosome
pattern marker) indicating that autophagosomes are
able to mature during infection. The autophagy inhibitor
3-MA is not able to reduce the number of infected cells
showing a LC3 punctate pattern. Western blot analysis
shows a LC3 conversion (LC3-I to LC3-II) early and late
during infection, which is enhanced in the presence
of autophagic flux inhibitors, suggesting that COTV
infection induces autophagic flux. Silencing of Beclin 1
or Atg7 expression mediated by specific siRNA did not
prevent LC3 conversion nor affected viral titres, but
triggered a relocalization of LC3, which accumulated at
the perinuclear region. Support: CNPq, Faperj, INPeTAm
BV240 - Molecular Investigation Of
Flaviviruses In Culicidae In Northern
Minas Gerais, Brazil.
Rezende, I.M., Carvalho, C.M., Lima, G.A.D., Silva,
A.C., Rodrigues, R.A., Silva, M.C., Kroon, E.G., Borges,
MA.G.Z., Drumond, B.P.
José Lourenço Kelmer, s/n - Campus Universitário Bairro São
Pedro
2. Universidade Federal De Minas Gerais, UFMG, Av.
Antônio Carlos, 6627, Pampulha Belo Horizonte - MG
3. Universidade Estadual de Montes Claros,
UNIMONTES, Campus Universitário Professor Darcy Ribeiro
- Vila Mauricéia - Montes Claros
4. Grupo de Pesquisa Ecologia de Vírus , ECOVIR,
Gerais, INTRAVIRUS
The genus Flavivirus (Flaviviridade) contains many
important arboviruses of public health importance
such as Yellow fever virus (YFV), Dengue virus (DENV),
Rocio virus (ROCV). These viruses have been detected
in Brazil and are etiological agents of febril diseases,
hemorrhagic fever and encephalitis. YFV is transmitted
by Aedes sp. and Haemagogus mosquitoes, DENV is
transmitted by species from Aedes genus, mainly A.
aegypti, Psorophora ferox and A. scapularis were already
demosntrated to be susceptible vectors to ROCV. The
aim of this work was to perform a prospective study
of Culicidae naturally infected with DENV, YFV and
ROCV, in Montes Claros-MG. Mosquitoes were collected
at UNIMONTES-MG, and properly identified. Pools of
mosquitoes (up to 20 individues) were macerated and
total RNA was extracted. Total RNA was used for cDNA
synthesis followed by nested-PCR to detect Flavivirus.
A total of 4210 mosquitoes were collected, including A.
scapularis, A. aegypti, A. albopictus, Psorophora sp. and
Limatus sp. Initially, 82 pools were tested for DENV. One
pool of A. aegypti was positive for DENV 1. A total of 41
pools (including A. scapularis, A. aegypti, A. albopictus,
Psorophora sp. and Limatus sp.) were tested for YFV
and ROCV. All pools were negative for YFV. One amplicon
with the expected size for ROCV was detected in one
pool of A. scapularis. The others pools are being tested
for DENV, YFV and ROCV and the obtained amplicons
are going to be sequenced to confirm de the results.
Among the Culicidae, A. scapularis is a widespread and
its epidemiological competence and capacity to transmit
various agents of human and animal diseases have long
been recognized. Although there is no report of DENV
infecting A. scapularis, it is known that different species
of Aedes sp are related to DENV transmission what
should be further investigated. Moreover, our results
indicate a possible occurrence of ROCV in Northern
Minas Gerais. Financial support: FAPEMIG, CNPq, CAPES,
UFJF, PROPESQ/UFJF.
BV247 - The In Vitro Antiherpetic Activity
Of A Polysaccharide Of Green Seaweed
(Enteromorpha Sp.)
Lopes, N., Faccin-Galhardi, L.C., Espada, S.F., Godoi,
A.M., Ray, B., Linhares, R.E.C., Nozawa, C.
Celso Garcia Cid, Pr 445 Km 380, CEP 86.057-970, Londrina
- PR
2. University of Burdwan, , Bardhaman, West Bengal,
India
The green algae, members of the family Ulvaceae, are
a rich source of polysaccharides referred to as ulvans.
These high molecular weight compounds have several
biological and pharmacological activities, determined by
their chemical structure, including the degree of sulfation,
molecular weight, sugar constituent, spatial conformation
and dynamic stereochemistry. The diseases caused by
herpes simplex virus (HSV) represent a medical and
social problem due to their communicability, recurrence
and the establishment of latent infection. Therefore, the
search for new antiherpetic compounds, particularly,
makes it extremely challenging. The aim of this study is
to investigate the antiviral activity of a polysaccharide of
58
Basic Virology: BV
green seaweed (Enteromorpha sp.) to HSV-1 in HEp-2 cell
cultures. The 50% cytotoxic concentration (CC50) of the
substance was 1000 µg/ml, determined by MTT assay.
The antiviral action was assayed by plaque reduction
assay, by the use of the following protocols: the time-ofaddition assay (-3h, 0, +1h, +2h), the inhibition of virus
adsorption and penetration, and the virucidal effect. The
compound showed a great activity at time 0h with the
50% inhibitory concentration (IC50) of 28.25 µg/ml and
the selectivity index of 35.4. It was also observed that the
inhibitory effect was maintained until 2h post-treatment,
with 100% of viral inhibition at the concentration of 100
µg/ml. Thus, the viral inhibition caused by this substance
most likely occurs in the initial stages of viral replication,
but, after the entry of the virus into the cell, since no
effect was observed in the inhibition of adsorption and
penetration assays and virucidal test. The pre-treatment
has showed no inhibition even when the substance was
added 3h before the infection at concentrations eight
times greater than that of the IC50. Further studies will
be conducted in order to better clarify at what point of
the HSV-1 replication Enteromorpha sp. polysaccharide
may act. Financial support: CAPES/CNPq/Fundação
Araucária/UEL
BV266 - Investigation Of Stop Codons In
Hepatitis C Virus Ns5a Protein
Campos, G.R.F., Rahal, P., Bittar, C.
Instituto de Biociências, Letras e Ciências Exatas, Ibilce/
UNESP, Rua Cristóvão Colombo, 2265, Jardim Nazareth
The hepatitis C virus (HCV) is a single strand positive
RNA virus member of the Flaviviridae family. The
infection leads to liver inflammation which may cause
liver cirrhosis, fibrosis and hepatocellular carcinoma.
The treatment is based on interferon and ribavirin, but
in severe cases, the liver transplant is needed. Due to the
RNA genome, HCV has a high mutational rate resulting
in high variability. Among its proteins, the NS5A shows
to be important to act in the resistance of the virus
to interferon as well as in the apoptotic processes of
damaged cells, with a possible role in the hepatocellular
carcinogenesis. Recent studies reported mutations that
give rise to stop codons in the NS5A protein region
recurrent in different patients. The presence of these
stop codons would lead to early termination of the
polyprotein preventing the translation of complete NS5A
and as a consequence the following protein, the viral RNA
dependent RNA polymerase NS5B. The aim of this study
is to evaluate in cell culture the impact of the presence
of the TGA codon in the position 111 (originally TGG) of
the NS5A protein in its translation. We performed a site
directed mutation in the vector CMV_SGR_JFH1_GFP5A
that contains JFH-1 subgenomic fragment, generating
the codon TGA. This vector has a GFP downstream site
111 allowing to verify whether the translation is being
stopped. The mutation was confirmed by sequencing
and high concentration of plasmid was produced
by Maxiprep. Wild type and mutated vectors were
transfected in human hepatocellular carcinoma cell line
HepG2 and cells were cultured for 48h. The expression
of GFP was analyzed under fluorescence microscope.
The results show that GFP expression is observed in cells
transfected with both, wild type and mutated vector,
suggesting the expression of NS5A protein is not being
terminated. HepG2 cells stably expressing wild type and
mutated vectors are being established to allow further
experiments to better understand this process. Financial
Support: FAPESP, Processo nº 2013/02856-0
BV269 - The Equine Herpesvirus Infection
Depends Of Erk1/2 Mapk Signaling Pathway
For Biossinthesis
Fernandes, M.J.B., Codignoto, P.S.C., Patrício, G.F.,
Simoni, I.C., Conceição, A.O.
1. Instituto Biológico, CPDSA/IB, Av. Cons. Rodrigues
Alves, 1252, São Paulo, SP, Brasil
2. Universidade Estadual de Santa Cruz, Ilhéus, UESC
The mitogen activated protein kinases/extracellular
signal-regulated kinase 1/2 (MAPK/Erk1/2) cellular
signaling pathway has been described as an important
component to virus entry and biosynthesis. However,
the involvement of the ERK1/2 signaling pathway in
the equine herpesvirus type 1 (EHV-1) infection is not
known. The aim of this study was to verify if the infection
of Vero cells by EHV-1 was dependent of MAPK/Erk1/2
signaling pathway in vitro. Inhibition of Erk1/2 signaling
pathway and titer analysis of strain A4/72 of EHV-1 in
Vero cells were used. Cells were serum starved for 24
hours and the Erk1/2 pathway was suppressed by the
selective inhibitor U0126 for one hour. To observe the
interference of MAPK inhibition on viral biosynthesis,
cells were treated with 100 TCDI50 of virus and incubated
for 5h. The cells were then frozen and thawed to titer the
viruses. The virus titer showed 0.7-log reduction. The
results showed evidence that the EHV-1 is dependent on
the activation of this MAPK/Erk1/2 signaling pathway
for an efficient replication. Further studies are needed
to establish which steps of the virus cycle the ERK1/2
participates as well as the state of activation of ERK1/2
proteins. Financial support: FAPESB
BV278 - Inhibition Of Yellow Fever Virus
Entry By Lactoferrin
Ferreira, M.V.M., Mendes, Y.S., Alves, N.S., Carvalho,
C.A.M., Campos, S.P.C., Schwarcz, W.D., Silva, J.L.,
Gonçalves, R.B., Gomes, A.M.O., Oliveira, A.C.
59
Basic Virology: BV
Av. Carlos Chagas Filho 373, CCS bloco E - sala 8, Cidade
Universitária - RJ
2. Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil
4.365, Manguinhos, Pavilhão Rocha Lima, Rio de Janeiro - RJ
3. Universidade Federal do Estado do Rio de Janeiro,
UNIRIO, Rua Frei Caneca 94, Centro, 3º andar, Rio de Janeiro
- RJ
The Yellow Fever Virus (YFV) is an endemic flavivirus in
tropical regions, particularly Africa and South America,
causing an acute febrile disease of major public health
impact. Although a large percentage of patients develops
spontaneous cure, approximately 60% of patients who
progress to more severe cases die within two weeks.
Due to the high morbidity associated with the absence
of specific treatments for this infection, searching for
antiviral drugs became a target of medical importance.
Lactoferrin, a glycoprotein present in various secretions
such as milk, tears and saliva, shows several biological
functions, including modulation of the immune
response and defense against numerous pathogens
such as different viruses of medical and socioeconomic
importance. The main goal here is to evaluate the
antiviral activity of bovine lactoferrin (bLf) against YFV
infection and to elucidate the step(s) where bLf would
be acting in the viral cycle. Our results show that bLf has
a viral inhibitory activity of approximately 80% without
causing cytotoxic effects in Vero cells, our cellular model.
To investigate which steps and mechanisms are involved
in this inhibition, cells were pre-treated or incubated
with bLf only in the viral adsorption step, and our data
indicate that infection is inhibited by about 60% and
70%, respectively. In contrast, the presence of bLf only
after viral adsorption and internalization steps leads
to an inhibition of less than 10%. Furthermore, when
assessing the ability of bLf to bind to viral particles, we
observed no significant changes in viral titer. Together,
our results suggest that bLf has antiviral activity, acting
mainly on the early events of the infection cycle of YFV
by binding to the cell surface and possibly hampering
the virus-cell interaction. The present study can help in
the better understanding of the cycle and formulation of
novel strategies for the development of effective antiviral
drugs against different flaviviruses. Financial support:
CNPq/CAPES/FAPERJ/PRONEX/INBEB
BV286
Quercetin
And
Quercetin
3-O-Glycosides
From
Bauhinia
Longifolia(Bong.)Steud.With Anti-Mayaro
Virus Activity
Yamamoto, K.A., Dos Santos, A.E., Kuster, R.M., Salles,
T.S., Meneses, M.D.F., Da Silva, M.R.S., Ferreira, D.F.
Instituto de Microbiologia - Departamento de Virologia,
Cidade Universitária, RJ
Instituto de Química - Departamento de Bioquímica
3. Universidade Federal do Rio de Janeiro, UFRJ, Núcleo
de Pesquisas em Produtos Naturais - NPPN
Mayaro virus (MAYV) is an arborivus (Togaviridae
family, Alphavirus genus), endemic in South America
and responsible for sporadic outbreaks of Mayaro
fever in rural communities of Brazil and Bolivia.
In this work, the flavonol quercetin along with its
3-O-glycosides guayjaverin, quercitrin, and a mixture
(2:1) of isoquercitrin and hyperin were isolated from the
methanol extract of the leaves of Brazilian shrub Bauhinia
longifolia. These flavonoids and the AcOEt and n-BuOH
fractions containing them were also investigated for their
in vitro antiviral activity against MAYV replication in
Vero cells. Quercetin was the most active among the pure
flavonoids, with selectivity index (SI) of 94 (IC50=10.3
μg/ml). AcOEt and n-BuOH fractions demonstrated the
highest activity among all the samples with SI of 623
(IC50=5.5) and 208 (IC50=2.8) respectively. At 25 µg/
mL quercetin, AcOEt and n-BuOH fractions were able
to inhibit MAYV in a dose-dependent manner by more
than 90 %, a strong inhibitory effect on viral replication
when compared to ribavirin (SI=8). Furthermore, MAYV
replication was inhibited about 84% by the flavonoid
isomeric mixture (isoquercitrin and hyperin) at 100 µg/
mL. Guayjaverin and quercitrin did not show significant
antiviral effect up to maximum tested concentration. Our
results showed B. longifoliaas as an interesting source
of quercetin derivatives with antiviral activity against an
alphavirus replication and that the presence of different
sugars decreased their antiviral activity. Although
quercetin and derivatives are fairly common in the plant
kingdom, this is the first report on the anti-Alphavirus
activity for these flavonoids. To date, there are no
licensed antiviral drugs for most mosquito transmitted
viruses. Therefore, the potential activity of quercetin,
AcOEt and n-BuOH against our alphavirus model is a
very important step in the search for new drugs against
these important pathogens. Financial Support: CNPq,
CAPES, FAPERJ, INBEB
BV306 - Human Respiratory Syncytial Virus
N, P And M Protein Interactions In Hek-293t
Cells
Oliveira, A.P., Simabuco, F.M., Tamura, R.E., Guerrero,
M.C., Ribeiro, P.G.G., Libermann, T.A., Zerbini, L.F.,
Ventura, A.M.
1. Universidade de São Paulo, USP, Cidade Universidade
60
Basic Virology: BV
2. Universidade de Campinas, UNICAMP
3. Instituto do Câncer do Estado de São Paulo, ICESP
4. Harvard Medical School, BIDMC
5. International Centre Genetic Engineering and
Biotechnology, ICGEB
Characterization of Human Respiratory Syncytial Virus
(HRSV) protein interactions with host cell components is
crucial to devise antiviral strategies. Viral nucleoprotein,
phosphoprotein and matrix protein genes were
optimized for human codon usage and cloned into
expression vectors. HEK-293T cells were transfected with
these vectors, viral proteins were immunoprecipitated,
and co-immunoprecipitated cellular proteins were
identified through mass spectrometry. Cell proteins
identified with higher confidence scores were probed in
the immunoprecipitation using specific antibodies. The
results indicate that nucleoprotein interacts with arginine
methyl-transferase, methylosome protein and Hsp70.
Phosphoprotein interacts with Hsp70 and tropomysin,
and matrix with tropomysin and nucleophosmin.
Additionally, we performed immunoprecipitation of
these cellular proteins in cells infected with HRSV,
followed by detection of co-immunoprecipitated viral
proteins. The results indicate that these interactions also
occur in the context of viral infection, and their potential
contribution for a HRSV replication model is discussed.
Financial Support: FAPESP/USP/CNPq
BV310 - Callithrix Penicillata: A Possible
Experimental Model For The Study Of
Dengue Virus
Ferreira, M.S., Castro, P.H.G., Silva, G.A., Rodrigues, S.G.,
Nunes, B.T.D., Domingues, R.A.B., Vasconcelos, P.F.C.
1. Evandro Chagas Institute, IEC
2. National Primate Center, CENP
3. Metropolitan College of Amazon, FAMAZ
Despite many efforts over the past years to find an
experimental model to study the pathogenesis of dengue
Virus (DENV), this remains a challenge. To investigate
the levels of viremia and the immune response of IgM by
ELISA and of hemagglutination inhibition (HI) antibodies
followings in infections caused by DENV-3 (secondary
infection) in animals; two viral suspensions (one of the
DENV-2 and the other DENV-3) were prepared from virus
isolates of patients who died of Dengue Hemorrhagic
Fever and Dengue Shock Syndrome (DHF/DSS). Three
animals were experimentally infected with the DENV-2
suspension (infective dose: - 4.47 × 10 4 PFU / ml) and
after one year and seven months same were infected with
DENV-3 (infective dose: 3.23 × 10 3 PFU / ml). On days
3, 4 and 10 post infection (d.p.i.), animals were bled to
obtain blood, serum and euthanized to collect visceras.
RNA extraction of the samples were carried out using
the RNA assay Minikit (QIAGEN), and RT-PCR performed
according to a previously published protocol. For the
detection of IgM antibodies and HI, the IgM-ELISA assay
and HI test were used respectively. For blood count the
automated hematology MS4 + was used. For coagulation
the CLOT timer-laser sensor was used and for the
determination of urea, creatinine and enzyme aspartate
aminotransferase (AST) and alanine aminotransferase
(ALT), the COBAS MIRA PLUS 400-SP was used following
the manufacturers’ protocols. Results demonstrated the
presence of viral RNA in the liver, spleen, kidney, lymph
node and brain; IgM antibodies were not detectable, HI
antibodies were detectable secondary response of 3, 4 to
10 d.p.i. Leukopenia and increased AST were observed
in both infections. The results indicate that non-human
primate species Callithrix penicillata is highly susceptible
to DENV infection and suggest that they may be a reliable
model for studying dengue fever.
BV312 - ANTI-HMPV ACTIVITY OF DL-GALACTANS
OBTAINED FROM Cryptonemia seminervis
Mendes, G.S., Colodi, F.G., Duarte, M.E.R., Noseda, M.D.,
Cavalcanti, J.F., Santos, N., Romanos, M.T.V.
1. Departamento de Virologia, Instituto de
Microbiologia Paulo de Góes, UFRJ, Brasil
2. Departamento de Bioquímica e Biologia Molecular
- Universidade Federal do Paraná. Curitiba - Paraná – Brasil
Respiratory tract infections (RTIs) are a leading cause of
morbidity and mortality worldwide. For children under
the age of 5 years old, RTIs are ranked as the second leading
cause of death, regardless of geographical location. In
children, respiratory syncytial virus (RSV), parainfluenza
viruses (PIVs), and influenza virus are known major
causes of bronchiolitis and lower respiratory tract
illnesses. In 2001, a previously unknown virus, human
metapneumovirus (HMPV), was added to this list. HMPV
is a member of the Metapneumovirus genera of the
Pneumovirinae subfamily in the Paramyxovirus family.
No vaccine or antiviral therapy is currently available
for prevention or treatment of HMPV infection. In this
work, the anti-human metapneumovirus (anti-HMPV)
activity was determined for two sulfated DL-hybrid
galactans (P6 and P7) obtained from the red seaweed
Cryptonemia seminervis and four depolymerized
products obtained by reductive partial hydrolysis (P15,
P16, P17 and P18). Structural studies carried out in
three homogeneous depolymerized fractions P16, P17
and P18 (Mw of 51.6, 60.1 and 63.8 kDa, respectively)
showed that these galactans present different chemical
characteristics, as monosaccharide composition, content
of sulfate groups (14.1, 23.0 and 29.9 %, respectively)
and agaran:carrageenan molar ratio diads, 2.7:1 for
61
Basic Virology: BV
P16 and P17 and 1:1 for P18. Cytotoxicity tests showed
no significant damage to LLC-MK2 cells. The antiviral
activity was evaluated using Real Time RT-PCR, and
all the fractions analysed showed promising results,
some inhibiting more than 90%of viral replication.
Due to this, the mechanism of action of this compounds
was evaluated. Sulfated DL-galactans and their
depolymerized products exhibited antiviral activity at a
very early stage of the viral infection cycle. All fractions,
except P17 inhibited HMPV replication by binding to
the viral particle. Additionally depolymerized galactans
P17 and P18 inhibited the recognition of cell receptor
by HMPV and penetration to the host cell, respectively.
Financial support: FAPERJ, CAPES, CNPq.
BV313 - INFLUENCE OF STRUCTURAL ALTERATIONS
IN ISATIN MOLECULE ON ANTIVIRAL ACTIVITY
Mendes, G.S., Bastos, R., Cavalcanti, J.F., Pinto, A., Santos,
N., Romanos, M.T.V.
1. Departamento de Virologia,
Microbiologia Paulo de Góes, UFRJ, Brasil
2. Instituto de Química, UFRJ, Brasil
Instituto
de
Respiratory infections caused by viruses play an
important role in public health and the economy. HMPV
is an emerging virus known to cause severe disease in
children, elderly and imnocompromised patients. At
the moment, there are no antiviral drugs licensed for
the treatment of infections caused by HMPV, there is
also no effective measures for prevention and control
of infections by this virus, so the search for efficient
alternatives to combat these infections is necessary.
Isatin is an endogenous compound reported to possess
a wide range of biological activities. In view of the
broad spectrum activities of isatin derivatives, we
aimed at evaluating the antiviral activity of seven novel
mannich bases derived from isatin against human
metapneumovirus in LLC-MK2 cells. And all the seven
molecules synthesized proved to be more toxic than
the isatin. Since the CC50 isatin was higher than 200
µg/mL and molecules ranged from 18.8 µg/mL for the
most toxic to 118.8 µg/mL for the least. Regarding antiHMPV activity, isatin was able to inhibit viral replication
even in very low concentrations, and its ED50 was 3.97
µg/mL. Of the seven molecules tested, six had a lower
ED50 value, i.e., presented a higher inhibitory potential
than isatin. This data may suggest that the substitution
pattern interferes with the antiviral activity. In this case,
the molecules that were not substituted in position 5 of
the ring had the lowest percentage of inhibition within
this class, and also showed higher values of ED50 (4.14
µg/mL and 1.2 µg/mL, respectively). Studies were then,
performed to determine in which stage of the replicative
cycle of HMPV they interfere, as well as virucidal activity.
A pattern was associated with lipophilicity, and virucidal
activity. The molecules were also capable of interact
with cellular receptors and inhibit viral penetration.
This work shows the great potential of the structures
synthesized in vitro, since it allows bioguided studies
aiming to improve the activity and reduce/increase
the toxicity of a compound. Financial support: FAPERJ,
CAPES, CNPq.
BV322 - Porphyrin-Membrane Interactions
And Their Antiviral Activity Against Sinv
And Vsv
Cruz-Oliveira, C., Freire, J.M., Neris, R.L.S., Figueiredo,
C.M., Assunção-Miranda, I., Castanho, M.A.R.B., Da
Poian, A.T.
1. Instituto de Bioquímica Médica, IBqM - UFRJ, Rio
de Janeiro, Brasil
2. Instituto de Medicina Molecular, Universidade de
Lisboa, IMM, Lisboa, Portugal
3. Instituto de Microbiologia Professor Paulo de Góes,
IMPPG - UFRJ, Rio de Janeiro, Brasil
INTRODUCTION: Porphyrins are amphipathic cyclic
molecules composed by a tetrapyrrole ring that can
bear a metal atom in the center. We demonstrated
that porphyrins are potent antiviral compounds that
inactivate some viruses including flaviviruses, Sindbis
(SINV) and Vesicular Stomatitis (VSV) viruses. Since
these viruses are enveloped viruses and porphyrins are
amphipathic molecules that intercalate cell membranes,
we hypothesized that they could interact with viral
envelope, impairing virus infection. The fluorescent
porphyrins PPIX, MesoPPIX and ZnPPIX were used to
study porphyrin-membrane interactions. As porphyrins
fluorescence emission spectra are affected by changes
from aqueous to hydrophobic environment, we evaluated
the partitioning of these compounds to membranes using
fluorescence spectroscopy. MATERIAL AND METHODS:
Progressive LUV (Large Unilamelar Vesicles) addition to
a solution containing porphyrins resulted in fluorescence
emission curves from which partition coefficients (Kp)
were calculated. Porphyrin partition to PC(100%),
PC:PE(4:1), PC:PS(4:1), PC:Chol(3:1), PC:Sph(3:1) and
PC:Sph:Chol(1:1:1) as well as LUVs mimicking SINV
and VSV envelopes were tested. To correlate membrane
partition with porphyrins antiviral activity, viruses
were incubated with 50, 100, 200 and 300 uM of each
porphyrin for 1 hour and virus infectivity was accessed
by plaque assay in BHK cells. RESULTS AND DISCUSSION:
PPIX and MesoPPIX showed higher Kp values (14,9-25,9
x103 for MesoPPIX and 10,6-14,1 x103 for PPIX) than
ZnPPIX (1,6-3,6 x103) in all LUVs tested. Kp values from
porphyrin partition to SINV or VSV synthetic envelopes
were: 3 x103 and 1,9 x103 for ZnPPIX, 16,8 x103 and
62
Basic Virology: BV
19,2 x103 for MesoPPIX and 10,6 x103 and 12 x103 for
PPIX, respectively. ZnPPIX and MesoPPIX inactivated
both SINV and VSV in concentrations up to 200 and 300
uM in a dose dependent manner, whereas PPIX impaired
only SINV replication. CONCLUSION: Using porphyrin
fluorescent properties, it was possible to calculate their
partition coefficient for different model membranes
and to correlate these values to their antiviral activity.
Furthermore, our results suggest that porphyrin
antiviral activity does not depend only on viral envelope
phospholipid content. Porphyrin accessibility to viral
envelope membrane, protected by envelope proteins,
or porphyrin interaction with envelope proteins could
explain the differences in antiviral activity. Supported
by: CNPq, CAPES, FAPERJ and PRONEX.
BV323 - Antiviral Screening Of Brazilian
Plant Extracts Against Dengue Virus
Barbosa, E.C., Francisco, F.L.M., Rocha, E.S.O., Kroon,
E.G., Alves, T.M.A., Calzavara-Silva, C.E., Oliveira, J.G.
1. Centro de Pesquisas René Rachou/Fiocruz Minas,
CPqRR, AV Augusto de Lima 1715, Belo Horizonte MG
2. Universidade Federal de Minas Gerais , UFMG, Av.
Antônio Carlos 6627, Pampulha, Belo Horizonte MG
Seven hundred and twenty plant extracts obtained
from the Fiocruz collection of Brazilian plant and fungi
extracts (COLAB) were screened for antiviral activity
against Dengue virus (DENV). Ethanolic extracts of
different anatomical parts of a wide range of plant
species have been evaluated in vitro against Dengue
virus 2 (DENV-2) by the 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide assay using LLCMK2
cells. A total of 29 out of the 720 extracts tested have
disclosed antiviral activity against DENV. These 29
extracts were obtained from plants belonging to twelve
distinct families: Malpighiaceae (9), Erythroxylaceae (3),
Melastomataceae (1), Euphorbiaceae (1), Calophyllaceae
(3), Boraginaceae (1), Myrtaceae (2), Rubiaceae (2),
Hypericaceae (1), Fabaceae (4), Peranemataceae
(1), Celastraceae (1). These extracts will be further
tested by plaque reduction assay (PRNT) in different
concentrations to confirm their antiviral effect and for
cytotoxicity assessment. Active extracts from natural
products could be, in the future, a source of antiviral
drugs for dengue treatment and also for other diseases
caused by viruses of the Flaviviridae family, or even by a
wide spectrum of viruses. Financial support by Fiocruz,
CPqRR, CNPq and Fapemig
BV329 - Hiv-1 Latency Reactivation By A New
Ingenol Ester Molecule
Pandeló, D., Delvecchio, R., Abreu, C.M., Glinsk, J., Costa,
T.B.F., Rabay, A.N.B.M., Filho, L.F.P., Pianowski, L.F.,
Tanuri, A., Aguiar, R.S.
Carlos Chagas Filho 373, CCS/Bloco A, sala A2-121.CEP21941-902, Fundão, RJ
2. Kyolab Laboratórios, Kyolab, R. Isaura Ap. O.
Barbosa Terini, 231, Jd Itapuã - Valinhos-SP. CEP-13273-105
3. Planta Analytica LLC, Planta Analytica, 39 Rose St,
Danbury, CT 06810, Estados Unidos
The HIV eradication in infected individuals is not
effective because of the establishment of viral latency
during the early stages of infection. These latency
reservoirs are not affected by HAART. Several molecular
mechanisms are responsible for the establishment of
HIV latency (promoter methylation, histone modification
and cell activation). The internalization of NF-κB into
the nucleus and upstream pathways are also involved
in HIV latency. Here we evaluate the activity of a new
compound extracted from Euphorbia sp, denominated
Ingenol B (ING B) (KYOLAB Laboratories) to reactivate
HIV latency and the molecular mechanism involved.
J-Lat cells (clones 6.3 and 8.4) were used as model of HIV
latency. The reactivation was assessed by flow cytometry
in the presence of ING B. Cytotoxicity effects were also
evaluated. Reporter plasmids expressing luciferase in
control of HIV LTR enhancers (p3´Blue LTR-Luc) were
used to evaluate the transcription activation. NF-κB effects
were evaluated by nuclear translocation and upstream
pathways with PKC-inhibitors. Immunofluorescence and
western blotting assays were performed to evaluate PKC
activation. ING B was a better candidate to reactivate
HIV latency if compared with others activators and
no cytotoxicity effects were associated (lower than
0.32 µM). Our results have demonstrated that the
reactivation is essentially mediated by NF-κB binding
sites and independent of HIV-Tat transactivation. The
ING B treatment promotes HIV-GFP expression at high
levels in latency models. This latent HIV-1 reactivation
is associated mainly with PKCs isoforms activation and
NF-κB nuclear translocation. Our results suggested the
potential of ING B as new compound able to reactivate
HIV latency that can potentially be combined with
HAART therapy to eradicate HIV from the body. Financial
support: CNPq, FAPERJ, Kyolab
BV334 - Phylogeography And Evolutionary
History Of Hepatitis B Virus Genotype F In
Brazil.
Mello, F.C.A., Araujo, O.C., Lago, B.V., Motta-Castro, A.C.,
Moraes, M.T.B., Gomes, S.A., Bello, G., Araujo, N.M.
63
Basic Virology: BV
1. Fundação Oswaldo Cruz, FIOCRUZ, Avenida Brasil,
4365, Manguinhos, Rio de Janeiro, RJ, Brasil
2. Universidade Federal do Mato Grosso do Sul, UFMS
Hepatitis B virus (HBV) genotype F (HBV/F) is considered
to be indigenous to the Americas, but its emergence and
spread in the continent remain unknown. Previously,
only two HBV/F complete genome sequences from Brazil
were available, limiting the contribution of Brazilian
isolates to the phylogenetic studies of HBV/F. Here, we
examined the prevalence and geographic distributions
of HBV/F subgenotypes in Brazil, determined the fulllength genomic sequences of HBV/F isolates from
different Brazilian geographic regions, and investigated
the detailed evolutionary history and phylogeography
of HBV/F in Brazil. Complete HBV/F genomes isolated
from 12 Brazilian patients, representing the HBV/F
subgenotypes circulating in Brazil, were sequenced
and analyzed together with sequences retrieved
from GenBank, using the Bayesian coalescent and
phylogeographic framework. Phylogenetic analysis
using all Brazilian HBV/F S-gene sequences available
in GenBank showed that HBV/F2a is found at higher
frequencies countrywide and corresponds to all
sequences isolated in the Brazilian Amazon Basin. In
addition, our evolutionary analysis using complete
genome sequences estimated an older median ancestral
age for the Brazilian HBV/F2a compared to the Brazilian
HBV/F1b and HBV/F4 subgenotypes, suggesting that
HBV/F2a represents the original native HBV of Brazil.
The phylogeographic patterns suggested a north-tosouth flow of HBV/F2a from Venezuela to Brazil, whereas
HBV/F1b and HBV/F4 strains appeared to have spread
from Argentina to Brazil. Our study suggests a plausible
route of introduction of HBV/F subgenotypes in Brazil
and demonstrates the usefulness of recently developed
computational tools for investigating the evolutionary
history of HBV.
BV353 - Mapping Of Tcd8 Cell Epitopes In
Human Respiratory Syncytial Virus L
Protein
Medina-Armenteros, Y., Farinha-Arcieri, L.E., Braga,
C.J.M., Carromeu, C., Tamura, R.E., Ventura, A.M.
Universidade de São Paulo, USP, Avenida Professor
Lineu Prestes 1374, São Paulo-SP, Brasil 05508-900
Since it has been reported that in humans there is a
relationship between human respiratory syncytial
virus (hRSV) specific cytotoxic T-lymphocyte (CTL)
and symptom-reduction, and that the polymerase
(structural L protein) is highly conserved among
different strains, this work aimed at the identification of
CD8 T cell epitopes H-2d-restricted within L sequence
for immunization purposes. Previously we screened
hRSV strain A2 L protein sequence with SYFPEITHI and
Pred/Balbc algorithms, to predict CD8 T cell epitopes.
Nine peptides showing the best binding scores to
BALB/c MHC-I molecules (H-2Kd, Ld and Dd) were
selected. Sequence homology analysis showed that these
sequences are conserved among different hRSV strains.
The selected peptides were synthesized and used to
immunize BALB/c mice, for evaluating T cell response.
Two peptides induced significant IFN-γ production
by ex vivo stimulated T cells. In this report these
experiments were repeated and new data reinforce
that CD8 T cell epitopes are present in these peptides.
Additionally, to show in vivo functionality, their ability
to stimulate the production of IFN-γ from splenocytes
and lung lymphocytes of hRSV-infected animals was also
measured and confirmed. These results show that hRSV
L protein contains H-2d restricted epitopes that can be
added to the already reported ones to compose a multiepitope vaccine. Financial Support: FAPESP/USP/CNPq
BV363 - Detection And Typing Of Dengue
Virus In Aedes Aegypti Collected In The
City Of São José Do Rio Preto-Sp.
Fávaro, E.A., Parra, M.C.P., Mondini, A., Ozanic, K., Dibo,
M.R., Colombo, T.E., Chiaravalloti-Neto, F., Eiras, A.E.,
Nogueira, M.L.
Famerp, Av. Brigadeiro Faria Lima, 5416 Vila São Pedro CEP:
15090-000
2. Universidade Estadual Paulista/FCFAR-Araraquara,
Unesp, Rodovia Araraquara-Jaú Km 1 Bairro Machados
3. Universidade de São Paulo, USP, Av. Prof. Almeida
Prado, 1280 Butãnta
4. Universidade Federal de Minas Gerais, UFMG, R:
Antonio Carlo, 6627 Pampulha BH
Dengue is a viral disease which is spreading worldwide
and infects 50 million people annually. The transmission
of the disease occurs when infected mosquitoes of the
Aedes aegypti species bite susceptible hosts. The vector
is extremely adapted to urban environments, and it can
be captured either intra or peridomicile. The use of traps
to catch adult mosquitoes has been an important tool for
entomological surveillance of the vector. The objective
of this study is to evaluate the use of the Mosquitito
trap as an entomological surveillance tool for Aedes
aegypti. The study was conducted in a neighborhood of
São José do Rio Preto, a city located in the Northwest of
the São Paulo state. Twenty seven Mosquitito traps were
installed, on Mondays and Thursdays, remaining in each
residence during 24 hours. The installation site was the
covered peridomicile, close to vases or foliage in only
64
Basic Virology: BV
one house per block drawn. The houses were chosen
following guidelines for household characteristics such
as the presence of covered area for installation of the
trap and the presence of small and large vegetation.
After removing the trap, the collected mosquitoes were
sent to the Laboratory of Vectors SUCEN/FAMERP for
identification of the species category. In the period
from March 2012 to May 2013, 2,363 Mosquititos
were installed, from where 690 females and 449 males,
Aedes aegypti, species were collected; totaling 1,139
specimens in 509 traps. Besides this species, 4,929 Culex
quinquifasciatus specimens and one Uranotaenia sp were
present in 586 traps; totaling 6069 captured mosquitoes.
Traps were found positive for Aedes aegypti throughout
the year. The month with the highest number of collected
specimens was January 2013 (86 mosquitoes); following
October 2013 and August 2012 (50 each month), March
2013 and November 2012, 47 and 46 of the vector
specimens were collected, respectively. The month with
the lowest number of collected mosquitoes was April
2012 (2 vector specimens). Therefore, the Mosquitito
can be used as an entomological surveillance tool for
Aedes aegypti, to be installed in a certain amount of preprogrammed residences in the city this could guide the
activities toward the vector control.
BV371 - Dengue Virus Modulates Secretion
And Post-Translational Modifications Of
Alpha-Enolase In Hepg2 Cells.
Higa, L.M., Curi, B.M., Zingali, R.B., Da Poian, A.T.
1. Instituto de Bioquímica Médica-UFRJ, IBqM,
2. Unidade de Espectrometria de Massas e Proteômica
-UFRJ, UEMP-UFRJ,
Introduction: Haemostatic dysfunction is a common
feature in the severe forms of the dengue diseases.
Previously, our group used a proteomic approach to study
the effects of dengue virus (DENV) infection on protein
secretion from HepG2 hepatic cells. We showed that
DENV infection alters the secretion of several proteins
including alpha-enolase (ENO1). Recently, ENO1 was
described as a plasminogen receptor that modulates
its activation. In this work, we study the effects of
DENV infection on the modulation of alpha-enolase
in HepG2 cells. Material and Methods: ENO1 secretion
was analyzed by indirect ELISA. To assess cell viability,
we performed trypan blue and LDH activity assays.
Western Blot were used to inquire ENO1 intracellular
content. Two-dimensional gels western blots were used
to analyze ENO1 isoforms. Results: Our data show that
ENO1 secretion correlates with viral load in a dosedependent manner. However, DENV infection does not
affect the ENO1 intracellular content. Cell viability was
not affected by DENV up to 24h post-infection. Two-
dimensional Western blots indicates that ENO1 presents
5 isoforms with different isoeletric points indicating
post-translational modifications. Comparative analysis
showed that the distribution of these isoforms differs
between control and infected cells. Conclusions: The
infection of HepG2 cells by DENV leads to an increase
in alpha-enolase secretion which is dose-dependent but
it has no effect on ENO1 intracellular content. Our data
also suggests that DENV infection ENO1 modulates posttranslational modifications. In our future investigations,
we will study the effects of ENO1 secreted by infected
and control cells on plasminogen activation. Discussion:
The increase of ENO1 secretion by infected cells might
be associated with fibrinolysis impairment through
plasminogen activation promoting haemostatic
dysfunction and playing an important role in dengue
pathogenesis. Financial Support: CNPq and FAPERJ
BV372 - Assessment Of The Use Of The
Mosquitito Trap As An Entomological
Surveillance Tool For Aedes Aegypti.
Fávaro, E.A., Dibo, M.R., Ricci, L.S., Nogueira, M.L., Parra,
M.C.P., Cassiano, J.H., Zanforlin, J.R., Chiaravallori-Neto,
F., Mondini, A., Eiras, A.E.
Famerp, Av Brigadeiro Faria Lima, 5416 Vila São Pedro
2. Superintendência de Controle de Endemias, SUCEN,
Av. Philadelpho Manoel Golveia Neto, 3101 Jardim Mona
3. Faculdade de Saúde Pública, USP, Av. Professor
Lineu Prestes, 2565, Butãnta
4. Universidade Estadual Paulista Julio de Mesquita
Filho, UNESP, Rod. Araraquara-Jaú Km 1 Machados
5. Universidade Federal de Minas Gerais , UFMG, Av.
Antonio Carlos, 6627, Pampulha
Dengue is a viral disease which is spreading worldwide
and infects 50 million people annually. The transmission
of the disease occurs when infected mosquitoes of the
Aedes aegypti species bite susceptible hosts. The vector
is extremely adapted to urban environments, and it can
be captured either intra or peridomicile. The use of traps
to catch adult mosquitoes has been an important tool for
entomological surveillance of the vector. The objective of
this study is to evaluate the use of the Mosquitito trap as
an entomological surveillance tool for Aedes aegypti. The
study was conducted in a neighborhood of São José do
Rio Preto, a city located in the Northwest of the São Paulo
state. Twenty seven Mosquitito traps were installed, on
Mondays and Thursdays, remaining in each residence
during 24 hours. The installation site was the covered
peridomicile, close to vases or foliage in only one house
per block drawn. The houses were chosen following
guidelines for household characteristics such as the
65
Basic Virology: BV
presence of covered area for installation of the trap and
the presence of small and large vegetation. After removing
the trap, the collected mosquitoes were sent to the
Laboratory of Vectors SUCEN/FAMERP for identification
of the species category. In the period from March 2012 to
May 2013, 2,363 Mosquititos were installed, from where
690 females and 449 males, Aedes aegypti, species were
collected; totaling 1,139 specimens in 509 traps. Besides
this species, 4,929 Culex quinquifasciatus specimens
and one Uranotaenia sp were present in 586 traps;
totaling 6069 captured mosquitoes. Traps were found
positive for Aedes aegypti throughout the year. The
month with the highest number of collected specimens
was January 2013 (86 mosquitoes); following October
2013 and August 2012 (50 each month), March 2013
and November 2012, 47 and 46 of the vector specimens
were collected, respectively. The month with the lowest
number of collected mosquitoes was April 2012 (2 vector
specimens). Therefore, the Mosquitito can be used as
an entomological surveillance tool for Aedes aegypti,
to be installed in a certain amount of pre-programmed
residences in the city this could guide the activities
toward the vector control.
BV374 - The Analysis Of Virulence And Host
Tropism Genes Depict The Genetic Diversity
Between The Two Brazilian Vaccinia Virus
Clades.
Assis, F.L., Ferreira, P.C.P., Trindade, G.S., Drumond, B.P.,
Kroon, E.G., Abrahão, J.S.
Antônio Carlos, 6627, Pampulha, Belo Horizonte/MG, 31270901 (31) 3409-3002
2. Universidade Federal de Juiz de Fora, UFJF, Rua José
Lourenço Kelmer, s/n - Bairro São Pedro, Juiz de Fora/MG,
36036-900
Vaccinia virus (VACV) is a zoonotic agent endemic in
Brazil. In recent years, VACV has spread to all Brazilian
regions by an unknown chain transmission affecting
dairy cattle and workers in rural villages. Since 1999,
several VACV strains have been frequently isolated
during outbreaks in Brazil and have been featured
molecular and biologically. These approaches have
revealed the presence of two Brazilian VACV (VACVBR) clades. The aim of this work was to investigate the
genetic polymorphism between these clades, assessing
nucleotide sequences of virulence and host tropism
genes. We conducted the sequencing of 38 genes, being
24 immunomodulatory genes, 11 viral-release related
genes; 02 kelch-like genes and 07 viral antigenic targets.
The coding sequences were obtained from VACV-BR
strains Serro virus 2 (SV2) (Clade 1) (C1) and Guarani
P1 virus (GP1V) (Clade 2) (C2) and the nucleic acid
sequences were aligned using the MEGA 4.0 program.
The VACV-WR strain (GenBank: AY243312.1) were
used as the reference. Our results revealed that 94,7%
(36/38) of the analyzed genes possess polymorphisms
between GPIV and S2V. Of those genes, three presented
one or more synonymous mutation. The remaining
divergent genes (n = 33) presented non synonymous
mutation that in some cases culminate in premature
stop codon. Some C1 and C2 virulence and host tropism
genes shown significant divergences in the nucleotide
and amino acid content. The S2V and GP1V strains
shared a nucleotide content of 99,2% as higher as when
compared the VACV-BR with other VACV vaccine strains.
Although the GP1V has shared a close nucleotide content
with VACV-WR, many polymorphisms between them can
be observed, such as the premature stop codon in the
F13L (palmytilated EEV membrane protein) gene of the
GP1V, and nucleotide substitutions present in the VACVWR and absent in both GP1V and S2V. All these results,
reinforce the circulation of more than one VACV subtype
in Brazil.
BV379 - “Inhibitory Activity Of Dl-Galactans
From Criptonemia Seminervis Marine Alga
On Dengue Virus Type 1, In Cell Culture”
Cavalcanti, J.F., Colodi, F., Ferreira, L.G., Mendes, G.S.,
Noseda, M.D. , Duarte, M.E.R., Romanos, M.T.V.
Lourenço Kelmer, s/n - Bairro São Pedro, Juiz de Fora/MG,
36036-900
Vaccinia virus (VACV) is a zoonotic agent endemic in
Brazil. In recent years, VACV has spread to all Brazilian
regions by an unknown chain transmission affecting
dairy cattle and workers in rural villages. Since 1999,
several VACV strains have been frequently isolated
during outbreaks in Brazil and have been featured
molecular and biologically. These approaches have
revealed the presence of two Brazilian VACV (VACVBR) clades. The aim of this work was to investigate the
genetic polymorphism between these clades, assessing
nucleotide sequences of virulence and host tropism
genes. We conducted the sequencing of 38 genes, being
24 immunomodulatory genes, 11 viral-release related
genes; 02 kelch-like genes and 07 viral antigenic targets.
The coding sequences were obtained from VACV-BR
strains Serro virus 2 (SV2) (Clade 1) (C1) and Guarani
P1 virus (GP1V) (Clade 2) (C2) and the nucleic acid
sequences were aligned using the MEGA 4.0 program.
The VACV-WR strain (GenBank: AY243312.1) were
used as the reference. Our results revealed that 94,7%
66
Basic Virology: BV
(36/38) of the analyzed genes possess polymorphisms
between GPIV and S2V. Of those genes, three presented
one or more synonymous mutation. The remaining
divergent genes (n = 33) presented non synonymous
mutation that in some cases culminate in premature
stop codon. Some C1 and C2 virulence and host tropism
genes shown significant divergences in the nucleotide
and amino acid content. The S2V and GP1V strains
shared a nucleotide content of 99,2% as higher as when
compared the VACV-BR with other VACV vaccine strains.
Although the GP1V has shared a close nucleotide content
with VACV-WR, many polymorphisms between them can
be observed, such as the premature stop codon in the
F13L (palmytilated EEV membrane protein) gene of the
GP1V, and nucleotide substitutions present in the VACVWR and absent in both GP1V and S2V. All these results,
reinforce the circulation of more than one VACV subtype
in Brazil.
BV380 - “Antiviral Evaluation Of Sulfated
Polysaccharides From Gayralia Oxysperma
Marine Alga On Dengue Virus Type 1”
Cavalcanti, J.F., Duarte, M.E.R., Noseda, M.D. , Mendes,
G.S., Ducatti, D.R.B., Romanos, M.T.V.
Carlos Chagas Filho, 373 - Ilha do Fundão; Rio de Janeiro R.J
CEP: 21949-900
2. Universidade Federal do Paraná, UFPR
Dengue and dengue hemorrhagic fever are caused by
serotypes of dengue virus, which are closely related,
but antigenically different, known as dengue 1 (DENV1), dengue 2 (DENV-2), dengue 3 (DENV-3) and dengue
4 (DENV-4). Infection with these viruses produces
a spectrum of clinical symptoms ranging from a
nonspecific framework to severe and fatal hemorrhagic
disease. There are no promising prospects for reversing
the growing epidemic and geographical expansion of
dengue. Due to the unavailability of specific drugs for
the treatment of dengue and frequent epidemics caused
by these viruses, the aim of this study was to evaluate
the activity of four sulfated polysaccharide fractions
obtained from the Gayralia oxysperma marine alga (crude
polysaccharide fraction [P19], P19 partial hydrolysis
[P20], ion exchange chromatography of P20 with 1M
[P21] and 1,5M [P22] of NaCl) on the dengue virus type
1 biosynthesis, using as model C6/36 cell culture. When
cytotoxicity was evaluated, all fractions showed CC50
values higher than 200 µg/mL (maximum concentration
tested). In screening experiments it was observed that
all fractions showed 99.9% inhibition. This inhibitory
activity can be attributed to the high molecular weight of
the fractions and its high degree of sulfation. Regarding
the mechanism of action, all fractions presented virucial
activity, inhibiting The fractions P19, P20, P21 and P22
presented 94.7%, 99.7%, 88% and 99.5% inhibition on
viral particles (virucidal activity), 57.6%, 0%, 32.8% and
5.5% inhibition on the cell receptor and 98.5%, 97.7%,
96.4% and 99.9% inhibition during the penetration
events, respectively. Studies are being conducted to
determine the activity on events after penetration.
These are promising results, since the polysaccharides
are considered pharmacologically active molecules and
can be used in the development of new natural drugs.
BV388
Analysis
Of
Subcellular
Localization Of Oropouche Virus During
Its Replication Cycle In Hela Cells
Mendonça, L.R., Criado, M.F., Silva, M.L., Arruda, E., Da
Silva, L.L.P.
Universidade de São Paulo, USP, Depto. de Biologia
Celular e Molecular e Bioagentes Patogênicos - FMRP
Oropouche virus (OROV) is the second most frequent
cause of arboviral febrile illness in Brazil. Despite its
epidemiological importance, most details about the
replication cycle of OROV remain unknown. Thus, this
study aims to analyze the subcellular localization of
OROV during its replication cycle and identify structures
of the host cell involved in viral assembly and budding.
To this end, we inoculated HeLa cells with OROV (M.O.I.
= 1) and fixed infected cells at the following time points
post-infection (p.i.): 0h, 1h30, 2h30, 4h, 6h, 8h, 10h
and 12h. For each time point, we quantified viral titres
by TCID50 and monitored the intracellular presence/
distribution of OROV by indirect immunofluorescence,
using a polyclonal anti-OROV antibody. At 1h30 and
2h30 p.i., we observed OROV staining spread in puncta
through the cytosol. Viral titre was null at these time
points, suggesting that the observed staining pattern
was from viral proteins recently released after viral
uncoating. At 4h p.i., there was a visible reduction of
viral staining and virus titre was still null, indicative
of viral eclipse. At 6h and 8h p.i., there was increased
staining with reticulated pattern spread through the
cytosol, especially in the perinuclear region and close to
the plasma membrane. At 6h p.i., supernatant viral titre
was 101.75 TCID50/mL, indicating the release of newly
synthesized infectious viral particles to the supernatant.
At 10h and 12h p.i., we observed a concentration of OROV
staining in large vesicular structures at the perinuclear
region and also dispersed through the cytosol, possibly
related to virus factories. Altogether, the present results
provide an initial characterization of the intracellular
distribution of OROV during its replication cycle. These
findings will be complemented in double-staining
indirect immunofluorescence assays to compare viral
67
Basic Virology: BV
localization with specific protein markers of cellular
structures. Financial support: FAPESP, CNPq
BV411 - Substances Of Canistrocarpus
Cervicornis Inhibit Replication In Vitro
Of Human Immunodeficiency Virus Type 1
Barcelos, I.O., Barros, C.S., Teixeira, V.L., Pinho, R.T.,
Cirne-Santos, C.C., Paixão, I.C.N.P.
1. Universidade Federal Fluminense , UFF, Rua Outeiro
de São João Batista, s/nº, Valonguinho - Niterói, RJ - 24.020150
2. Fundação Oswaldo Cruz , Fiocruz, Avenida Brasil,
4365, Manguinhos - Rio de Janeiro, RJ - 21.040-360
Acquired Immunodeficiency Syndrome (AIDS) is a
clinical syndrome resulting from infection by human
immunodeficiency virus (HIV), which causes profound
immunosuppression. HIV infects CD4+ cells and,
once inside a cell, integrates its genetic material into
the genetic material of the host. Currently, available
treatment for the disease is HAART, highly active
antiretroviral therapy. However, effective drugs can fail in
an advanced stage due to chronic adverse effects and the
emergence and transmission of variant strains resistant
to the drugs used in treatment. This shows the need for
continued efforts in the discovery of new antiretroviral/
anti-HIV agents. The aim of this study is to search
new substances with anti-HIV-1 activity, seeking new
strategies and alternatives of treatment to the combat
to AIDS. For the study were used substances isolated
from brown alga Canistrocarpus cervicornis which were
denominated C9, C26-2 and C28. Were used MT-2 cells,
which were maintained at 37 °C, 5% of CO2 and used for
cytotoxicity and antiviral assay. For the antiviral assay
were used the viral isolated from HIV-1 IIIB. Cytotoxicity
assay was performed by MTT method and antiviral
assay was assessed by percent inhibition. Results
showed that substances were not cytotoxic to the cells.
C9, C26-2 and C28 presented 492µM, 178µM, 246µM of
CC50, respectively. All the substances inhibited the viral
replication in a dose-dependent manner. C9 inhibited up
to 99%, whereas C26-2 inhibited up to 80,9% and C28
inhibited up to 87,5% the replication of HIV-1. Thus, we
can conclude that, with the results presented, the natural
substances C9, C26-2 and C28 are promising to continue
studies in vitro of their mechanism of action and future
development of drugs with antiviral action. Financial
support: CAPES, CNPq, FAPERJ.
BV414 - Characterization Of Intracellular
Trafficking Routes Used By The Hiv1 Nef Protein To Downregulate Main
Histocompatibility Complex (Mhc) Type I
Molecules
Carvalho, J.V., Da Silva, L.L.
Faculdade de Medicina de Ribeirão Preto USP, FMRPUSP-RP, Av. Bandeirantes 3900 Bairro: Monte Alegre
Nef is an HIV-1 accessory protein that plays important
roles in progression to AIDS. Nef downregulates cell
surface expression of CD4 and MHC-I in infected cells.
MHC-I downregulation prevents recognition and
destruction of infected cells by cytotoxic T-cells. Nef
alters the intracellular trafficking of MHC-I molecules,
resulting in targeting of these proteins to lysosomes
for degradation. Although this effect of Nef has been
extensively documented, the mechanism by which Nef
induces changes in MHC-I trafficking is mostly unknown.
Our aim is to better understand these mechanisms,
identifying cellular factors used by Nef to alter the
intracellular trafficking of MHC-I (HLA-A2). To monitor
downregulation of HLA-A2 by Nef, we use HeLa cells
that constitutively express HLA-A2. Flow cytometry
confirmed that Nef decreases cell surface expression
of HLA-A2 and confocal microscopy showed that Nef
causes redistribution of these molecules to endosomes
and TGN. To better understand the similarities between
CD4 and HLA-A2 downregulation, we compared the
distribution of these poteins in cells expressing Nef and
found co-localization of CD4 and HLA-A2 in endosomes.
In addition, treatment with lysosomal inibitors leads to
increased CD4 and HLA-A2 colocalization in enlarged
endosomal structures. Next, we tested whether targeting
of MHC-I to lysosomes by Nef requires the activity of
the ESCRT (endosomal sorting complexes required for
transport) machinery, by overexpressing either HRS or a
mutant of the AAA ATPase VPS4 (VPS4 E/Q). Under these
conditions, HLA-A2 re-localized by Nef, accumulates
in enlarged endosomes containing HSR or VPS4 E/Q.
Together, our data indicate that Nef targets MHC-I to
lysosomes via the ESCRT-dependent multivesicular
body pathway, a route previously implicated in CD4
downregulation. The better understanding of how Nef
manipulates intracellular trafficking pathways could
shed light on strategies to interfere with the activity of
this viral protein.Financial support: FAPESP
BV423 - Studies Of Antiviral Activity And
Cytotoxicity Of Diterpenes Isolated From
Oxoquinoline Derived Marine Brown
Algae Using Human Cervical Explants And
Cell Lines.
Stephens, P.R.S., Amorim, L.S.C., Ocampo, P.L., CastelloBranco, L.R., Laneuville, V.T., Batalha, P., Santos, F., Souza,
M.C., Sako, K., Cunha, A.C., Paixão, I.C.N.P.
1. Laboratório de Virologia Molecular - Instituto de
68
Basic Virology: BV
Biologia, LVM - IB - UFF, Rua Mário Santos Braga - Ingá,
Niterói - RJ, 24020-140
2. Laboratório de Imunologia Clínica - Instituto
Oswaldo Cruz, LIC - IOC - Fiocruz, Avenida Brasil, 4365
3. Laboratório de Produtos Naturais de Algas Marinhas,
LPNAM - IB - UFF, R. Mário Santos Braga - Ingá, Niterói - RJ,
24020-140
According to UNAIDS 2009, there were more than 33
million people living with HIV worldwide. Brazil has a
population of approximately 192 million inhabitants
and (from 1980 to 2010) more than 470.000 AIDS cases
were diagnosed, with more than 34.000 new cases per
year. Currently, there is no effective HIV/AIDS vaccine
or cure, although the introductions of antiretroviral
drugs significantly improved the prognosis of infected
individuals with access to treatment. However, the
emergence of drug-resistant viral strains is increasing.
Therefore numerous studies have been developed, such
as preventive strategies in order to find some low-toxicity
and low-cost anti-HIV substances. The literature has
been shown that studies using the ex vivo model (human
cervical explant) are suitable for histopathological
analysis as well as for drug testing. The aim of this study
is to evaluate the cytotoxicity and anti-viral activity
of diterpenes isolated from marine brown algae and
oxoquinoline derivatives in cervical explants (epithelial
and stromal tissues) and PM-1 cells. We used human
cervical explants obtained from fertile age women
from the Hospital Federal de Bonsucesso (HFB), Rio de
Janeiro, Brazil. Cytotoxicity assays were performed by
the MTT 3-(4,5-dimetiltiazol-2-il)2,5-difenil brometo
de tetrazolium assay and measurement of ELISA p24
antigen in supernatants from explant cultures and cell
lines treated with marine diterpenes and oxoquinoline
derivatives and both infected by HIV-1. The diterpenes
isolated from marine brown algae and oxoquinoline
derivatives studied by our group have important effects
on HIV replication, as we have observed more than 90%
viral inhibition. Cytotoxicity levels lower than 30%
were observed in both classes of substances. Further
preclinical studies are needed to better evaluate these
substances as potential candidates for microbicides or
systemic drugs. Financial Suport: FIOCRUZ, Brazilian
Ministry of Health, UNESCO, CNPq, FAPERJ, CAPES,
FOPESQ-UFF-PROPPI.
BV435 - Proteomics Approach Identifies
Cellular Protein That Interacts With YfvNs4b
Vidotto, A., Morais, A.T.S., Pacca, C.C., Mohana-Borges,
R., Gil, L.H.V.G., Nogueira, M.L.
FAMERP, Laboratório de Pesquisa em Virologia, FAMERP,
São José do Rio Preto, SP, Brazil
Laboratório de Genômica Estrutural, Instituto de Biofísica
Carlos Chagas Filho
3. FIOCRUZ, FIOCRUZ, Centro de Pesquisas Aggeu
Magalhães - CpqAM, Recife
4. Universidade Federal do Rio de Janeiro, Inst.
Microbiologia, UFRJ, Laboratório de Genética e Imunologia
das Infecções Virais
Yellow Fever Virus NS4b (YFV-NS4b) is a non-structural
protein that is related to viral replication and immune
evasion, but its precise role and cellular partners are
not yet known. Proteomics has been applied to study of
the interaction between virus and the host cell proteins.
We have expressed GST fusion YFV-NS4b protein in
E. coli, the synthesis of the protein was confirmed by
Western blot and NS4b-GST protein was purified by
affinity column. GST Pull down studies were performed
using GST-NS4b as a bait and HeLa cellular extracts
to search virus-host protein interactions using 1DE
coupled to LC-MS/MS. After MS analysis, the proteins
identified were classified by their cellular roles based
in their definition in databases, as: initiation of viral
infection, entry into host cell, regulation of viral genome
replication, viral transcription, interferon signaling
pathway, signal transduction, defense response, RNA
processing, translation, protein maturation, post-Golgi
vesicle-mediated transport, cell cycle checkpoint and
apoptosis. We have used the Scaffold 3 Software and
207 proteins were confirmed in the pull down assay.
Fifty-nine proteins were found to be significantly
increased in NS4b pull down when compared with
GST alone, and the Fisher test was significant for 58
proteins. The Ingenuity Systems identified 16 possible
pathways, as Antimicrobial Response, Dermatological
Diseases and this analysis indicated an mTOR pathway
inhibitor as a potential inhibitor of CypA. Our results
of immunofluorescence and plates assays showed a
significant reduction in YFV replication when using the
mTOR pathway inhibitor. We also evaluated the role
of CypA in viral replication by overexpression it in the
BHK LucNeo Replicon YF17D cells treated or not with
Cyclosporine A, and the YFV replication was inhibited
by the CypA pathway. Furthermore, these findings
can provide important information for understanding
Flavivirus biology and generate potential targets for
antiviral drugs. Financial Support: FAPESP, CNPq,
PRONEX-Dengue, LNBio/CNPEM
BV436 - Molecular Characterization Of
Occult Infection In Samples With Isolated
Anti-Hbc
69
Basic Virology: BV
Santos, A.O., Pereira, A.V.C., Botelho, L.P., Virgens, J.,
Vieira, D.S., Salcedo, J.M.V.
1. Fundação Oswaldo Cruz RO , FIOCRUZ-RO –, Da
Beira, 7671 - BR 364 - Km 3,5 - Bairro: Lagoa
2. Instituto de Pesquisa em Patologias Tropicais,
IPEPATRO, Da Beira, 7671 - BR 364 - Km 3,5 - Bairro: Lagoa
3. Fundação Universidade Federal de Rondônia, UNIR,
Campus - BR 364, Km 9,5
Occult infection with the Hepatitis B virus (HBV) is
characterized by the presence of viral DNA in the serum
of HBsAg negative individuals. It is not clear whether
isolated anti-HBc is involved in increasing predisposition
towards occult HBV infection. This study aims to form a
clinical accompaniment and molecular characterization
of this serological standard, to contribute to the
knowledge of occult infection, and to elucidate the
molecular mechanisms that collaborate to bring about
the change in expression of different proteins from HBV.
40 individuals with isolated anti-HBc and detectable
HBV DNA in serum were selected. Serological and
molecular tests will be performed on these individuals
every 6 months for 2 years. First, PCR was performed,
using primers that amplify a fragment of 109bp from the
pre-core region. Samples returning a positive result after
the first PCR will be submitted for amplification of the
complete genome. The sequences obtained will then be
clustered with the reference sequences extracted from
GenBank using Clustal X software, and edited with Seal software. Phylogenetic analysis will be performed
using Monte Carlo Markov Chain (MCMC), using BEAST
v.1.5.3. Of the 23 samples with isolated anti-HBc gained
from DNA extraction and PCR, 12 gave positive results
in the first PCR, and were chosen for complete genome
sequencing. In Rondonia, Brazil, we do not dispose of
studies related to this clinical profile. Therefore, it is
very important to elucidate associated factors, and to
analyze until the serological profile of the isolated antiHBc patient corresponds with cases of occult hepatitis B
that have the greatest potential pathogenic and clinical
repercussions, or, conversely, until the development
of the serological profile results in a pattern of no
greater clinical epidemiologic importance. FINANCIAL
SUPPORT: FIOCRUZ/RO, CEPEM/RO
BV443 - Searching For Interactions Between
Cellular Proteins And Dengue Virus Ns4b
Protein
Scagion, G.P., Pacca, C.C., Koolen, H.H.F., MohanaBorges, R., Gozzo, F.C., Nogueira, M.L., Vidotto, A.
FAMERP, Laboratório de Pesquisa em Virologia, Av.
Brigadeiro Faria Lima, 5416
Laboratório de Genômica Estrutural, Instituto de Biofísica
Carlos Chagas Filho
3. Laboratório Dalton de Espectrometria de Massas,
IQ, IQ - UNICAMP, Laboratório Dalton de Espectrometria de
Massas, Instituto de Química, UNICAMP
Dengue is the most important arbovirus in Brazil and is
also a serious public health problem. The viruses belong
to the four serotypes are transmitted mainly by the bite
of Aedes sp mosquitoes. The DENV are composed of a
single, approximately 11 kb positive-strand RNA genome
that encodes a single polyprotein, which is cleaved into
three structural proteins, capsid (C), membrane (M)
and envelop (E), and seven nonstructural proteins, NS1,
NS2a, NS2b, NS3, NS4a, NS4b and NS5. The genome
replication occurs in the cell cytoplasm through a
replication complex involving viral and cellular proteins
and viral RNA. NS4b is a non-structural protein that is
related to viral replication and may also be involved in
modulation of the activity of NS3 helicase and inhibition
of the interferon in DENV infections. However, the NS4b
real role and cellular partners are not known. Proteomics
has been applied in several instances to the study of the
interaction between virus and the host cell proteome.
The aim of this study was to identify interactions
between DENV2 NS4b protein and host cellular
proteins by Proteomics. The DENV2 NS4b protein was
expressed using the pGEX-5X-1 vector, in E. coli BL21
(DE3). Synthesis of the fusion protein was confirmed by
Western blot analysis and DENV2 NS4b was purified by
affinity column. We performed a Pull down assay and
SDS-PAGE to compare the HeLa cell extract proteins that
interacted with GST-NS4B and GST alone. The bands
differentially pulled were cut out of the gel and submitted
in situ digestion using trypsin for subsequent analysis by
mass spectrometry (MS). The MS data were performed
a search against NCBInr database and subsequently
Scaffold 3.6 software analysis. Thus, it was possible to
confirm the interaction of 74 proteins in NS4b-GST
DENV2, with protein threshold to 90%. Among proteins
was identified polyprotein DENV2, which validates the
Pull down assay. We also performed analysis using the
protein threshold to 95% and the Scaffold identified
26 proteins, among these proteins are myozenin-2
and stanniocalcin-1. These proteins have been poorly
studied and functions related to the immune system.
Thus, myozenin-2 and stanniocalcin-1 can be targeted
for future validations, since the NS4b is involved on the
interferon signaling inhibition. Therefore, this study may
be the starting point to produce new knowledge about
the NS4b role in DENV2 pathogenicity and replication
and help in developing new strategies for Dengue
prevention.
70
Basic Virology: BV
BV464 - Antiviral Activity Of Extracts
Of Bacteria Isolated From Soils Mounds
Against Bovine Viral Diarrhea Virus,
Surrogate Model For Hepatitis C Virus
Barnabé, A.C.S., Padilla, M.A., Kohn, L.K., Porto, P.S.,
Morandi, B.C., Menezes, C.B., Fantinatti-Garboggini, F.,
Uetanabaro, A.P.T., Bomfim, G.F., Arns, C.W.
1. Universidade Estadual de Campinas, UNICAMP,
Departamento de Genética, Evolução e Bioagentes, Instituto
de Biologia
2. CPQBA/UNICAMP, CPQBA/UNICAMP
3. Universidade Estadual de Santa Cruz, UESC
4. Universidade Estadual de Feira de Santana, UEFS
Hepatitis C virus (HCV) is an important human pathogen
that causes acute and chronic hepatitis, evolving
frequently to cirrhosis and hepatocellular carcinoma.
There is currently no vaccine available and treatment
has limited effectiveness; however, research in this area
is ongoing. The termites are present in tropical soils
and have in their bacterial microbiota species as class
Actinobacteria and the genus Bacillus. In the present
study, was evaluated the antiviral activity of extracts
of bacteria isolated from soil mounds in northeastern
Brazil against bovine viral diarrhea virus (BVDV), as a
surrogate model of HCV. Extracts were obtained from
microorganisms isolated from land of termite were
incubated in culture medium for four week at 30°C
and these inoculums were extracted by liquid-liquid
extraction with ethyl acetate. Determination of antiviral
activity was based on cytopathic effect inhibition the
BVDV virus (100 TCID50/50 µL) after 72 hours of
incubation. Was performed the virus titration technique
and calculated the percentage of viral inhibition (PI)
of the samples. 66 extracts were tested, but only one
extract, CDPA27_1, presented antiviral potential against
BVDV, with 98% of PI. Two extracts, LC32_1 e CDPI07_1,
showed toxicity at the concentration tested (50µg/Ml)
for the MDBK cell line. The microorganisms from termite
mounds are source of natural products important for
pharmaceuticals. Additional studies are necessary to
evaluate the mechanisms of action and the chemical
compounds responsible for the activity. Financial
support: FAPESP/CNPq
BV465 - Modulation Of Cellular Genes
The Nfκb Pathway By 17b-Estradiol In
Cell Lines Infected With Htlv-1 (Human
T-Lymphotropic Virus 1).
Martins, M.L., Barbosa-Stancioli, E.F., De Carvalho, L.,
Souza, J.G., Gomes, R.A., Martins, C.P.S., Fagundes, E.M.S.
1. Universidade Estadual de Santa Cruz, UESC, BR-
415, Rodovia Ilhéus- Itabuna, Km-16 Solobrinho, Ilhéus - BA,
45662-000 (73)
2. Universidade Federal de Minas Geraes, UFMG,
Av. Antônio Carlos, 6627, Pampulha Belo Horizonte - MG,
31270-901
3. Fundação Centro de Hematologia e Hemoterapia
de Minas Gerai, Hemominas, Alameda Ezequiel Dias, 321,
Santa Efigênia Belo Horizonte - MG, 30130-110
HTLV-1 retrovirus was the first to be isolated in humans
and can induce leukemia, T-cell lymphoma (ATL) and
HTLV-associated myelopathy (HAM / TSP). The HTLV-1
can be transmitted by breastfeeding, during intercourse
and through blood transfusions or sharing contaminated
needles and syringes. Transmission of HTLV-1 more
effective from men to women and infected women get
sick more often than men. Greater female susceptibility
to HAM / TSP is reported in different populations
around the world and its cause is unclear although
recent studies point to a possible hormonal factor. In
this context, the aim of this study was to evaluate the
regulation by 17 β estradiol of the NFκB pathway genes
in human lymphocyte lines permanently infected with
HTLV-1 (C-91PL cells) and uninfected cells (Jurkat
cells) .Cells were treated with different concentrations
of 17β estradiol (1μM to 0.0001 µM). The hormone
is not cytotoxic at the concentrations evaluated. Cell
viability was assessed by flow cytometry (HFS). The
expression of cellular genes related to pathway the
NFκB was evaluated by PCR of a set of 84 genes after
treatment with 17β estradiol in the concentrations of 1
µM and 0.01 µM in C91PL cells (CD4 + / CD25 + / HTLV1 positive) and Jurkat cells (CD4 + / CD25 + / HTLV-1
negative). Altogether 15 genes were regulated. Thus 11
genes regulated in a concentration-dependent manner,
in which showed a negative regulation in infected cells.
The results suggest that fluctuations in estradiol levels
may alter the expression of regulatory molecules NFκB
pathway during infection with HTLV-1, contributing to
the processes of inflammation and chronic infection
observed in infected individuals, especially in the context
of infection in women.
BV497 - Cytotoxic And Antiviral (AntiHsv-1) Activities Of Extracts Of Clusia
Fluminensis Planch & Triana
Meneses, L.C., Barcelos, I.O., Giongo, V., Silva, M.C.A.,
Kaplan, M.A.C., Paiva, S.R., Paixão, I.C.N.P.
Carlos Chagas Filho, 373. Bl. H, Cidade Universitária, RJ 21.941-902
2. Universidade Federal Fluminense , UFF, Rua Outeiro
71
Basic Virology: BV
de São João Batista, s/nº, Valonguinho - Niterói, RJ - 24.020150
Herpes simplex virus type 1 (HSV-1) is a virus that has
enveloped double-stranded DNA. The HSV-1 infects
mucosal epithelial cells and is able to establish latency
in sensory ganglia. The transmission of this virus occurs
when some kind of fissure in the skin or mucosa gets
in direct contact with infected secretions. The most
common clinical manifestations are mucocutaneous
lesions, genital infections, neonatal infections,
keratoconjunctivitis, encephalitis and gingivostomatitis.
Prolonged treatment with drugs already known, such
as acyclovir, favors the emergence of resistant strains,
especially in immunocompromised patients. Due to this
trend, it is necessary and urgent to develop and search
for new substances to prevent and treat infections by
HSV-1. Clusiaceae currently comprises 14 genera, and
is characterized from the chemical point of view the
presence of xanthones, benzophenones, flavonoids,
coumarins, terpenoids, among others. In this study, was
evaluated the activity of crude extracts of vegetative and
reproductive parts of Clusia fluminensis Planch & Triana,
a native of the Brazilian coast, in the in vitro replication
of HSV-1. The natural extracts evaluated showed some
cytotoxicity compared to positive control, acyclovir, with
the exception of hexane extracts of ripe fruit (CFFRH),
leaves methanol (CFFM) and methanolic fruit (CFFRM).
The extracts showed high inhibition percentage
against HSV-1, reaching 81,4 to 100% inhibition in
noncytotoxic concentrations (50μg/ml), except for the
dichloromethane extract of flowers (CFFLD), whose
CC50 = 19μg/ml. The results obtained with extracts
of Clusia fluminensis Planch & Triana corroborate the
idea that the plant extracts represent a valuable source
of substances with potential anti-HSV-1 activity, being
promising for in vitro studies of its mechanism of action.
Financial support: CAPES, CNPq, FAPERJ.
BV517 - Effect Of Adenovirus 5 Infection
With The Expression Of Four Genes
Involved In Cell Cycle
Giehl, I.C., Rigotto, C., Henzel, A., Staggemeier, R., Dalla
Vecchia, A., Jesus, L.F., Bianchi, E., Spilki, F.R.
Universidade Feevale, FEEVALE, Rodovia RS 239,
n2755 - sala 205, CEP:93352-000, Novo Hamburgo/RS
Adenoviruses are DNA and no enveloped viruses
that belong to the Adenoviridae family. Some human
adenoviruses, most specifically human serotype 5
(HAdV-5) are causative of respiratory tract infections.
HAdV-5 encodes several proteins that can interfere with
cellular mechanisms that regulate cell cycle progression
and apoptosis. In order to understand what might be the
impacts of adenoviruses on cells of different organisms,
studies evaluating the effect of infectious viral particles on
the expression of cellular genes are frequent. Therefore,
the aim of this study was to evaluate the expression of
four cellular genes involved in cell cycle, in the early
phase of infection - 1h post infection (p.i). HAdV-5 was
inoculated onto human lung carcinoma cell line (A549)
reaching the concentrations of 1 and 5 MOI (multiplicity
of infection). Negative control, mock inoculated cells,
was also performed in order to normalize the results.
One hour p.i, total RNA was extracted by a commercial
kit (Ambion), followed by cDNA synthesis. Real time
PCR was performed using primers that targeted the
following genes: CCNDBP1, TGFBR1, DHFR and Smurf2;
β-actin coding gene was used as the endogenous control.
The comparative threshold cycle (Ct) method was
used in order to quantify changes in gene expression
between the no infected negative control and the
infected groups. Our preliminary results showed that
the expression of CCNDBP1 and DHFR genes remained
virtually unchanged at this time point and tested virus
concentrations. Nevertheless, TGFBR1 and Smurf2,
molecules involved in the TGF-β signaling, showed an
increase of 9.7 and 3.3 fold, respectively, when compared
to the negative control, in the 5 MOI concentration. This
was an expected behavior, since TGF-β cascade blocks
advance through the cell cycle, what is habitual during
HAdV infection. These results represent a previous
approach regarding the possible impacts of adenoviral
infection over transcription in human cell lines. Financial
support: CAPES & FAPERGS.
BV530 - Inhibition Of Dengue Virus Infection
By Bovine Lactoferrin
Pereira, J.G.
RJ, RJ
Bovine lactoferrin (bLf) is a multifunctional ironbinding glycoprotein, known for exerting a broadspectrum primary defense against bacteria, fungi and
viruses. In order to investigate the mechanism by which
bLF exerts its antiviral activity, we evaluated the effects
of bLf treatment on the infection process of dengue
virus serotype 2 (DENV-2), an arbovirus responsible
for hundreds of millions of cases of human infection
each year. Our results show that bLf was able to inhibit
infection by DENV-2 in Vero cells without leading to
cytotoxic effects. Furthermore, when assessing the
stages of viral infection compromised by treatment with
bLf, we demonstrated that the antiviral action of the
protein occurs predominantly during viral entry into the
cell. Imaging of the early steps of cell infection by DENV-2
72
Basic Virology: BV
labeled with fluorescent probes is underway to evaluate
the effect of bLf on the dynamics of this phase of viral
infection. Our findings suggest a new approach against
DENV-2 infection and highlight the antiviral potential of
bLf.
BV538 - Effect Of Extracts Schinus
Terebinthifolius And Punica Granatum On
Mayaro Virus Replication.
Tiago, S.S., Marcelo, D.F.M., Yamamoto, K.A., Kuster,
R.M., Da Silva, M.R.S., Ferreira, D.F.
Departamento de Virologia, Instituto Microbiologia Prof.
Paulo de Góes. CCS
Núcleo de Pesquisas de Produtos Naturais, Centro de Ciências
da Saúde
Departamento de Bioquímica, Instituto de Química, Centro
Tecnológico
Mayaro virus (MAYV) is an arbovirus belonging to the
genus Alphavirus, Togaviridae family which causes a
disease known as Mayaro fever presenting symptoms
similar to the classic dengue fever. MAYV is endemic in
tropical and subtropical regions on the borders of the
Amazon Basin. The Brazilian popular medicine has been
exploring the anti-inflamatory properties of substances
extracted from the plants Schinus terebinthifolius
(known as mastic) and Punica granatum (known as
Pomegranate). In this work we tested the antiviral effect
of these substances against the Alphavirus MAYV. The
toxicity of these substances in VERO cells was tested by
the incorporation of neutral red after 24h of treatment.
The CC50 of each substance was determined: 242, 315,
102 and 5000 µg/mL in acetate, flavonoids 1 and 2 and
oil of Schinus, respectively, and 590 and 442 µg/mL
for Crude Extract and Acetate of Punica, respectively.
After the determination of non-toxic concentrations of
the substances, tests were conducted to evaluate the
antiviral effect. Cells were infected with MAYV using
a MOI=0,1. Treatment of cells was carried out for 24h
with increasing concentrations of the substances. The
viral production was quantified using the methodology
of plaque formation. The IC50 of each was determined
by a dose response graph, and were 4,3; 4,5; 14 and
830 µg/mL µg/mL for acetate, flavonoids 1 and 2 and
oil of Schinus, respectively, and 12 and 30 µg/mL for
Crude Extract and Acetate of Punica, respectively. The
selectivity index (ratio CC50/IC50), was determined and
the values were greater than 7 for all substances. We also
tested the substances for virucide properties, adsorption
impairment and pretreatment. Our results show more
than 95% virucidal effect for the partitions acetate,
flavonoids mastic and Crude Extract of pomegranate.
Mastic oil 22%, and acetate of pomegranate did not
present virucidal effect. We conclude that some of the
partitions in our substances act directly on the virus
particle, and we are now assaying for this interaction at
the molecular level. FAPERJ, CNPQ, INBEB
BV540 - Cytotoxic And Anti-Hsv-1 Activities
Of Natural And Synthetic Heterocyclic
Ribeiro, M., Giongo, V., Borges, J., Pestana, C., Faria, D.,
Bernardino, A., Teixeira, V., Paixão, I.C.P.
Universidade Federal Fluminense, UFF, Outeiro de
Saso Joao Batista ss/n - Centro Niterói-Rio de Janeiro- Brasil
Infection with herpes simplex virus type 1 is responsible
for the development of oral, ocular and genital lesions,
establishing a lifelong latency in the host subject to
periodic reactivations. Despite the use of nucleoside
analogues, mainly acyclovir as effective therapy, in most
cases the prolonged use and immune status of the host
can stimulate the emergence of resistance to these
drugs. For this reason the elucidation of new molecules,
natural or synthetic, that could act in a different step of
HSV-1 replication or synergistically with acyclovir are
the main focus of viral resistance studies. We identified
the potential anti-herpes activity of caulerpina, isolated
from Caulerpa racemosa and quinoline derivatives JV
23(Fluoride radical), JV 28(Chloride and methil radicals)
and JV 29( Methil ester and Chloride radicals) in VERO
cells infected with strains AR-29 and KOS. In time of
addition studies, all the substances quinoline derivatives
examined were considered suitable for viral inhibition
in the presence of the strain AR29. In the order hand,
the caulerpina only inhibited the replication of HSV-1
virus in cells infected with KOS strain. The substance JV
29 also showed virucidal activity. Based on our results
we conclude that the caulerpina and substances derived
from quinoline JV23, JV28 and JV29 showed promise for
anti-HSV-1 activity.
BV542 - Antiviral Activity Of Synthetic
Quinolone Against Bovine Herpesvirus-5
Pinto, A.M.V., Leite, J.P.G.L., Santos, F.C., Souza, M.C.B.,
Paixão, I.C.N.P.
1. Universidade Federal Fluminense, UFF, Universidade
Federal Fluminense, Rua Professor Hernani Melo, 101, São
Domingos
2. Laboratório de Virologia Comparada, Fundação
Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365, Manguinhos,
CEP: 21040-360 Rio de Janeiro
Bovine herpesviruses type 5 (BoHV-5) is an important
etiologic agent of meningoencephalitis in cattle and has
73
Basic Virology: BV
been identified in outbreaks of neurological disease in
several Brazilian states. During the lytic cycle of BoHV-5
replication the genome is expressed in three temporal
phases known as immediate-early, early and late. This
study aimed to evaluate the in vitro cytotoxic effect
and the antiviral properties of a series of synthetic
quinolonecarboxamide and theirs derivatives obtained
by chemical synthesis in BoHV-5 RJ42/01 replication.
The cytotoxic effect has been measured in MadinDarbin bovine kidney cells treated with different drug
concentrations. Cytotoxic concentration (CC50) values
have been determined for acyclovir: CC50 (989 ± 2.0)
and compounds MPD19-Cl CC50 (1798 ± 4.1); MPD31CH3: CC50 (1239 ± 4.5); and MPD59-CH3 CC50 (1046 ±
7.1). Antiviral analyses of the compounds against BoHV5 RJ42/01 virus consisted in measuring the inhibition of
cytopathic effect by plaque assay (PA) and EC50 values,
determined for acyclovir: EC50 (166 ± 2) and compounds
MPD19-Cl: EC50 (10 ± 6.2), MPD31-CH3: EC50 (6.0 ±
1.5) and MPD59- CH3: EC50 ( 42 ± 8.0). Time-of-addition
studies revealed blockage virus production in differents
stage of virus replication with exception to the compound
MPD 31 that slightly inhibited viral replication in the
first two hours post infection but it showed expressive
inhibition of virus replication after 3h p.i. Acyclovir
were used as control slightly reduced the viral titer. For
better understanding about mechanisms of the antiviral
activity by these compounds further investigations are
underway Financial support: CNPQ/UFF/ FIOCRUZ
ISGs, but can also be induced in an IFN independent way
directly by viral stress or other stimuli. The Bunyaviridae
family is composed by a group of more than 300 viruses,
mainly transmitted by arthropods, that can cause mild
to severe conditions varying from non-specific fever
and encephalitis to hemorrhagic fever in humans and
are recognized as posing an increasing threat to human
health. So far there is no data linking 2’5’OAS genes to
antiviral response against Bunyaviruses. We designed
quantitative PCR reactions for detection of all four
human 2’5’OAS gene family members and evaluated
the expression of each one in bunyavirus infected cells,
using VSV infected cells as a positive control. Tahyna and
Apeu viruses induced none to very low levels of: each
OAS family and IFNs in A549 cells ; OASL in VERO cells
; each OAS family in PBMCs. In contrast, VSV infections
induced higher levels of all these genes. We can conclude
that Tahyna and Apeu viruses are able to evade the IFN
system by inhibiting IFN and OAS genes in infected cells,
a finding that increases the concern about the emerging
potential of these viruses. Financial Support: FAPEMIG,
CNPq, CAPES.
BV577
Tahyna
And
Apeu
Viruses
(Bunyaviridae) Are Able To Evade The
Interferon Response By Inhibiting Type I
Ifns And 2’5’oas Genes Induction
Oliveira, D.B., Almeida, G.M.F., Botelho, L.M., Silva,
L.K.S., Abrahão, J.S., Bonjardim, C.A., Trindade, G.S.,
Kroon, E.G., Ferreira, P.C.P.
Universidade Federal de Minas Gerais, UFMG, Avenida
Antônio Carlos, 6627, Caixa Postal 486, Bloco F4, Sala 258
31270-901 Bel
IFNs are cytokines that exerts antiviral and
immunomodulatory actions through the regulation of
IFN stimulated genes (ISGs). These genes are expressed
as a result of intracellular signaling pathways activated
by the binding of an IFN to its cellular receptor and are
crucial for creating and maintaining a correct immune
response. The 2’5’OAS gene family comprises four
different genes (OAS1, OAS2, OAS3 and OASL) that
can produce up to ten different variants by alternative
splicing. 2’5’OAS gene products are latent enzymes
with important antiviral activity, since they are able to
suppress protein synthesis on virus infected cells. These
genes are induced directly by IFN stimulation like other
Environmental Virology: EV
75
EV3 - Swine Manure Sanitary Surveillance
For Biofertilizing Purposes
Fongaro, G., Viancelli, A., Elmahdy, E.M., Pilotto, M.R.,
Kunz, A., Barardi, C.R.
1. Universidade Federal de Santa Catarina, UFSC,
Campus Universitário Reitor João David Ferreira Lima Trindade Florianópolis
2. Embrapa Suínos e Aves, Embrapa, Linha Tamanduá
- Concórdia (SC)
The use of anaerobic biodigesters (AB) for swine manure
management allows storage and biogas recovery. The
final effluents can be used as biofertilizers, but this
depends on safety parameters (presence of pathogens).
This study aimed to quantify porcine circovirus (PCV2)
and Rotavirus–A (RVA) genomes by qPCR, and total
coliforms (TC) and Escherichia coli (EC) by classical
microbiological methods (MPN) in biofertilizers from
swine manure. A total of 14 samples were collected
during the summer/2013 in Concórdia, Brazil, consisting
of Biofertilizer A–BFA (farm with nursery production),
Biofertilizer B–BFB (farm with grow-finish production)
both analyzed before and after AB treatment and
Biofertilizer C–BFC (farm with grow-finish production),
analyzed before AB. Regarding PCV2 presence, all
samples (BFA, BFB and BFC) were 100% positive before
treatment (1x108GC/mL, 3x107GC/mL and 5x107GC/
mL, respectively). The treatment process did not show
total efficiency, and 25% and 100% of samples on
BFA and BFB were positive, ranging respectively from
2×107 to 4×108GC/mL and 2x107 to 3x109GC/mL.
Regarding RVA presence, 100% of nursery production
farm (BFA) were positive before (1x1011GC/mL) and
after treatment (ranging from 2×105 to 2×108GC/mL).
RVA was not detected on grow-finish production farm
(BFB) before but surprisingly was detected on 50% of
these samples after treatment (ranging from 3x105 to
3x106GC/mL) which can be explained by the different
sampling times. For BFC, RVA was present in a range of
3x107 to 3x1012GC/mL. In addition, treatment process
did not show efficiency on TC and EC removal. The PCV2
and RVA reduction observed after AB treatment can
be explained by the capacity of AB to induce manure
precipitation in sludge form, carrying aggregated viral
particles and reducing the final viral load in the effluent
(biofertilizer). However, these results reinforce the need
to improve pathogens inactivation in biofertilizers,
before their use in agriculture.
EV8 - Acanthamoeba Polyphaga Mimivirus
Stability
In
Differents
Substrates:
Implications For Prospecting Studies
Silva, L.C.F., Dornas, F.P., Almeida, G.M., Campos, R.K.,
Boratto,P.V.M., Franco-Luiz, A.P.M., La Scola, B., Ferreira,
P.C.P., Kroon, E.G., Abrahão, J.S.
Antônio Carlos, 6627 - CEP: 31.270-901 Belo Horizonte - MG
- Brasil
2. Aix Marseille Universite
Viruses are extremely diverse and abundant and are
present in countless environments. Giant viruses of
the Megavirales order have emerged as a fascinating
research topic for virologists around the world. As
evidence of their ubiquity and ecological impact,
mimiviruses have been found in multiple environmental
samples. Currently, the isolation of giant viruses has been
prospected, but it seems to be laborious due the isolation
protocols limitations and lack of information regarding
the interactions between viruses and substrates. Thus,
this study aimed to verify the stability of Acanthamoeba
polyphaga mimivirus (APMV) in hospital (ventilator
plastic device tube) and environmental (soil, freshwater
and saline water) substrates and validate an enrichment
protocol for isolation of Mimiviridae. Therefore, to test
the APMV recovery from the assayed substrates, a total
of 106 purified APMV was re-suspended in phosphate
buffered saline (PBS) and added to autoclaved
substrates, which were previously tested for APMV
DNA and/or infectious particles. After one hour, all
the samples were titrated in Acanthamoeba castellanii
by the TCID50 method. Along one year, every month,
substrates described above, initially added with APMV,
were submitted to amoebae titration and Real-Time
PCR. Furthermore, at the same time, the substrates
added to APMV were submitted to enrichment protocol.
Briefly, 500 ul of samples were added to 450 ml waterrice medium and kept in the dark at room temperature
for 5 days. Following this incubation, 5000 pathogenfree amoebas were added to the samples, and 5000
more amoebas were added after twenty days. The
samples were titrated in amoebae after thirty days and
then every subsequent month for one year. The effect
of enrichment protocol in biology, morphology and
genetics of recovered viruses was evaluated by onestep-growth-curves, electron microscopy and genetic
analysis. The enrichment protocol implemented was
able that remarkably increased viruses detection from
all tested substrates. Moreover, biological, morphological
and genetic tests revealed that the enrichment protocol
maintained viral particle reliability. In conclusion, our
work demonstrated a long-lasting stability of APMV
in environmental and hospital device samples and
proposed a reliable and easy protocol to improve giant
viruses isolation.
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV
76
EV79
Molecular
And
Biological
Characterization Of Kroon Virus A New
Giant Virus Of The Mimiviridae Family
Isolated From An Urban Lake
Dornas, F.P., Boratto, P.V.M., Rodrigues, R.A.L., Silva,
L.C.F., Ferreira, P.C.P., Bonjardim, C.A., Trindade, G.S.,
Kroon, E.G., La Scola, B., Abrahão, J.S.
Av. Antônio Carlos, 6627 - Pampulha 31270-901 - BELO
HORIZONTE - MG
2. Universitée de la Méditerranée, Marseille, França,
Univmed, Marseille, França
The members of the Mimiviridae have been isolated
from samples of water, soil, contact lens, cooling towers,
etc. Although, despite those studies have demonstrated
the presence of giant viruses in different ecosystems,
there is no data regarding giant viruses in Minas Gerais
State. Therefore, this work aimed to isolate viruses of
the Mimiviridae family as well as other giant viruses in
a lake in Lagoa Santa city, MG, Brazil. Waters samples
were equidistantly collected from 14 points of this lake,
in a total of 5 collection procedure per point (n=70).The
water samples were submitted to an enrichment process
in rice medium and then were filtered afterwards (in
200nm filters) to retain the viruses. Samples were eluted
in PBS and then inoculated in amoebae (Acanthamoeba
castellanii) cultures to isolation. In parallel, the samples
were submitted to a Real-Time PCR assay, targeting
the helicase viral gene, which is conserved in the
Mimiviridae family. The PCR results indicated the
amplification of viral target in 6 samples. Accordingly, 2
samples were positive in isolation tests (all PCR positive
samples). We selected one viral sample, named Kroon
virus, for further characterization. Biological analyses,
including cytopathic effect assays, resistances tests,
optical microscopy and gram stain have revealing unique
features of Kroon virus. Electron microscopy imaging
revealed a giant virus, with dimensions similar to that
described for other mimiviruses. The helicase gene
sequencing and phylogenetic analyses indicated that
Kroon virus belongs to group A mimivirus, clustering
together with APMV, mamavirus and Samba virus. The
isolation of Kroon virus, from an urban lake reinforce the
idea that giant viruses are ubiquitious and suggests that
these viruses may be ecologically important in aquatic
ecosystems.
EV112 - Amazonia Virus: Another Giant
Virus Of The Mimiviridae Family Isolated
In The Brazilian Amazon Rainforest
Rodrigues, R.A.L., Dornas, F.P., Boratto, P.V.M., Campos,
R.K., Silva, L.C.F., Ferreira, P.C.P., Bonjardim, C.A.,
Trindade, G.S., Kroon, E.G., La Scola, B., Abrahão, J.S.
Presidente Antônio Carlos, 6627, Pampulha, Belo Horizonte,
MG, Brasil
2. Universitée de la Méditerranée, Univmed, Marseille,
France
The Mimiviridae family comprises giant DNA viruses,
included in nucleocytoplasmic large DNA viruses
(NCLDV) group. These viruses infect ubiquitous
amoeba’s species of Acanthamoeba genus, which
indicate the possibility of these viruses being ubiquitous
as well. Several studies have been trying the isolation
of NCLDV in samples of cooling towers, soil, water,
etc. Among Brazilian’s biomes, the Amazon rainforest
comprises uncountable species of plants, animals and
micro-organisms. However, viruses of this biome are
poorly studied. Thus, the aim of this work is to search for
viruses of the Mimiviridae family in the Rio Negro River,
AM, Brazil. Samples were collected at various points of
the river and submitted to an enrichment process in rice
medium and filtered afterwards (in 200nm filters) in
order to retain possible viruses in the filter. Samples were
eluted in PBS and inoculated in amoeba (Acanthamoeba
castellanii) cultures aiming viral isolation and, at the
same time, submitted to Real-Time PCR assay, for
amplification of the viral helicase gene, a marker gene
in Mimiviridae family. The results of Real-Time PCR
tests indicated the presence of the viral helicase gene
in some water samples and one virus was isolated from
a sample using amoeba cultures and named Amazonia
virus. Phylogenetic analyses were performed using the
MEGA 5.0 program and showed virus relationship with
the Mimiviridae family indicating that Amazonia virus is
a member of the family, representing another giant virus
isolated in Brazil. Additionally, cytopathic effect assays,
optical microscopy and gram stain were done, revealing
unique characteristics of Amazonia virus. The recently
isolated virus will be submitted to resistance tests,
one-step growth curve and electronic microscopy for a
better biological and morphological characterization.
The isolation of Amazonia virus reinforces the idea
that giant viruses are ubiquitious and suggests that
these viruses may have some ecological importance.
Key-words: Mimiviridae, Rio Negro River, giant viruses,
virus characterization, virus isolation. Finantial support:
CNPq, FAPEMIG, CAPES, MAPA, PRPq
EV133 - Detecting Human Pathogenic Viruses
On Aquatic Environments: Development
Of A Qpcr Platform For Water Quality
Assessment
Alves, P.A., Brandão, L.R., Almeida, G.M., Fonseca, F.G.,
Rosa, C.A., Trindade, G.S.
77
Antônio Carlos, 6627, Campus Pampulha, CEP: 31270-901.
Belo Horizonte, MG
Viruses are considered important contaminants of
aquatic environments that can, consequently, be
important sources for infections such as gastroenteritis.
However, viruses are not yet included in the parameters
commonly evaluated in order to determine water quality.
The most frequent human pathogenic viruses that can be
found in water samples are Human adenovirus (HAdV),
Rotavirus A (RVA), Norovirus genus (NoV) and Hepatitis
A virus (HAV). The aim of this study was the development
of a real time PCR platform for the detection of human
enteric viruses (HAdV, RVA, NoV and HAV) in aquatic
environments. Positive controls were synthesized, cloned
into pGEM-T easy vector (Promega), and used for the
validation of the designed primer pairs. Standard curves
ranging from 1ng to 10.0 fg were prepared, reactions
were performed using the SYBR® Green PCR Master
Mix (Applied Biosystems), and the detected efficiency
and linearity coefficients (R2) for each primer pair
were: HAV (94%; 0,998), RVA (99%; 0,996), HAdV (92%;
0,999) and NoV (105%; 0,983). These initial results
indicate that the platform can be used for detection of
the targeted viruses in environmental samples, which
will be prepared and used as template for our reactions
in the near future.
EV139
Detection
Of
Noroviruses
Genogroups I And Ii In Bathing Water From
Mosqueiro Island, Belém Area, Pará State,
Brazil.
Deus, D.R., Teixeira, D.M., Spada, P.K.P., Correa, V.C.,
Santos, D.S.A., Girard, R.P., Lopes, L.C., Morais, L.L.C.S.,
Mascarenhas, J.D.P., Gabbay, Y.B.
1. Seção De Virologia Do Instituto Evandro Chagas ,
Iec, Svs, Ms, Br 316 Km 7 Ananindeua, Pará
2. Seção De Meio Ambiente Do Instituto Evandro
Chagas, Iec, Svs, Ms, Br 316 Km 7 Ananindeua, Pará
3. Universidade Federal Do Pará, Ufpa, R. Augusto
Corrêa, 1 - Guamá, Belém, Pará
Bathing water quality can be affected by various
contaminants sources such as dumping of untreated or
ineffectively treated sewage. Therefore, these aquatic
environments can present several viruses, including
the noroviruses (NoVs), which are involved in sporadic
cases of acute gastroenteritis, hospitalizations and
outbreaks, and can be associated with the contamination
of recreational water as well. This study aimed to detect
NoVs genogroups I and II, in bathing water samples,
collected from four freshwater beaches (Farol, Murubira,
Areiao e Paraiso) located at Mosqueiro Island, Belem
area, Para State, Brazil. One sample per month was
collected, from January to December 2012, with two
fortnightly collections in July. The water samples (two
liters) were concentrated by adsorption-elution in
filtering membrane followed by RNA extraction by the
silica method. NoVs detection was performed using the
semi nested RT-PCR method using in the first step the
primers pair JV13I/JV12Y, and in the second step the
pair JV13I/GI and JV12Y/NoroII-R, which target the viral
RNA-dependent RNA polymerase and is specific for GI/
GII, respectively. A total of 52 samples were collected and
analyzed for NoVs presence, with a positivity of 38.5%,
of which 60% (12/20) were classified as GI, 30% (6/20)
as GII and 10% (2/20) as GI+GII. The co-circulation of
both genogroups was detected in the beaches of Paraiso
(July) and Murubira (November). The greater number
of positive samples was detected in the beach of Paraiso
(n=7), followed by Farol (n=5) and Areiao/Murubira
(n=4) beaches. In April, NoVs was detected in all sites
studied. These results show the circulation of NoVs in the
most popular beaches of Mosqueiro Island. This suggests
the existence of a probable source of fecal contamination,
evidencing a risk to human health, mainly by hazard
of accidental ingestion during recreational activities,
especially involving children. To our knowledge, this is
the first report about the presence of NoVs in beaches
from Northern of Brazil.
EV162 - Evaluation The Use Of Bacteriophages
To Control Of Biofilm Formed By Bacterial
Isolates From Reverse Osmosis Systems.
Dias, R.S., Fonseca, L.A.B.V., Albanese, J.M., Belgini,
D.R.B., Siqueira, V.M., Suhette, R., Torres, A.P,R., Sousa,
M.P., Silva, C.C., De Paula, S.O.
1. Universidade Federal de Viçosa, UFV, Universidade
Federal de Viçosa – UFV, CP 36570-000
2. Research Center for Chemistry, Biology and
Agriculture , CPQBA, Campinas University - UNICAMP, CP
6171, CEP 13081-970, Campinas, SP, Brazil
3. Centro de Pesq. e Desenv. Leopoldo Américo Miguez
de Mello, Cenpes, Federal University of Rio de Janeiro – UFRJ,
CP 21941-915, RJ, Brazil
The current trend in wastewater management by
industries focuses on pollution prevention, either by
the reduction of the use of natural resources or the
application of clean technologies with low environmental
impacts. In this sense, the technology of reverse osmosis
(RO) membrane has been widely used by various
industries, such as petroleum refineries. Biofilms are
microbial communities that develop adhered to a
surface and surrounded by extracellular polysaccharides
substances. As microbial communities, biofilms are
assemblages of diverse species occupying the same
78
functional discrete environment that have a complex
level of organization with a distinctive and specialized
structure and particular activities, which depend on the
relationships between their constituents. Since biofilms
are very difficult to eradicate, the ability of bacteria to
form biofilms poses a major problem in various industrial
settings, being a persistent source of (re)contamination.
The impenetrable character of the biofilm, the slow
growth rate of the constituent organisms and the
induction of resistance are examples of mechanisms
proposed to explain the observed increased endurance
of biofilms to antimicrobial and disinfectant agents. The
application of bacteriophages has been nowadays seen
as a good alternative to prevent and control biofilms
in waste water treatment plants and RO systems. One
bacteriophage was isolated from activated sludge. It was
named according to the characteristics of the bacterium
and the culture medium in which it was isolated:
UFVhalophage01. After the addition of phage, it was
possible to observe statistically significant reduction in
biofilm biomass of most strains, isolated from RO system
feed water. The UFVhalophage01 phage is not specific
to the bacterial isolates tested, thus its interference in
biofilm formation maybe due to its ability to inhibit
biofilm formation mainly by the action of depolymerase,
or by infection of the cell without necessarily causing
cell lysis. Financial Support: PETROBRAS
EV223 - Detection Of Mimivirus And
Megavirus Genome In Vertebrate Sera
Samples
Rodrigues, F.P., Dornas, F.P., Boratto, P.V.M., Ferreira,
P.C.P., Bonjardim, C.A., Trindade, G.S., Kroon, E.G., La
Scola, B., Abrahão, J.S.
Antônio Carlos, 6627 - Pampulha - BELO HORIZONTE - MG
2. Universitée de la Méditerranée, Marseille, França,
Univmed, Marseille, França
The members of the Mimiviridae have been isolated from
samples of water, soil, contact lens, and cooling towers
in amoebaes, and the genome has already detected in
human. During metagenomic studies, which culminated
with the discovery of Schmallenberg virus, the presence
of Mimivirus genomewas demonstrated in sera of
cattle in Europe. In addition to that, many evidences
support the idea that mimiviruses might be a vertebrate
pathogen. Therefore, this work aimed to detect viruses
of the Mimiviridae family as well as other giant viruses
in silvatic and domestic animals samples from legal
Amazon Region. To develop this study, we selected 68
monkeys’ samples to the specie Alouatta caraya, 163
monkey samples to the specie Cebus apella, both from
the Tocantins state and 134 bovines samples of Pará
and Maranhão state. These samples were grouped into
pools with 20μL serum to the each 5 animals of the same
species, to optimize the analysis. The DNA extractions
was performed by PCI protocol and then, were submitted
to a Real-Time PCR assay, targeting the helicase viral
gene, which is conserved in the Mimiviridae family, using
the Kit Step One® from Applied Biosystem. The pools
samples to the monkeys Cebus apella were positive
(n=9) and the pools bovines samples (n=15), while all
the samples belonging to Alouatta caraya monkeys were
negative. Sequencing analyses revealed samples with
high identity with mimiviruses and megaviruses isolates.
Although inconclusive in the context of mimiviruses
pathogenesis, our results indicate that giant virus may
be in association with vertebrates in Brazilian Amazon.
EV255 - Evaluation Of Trhee Different
Concentration Methods To Recovery
Noroviruses From Strawberry Samples
Melgaço, F.G., Victoria, M., Corrêa, A.A., Miagostovich,
M.P.
1. Fundação Oswaldo Cruz, Fiocruz, Av. Brasil, 4365,
Manguinhos, Rio de Janeiro
2. Universidade Federal Fluminense, UFF, Rua Prof.
Hernani Melo,101, São Domingos, Niterói, RJ
3. Universidad de la República Regional Norte, unorte,
Rivera, 1350, Salto, Uruguay
Norovirus (NoV) is the most important agent of food
borne outbreaks of acute gastroenteritis and their
identification in foods is difficult due to the complexity
of the food matrix. This study evaluated the efficiency of
three viral concentration methods as organic flocculation
(skimmed milk), polyethylene glycol (PEG) precipitation
and adsorption-elution for Human NoV GII.4 (NoV
GII.4) and Murine Norovirus (MNV-1) recovery from
strawberries samples. For organic flocculation method,
two buffers (Glycine 0.05M/Tris-HCl 0.1M and PBS) and
two containers (filter bag and becker) were evaluated.
PEG precipitation method used Glycine 0.05M/TrisHCl 0.1M with 3% beef extract as an elution buffer. The
adsoption-elution method, using negatively charged
membranes, was performed with Glycine 0.05M/TrisHCl 0.1M buffer, following an ultrafiltration step using a
Centriprep Concentrator®. The viral RNA was extracted
by QIAamp viral RNA mini kit® (Qiagen) and the cDNA
produced. The viral quantification was performed by real
time PCR using primers and probes previously described.
For the flocculation method, the Glycine buffer showed
higher recovery success for both viruses independent of
the container used. Considering the recovery efficiency
for both viruses the use of filter bag was more efficient
when compared to becker, although Glycine buffer
did not provide a good result for MNV-1 recovery. The
79
combined analysis of success and efficiency of recovery
determined that organic flocculation using Glycine and
filter bag was the best option, with 15.9% and 12.8%
recovery for GII.4 and MNV-1, respectively. The PEG
methodology recovered NoV GII.4 with a low efficiency
(6.4%) and MNV-1 (10.8%) as well the adsorptionelution method, for GII.4 (0.7%) and MNV-1 (0.9%).
These results suggest that an organic flocculation should
be the method of choice for recovery those viruses from
strawberries and could be used assist epidemiologic
investigations of outbreaks associated with NoV.
Financial support: MCTI/CNPq/ANVISA no. 23/2012 e
APQ1/FAPERJ. This research study is under the scope
of the activities of Fiocruz as a collaborating center of
PAHO/WHO of Public and Environmental Health.
Virus detection was performed by qPCR using primers
that targeted a conserved region (hexon) of the virus
genome. Viable HAdV were detected in 4 water samples
(4/55 = 8.8% - 3 springs and 1 stream) and 5 sediment
samples (5/20= 25% - 2 springs, 2 dams and 1 stream ).
The highest incidence of viable HAdV in sediment found
in this study suggests that viral particles aggregate
to sediment could be more protected and resistant to
inactivation when compared to those distributed in the
water column. In combination with the cell culture (i.e.,
ICC-RT-qPCR) important information concerning virus
viability were obtained suggesting fecal contamination
in the Sinos River region, which can pose a risk to public
health. Financial support: CAPES/ FAPERGS/ CNPQ/
FEEVALE
Universidade Feevale, Feevale, RS 239, 2755, Novo
Hamburgo, RS
2. Université de la Méditerranée - France
EV375
Detection
Of
Infectious
Adenoviruses In Water And Sediment
Samples In The Rio Dos Sinos Watershed, Rio
Grande Do Sul State, Brazil.
Staggemeier, R., Bortoluzzi, M., Heck, T.M.S., Weiler, C.,
Luz, R.B., Fabres, R.B., Soliman, M.C., Souza, F.G., Fleck,
J.D., Kluge, M., Jesus, L.F., Henzel, A., Rigotto, C., Spilki,
F.R., Almeida, S.E.M.
The watershed of Rio dos Sinos, northeastern of Rio
Grande do Sul, is located in an area of the Guarani
aquifer where the cities of Rolante and Riozinho are
inserted. Enteric viruses in the soil have the ability
to migrate through it by the successive adsorptiondesorption process, thus, reaching groundwater due to
the penetration of viral particles through soil. Among
the enteric viruses, adenoviruses (AdV) have been the
focus of many studies, mainly due to their persistence
in the environment. The integrated cell culture-reverse
transcription-quantitative PCR (ICC-RT-qPCR) assay
has been developed for the detection of viable virus
particles. providing a relatively rapid, efficient and
sensitive approach in detecting infective viruses by
combining cell culture and molecular techniques.The
main goal of this study was to assess the viral viability
ofhuman AdV (HAdV) by ICC-RT-qPCR in sediment and
water samples. Samples were collected from dairy farms
in the cities of Rolante and Riozinho, in the watershed
of Rio dos Sinos. Fifty-five water samples (springs,
wells, ponds and streams) were concentrated by the
negatively charged membrane method and 20 sediment
samples were directly eluted with E-MEM. To avoid
citotoxicity, samples were previously diluted 1:2 (water)
and 1:4 (sediment) and inoculated onto A549 cells for
24 hours. After this step, total RNA was extracted by a
commercial kit (Invitek®) followed by cDNA synthesis.
EV376 - Full Genome Sequencing Of Samba
Virus: A Giant Virus Of The Mimiviridae
Family Isolated From Negro River, In The
Brazilian Amazon Rainforest
De Assis, F.L., Aguiar, E.R.G.R., Campos, R.K., Boratto,
P.V.M., Silva, L.C.F., Ferreira, P.C.P., Marques, J.T., La
Scola, B., Kroon, E.G., Abrahão, J.S.
The Mimiviridae family comprises giant DNA viruses
which are studied as putative pneumonia agents in
humans. Recent metagenomic studies have detected
DNA of viruses of this family in natural aquatic
ecosystems. Although the Amazon rainforest is known
by its huge biodiversity, viruses of this biome are poorly
studied. Recently, our team isolated a giant viruses from
water samples collected at Rio Negro river, in a region
near to Manaus. Biological and molecular analysis, such
as electronic microscopy, PCR and sequencing of viral
gene, indicated the isolation of a new member of the
Mimiviridae family, named Samba virus (Samba). In this
study we performed Samba full genome sequencing and
analysis. Purified viral genomic DNA (10 micrograms)
was used to de novo genome sequencing using the
454 platform. Genome assembly tools revealed that
Samba present a genome size of 1.2 Mb, the second
largest viral genome ever described. Samba genome is
approximately 50,000 nt larger than APMV. The openreading frames (ORF) predictions were performed using
Markov-based methods implemented by Glimmer3
and Fgenes platforms, which predicted 1032 and 1298
ORF’s, respectively. We also performed the transfer of
annotation (RATT: Rapid Annotation Transfer Tool)
from a closely genome already annotated. The three
predictions were manually curated and the ORFs fixed in
80
a final prediction. Finally, 938 ORF’s were annotated as
putative genes, from which a search to gene similarity was
conducted. Many of the genes within the Samba genome
had not previously been found in viruses, except in the
virus of Mimiviridae family, including that putatively
encoded proteins with a role in protein translation and
involved in DNA repair. Moreover, 442 (47,12%) putative
genes remains without homologues encoded proteins. In
the following months our group will study the function
of Samba hypothetical genes, aiming to associate them
with viral structure and host-virus relashionships.
EV377 - Evaluation Of Removal Efficiency Of
Enteric Viruses By Secondary Treatment,
Activated Sludge, In A Sewage Treatment
Plant In Rio Grande Do Sul
Fabres, R.B., Fontana, T., Soliman, M.C., Staggemeier,
R. Kluge, M., Rodrigues, M.T., Bortoluzzi, M. Fleck,
J.D., Rigotto, C., Henzel. A., Nascimento, C.A., Giehl, I.,
Vecchia, A., Spilki, F.R.,
Universidade Feevale, Feevale, RS 239, 2755, Novo
Hamburgo, RS
The waste water treatment systems are usually divided
into preliminary treatment, primary, secondary and
possibly tertiary. Secondary treatment is also called
biological features as main characteristic the removal
of organic dissolved (soluble BOD) and suspended
(suspended or particulate BOD). The objective of
this study was to evaluate the removal efficiency of
Human adenovirus (HAdV) inactivated sludge after
secondary treatment in a Sewage treatment plant
located in Canoas, RS. Sewage samples were collected
after primary and tertiary treatment between 2011 and
2012, totalizing 10 samples. Viral nucleic acids were
extracted with a commercial kit (RTP DNA/RNA Virus
Mini Kit) and the real time polymerase chain reaction
(qPCR) was performed using primers design to amplify
the hexon protein gene of HAdV, namely VTB2 HAdVCf
(5’-GAGACGTACTTCAGCCTGAAT-3’) and VTB2 HAdVCr
(5’-GATGAACCGCAGCGTCAA-3’). Our results showed
that all samples after preliminary treatment were
positive for HAdV with minimum and maximum values
ranging from 4.0x10³ genomic copies/mL (gc/mL) and
5.2x104gc/mL. The HAdV removal efficacy observed
for the activated sludge secondary treatment was very
low, since the reduction on genomic copies between
the two treatment steps was below 1 log. In this study,
activated sludge secondary treatment was ineffective for
removal of HAdV in domestic sewage. Financial support:
FAPERGS, CAPES, CNPQ, Feevale.
EV387 - Seasonal-Spatial Assessment Of
Virioplankton Abundance In A Brazilian
Costal Region Influenced By Upwelling
System
Barbosa, J.E.F., Pereira, P.S., Lorena, L.G.M., Vogel, V.A.,
Ferreira, D.F., Nepomuceno, A., Caprez, M., Amorim,
L.M.F., Giongo, V., Paixão, I.C.P.
1. Universidade Federal Fluminense, UFF, Outeiro de
Saso Joao Batista ss/n - Centro Niterói-Rio de Janeiro- Brasil
2. FIOCRUZ, IOC, Av. Brasil -Rio de Janeiro
Avenida Brasil-Rio de Janeiro-Brasil
Marine viruses are among the most common, abundant
and diverse biological entities living in the seawater
column. In spite of this fact little is yet know about
virus abundance and distribution in tropical aquatic
ecosystems and in particular there are no studies
concerning the influence of environmental factors
controlling their spatial and seasonal distribution. Here,
we evaluated for the first time virus abundance and their
relationships with hosts and environments variables in
the upwelling region of Arraial do Cabo coastal region
of Rio de Janeiro State, Brazil. Seawater samples were
taken during four seasons campaigns of a series of five
sampling stations. We have also compared two different
viral abundance counting methods (EFM versus FCM),
showing that the greatest efficiency counts was obtained
when we used the FCM counting protocol (P < 0.05).
Virioplankton abundance ranged from 0.79 to 7.95 x108
part.ml-1, whereas bacteriopankton abundance ranged
from 2.6 to 13.4 x 107 cell.ml-1. The distribution of viruses
were evaluated in relation to their possible host, being
viral abundance positive correlated with both bacteria
(r = 0.65; P < 0.01) and chlorophyll-a (r = 0.61; P <0.01).
In this study, PCR primers CPS1/CPS2 were successful
in yielding PCR products of approximately 165 bp from
virus communities concentrates from sampling sites
studied. Our TEM approach on virioplankton diversity
were grouped according size classes based on the
diameter of the heads, with the dominant virioplankton
capsid diameter in the range of 30–60 nm. Principal
component analysis showed a clear evidence that there
is a seasonal influence in biotic and abiotic variables of
Arraial do Cabo and that high abundances of viruses were
correlated mainly with inorganic forms (NO2-and NO3), PO43-, chlorophyll-a and bacteria. Thus, our seasonalspatial study indicated that viral abundance in Arraial do
Cabo coastal region depends on hosts cells abundances,
which are controlled mainly by nutrient availability.
EV510 - Thermal And Temporal Stability Of
Human Adenoviruses In Fresh Water
Moresco, V., Damazo, N.A., Pilotto, M.R., Barardi, C.R.M.
81
Laboratório de Virologia Aplicada, MIP, CCB, UFSC
3. Instituto Gulbenkian de Ciência, IGC, Rua da Quinta
Grande, 6 2780-156 Oeiras, Portugal
Surface waters are constantly contaminated by enteric
viruses introduced in the aquatic environment. The
temperature can contribute to viral inactivation,
however, the real stability of the enteric viruses in these
environments is not entirely known. Human adenoviruses
(HAdV) are one of the most persistent enteric viruses in
the aquatic environment and are responsible for several
waterborne outbreaks. Current methods used to detect
HAdV in water samples are usually based on molecular
techniques, although these methods do not predict viral
infectivity. An alternative to evaluate the stability of
infectious viruses is to infect permissive cells in vitro.
The aim of this study was to evaluate the thermal and
temporal stability of HAdV2 seeded in fresh water and
stored in different temperatures using flow cytometry
(FACS) and plaque assay (PFU). Fresh water samples
were seeded with known amounts of HAdV2 and stored
at +22°C, +4, -20 and -80°C. The stability was evaluated
at time zero (T0), and after 5 (T5), 10 (T10), 15 (T15)
and 30 (T30) days of storage, in triplicates. The log
reduction (log10 = Nt/N0) of viral titres obtained in
each temperature and respective assay were compared
with original viral titres at T0. FACS assay showed a 3.73
log10 overall reduction in the samples stored at +22°C
at T30, being observed an average of 1 log reduction in
each time. Samples stored at +4, -20 and -80°C showed an
average of 1.70 log10 reduction at T5, with no subsequent
viruses decay until T30. PFU assay, demonstrated 0.4
log10 reduction for samples stored at +22°C at T30 with
no reductions in the other temperatures evaluated. Due
to the difference of infectivity analysis between the two
assays resulting in different values of log10 reduction,
both were able to demonstrate a temporal HAdV decay
when stored at +22°C and a high viral stability in lower
temperatures, including +4°C. The present work will
continue evaluating the samples stored up to 180 days.
Financial support: CNPq Universal 471755/2011-7;
CAPES
Vaccinia virus (VACV), a member of the family Poxviridae
and genus Orthopoxvirus (OPV), is the etiological agent
of a zoonosis called Bovine Vaccinia (BV) in Brazil.
Outbreaks of BV are often reported in small dairy
properties, affecting both cattle and milkers. Although
researches have clarified many aspects of the infection,
little is known about the circulation of VACV in nature
and urbanized locations. Studies showed that VACV
has a wide range of hosts and it’s notable that wild and
domestic animal may have direct or indirect contact
with cattle. Abrahão et al. proposed an important role
for small rodents in BV epidemiology after finding an
infected Mus musculus during an outbreak in Marina
city, Minas Gerais state (MG). Considering that other
OPV have rodents as their reservoirs and emphasizing
Cowpox virus’ urban circulation among small rodents,
our group attempted to assess VACV possible circulation
in mice (M. musculus) from three different urban areas at
MG. Twelve mice were trapped with size selective traps
at the cities of Belo Horizonte, Sabará and Ouro Preto.
Blood, toraxic and abdominal viscera were sampled. RNA
extraction was performed for blood samples (gathered in
pools), each subsequently submitted to cDNA synthesis.
A real time PCR was then conducted to target a fragment
of a conserved gene among OPV, the VACV growth factor
gene or vgf. Our preliminary results show that one pool
is positive for vgf qPCR. It is a new data related to the
epidemiology of VACV since its circulation in urbanized
areas has never been reported before. Our results call
attention to a non-explored side of VACV’s epidemiology
and encourage further investigation to assess whether
VACV circulates frequently among urban rodents. If so,
why VACV’s reports are not found in Brazilian urban
areas as seen for other zoonosis which also involve mice?
Analyses by nPCR and attempts to isolate the virus will
be performed to corroborate the results obtained so far.
EV544 - Changing The Paradigm: Detection
Of Vaccinia Virus In Urban Areas In The
State Of Minas Gerais, Brazil
Miranda, J.B., Müller, U.B., Borges, I.A., Ambrósio, L.L.D.,
Ferreira, P.C.P., Bonjardim, C.A., Abrahão, J.S., Kroon,
E.G., Howard, J.C., Trindade, G.S.
Av. Antônio Carlos, 6627, Pampulha Belo Horizonte - MG,
31270-901
2. Universität zu Köln, , Frangenheimstraße 4 50931
Köln, Alemanha
EV637
Standardization
Of
The
Optimal Period Of Human Adenovirus
Bioaccumulation By Oysters Crassostrea
Gigas Evaluated By Different Cell Culture
Techniques
Pilotto, M.R., Moresco, V., Barardi, C.R.M.
Campus Universitário Reitor João David Ferreira Lima, CEP
88040-900
Bivalve shellfish, such as oysters, are filter feeding
animals. As a consequence, they can filter large volumes
of water and are able to accumulate and concentrate
in their tissues different types of pathogens from fecal
82
origin, including enteric viruses. Rates of pathogens
bioaccumulation can be affected by various environmental
factors for instance, temperature, salinity, etc. When
conducted in laboratory scale for research purposes,
bioaccumulation assays must be carefully undertaken in
order to reach good and reproducible results. The aim
of this study was to standardize the optimal period of
human adenovirus type 2 (HAdV-2) bioaccumulation
by oysters Crassostrea gigas for subsequent depuration
and viral stability studies. Oysters were placed in a
20L aquarium containing predetermined amounts
of HAdV-2 for bioaccumulation and were harvested
after 3h, 8h and 24h. One aquarium without virus was
used as negative control. The oysters were opened,
the digestive glands were dissected and tissue extracts
were prepared by an absorption-elution protocol using
PEG precipitation according to the method already.
The amount of HAdV-2 present on tissue extracts were
evaluated by two different cellular techniques in order
to check viral presence and infectivity: plaque assay
and ICC-RT-qPCR (integrated cell culture preceded
by reverse transcription quantitative PCR) assay. The
results of HAdV-2 bioacumulation by oysters after 3h,
8h and 24h were respectively: 1,30 x 104 PFU/g (plaque
forming unit per gram of oyster) and 1,95 x 105 GC/g
(genome copies per gram of oyster); 6.2 x 104 PFU/g
and 1.46 x 106 GC/g and 4.7 x 102 PFU/ g and 1.53 x 105
GC/g. Both assays were able to determine that, the 8h
period of HAdV-2 uptake was the optimal one and, after
24h, oysters started to release viral particles from their
tissues. This standardized protocol will be applied for
depuration studies and thermal stability of the virus in
oyster tissues after depuration. Financial support: CNPq
Universal 471755/2011-7; CAPES
HUMAN VIROLOGY -HV
84
Human Virology: HV
HV1
Incidence,
Genotypic
Characterization And Determination
Of The Dynamics Of Excretion Of Human
Polyomavirus In Urine Samples Of Healthy
Individuals.
Urbano, P.R.P., Oliveira, R.R., Romano, C.M., Fink,
M.C.D.S., Pannuti, C.S.
Instituto de Medicina Tropical, IMTUSP , R. Dr. Enéas
Carvalho de Aguiar 470, prédio 1, 2 andar
The Polyomavirus JC and BK are the most important
members
of
Polyomaviridae
family,
genus
Orthopolyomavirus, due to their degree of pathogenicity
in humans. The human polyomavirus JC (JCV) was
isolated from a fragment of the brain of a patient
with Hodgkin’s lymphoma and progressive multifocal
leukoencephalopathy by Padgett et al. On the other
hand the human polyomavirus BK was also isolated in
1971 by Gardner et al from the urine of a patient who
underwent renal transplantation in VERO cell line.
There are few data on human polyomavirus JC and BK in
healthy individuals on the world and in Brazil. Moreover
the forms of excretion and transmission of these
viruses are not yet fully elucidated. This study aimed
to determine the incidence, the dynamics of excretion,
and the molecular characterization of polyomavirus JC
and BK in serial samples of urine of healthy individuals.
A secondary objective was to analyze phylogenetically
the subtypes of the viruses found during the study. Were
included 71 patients of both genders, aged from 21 to
65 years-old. Urine samples were collected every month
for six months. All samples in the study were screened
by a real time PCR which amplifies a fragment of the T
antigen gene, and to a conventional PCR that amplifies a
fragment of the gene of VP1 protein of the virus. At the
end of 6 months of follow-up, the incidence of urinary
excretion of polyomaviruses BKV and JCV in the study
population was 53.52% and 64.79% respectively The
profile of excretion of JCV was continuous in 42% of
cases, intermittent in 8% and sporadic in 50% of cases.
The profile of excretion of BKV was shown to be sporadic
in 80% of cases, intermittent in 17% and continuous in
only 3% of cases. Subsequently, the positive samples
were sequenced and analyzed phylogenetically showing
that the more prevalent genotypes were JCV 1, subtype
1b and 3, followed by genotype 1, subtypes 1a and 4.
Regarding the BKV genotype 1 subtype 1a was the most
prevalent, followed by 4 and 1, subtype 1b
HV4
Orthopoxvirus
Household
Transmission In A Family Resident In A
Bovine Vaccinia Endemic Rural Area
Costa, G.B., Borges, I.A., Miranda, J.B., Augusto, L.T.S.,
Ferreira, P.C.P., Moreno, E.C., Abrahão, J.S., Kroon, E.G.,
Trindade, G.S.
1. Laboratório de Vírus, Departamento de
Microbiologia ICB/UFMG, UFMG, Avenida Antônio Carlos,
6627, Pampulha Belo Horizonte
2. Instituto Mineiro de Agropecuária, IMA, Rua da
Maria Amélia, 93, Centro, Serro
3. Fundação Hemominas, HEMOMINAS, Rua Grão
Pará, 882, Santa Efigênia, Belo Horizonte
Vaccinia virus was used as vaccine in smallpox
eradication campaign. Nowadays, the vaccination just
continues in USA and Europe, applied to militaries and
laboratory workers, and infections are reported by
the contact with recent vaccinated people. Currently,
in Brazil, VACV is responsible to cause outbreaks of
an exanthematic disease known as Bovine Vaccinia
(BV). The aim of this study was to report a household
transmission case occurred after a BV outbreak. It was
collected 5 serum samples from a family (father, mother
and 3 daughters) living in a rural area of Minas Gerais
State and lesions swab samples from the father who’s
had lesions similar those observed in BV’s outbreaks.
Also, the father related signals and symptoms like
fever, headache, myalgia and lymphadenopathy.
Epidemiological data was also analyzed. Serological
diagnosis for neutralizing antibodies anti-OPV was
realized by plaque reduction neutralizing test. Three
serum samples (father, mother and one daughter) were
positives, with antibodies titer ranging from 800 to
3200 neutralizing units/mL. Real time PCR was realized
from serum and swab samples and showed one positive
sample, from another daughter. The epidemiological
data showed that the father and mother were vaccinated
during the smallpox eradication campaign and have
the vaccine take. Besides, they have daily contact with
cattle and horses, and make cheese from raw milk.
Only the father practice hand milking. Their daughters
don’t practice activities that demonstrate exposition to
VACV. BV is an emerging infectious disease that is often
reported in Brazil, however, control measures to avoid
environmental virus dissemination are not well-known
by the vulnerable population. Our data show a small BV
outbreak and suggest a possible household transmission,
once was detected DNAemia and anti-OPV antibodies in
two daughters. This case reflects the lack of knowledge
regarding of the spreading of the infection in rural areas.
Financial support: CNPq, FAPEMIG
HV5
Evidence
Of
Orthopoxvirus
Circulation In A Vulnerable Rural
Population In Minas Gerais State
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Human Virology: HV
85
Human Virology: HV
Costa, G.B., Borges, I.A., Miranda, J.B., Augusto, L.T.S.,
Ferreira, P.C.P., Abrahão, J.S., Kroon, E.G., Moreno, E.C.,
Trindade, G.S.
Microbiologia ICB/UFMG, UFMG, Avenida Antônio Carlos,
6627, Pampulha Belo Horizonte
2. Instituto Mineiro de Agropecuária, IMA, Rua da
Maria Amélia, 93, Centro, Serro
3. Fundação Hemominas, HEMOMINAS, Rua Grão
Pará, 882, Santa Efigênia, Belo Horizonte
In Brazil, Vaccinia virus, which is included in
Orthopoxvirus (OPV) genera, is responsible for a
disease called Bovine Vaccinia (BV), characterized by
vesiculopustular infections in dairy cattle and horses,
as well as in humans. Infections can occur after direct
contact with animals naturally infected. Besides, wild and
peridomestic rodents can be involved in the transmission
of this disease. The aim of this study was to investigate
the immunological profile of people living in an endemic
rural area to BV, evaluating the humoral immunity and
the exposure factors involved in possible infections.
It was conducted an epidemiological survey and 240
human sera samples were collected. The population
comprises 127 (52.9%) men and 113 (47.1%) women,
aged from 5 to 90 years. Of these individuals, 185 (77%)
had contact with cattle and horses, 114 (47.5%) practice
milking, 213 (88.8%) consume unpasteurized milk
or raw cheese. Besides, 128 individuals (53.3%) have
a vaccination history, where only 77 (32%) have the
vaccine take. Humoral immunity was checked by plaque
reduction neutralizing test, considering positives the
samples that reduced in 50% the number of plaques
found in virus control (positive control). It was found
that 74 (30.8%) individuals have neutralizing antibodies
anti-OPV. The antibodies titers of positive individuals
ranged from 100 to 6400 neutralizing units/ml. In Brazil,
after smallpox eradication, the vaccination that confers
immunity against OPV was discontinued and several
outbreaks have been described in several regions of the
country. Our data reveal a low number of seropositive
individuals, and even those with vaccine take (n =
77), with vaccination history, only 44 were positives,
indicating some residual OPV immune response.
Therefore, we can’t exclude the OPV circulation in
rural areas and neither the population vulnerability to
infection. Financial support: CNPq, FAPEMIG
HV9
Phenotypic
And
Genotypic
Characterization Of Influenza A/H1n1
Pandemic Virus
Thomazelli, L.M., Oliveira, D.B.L., Macedo, P.V., Lotufo,
J.P.B., Cunha, C.A., Neto, J.T., Durigon, E.L.
1. Instituto de Ciências Biomédicas, USP, ICB-USP, Av
Prof Lineu Prestes 1374 sala 225, São Paulo, SP. cep 05508-000
2. Hospital Universitario, Universidade de Sao Paulo,
HU-USP, São Paulo
3. Centro Medico Sao Francisco, CMSF, Curitiba
4. Nucleo de Pesquisas em Geriatria Clınica e
Prevenção, NPGCP-UNIFESP, São Paulo
Influenza is an acute, typically febrile, respiratory
illness having outbreaks of varying severity with the
winter months heavily affecting children and the elderly.
While both Influenza type A and B can cause epidemic
outbreaks, Influenza A outbreaks generally increases
the rates of hospitalization for lower respiratory tract
disease amongst infants and children. Due to a higher
mortality rate it is essential to differentiation between
Influenza and other respiratory viruses. The virus is
preventable by vaccination and can now be managed
with specific antivirals. This study aimed to compare
the diagnostic performances of three enzyme-linked
immunosorbent assays; Directigen EZ Flu A+B (BD,
Maryland, USA), QuickVue Influenza A+B test (Quidel,
San Diego, USA) and Bioeasy Influenza Ag A/B/A H1N1
Pandemic (Bioeasy, Belo Horizonte, BRA) with viral
culture (Influenza A) and clinical samples (Influenza
B) previously quantified by Real-time RT PCR. All the
tests were performed in accordance to the manufacturer
instructions. For the first test we used a series of dilutions
(1, 1/5, 1/10, 1/20, 1/40) of the Influenza A sample
T-25 (ct = 23.22) isolated in MDCK cells with a viral
load of 1.04e5 copies of DNA to compare the diagnostic
performances of the Directigen and the QuickVue. With
the second test we used the same methodology for
Influenza B clinical nasopharyngeal wash sample R-950
(ct = 30.06) with a viral load of 4.15e3 copies of DNA
to compare the Directigen and the Bioeasy. Our study
demonstrated the effectiveness of the test by returning
no invalid results (n=20) from heavily diluted samples.
The detection of Influenza A ranged from a 20 fold
dilution by Directigen and 10 fold by QuickVue while
Influenza B had a 5 fold dilution for both Directgen and
Bioeasy assays. In conclusion, our findings suggests that
Directigen has a higher diagnostic yield than QuickVue
for influenza virus type A and the same yield that Bioeasy
for influenza B virus. All assays showed good accuracy
and speed with results being obtained within 15 and 20
minutes, including labor and incubate time.
HV10 - Antigen-Antibody Dissociation
Significantly Improves The Ns1 Capture
Elisa Sensitivity For Dengue Virus Type 4
Diagnosis In Brazil
Lima, M.R.Q., Nogueira, R.M.R., De Filippis, A.M.B.,
Nunes, P.C.G., Sousa, C.S., Heringe, M., Dos Santos, F.B.
86
Human Virology: HV
Oswaldo Cruz Institute / FIOCRUZ, IOC, Av Brasil,
4365, Rio de Janeiro
In Brazil, dengue became a public health problem after
the introduction of DENV-1 in 1986. In July of 2010, DENV4 was isolated in Roraima. The detection of DENV NS1
as an alternative method useful for the early diagnosis
of dengue has been shown. However, in secondary
infections NS1 is less likely to be available for capture
in an immunoassay due to immune-complex formation.
We aimed to analyze the NS1 ELISA sensitivity for early
diagnosis of DENV-4 cases recently reported and aiming
to improve the sensitivity, results were compared to
those by dissociating immune complexes from primary
and secondary cases. DENV-4 sera (n=471) confirmed by
virus isolation and/or were analyzed. The IgG—ELISA
was performed immune response characterization. The
Platelia™ Dengue NS1 Ag-ELISA (BioRad Laboratories)
was used for NS1 capture. To improve the test sensitivity,
two dissociation protocols were used: acid (AD) and
heat-meadiated (HD). Positive NS1 was observed in
54.38% of primary and 39.07% of secondary cases. The
overall NS1 assay sensitivity increased to 70.48% and
77.49% (p=0,017), after the AD and HD procedures,
respectively. After the HD procedure, a significant NS1
sensitivity increase was observed in primary (82.01%)
and secondary cases (73.10%, p=0,002).The NS1 assay
results should be interpreted with caution when used
alone due to the false negative results and the addition
of a HD step prior to the assay to improve the sensitivity
on endemic areas where secondary infections are more
frequently reported is suggested. Support by: CAPES,
CNPq, FAPERJ, PAPES VI, FIOCRUZ, MS
HV16 - Investigation Of Orthobunyavirus
Circulation In Humans With Febrile Acute
Illness And In Culex Quinquefasciatus
Mosquitoes In Mato Grosso, Brazil
Cardoso, B.F., Serra, O.P., Zuchi, N., Heinen, L.B.S.,
Gondim, B.H., Pereira, F.C., Santos, F.A.L., Santos,
M.A.M., Souto, F.J.D., Dezengrini-Slhessarenko, R.
1. Laboratório Central de Saúde Pública do Mato
Grosso, MT- Laboratório, R Tenente Thogo da Silva Pereira
63 - Centro Sul - Cuiabá/MT
2. Universidade Federal de Mato Grosso, UFMT, Av.
Fernando Corrêa da Costa, nº 2367 - Bairro Boa Esperança.
Cuiabá - MT
3. Secretária de Vigilância em Saúde, SVS, Centro
Político Administrativo, Palácio Paiaguas, Bloco D. Cuiabá/
MT
4. Secretária Estadual de Saúde, SES, R. Treze de Junho,
1055 - Centro Sul Cuiabá - MT
The genus Orthobunyavirus, family Bunyaviridae
comprises several arboviruses already detected in
Brazil. Oropouche (OROV) is considered the most
prevalent arbovirus after Dengue virus in the country,
being the most prevalent in the Amazon region.
Epidemiological situation of these viruses in MT is
unknown. RNA was extracted with QIAmp viral RNA kit
from serum samples of 604 patients with acute febrile
illness from Mato Grosso (2012). Pools of adult female
Culex quinquefasciatus (n=319) and Culex sp. (n=138)
were collected with Nasci aspirators and hand net in
200 points in Cuiabá between January and April, 2013.
Total RNA was extracted (Trizol) from 50 pools of Culex
quinquefasciatus and 5 of Culex sp. RNA from human
samples (n=604) and mosquitoes pools (n=55) were
submitted to reverse transcription (Superscript III)
with primer BUN-S (Orthobunyavirus; segment S). The
cDNA of 98 human samples and 55 pools of mosquitoes
were submitted to N-RT-PCR with primers BUN-C/
BUN-S and BS-C e BS-S, this latter amplify the segment
S of Simbu group orthobunyaviruses (300 bp). Results
demonstrate 1/98 (1%) human sample from Cuiabá and
2/50 (4,0%) pool of Culex quinquefasciatus positive for
an Orthobunyavirus from Simbu group. The sequences
(mosquitoes and human sample) presented 84-94% of
identity with OROV sequences from IEC/Para. In urban
centers, Culicoides paraensis and Culex quinquefasciatus
are considered vectors for OROV. C. quinquefasciatus
is an excellent reservatory, transmitting OROV only in
high viremic levels. Oropouche fever is clinically similar
but milder than Dengue Fever and, serology has been
demonstrated in humans in two cities from Pará in the
border with MT, affected by Cuiabá-Santarém highway.
This is the first report of OROV in MT. * Project developed
with funds from CAPES, CNPq and PROPEQ / UFMT.
HV17 - Virological Surveillance Of
Adult Mosquitoes Naturally Infected
With Arboviruses From Alphavirus And
Flavivirus Genus In Cuiabá, Mato Grosso,
Brazil
Serra, O.P., Cardoso, B.F., Gondim, B.H.F., Heinen, L.B.S.,
Pereira, F.C., Zuchi, N., Santos, F.A.L. , Rodrigues, J.S.V.,
Ribeiro, A.L.M., Myiazaki, R.D., Dezengrini-Slhessarenko,
R.
1. Universidade Federal do Mato Grosso, UFMT, Av.
Cuiabá - MT
2. Hospital Universitário Júlio Muller, HUJM, Rua Luís
Philippe Pereira Leite, S/N - Alvorada - Cuiabá-MT
Arbovírus are transmitted by hematophagus arthropods,
circulating in nature in cycles involving vectors, hosts
and reservoirs. The aim of this study is to determine the
87
Human Virology: HV
variety and frequency of mosquitoes naturally infected
with arboviruses from genus Alphavirus and Flavivirus
in Cuiabá. To achieve that, we collected mosquitoes
in three residencies from 200 points determined by
the urban census map (IBGE) and GPS locators, using
Nasci aspirators and hand net. Mosquitoes where
identified with dichotomy key at specific level, allocated
in pools (1-10 mosquitoes) according to species, sex
and point of collection and stored at -80°C. 1603 pools
where obtained, 795 are hematophagus female pools,
comprising A aegypti (207), A albopictus (1), Aedes
sp (1), C quinquefasciatus (319), C comp pipiens (95),
Culex sp (138), C bidens interfor (5), C spinosus (1),
Psorophora sp (5), Psorophora varipes albigenu (11),
Psorophora ciliata (1), Sabethes cloropterus (1), Limatus
sp (6), Uranotenia sp (1), Galindomyia sp (1) and
Mansonia wilsoni (2). 40 pools of A aegypti and 34 of C
quinquefasciatus and 4 of Culex sp where submitted to
RNA extraction (Trizol), reverse transcription, multiplex
RT-PCR for Flavivirus and Alphavirus amplification and
species-specific semi-N-RT-PCR for Flavivirus (DENV1 472 bp; DENV-2 316 bp; DENV-3 659 bp; DENV-4
222 bp; YFV 253 bp; SLEV 232 bp, WNV 195 bp, ILHV
474 bp, ROCV 230 bp, IGUV 254 bp, BSQV 388 bp) and
Alphavirus (MAYV 270bp; EEEV 124 bp; WEEV 208 bp,
VEEV 400 bp, AURAV 89 bp). 1/40 (2.5%) of A. aegypti
showed a band consistent with DENV-4 size. Sequencing
is underway to confirm the amplification. DENV-4 is the
most prevalent serotype in Cuiabá since 2012, when the
introduction of this virus was detected in MT for the first
time. Frequency and distribution of arboviral infected
mosquitoes in Cuiabá is important to improvement of
health surveillance strategies aiming to prevent and
control outbreaks in MT.*Financial support:CAPES/
FAPEMAT/UFMT.
HV19 - Entomological Surveillance Of
Adult Mosquitoes Vectors Of Arboviruses
In Cuiabá, Mt
Serra, O.P., Cardoso, B.C., Gondim, B.H.F., Pereira,
F.C., Santos, F.A.L. , Heinen, L.B.S., Zuchi, N., Ribeiro,
A.L.M., Carvalho, A.C., Rodrigues, J.S.V., Correa, L.V.A.,
Myiazaki, R.D., Dezengrini-Slhessarenko, R.
Fernando Corrêa da Costa, 2367 - Boa Esperança. Cuiabá MT
2. Ministério da Saúde, MS, Av Presidente Getúlio
Vargas, N 1426 Popular - Cuiabá - Mato Grosso
3. Hospital Universitário Júlio Müller, HUJM, Rua Luís
Philippe Pereira Leite, S/N - Alvorada - Cuiabá-MT
4. Secretaria Municipal de Saúde - Cuiabá/MT, SMS,
Rua São Joaquim, n°. 315 - Bairro: Porto. Cuiabá - MT
Entomological surveillance has proven to be an
important strategy for monitoring Culicidae species
in tropical areas and, to predict the risk of human
exposure to arboviruses. In this preliminary study, we
collected adult mosquitoes in 200 locations from Cuiabá,
determined with GPS and IBGE maps. Using Nasci
aspirators, we collected 1603 pools (1-10 mosquitoes),
795 female, 808 male, between Jan-Apr/2013. 403
are Aedes aegypti, 2 Aedes albopictus, 748 Culex sp,
319 C quinquefasciatus, 5 C bidens interfor, 95 C comp
pipiens, 1 C spinosus, 11 Psorophora var. albigenu, 1
Psorophora ciliata, 6 Psorophora sp, 2 Mansonia wilsoni,
1 Sabethes chloropterus, 7 Limatus sp, 1 Uranotenia sp,
1 Galindomyia sp. The majority of the female collected
where fulfilled with blood, probably from humans,
dogs, birds, chickens, horses or monkeys, as they were
collected surrounding these species in the residencies.
This variety of vector species in Cuiabá represent a
potential risk for arboviral spread in the imminence
of their introduction by travelers or migratory birds,
due to the proximity with Pantanal and the habit of the
birds from there to rest every night in the UFMT zoo.
Agents as Cacipacoré, West Nile, Saint Louis, Equine
Encephalitis, Chickungunya, Yellow Fever, Oropouche
and others could find susceptible vectors and hosts to
establish their cycles. This is the first report of Culicidae
variety of Cuiabá, city that annually contributes with the
majority of Dengue notified cases in the State. Cuiabá
has a diversified ecosystem, consisting of extensive areas
of fauna and flora preservation, small rural properties,
rivers and streams inside the urban perimeter, climate
and humidity conditions that favor the amplification of
mosquitoes. Virological surveillance in the 795 pools
is currently being performed, aiming to identify their
frequency of infection with arboviruses by RT-PCR. These
data demonstrate the importance of entomological
surveillance for gathering information and promoting
health surveillance strategies to prevent outbreaks in
MT. *Financial support: CAPES/FAPEMAT/UFMT.
HV29 - G3 Rotavirus Strain: A Complex
Evolutionary Dinamic
Luchs, A., Souza, R.P., Timenetsky, M.C.S.T.
Instituto Adolfo Lutz, IAL, Av Dr Arnaldo, 355 Centro
de Virologia 01246-902
Rotavirus group A (RVA) G3 genotype has broadest
host range. The aims of this study were to carry out
Bayesian phylogenetic analyses using the nucleotide
sequences of VP7 gene available in GenBank in order
to investigate the evolutionary dynamic between RVA
G3 strains originating in humans, wild and domestic
animals; quantify the mutation rates; and estimate
the most recent common ancestors. For 5 bovines,
88
Human Virology: HV
3 simians, 2 environmental, 8 canines, 22 equines, 3
felines, 5 rabbits, 5 porcines, 2 caprines, 3 murines, and
199 human G3 strains; the entire or partial VP7 ORF
sequences and the year of isolation could be retrieved
from GenBank. The Bayesian inference method available
in the software BEAST v. 1.6.2 was used in order to
analyze the phylogenetic relationship. Based on 257
sequences, the mutation rate was estimated to be 1.7318
x 10-3 (1.4374-2.075 x 10-3) nt substitution/site/year.
The TMRCA inferred for G3 strain was calculated to be
1786 (1765-1810). It was possible to separate three
distinct Lineages of G3 by phylogenetic analysis. All of
them contain animals and humans strains; however,
Lineage II contains the majority of human G3 strains,
and they are associated with urban environments.
Phylogeography and temporal analysis, suggested
that G3 strain emerged in Asia and scattered through
the globe in rural environments. The urban context of
RVA G3 circulation was later observed 100-110 years
ago, and the data analyzed also suggested that the
urbanization process took place in Asia, and posteriorly
in Europe and the Americas. The Bayesian Phylogenetic
analysis suggests that a transmission between human
and animals may be the ancestral characteristic of the G3
strain, and its urbanization is a later phenomenon. The
most recent common ancestor of this strain was dated
back to 1786; however the emergence of the majority
human urban Lineage II could be tracked back to around
1904. This data suggests that the urbanization of the RVA
and its fixation on human population may be associated
with the industrialization process associated with the
change from rural settlements towards a predominantly
urban population. Also, urbanized strains are apparently
more prevalent than rural strains. The complexity that
naturally arises from this changing environment is an
ideal situation to the emergence of a new zoonotic virus,
as indicated by the recent epidemics of SARS-COV, and
H1N1. Financial Support: PPG-CCD-SES/SP; IAL
HV37 - Molecular Characterization Of
Influenza B Virus Outbreak On A Cruise
Ship In Brazil 2012
Borborema, S.E.T., Da Silva, D.B.B., Santos, K.C.O., Pinho,
M.A.B., Curti, S.P., De Paiva, T.M., Santos, C.L.S.
Instituto Adolfo Lutz, IAL, Av Dr Arnaldo 355,
Cerqueira Cesar, SP
Cruise ship holidays are increasing in popularity
worldwide. The nature of the environment may facilitate
the transmission of infectious diseases. In February
2012, an outbreak of respiratory illness occurred on
the cruise ship MSC Armonia during a summertime
in Brazil. A 31-year old woman from crew member
was hospitalized with respiratory failure and died. In
order to study the etiology of the respiratory illness,
fifteen samples from respiratory secretions and tissue
necropsy of thirteen passengers and crew members
with respiratory symptoms were investigated. Influenza
real time RT-PCR assays were performed. The full-length
hemagglutinin (HA) gene of influenza positive samples
was sequenced. Only influenza B virus was detected
in seven individuals, this finding implicated influenza
B virus as the cause of a respiratory illness outbreak
onboard the cruise ship. Sequence analysis of the HA
gene indicated that the viruses were closely related to
the B/Brisbane/60/2008-like virus, Victoria lineage, the
vaccine virus for the 2011-2012 Southern hemisphere
season. Since the recommended composition of influenza
vaccines for use in the 2012-2013 season changed, it is
crucial an intensive surveillance of circulating viruses
worldwide. Molecular analysis is a very important tool to
characterize the pathogen responsible for the outbreak.
In addition, laboratory disease surveillance can
contribute to the control measures towards influenza is
an immunopreventable disease. Financial support: IAL/
SES/SP.
HV38 - Genetic Analysis Of Seasonal
Influenza A(H3n2) Viruses Isolated In
Brazil During 2010 – 2012
Borborema, S.E.T., Santos, K.C.O., Da Silva, D.B.B., Pinho,
M.A.B., Pereira, J.C., Curti, S.P., De Paiva, T.M., Santos,
C.L.S.
Instituto Adolfo Lutz, IAL, Av Dr Arnaldo 355,
Cerqueira Cesar, SP
Influenza viruses are a common cause of human
respiratory infections and responsible for annual
epidemics and occasional pandemics, which resulted
in serious threat to public health and socioeconomic
impacts. Influenza vaccines have to be updated frequently
because circulating influenza viruses continuously evolve.
Molecular and antigenic surveillance are important to
provide information about the circulating viruses that
will guide vaccine development and strategies. Our
study was performed to monitor the emergence of new
variants of influenza A(H3N2) viruses circulating in
Brazil. Samples obtained from respiratory specimens
or necropsy tissues collected during January 2010 to
December 2012 were laboratory-confirmed by realtime RT-PCR. Genetic analysis based on the full-length
hemagglutinin (HA) gene sequences was performed.
Nucleotide sequences were edited and aligned using
Sequencer 4.7 and Bioedit 7.0, respectively. Phylogenetic
tree was constructed by neighbor-joining method
applying Kimura’s two-parameter method using MEGA
5. A total of 84 HA sequences were analyzed, 6 of which
were from fatal cases. This analysis showed that the
89
Human Virology: HV
circulating influenza A(H3N2) strains in Sao Paulo state
were similar to ones circulating in other Brazilian states,
such as Goias, Distrito Federal, Mato Grosso, Mato Grosso
do Sul, Tocantins and Piaui. Samples fall into two major
genetic clades represented by A/Victoria/208/2009
and A/Perth/16/2009. The smaller A/Perth/16/2009
genetic clade carries signature amino acid substitutions
E62K and N144K. The majority of Brazilian A(H3N2)
samples belong to A/Victoria/208/2009 genetic clade,
but until 2011 remained antigenically related to A/
Perth/16/2009. With the A/Victoria/208/2009 clade,
the most commonly Brazilian circulating subgroups
were subgroups 5 and 6. Surveillance of influenza
viruses is essential for updating vaccines, for tracking the
emergence of drug resistant viruses, and for monitoring
zoonotic infections. Financial support: IAL/SES/SP.
HV39 - Epidemiology Of The Human
Papillomavirus (Hpv) In Women In Southern
State Of Bahia
Nascimento, J.H.F., Soares, D.M.V., Santos, F.P., Mariano,
A.P.M., Mello, S.R.G.
1. Universidade Estadual de Santa Cruz, LAFEM/
UESC, Rodovia Jorge Amado, km 16, Bairro Salobrinho,
Ilhéus/BA. CEP 45662-900
2. Laboratório de Anatomia Patológica/Hospital
Calixto Midlej, HCMF/LAPPAQ, Rua Antônio Muniz, Nº
200, Pontalzinho. Itabuna . Bahial Cep: 45.602-650
Human Papillomavirus (HPV) is one of the most
prevalent sexually transmitted pathogens associated
to malignancy, infecting 50 to 80% of sexually active
women worldwide and responsible for 99.7% of cancers
of the cervix. Cervical cancer is a critical public health
problem as it is the second most common cancer in
women worldwide. The main objective of this study was
to determine the prevalence of HPV in women attending
health units in the south region of Bahia and to compare
three diagnostic methods to detect the virus or their
pathological effects and/or the cervical lesions. It was
conducted a cross-sectional study, evaluating 195 women
in the period from April 2011 to April 2012. Initially,
it was proceeded gynecological clinical examination,
followed by endocervical samples collection, DNA
extraction and cytological analysis. In the clinical
analysis, it was used the acetic acid in the vaginal canal
and cervix to visualize possible lesions characteristics
caused by HPV. The brush-swab containing endocervical
cells was used to obtain HPV-DNA by nested PCR The
prevalence of HPV was 47.7% by PCR test, 35.3% by
cytological analysis and 26.7% in the clinical diagnosis.
It was found no correlation between the infection and
risk factors described in the literature, such as age,
sexual activity, smoking, immunosuppression and use
of hormonal contraceptive. Cytological abnormalities
most frequently found were, respectively: inflammation,
LSIL, ASCUS and HSIL. The techniques used for tracking
proved to be adequate. Besides that, our results suggest
that in order to obtain more accurate results and an
efficient diagnostic, the three analysis (the clinical,
the Pap smear and the molecular methods) should be
performed together. Certainly, this approach will result
in the decreasing of false-negative, earlier diagnostics
and treatment, and better prognostic. Financial Support:
CNPq; FAPESB; UESC
HV49 - Emergence Of Dengue Virus 4
Genotype American In São José Do Rio
Preto, São Paulo, Brazil.
Colombo, T.E., Vedovello, D., Pacca, C., Fávaro, E.,
Nogueira, M.L.
1. Faculdade de Medicina de São José do Rio Preto ,
FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro, São José
do Rio Preto, São Paulo
2. Universidade Estadual Paulista Júlio de Mesquita
Filho, UNESP, Rua Cristóvão Colombo, 2265 - Jardim
Nazareth, São José do Rio Preto, São Paulo
DENV-4 had a brief circulation in Brazil in 1982 in
the Northwestern region of Brazilian Amazon in a
focal epidemic. No further cases of infection had been
registered in the country until 2008, when the virus was
detected in three patients, who had no international
traveling history, in Manaus. DENV-4 reemerged in the
country in 2010 in the municipalities of Boa Vista and
Cantá in Roraima State, spread to different geographic
regions of Brazil. In the present work about DENV-4
transmission in SJRP from 2011 to 2013, we used serum
samples of suspected and confirmed DENV patients
provided by the Health Secretariat to profile DENV
circulation. The viral surveillance was performed with
Multiplex RT-PCR using Flavivirus generic primers based
on non-structural protein (NS5), followed by Nested
assays with species-specific primers and cultured cells of
Aedes albopictus for the identification and confirmation
of DENV-4. There were 997 cases confirmed in SJRP from
January 2011 to March 2013. We amplified 783 samples
for DENV and 375 (48%) were positive for DENV-4. Up
to now, 31 DENV-4 have been subjected to sequencing of
the entire envelope gene and were used for phylogenetic
reconstruction. The phylogenetic analysis of serotype 4
show that the samples identified in this study grouped
with genotype that circulating in Brazil (genotype
American). Looking inside the genotypes two distinct
clades formed in DENV-4 phylogenetic reconstructions,
indicating two possible lineages. This data shows
that the phylodinamics of dengue circulation can be
much more complex than expected even in a small
90
Human Virology: HV
city, with circulation not only of different serotypes
but also different strains. These data provide us more
information about the dynamics of DENV circulation
and its role in emergence of outbreaks and endemic
circulation. Financial support: Pronex; INCT-Dengue;
FAPESP; CAPES
HV51 - Rhinovirus E Enterovirus Infect
Lymphoid
Tissues
Of
Hypertrophic
Adenoids And Tonsils
Paula, F.E., Silva, M.L., Proença-Modena, J.L., Valera,
F.C.P., Saturno, T.H., Prates, M., Buzatto, G.P., Tamashiro,
E., Anselmo-Lima, W., Arruda, E.
Faculdade de Medicina de Ribeirão Preto, FMRP, Av.
Bandeirantes, 3900
Chronic adenotonsillar hypertrophy is a frequent
otorhinolaryngologic illness due to chronic inflammation
of the tissues of adenoids and palatine tonsils. Frequently
patients with chronic adenotonsillar diseases undergo
surgery for removal of hypertrophic tissues. HRV and
HEV are picornaviruses frequently involved in the
etiology of acute infections, and are frequently detected
in adenoids and palatine tonsils. This study aimed at
detecting whether there is replication of picornaviruses
in adenoids and palatine tonsils surgically removed from
patients with adenotonsillar diseases. To assess the
picornavirus replication activity the presence of minus
strand RNA was determined by in situ hybridization
(ISH) and viral capsid protein was detected by
immunohistochemistry (IHQ). Of 179 enrolled patients,
respectively 49% and 53% had palatine tonsils and
adenoids positive for a picornavirus by qPCR. HRV was
more frequently detected in adenoids 44/173 (25%),
while HEV was more common in palatine tonsils
73/179 (41%). A control group was made of tissues
from patients who underwent cochlear implant, and
HEV was detected in 2/12 (17%) tonsils and adenoids,
whereas HRV was detected in 3/12 (25%) adenoids
and in none of the tonsils. IHQ with antibody for VP1
capsid protein indicated the presence of virus capsids
in lymphoid tissue, within and outside of the lymphoid
follicles of tonsils and adenoids, and also in epithelial
cells from adenoids. The frequency of detection was
24/52 (46%) in tonsils and 22/44 (50%) adenoids
tested by IHQ. The ISH detected minus strand RNA in all
samples tested (7 tonsils and 9 adenoids), with signal
in and out of lymphoid follicles of tonsils and adenoids,
on the ciliated epithelium of the adenoid, and rarely on
positive cells in squamous epithelium from tonsils. HEV
was detected predominantly in tonsils and HRV A and
HRV C in adenoids. The high frequency of detection of
RNA (-) and VP1 in tissues from patients with chronic
adenotonsillar diseases, indicates that picornaviruses
replicate within these tissues, which become reservoirs
of replicating viruses in the absence of acute respiratory
symptoms. Financial support: FAPESP, CAPES and CNPQ.
HV58 - Time-Scale Of Minor Hiv-1 Complex
Circulating Recombinant Forms (Crfs_
Cpx) From Central And West Africa
Delatorre, E., Bello, G.
Instituto Oswaldo Cruz - Fundação Oswaldo Cruz,
IOC-FIOCRUZ, Av. Brasil, 4365. Manguinhos. Rio de Janeiro.
RJ
Several HIV-1 CRFs with a complex mosaic structure
including: 09_cpx, 11_cpx, 13_cpx and 45-cpx, circulate
at low prevalence in Central and West African regions.
Here we reconstruct the evolutionary history of
these complex CRFs and we further investigate the
dissemination dynamic of the CRF11_cpx clade. Two
HIV-1 datasets comprising 148 pol (26 CRF09_cpx,
91 CRF11_cpx, 19 CRF13_cpx and 12 CRF45_cpx) and
70 env (7 CRF09_cpx, 41 CRF11_cpx, 12 CRF13_cpx
and 10 CRF45_cpx) sequences sampled from different
central and western African countries over a period
of > 10 years were used in this study. Evolutionary,
phylogeographic and demographic parameters were
jointly estimated from sequence data using a Bayesian
coalescent-based method. The analysis of both HIV-1
datasets point to quite consistent onset dates for CRF09_
cpx (~1965: 1956-1974), CRF11_cpx (~1955: 19461964) and CRF13_cpx (1965: 1958-1972) epidemics;
while some divergence was found for the estimated
date of origin of CRF45_cpx epidemic (pol = 1969 [1963
- 1976]; env = [1957: 1946 - 1966]). Phylogeographic
reconstructions indicate that the CRF11_cpx clade most
probably emerged in Cameroon and from there it was
first disseminated to the Central Africa Republic in the
early 1970s and to other central and western African
countries at later times. Demographic reconstructions
suggest that the CRF11_cpx epidemic grew between
1965 and 1990 with a median exponential growth rate
of around 0.3 year-1, and after stabilize. These results
reveal that minor HIV-1 CRFs_cpx clades have been
circulating in central and western Africa for a long time,
comparable to other much more prevalent HIV group M
clades. Our analysis also suggests that those CRFS_cpx
lineages may have experienced a long, but slow, epidemic
growth phase before stabilize; which may explains their
current low prevalence.
HV65 - Respiratory Virus Profile In
Symptomatic Children In A Large Hospital
In Porto Alegre City
Baccin, T.G., Silveira, M.L., Guloch, R., Gregianini, T.S.,
Castro, A.
91
Human Virology: HV
1. Grupo Hospitalar Conceição, GHC, Av, Francisco
Trein, 596 - Bairro Cristo Redentor - Porto Alegre - RS CEP
91350-200
2. Fundação Estadual de Produção e Pesquisa em
Saúde, IPB-Lacen, FEPPS-IPB/LACEN, Avenida Ipiranga
5400
Acute respiratory infections (ARIs) are an important
cause of hospitalizations and morbidity in early
childhood worldwide. The most infections are caused by
viruses mainly Influenza A and B, respiratory syncytial
virus, human parainfluenza virus and adenovirus.
Together these viruses account for 35-87% of ARIs
in children and cannot be distinguished on basis of
clinical presentation and symptoms. In southern Brazil,
the pandemic influenza H1N1 was not detected in
2010 but reemerged in 2011 and has since then been
increasingly circulating. The study was realized in
Central Laboratory of Grupo Hospitalar Conceição, one
of the largest hospitals in public health in the State. All
1429 nasopharix samples from patients <15 years of age
who presented signs and symptoms of ARI (assisted in
child emergency department), were tested with indirect
immunofluorescence (IFI), between January through
December 2012. The positive samples to Influenza
A were sent to State Central Laboratory (LACEN-RS)
for real time reverse transcription-polymerase chain
reaction (qRT-PCR) analysis. Eight hundred forty one
(59,1%) patients were males and 581 (40,9%) were
females. Most of the children had less than one year of
age (79,2%). At least one respiratory virus was detected
in 569 (38,2%) respiratory samples and co-detection of
viruses was <1%. The variability was clear in seasonal
detection of respiratory viruses. The most detected
virus, RSV, was detected during the entire year with a
peak in winter. RSV was found in 372 samples (26,1%),
Parainfluenza-3 in 79 (5,5%) samples and Adenovirus in
46 (3,2%). Forty two children were found with Influenza
A (2,9%) which 39 (93%) were A(H1N1)pdm09 virus.
Most patients in which the pandemic virus was detected
had <1 year of age (67%) and >80% presented cough,
fever, dyspnea and rhinorrhea. There was concordance
in 89,7% between IFI diagnostic and confirmation with
qRT-PCR. In conclusion, routine testing of common
respiratory viruses in children with ARIs leads to
improvement of individual patient management.
Financial support: Ministério da Saúde
HV67 - Association Of The Hpv Molecular
Test To The Cytology Exam In Routine
Gynecology.
Paixão, C.G.S., Silvestre, R.V.D., Mello, W.A., Farias, S.L.,
Junior, L.B.D.
1. Instituto Evandro Chagas, IEC, BR 316 Km 07,
Ananindeua - Pará
2. Laboratório Dr. Paulo Azevedo , LPA, Avenida Braz
de Aguiar, 99, Belém - Pará
Gynecological cytology or Pap test has significant
limitations in identifying the precise beginning of a
cervical intraepithelial neoplasia (CIN) or squamous
cell carcinoma of the cervix, and knowing that the
presence of HPV infection is a necessary causal factor
to the appearance of these lesions, the combination
of strategies to detect HPV viral DNA associated with
cytology has proven more efficiency in predicting the
appearance of these lesions due to the statistical power
of the positive predictive value when using molecular
tests. In this context we aim to identify HPV infections,
in women between 20 and 50 years old attended for
gynecological routine exams that could be associated to
cytology without alterations, in the city of Belém, Pará.
After the cytology it’s concluded we used Hybrid Capture
2 (HC2) QIAGEN, for primary molecular screening
followed by Linear Array , ROCHE to type definition in
CH2 positive samples and 30% of CH2 negative samples
as a Quality control. A total of 93 samples was submitted
for all methodologies and cytology results demonstrate
classifications as Inflammatory 87(93.5%), atypical
cells of undetermined significance ASGUS 1(1.07%),
Immature squamous metaplasia 3(3.22%) and Low grade
Squamous intraepithelial lesion LSIL 2(2.15%). Using
molecular tools, HPV DNA was found in 12/93(12.9%)
and high risk infection are present in 7/12(58,3%)
distributed through types 51(4) and 59(3) and low risk
types detected 5/12(41.6%) are 55(3) and 66(2). In Pap
test without cellular alteration we have 9/87(10.3%) of
HPV positivity and these are preferably caused by high
risk types 7/9(77.7%). Even with not extensive sample
size, we could demonstrate the importance to adopt the
molecular tools associated to Pap test in prospective
screening programs to prevent precursor lesions and
cervical cancer, mainly after the HPV vaccine era trying
to use the right approach in different women life period.
HV76 - Prevalence And Genotyping Of
Human Papillomavirus (Hpv) Using Pcr And
Rflp Of Viral L1 Gene In Women Of Alagoas,
Brazil.
Nascimento, V.X., Souza, N.C.C., Fonseca, P.D.L., Soares,
L.W.O., Mendes, M.M.B., Santos, A.R., Todaro, A.R.,
Carvalho, L.W.T., Ramalho, F.E.A.V., Neto, R.E.
Laboratory of Genomics and Proteomics Center for
Agricultural Sciences Campus Delza Gitaí BR 101 Norte Km
85 CEP 57100-000 Rio Largo AL, Brazil
92
Human Virology: HV
Cervical cancer is the second most common cancer in the
world and the human papillomavirus (HPV) is present in
99% of the cases. The viral persistence of high-risk HPV is
considered the main cause for cancer development. HPV
infection is more common among young and sexually
active individuals, and 75% to 80% of the population
will be infected during their lifetime. Half of all new
cases are detected during the first three years of sexual
activity. It is estimated that there are over 200 types of
HPV, but only 110 described to date. Among the nearly
50 types of HPV that infect humans, the International
Agency for Research on Cancer (IARC) has classified 14
types as carcinogenic, since they are epidemiologically
associated with anogenital cancer development (16, 18,
31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and
3 were classified as probable high-risk types (26, 53, and
66). We investigated the prevalence of the HPV and its
genotypes in women with normal and abnormal cervical
cytology at Alagoas state, Brazil. Cervical samples of 100
women were subjected to HPV-DNA testing by PCR with
MY09/11 primers. HPV-positive specimens were typed
by RFLP (Restriction Fragment Length Polymorphism).
A structured epidemiological questionnaire was
administered to each woman. Among 100 patients
examined, HPV was detected in 19 %. The overall
prevalence of high-risk, low-risk and undetermined-risk
HPV types was 31.6, 63.1, and 5.6 %, respectively. HPV-6
was the most common type detected (36.8 %), followed
by types 16, 33 e 58 (10.5%) and 11, 40, 53, 69, 70 and
71 (5.6 % each). In Brazil, as HPV infection is not notified
because the available methods in screening programs
for cervical cancer do not detect the presence of viruses.
Thus, the inference of prevalence by molecular methods
is fundamental for development of effective programs
that seek early virus detection to prevent cervical
cancer development and its precursor lesions. Financial
support: Capes - Propep/UFAL
HV80 - Detection And Characterization
Of Non-Polio Enteroviruses Associated
With Acute Flaccid Paralysis In Northern
Brazil, Maranhão And Piauí, 2007-2011
Lima, S.T., Alves, J.C.S., Wanzeller, A.L.M., Linhares, A.C.,
Tavares, F.N.
Instituto Evandro Chagas, IEC, Rod BR 316, S/N, KM
07, Bairro Levilândia, Ananindeua, PA
Acute flaccid paralysis (AFP) is a clinical syndrome
characterized by rapid onset of weakness, including
(though less frequently) muscle weakness that may
cause respiratory failure and difficult in swallowing.
These symptoms may progress to maximum severity
within several days to weeks. AFP is the most severe
clinical manifestation of acute poliovirus (PV) infection
and others potential pathogens including non-polio
enterovirus (NPEV). These NPEVs are presently classified
into four Human Enterovirus (HEV) species A-D. In Brazil
the last case of poliomyelitis due to wild PV occurred
in Souza city, Paraíba state in Brazil, in 1989. However,
continuous AFP surveillance is critical in order to comply
with the World Health Organization (WHO) eradication
program and to promptly detect potential cases of
importation since wild poliovirus are still endemic in a
few countries of Asia and Africa. This study describes the
results of detection and characterization of NPEV isolates
by amplification of the 5´ non-coding region (5ŃCR) by
reverse transcription (RT)-PCR and molecular typing
by partial sequencing of the VP1 gene. Stool samples
were obtained from patients diagnosed with AFP in
the northern region of Brazil, as well as in Maranhão e
Piauí, during 2007 and 2011. Fecal specimens from 564
AFP cases were received and 20% suspensions were
clarified with chloroform and inoculated in RD, HEp2-C
and L20B cell lines, incubated at 36°C and examined
daily for the presence of cytopathic effect. A total of
28 (5%) specimens were positive in cell culture and 8
isolates were characterized as HEV-B species (2 samples
were Coxsackievirus B3, 2 Echovirus 9, 1 Echovirus
11 and 3 Coxsackievirus B6), when compared to the
GenBank sequences. The remaining twenty isolates
were amplified, purified for sequencing reaction and
are currently awaiting for further analysis. During the
eradication of wild poliovirus in the world, other NPEVs
have been identified as the cause of polio-like syndrome
and our data are of potential importance in broadening
the knowledge on the epidemiological features of AFP
cases. Financial Support: Instituto Evandro Chagas/SVS/
MS
HV82 - Il17 Gene Polymorphism (Rs 763780
T>C) And Viral Load In Chronic Hepatitis B
Patients
Vasconcelos De Deus, D.M., Santos, J.C., Lopes Neto,
E.P.A., Coêlho, M.R.C.D.
Universidade Federal de Pernambuco, UFPE, AV.
Professor Moraes,1235 - Cidade Universitária, Recife - PE CEP: 50670-901
Interleukin-17 (IL-17) is an important mediator in
delayed immune response, increasing the production of
chemokines in different tissues and the recruitment of
monocytes and neutrophils to the site of inflammation.
Elevated serum levels of this cytokine may indicates
a high risk for the development of hepatocellular
carcinoma (HCC). High levels of IL17 gene expression
are related to cirrhosis in patients with hepatitis B.
The T>C (rs763780) single nucleotide polymorphism
(SNP) causes an amino acid replacement (His161Arg).
93
Human Virology: HV
Since the T>C SNP in the IL17F gene, might be one of
the etiopathogenic agents related to aggravation of
liver complications in chronic hepatitis B The aim of
this study was to determine the frequency of the IL17F
gene polymorphism (rs763780) genotypes and the
hepatitis B virus (HBV) DNA level in chronic hepatitis B
patients without treatment. This study was performed
from October 2012 to April 2013. We investigated 79
patients from the Hepatology Outpatient at the Hospital
of Federal University of Pernambuco. Genotyping was
performed by real-time PCR according to the HRM (High
Resolution Melting) analysis and viral quantification. The
genotypes frequency was CC (17.7%), CT (50.6%) and
TT (31.6%) and it’s were in Hardy-Weinberg equilibrium
(p=0.3879). Among the 79 patients studied, the median
HBV DNA level was 2.047IU/mL. However, we observed
a higher viral load among the males with TT genotype
and beyond age 40 years (p<0.0001). Whereas male
patients below age 40, with CC genotype (4.717IU/mL)
or CT genotype (2.414IU/mL), showed a lower viral load
(p<0.0001). Male subjects with IL17TT, the no mutant
genotype, might have problems in clearance-HBV,
mainly due to the higher viral load. In addition, increase
ageing might be related to a further aggravation in the
development of liver complications.
HV89 - Effects Of Compounds Isolated From
Plants On Hepatitis C Replication
Jardim, A.C.G., Santos, V.A.F.F.M., Felippe, L.G., Amako,
Y., Igloi, Z., Shimizu, J.F., Furlan, M., Harris, M., Rahal, P.
1. Institute of Bioscience, Language and Exact Science,
IBILCE/UNESP, Rua Cristóvão Colombo, 2265, Jardim
Nazareth, 15054-000, São José do Rio Preto
2. Institute of Chemistry. Department of Organic
Chemistry, IQ/UNESP, Rua Prof. Francisco Degni, 55 Bairro:
Quitandinha 14800-900 - Araraquara, SP
3. University of Leeds, University of Leeds
Hepatitis C virus (HCV) infection is a worldwide problem
of public health. Current therapy based on pegylated
interferon and ribavirin presents low sustained
virological response, is expensive and causes severe
side effects. Although recent developments of direct
acting antivirals offer hope for improvements to HCV
therapy, there is still a need to develop more efficient
new antivirals or combination of therapies for HCV
treatment. In this context, compounds extracted from
plants can provide an alternative approach to new
therapies. The Brazilian flora represents a vast, largely
untapped, resource of potential antiviral compounds.
Here we evaluated the antiviral effects of Brazilian
natural compounds on HCV replication. We used a
cell line stably expressing SGR-JFH-1 FEO replicon by
electroporation of human hepatoma Huh-7.5 cells.
Increasing doses of the compounds were added to stable
replicon cells, and replication efficiency and cell viability
were accessed after 48 hours. The results indicated
that 4 compounds decreased HCV replication in a dosedependent manner with an EC50 of 2.3, 4.0, 8.2 and
38.9 μM. All 4 compounds significantly inhibited HCV
replication as judged by reductions in both luciferase
activity and HCV protein expression assessed through
western blotting for NS5A. An effect on HCV IRES driven
translation was excluded and we conclude that these
compounds directly inhibit virus genome replication.
The inhibitory effects were confirmed by using the full
length virus system where the compounds blocked viral
replication to 0.2, 2.4, 4.9 and 11% compared to DMSO
control. These data provide information of the potential
of Brazilian natural compounds as antiviral against
hepatitis C virus.
HV92 - Clinical Case: Intrafamilial
Transmission Of Vaccinia Virus During A
Bovine Vaccinia Outbreak In Brazil
Oliveira, G.P., Silva-Fernandes, A.T., Assis, F.L., Alves,
P.A., Franco-Luiz, A.P.M., Figueiredo, L.B., Almeida,
C.M.C., Travassos, C.E.P.F., Trindade, G.S., Abrahão, J.S.,
Kroon, E.G.
Presidente Antônio Carlos, 6627, Pampulha, Belo Horizonte,
MG
2. Universidade Estadual do Norte Fluminense Darcy
Ribeiro, UENF, Av. Alberto Lamego, 2000, Campus Campos
dos Goytacazes, Rio de Janeiro
The Bovine Vaccinia (BV) is an emerging zoonosis
caused by Vaccinia virus (VACV) that circulates between
bovines and humans causing economic losses and public
health problems. In general, human cases are related
to direct contact with sick cattle but there is a lack of
information about human-to-human transmission of
VACV during BV outbreaks. In this study, we molecularly
demonstrated a case of VACV transmission between
humans in São Francisco de Itabapoana County, Rio de
Janeiro state, in September 2002. A 49-year-old patient
reported the development of lesions on his hands a few
days after contact with sick cattle. The lesions evolved
from macules to papules, vesicles, pustules and, after
some weeks, to scabs. In addition, this patient presented
a high fever, ranging from 39 °C to 40 °C, myalgia,
headache and axillary lymphadenopathy. Approximately
six days after the beginning of the healing stage, patient
reported that his son, a 14-year-old student, presented
similar symptoms, including lesions, fever, headache and
axillary lymphadenopathy. Remarkably, the son did not
work as a milker and did not have contact with cattle. To
investigate this case, our group went to the affected farm
94
Human Virology: HV
and collected scab and swab samples from the hands of
patients. The samples were inoculated in Vero cell and
after the appearance of cytopathic effects, DNA was
extracted and then submitted to a PCR assay targeting the
a56r gene that is a molecular marker for Brazilian VACV.
The a56r PCR products were directly sequenced using
the MegaBACE platform. Both exanthematic samples
showed the amplification of a 950bp fragment. The
VACV isolates were grouped in the same phylogenetic
tree branch, revealing an unique nucleotide substitution
marker present only in the samples isolated during this
outbreak. Our data indicate that human-to-human VACV
transmission occurred during a BV outbreak in Brazil,
raising new questions about the risk factors of the VACV
transmission chain.
genotype was the most prevalent (78%), followed by gB3
(18%) and gB1 (4%). Genotypes gB4 and gB5 were not
found. Identification of regions under seletive pressure,
through comparison between non-synonymous (dN)
and synonymous (dS) substitution taxes (ω=dN/dS),
demonstrated the presence of positive selective pressure
on the variable region of the UL55 gene. Financial
support: UFABC/CNPq
HV93 - Frequency Of Glycoprotein B
Genotypes In Transplant Recipients And
Evidence Of Positive Selective Pressure On
The Gb Gene
Stangherlin, L.M., De Paula, F.C., Ruiz, L.G.P., Nogueira,
M.L., Braz, A.S.K., Silva, M.C.C.
1. Fundação Oswaldo Cruz, Fiocruz, Av Brasil, no
4365, Manguinhos, Rio de Janeiro, Brasil
2. Universidade Federal Fluminense, UFF, Rua Hernani
de Melo
Pampulha, Belo Horizonte
1. Universidade Federal do ABC, UFABC, Rua abolição
sem número, Santo André, SP
FAMERP
A total of 2,570 cases of deaths associated with viral
hepatitis is reported annually in Brazil. Most of these
fatal cases resulted from fulminant hepatic failure
(FHF), a rare but potentially fatal disease seen in a small
number of people (1%) with viral hepatitis. The unique
treatment for FHF is hepatic transplantation. In FHF,
the inflammation and necrosis grade are more severe
than those observed in acute viral hepatitis. In general,
the cause of death before transplantation is sepsis
accompanied by high level of circulatory endotoxins
in circulation. To access immunological mechanisms
of extensive liver lesions observed in FHF cases, seven
patients with FHF induced by hepatitis A virus (HAV)
infection, eight patients with acute hepatitis A and 10
health controls (HC) were investigated by quantification
of plasmatic cytokine levels (IL6, IL8, IL10, TNF-alpha,
IFN-gamma) and mitochondrial DNA (mtDNA). A
quantitative immunoassay was used to evaluate the
cytokine profile, and a real time PCR was employed in
order to evaluate the rate of mtDNA in plasma samples.
The results showed an increase in the levels of both
NADH dehydrogenase (2,891.75 ng/100µL serum) and
cytochrome C (1,853.68 ng/100µL serum) in plasma
samples from patients with FHF comparing HC patients
(0.018 ng/100µL serum and 0.025 ng/100µL serum,
respectively) (p<0.05). Plasma samples from hepatitis
A acute patients also showed increased levels of mtDNA
(75.70 Cyt C, 98.05 NADH) in comparison with HC
patients (p<0.05). The plasmatic level of IFN-gamma was
27.28 fold increased in comparison with health controls
(p<0.05). These findings confirmed the high expression
of IFN-gamma in plasma during the necro-inflammatory
Human cytomegalovirus is a ubiquitous infectious agent
worldwide. After primary infection, the virus remains
in a persistent or latent state in immunocompetent
individuals, due to an equilibrium between the immune
system and viral replication. However, HCMV is a
classical opportunistic agent and severe diseases can
occur in settings of immunosuppression (e.g. AIDS
patients and transplant recipients) or in the absence
of a fully competent immune system (congenital
infection). The factors responsible for virulence and
pathogenesis are not fully understood but it is clear that
a variety of mechanisms that allow the virus to escape
the humoral and cellular immune responses contribute
to pathogenesis. In addition, is postulated that genetic
variability may have impact on HCMV virulence and
pathogenesis. HCMV strains have polymorphisms
in several regions, and in particular, the envelope
glycoproteins are of interest since viral proteins are
involved with cell attachment and entry, and are targets
of the host immune system. To date, the most studied
polymorphisms involved the UL55 gene that encodes
the glycoprotein B (gB) one of the major constituents
of the virus and a target for neutralizing antibodies.
In this work we aimed to analyze the distribution of
gB genotypes in renal transplant recipients and to
investigate the presence of selective pressure on the
UL55 gene. From a total of 24 samples analyzed the gB2
HV108 - Cytokines And Mitochondrial
Products Involved In Fulminant Hepatic
Failure Caused By Hepatitis A Virus
Infection
Melgaço, J.G., Vieira, Y.R., Lewis-Ximenez, L.L., Soriani,
F.M., Menezes, G.B., Pinto, M.A., Vitral, C.L.
95
Human Virology: HV
process induced by HAV infection. This study also
provides important evidences of mitochondrial
dysfunction and DNA damage, both contributing to
critical events of viral fulminant hepatitis, and suggests
their use as outcome markers of viral FHF.
HV110 - Comparative Study Of Hepatitis A
Vp1/2a And Vp1 Genotyping Genes And Its
Correlation To The Clinical Outcome Of
The Disease
Lemos, A.S., Tourinho, R.S., Rodrigues, C., LewisXimenez, L.L., De Almeida, A.J., Pinto, M.A., De Paula,
V.S.
Instituto Oswaldo Cruz - FIOCRUZ, IOC - FIOCRUZ,
Av. Brasil 4365
Genetic variants of HAV have been identified by
sequencing of selected genome regions, including the
VP1 amino terminus and the VP1/2A junction. The VP1
amino terminus and the VP1/2A junction can be used to
distinguish one strain from another. On the basis of the
genetic variability observed within the putative VP1/2A
junction, 6 HAV genotypes have been identified: I, II e
III from human and IV, V e VI from Simians. However,
some studies demonstrated that HAV strains of VP1
amino terminus contain more informative variable
positions than the VP1/2A junction. To gain insight into
the molecular epidemiology of HAV, we investigated the
genetic variability of HAV strains recovered from acute
and fulminant patients using the complete sequence
of the VP1/2A and VP1 gene from the correspondent
sample. The genotyping results were correlated to the
hepatitis A clinical outcome of each patient to analyze
it as a disease prognostic factor. Genotyping analysis
was accessed through amplification of the VP1 (1119
bp) and VP1/2A (243bp) genetic region, using specific
primers, from HAV RNA of 94 serum samples. Expected
amplicons were sequenced and the results were
analyzed phylogenetically by Bayesian reconstruction
method using Tamura Nei 93 model. Results showed
that 63 samples were reactive for HAV RNA, which 46 for
VP1/2A and 17 for both HAV genetic regions. Fifty-four
samples were successfully sequenced for VP1/2A and
11 for VP1 region. Phylogenetic analysis demonstrated
that, independently of the genetic region used, strain
genotype does not change. Although, VP1 region contains
more information of HAV genetic diversity, it is a larger
fragment difficult to amplify and sequence. It was not
observed any correlation of HAV specific genotype
to disease outcome once fulminant pacient samples
clustered phylogenetically with acute ones. Thus, we
can conclude that variability on the VP1/2A junction is
sufficient to determinate HAV genotype and viral genetic
diversity does not seem to be a disease progression
factor.
HV120 - Hiv-1 Genetic Diversity And Drug
Resistance In Failing Antiretroviral
Therapy Patients From Amazonas State –
Brazil
Costa, C.M., Couto-Fernandez, J.C., Oliveira, C.M.C.
1. Tropical Medicine Foundation Dr Heitor Vieira
Dourado, FMT-HVD, Av Pedro Teixeira, n 25, Dom Pedro.
CEP 69040-000. Manaus-Amazonas-Brasil
2. Fundação Oswaldo Cruz, FIOCRUZ, Av Brasil, 4365,
Manguinhos. CEP 21040-900. Rio de Janeiro - RJ - Brasil
Molecular epidemiology is an important tool in the
studies of HIV-1. The geographical distribution of HIV
variants is heterogeneous and this tool allows us to
now the epidemiological characteristics of pandemic
HIV. In this study we evaluated 117 HIV-1 sequences
from patients failing ART submitted to the genotyping
from Amazonas state (Brazil) during the years 2009 to
2012 to know the genetic diversity of HIV-1 subtypes
and the prevalence of resistance mutation associated
to antiretroviral therapy (ART) in this region. The mean
age was 34 (±15) years, CD4 652 cells/mm3 and viral
load were 36,050 copies/ml. Viral resistance genotyping
was performed using Trugene Genotyping System
and subtype analysis was performed at the Brazilian
Algorithm for HIV-1 drug resistance. The majority of
genotyped virus was classified as subtype B (93.2%)
and 6.8% were non-B. One of the non-B virus was the
recombinant BC. The HIV-1 genotyping profile associated
with nucleoside reverse transcriptase inhibitors (NRTI)
has shown that more than 50% of the samples carried
the M184V resistance mutation. The timidine associated
mutations (TAMs) T215Y/F and M41L were found
in 48% and 35% of the samples, respectively. For the
non-nucleoside RT inhibitor (NNRTI), the substitution
K103N was the most prevalent (50%). The resistance
mutations associated to protease inhibitor (PI) were:
L63P (45,3%), M36I (44,4%) and L90M (18%). This
mutation profile is in accordance to therapy adopted in
Brazil. The minor mutation L63P was clearly associated
to B subtype (p< 0,05). This study contributes to the
north Brazilian region mapping, and Brazilian mapping
consequently, of HIV epidemic, once the majority of
studies in this theme in Brazil are performed in south or
southeast regions. Sponsorship: Dept. of STD, AIDS and
Viral Hepatites, Brazilian Ministry of Health; Oswaldo
Cruz Foundation, IOC/FIOCRUZ and Tropical Medicine
Foundation Dr Heitor Vieira Dourado - Amazonas, Brazil
HV131
Differential
Evolution
Of
Quasispecies In A Couple Infected With Hcv
96
Human Virology: HV
Matos, R.P.A., Jardim, A.C.G., Bittar, C., Yamasaki, L.H.T.,
De Carvalho-Mello, Rahal, P.
1. Instituto de Biociências Letras e Ciências Exatas,
IBILCE/UNESP, Rua Cristóvão Colombo, 2265 Bairro: Jardim
Nazareth - São José do Rio Preto
2. Universidade Federal de São Paulo, UNIFESP, Rua
Pedro de Toledo, 669. Bairro: Vila Clementino - Sao Paulo, SP
Hepatitis C Virus (HCV) is the major etiological agent
of chronic hepatitis worldwide. The World Health
Organization estimates that 3% of the population of
the world is infected. The aim of this study was to
analyze serum samples of two patients infected with
HCV genotype 1 that presented intrafamilial and sexual
contact in order to evaluate the genetic and phylogenetic
relationships among viral variants. Patient 11 was male
and non-responder, and patient 10 was female and endof-treatment responder. We analyzed baseline samples
and samples collected 2 and 6 months after treatment.
Investigation of possible risk factors for acquisition
and transmission of HCV was performed by analysis of
epidemiological questionnaires previously answered
by patients. The coding region NS5A of HCV was cloned
and sequenced, resulting in 90 complete sequences of
NS5A. Both patients declared to have unprotected sexual
intercourse and shared use of personal hygiene objects,
as razors. The phylogenetic tree showed that sequences
of both patients grouped together with bootstrap
support and control sequences located in different
clusters. This data demonstrate that the variants of
these patients were more related to each other than
to the variants from the control patients, suggesting
a common source of contamination. However, these
patients presented different quasispecies composition
and evolutionary dynamics over time. The quasispecies
of patient 11 clustered according to the collect point.
Conversely, the phylogeny analysis in patient 10 suggests
that quasispecies detected after treatment originated
from pre-treatment quasispecies. The differential
profile of quasispecies observed for each patient may
be due to the influence of host factors during the course
of the disease and therapy administration. So, the
population of quasispecies detected in each patient can
be an important factor related to treatment response.
HV136 - Tetravalent Synthetic Peptides
Derived From Dengue Virus Envelope
Domain I And Ii Are Able To Induce
Antibodies
With
Low
Neutralizing
Activity
Rodrigues, N.F., Rocha, P.R., Livonesi, M.C., Costa, L.C.F.,
Santos, M.C.S.G., Rocha, E.S.O., Kroon, E.G., Malaquias,
L.C.C., Coelho, L.F.L.
1. Universidade Federal de Alfenas, UNIFAL, Rua
Gabriel Monteiro da Silva, 700. Centro - Alfenas/MG.
2. Universidade Federal de Minas Gerais, UFMG
especially in the tropical and subtropical areas. Infection
with a single Dengue virus (DENV) serotype causes a
mild, self-limiting febrile illness called dengue fever.
However, a subset of patients experiencing secondary
infection with a different serotype progresses to the
severe forms of the disease (dengue hemorrhagic fever/
dengue shock syndrome). These forms are characterized
by spontaneous bleeding and plasma leakage after an
excessive immune activation of T cells and macrophages.
In this study we evaluated the immunogenicity of three
tetravalent and conserved synthetic peptides (Pep01,
Pep02 and Pep03) in a murine model by measuring
peptide-specific antibody levels (total IgG, IgG1 and IgG2a
subtypes). Sera from Pep01, Pep02 and Pep03 immunized
mice had mean total IgG titers of 96 +- 56; 133 +- 46 and
≥ 3200, respectively. PBS treated and DENV-1 infected
mice did not produce detectable levels of anti-peptides
antibodies. The IgG1 titers induced by all peptides were
similar to that found for total IgG. In contrast, no one
of these peptides induced IgG2 antibodies. The plaque
reduction neutralization assays showed an absence or a
low titer of neutralizing antibodies. Serum derived from
mice immunized with Pep01 had a neutralizing titer ≤
20 only for DENV-1 and the serum derived from Pep03
vaccinated animals showed had a neutralizing titer ≤ 20
for DENV-1 and DENV-3. Serum from Pep02 immunized
mice had no neutralizing activity. Further investigation
will be required to improve immunogenicity and
functional activity to make peptides a viable option for
DENV vaccines. Financial support: FAPEMIG; CNPq.
HV144 - Tetravalent And Conserved
Synthetic Peptides Derived From Dengue
Virus Envelope Domain I And Ii Are
Recognized By Dengue Igm Positive Serum
Human Samples
Costa, L.C.F., Rocha, P.R., Gomes, A.V.B.T., Filho, S.L.M.,
Junior, C.J.C.Z., Malaquias, L.C.C., Coelho, L.F.L.
Universidade Federal de Alfenas, UNIFAL, Rua Gabriel
Monteiro da Silva, 700. Centro - Alfenas/MG
especially in the tropical and subtropical regions of the
world. Despite the magnitude of the problem, there
are still limitations related to the diagnosis, due to the
presence of false negative results often presented in the
laboratory reports. Studies with the envelope protein
are extremely important for the development of new
vaccines and diagnostic tests. Serological methods are
97
Human Virology: HV
important for the diagnosis of dengue infections, among
them, the enzyme linked immunoassay that can detect
IgM against Dengue virus. In this study, a panel of 82
serum samples from dengue suspected patients was
classified as positive and negative using the commercial
Elisa kit Panbio Capture Dengue IgM. Assay performance
of the commercial kit was compared with the new
indirect ELISA assays using synthetic peptides derived
from E protein (Pep 01, Pep 02 and Pep 03) as substrate.
Of a total of 82 serum samples, (52.4%) were positive
by the commercial Elisa kit Panbio Capture Dengue IgM,
18 (21,95%) showed immunogenicity against Pep01;
40 (48,78%) against Pep02 and 66 (80,48%) against
Pep03. Among the serum samples classified as positive
by the commercial kit (42), 11 (26%) are also classified
by positive using Pep01 as substrate, 22 (52,3%) using
Pep02 as substrate and 40 (95,23%) using Pep03 as
substrate. Among the negative samples classified as
negative by the commercial kit (40), 28 (70%) were also
classified as negative using Pep01 as substrate, 20 (50%)
using Pep02 as substrate and 13 (32.5%) using Pep03
as substrate. Concluding, the Pep03 showed a superior
performance to that found in the commercial test
PanBio. Future analysis will be conducted to measure
the sensibility and specificity of the ELISA assays using
the peptides as substrate for detected IgM from dengue
suspected serum samples. Financial support: FAPEMIG;
CNPq.
HV146 - Hepatitis C Virus Quasispecies
Analysis Using Ultra-Deep Pyrosequencing
Yamasaki, L.H., Khudyakov, Y., Vaughan, G., GanovaRaeva, L.M., Diminitrova, Z.E., Pavel, S., Campo, D.S.,
Jardim, A.C.G., Bittar, C., Carvalho-Mello, I.M.V.G.,
Rahal, P.
1. Universidade Estadual Paulista “Julio de Mesquita
Filho”, UNESP, Rua Cristovao Colombo, 2265 Jd. Nazareth,
Sao Jose do Rio Preto - SP, Brasil
2. Center of Diseases Control and Prevention, CDC,
1600 Clifton Rd., Atlanta-GA, EUA
3. Universidade Federal de São Paulo - Escola Paulista
de Medic, UNIFESP, Sao Paulo-SP, Brasil
Hepatitis C is a major public health problem. New HCV
antiviral drugs were released on market on 2010, however,
excluding for genotype 1, the most used therapy used
currently is still based on Interferon (IFN) and Ribavirin.
Viral genome variability is one of the factors that lead in
therapy failure. HCV presents a high mutability during
replication course, implicating in arising of intra-host
variants called quasispecies. The hypervariable region 1
(HVR1) from envelope protein presents as quasispecies
and may be related to IFN therapy resistance. Resistant
quasispecies may not represent majority of variants
population in the host, therefore, in these cases
traditional sequencing techniques are unable to detect.
For detection of minority quasispecies, ultra-deep
pyrosequencing (UPDS) is a realiable and efficient tool,
being able to detect even variants with frequency <1%
in the population. Regarding this issue, we determined
HVR1 quasispecies from 43 patients infected with
HCV genotype 1 or 3 using the UPDS approach, in
collaboration with the Division of Viral Hepatitis in CDCAtlanta/USA. In total, 240.445 HVR1 sequences were
obtained from pre-therapy sample. Using the pipeline
developed by DVH-CDC group, 88.797 sequences
with high quality were filtered. These sequences were
analysed using median-joining networks and Bayesian
population structural analysis. These analysis identified
samples with different structures, from high conserved
(one sub-population) to high stratified ones (7 subpopulations). Networks analysis also confirmed this
result. Next steps of this study will include during
and pos-therapy sample analysis. These results will
contribute to the understanding of HCV quasispecies
dynamics and therapy and how a high resolution tool as
UPDS is essential to it. Financial support: CAPES, FAPESP
and CDC.
HV150 - Phylogenetic Analysis Of Dengue
Virus 1 Isolated In Alfenas, Minas Gerais,
Brazil.
Menezes Filho, S.L., Gomes, A.V.B.T., Fagundes, L.G.S.,
Rocha, R.P., Araki, C.S., Colombo, T.E., Nogueira, M.L.,
Malaquias, L.C.C., Coelho, L.F.L.
1. Universidade Federal de Alfenas, UNIFAL-MG,
Laboratório de Vacinas, Departamento de Microbiologia e
Imunologia
FMSJRP, Lab. de Pesquisas Em Virologia, Dept. de Doenças
Infecciosas e Parasitárias
especially in the tropical and subtropical areas with
around 2.5 billion people living in areas at risk regions
of the world. The disease is caused by a positive single
strand RNA virus that belongs to genus Flavivirus, family
Flaviviridae. There are four serologically related viruses
designated as DENV-1, DENV-2, DENV-3 and DENV-4.
Infection with one of these serotypes causes a mild, selflimiting febrile illness called dengue fever. However, a
reduced number of patients could develop the severe
forms of disease called dengue hemorrhagic fever and
dengue shock syndrome. In this study, we isolated and
performed a phylogenetic analysis of a DENV-1 strain
isolated from a dengue hemorrhagic fever patient from
Alfenas, South of Minas Gerais. The serum obtained from
this patient was used to infect C6/36 cells and after
98
Human Virology: HV
the fourth passage the supernatant was collected and
used for viral RNA extraction. The viral RNA was used
in a RT-PCR to amplify the envelope region. The PCR
product was sequenced and the sequence obtained was
analyzed using MEGA software. The analysis showed
that this strain isolated in Alfenas, MG/2012 is closely
related to strains isolated in Rio de Janeiro State during
2010-2011. This isolated was placed within lineage L1
from DENV-1 group together with other isolates from
Brazil, Venezuela and Colombia. This is the first report
of isolation and phylogenetic analysis of a DENV strain
isolated from South of Minas Gerais, Brazil. Financial
support: FAPEMIG; CNPq.
HV151 - Htlv-1 Co-Infection Is Able To
Reactivate Hiv-1 Latent Virus By Tax
Transactivation
Geddes, V.E.V., Pandeló, D., Aguiar, R.S.
Cidade Universitária, Ilha do Fundão, Rio de Janeiro - RJ
2. Laboratório de Virologia Molecular, LVM, Av. Carlos
Chagas Filho 373 - CCS - Bloco A - Sala 121 - 2o andar, UFRJ
One major conundrum in HIV/AIDS cure concerns
the virus latency established in resting memory T
lymphocytes and other non-dividing cells. This latent
reservoir is a major barrier to the eradicate HIV-1 from
positive patients and is not affected by highly active
antiretroviral therapy (HAART). Indeed, co-infections
with other retrovirus, such as HTLV-1, might modulate
the replication of HIV-1.HTLV-1 codify a transactivator
protein Tax-1 that is able to activate not only HTLV-1, but
also HIV-1 transcription. In this study, we evaluated if the
co-infection with HTLV-1 can activate HIV latency and
investigate the molecular mechanism of this modulation.
HTLV-1 proviral clone (PK30) was transfected in
lymphocytes TCD4+ models of HIV-1 latency (J-Lat cells,
clones 6.3 and 8.4). These cells harbor a HIV integrated
latent genome that express GFP as reporter gene of
transcription activation. The co-infection with HTLV-1
promotes activation in up to 15% of HIV-1 latent cells,
compared with positive controls by TNF-α treatment
(up to 18%). This activation was mediated by Tax
that promote up to 25% of HIV-1 activation. However,
Tax mutant variants (M20) that lose transactivation
activity were not able to promote HIV-1 transcription.
Our results with glycerol gradients showed that Tax
promote the activation of the Positive Elongation
Factor b (pTEF-b) that phosphorylate CTD domain of
cellular RNA polymerase II. In conclusion, HTLV-1 co
infection modulates HIV transcription increasing the
virus production and the risk to develop AIDS. Financial
support: FAPERJ/CNPq
HV155 - Molecular Epidemiology And Origin
Of Htlv-1 In The Southern Bahia - Another
Endemic Area For The Virus In The State.
Aleluia, M.M., Mello, M.A.G., Marin, L.J., Rego, F.F.A.,
Pereira, L.S., Galvão-Castro, B., Gonçalves, M., Bispo,
S.M., Alcântara, L.C., Gadelha, S.R.
1. Universidade Estadual de Santa Cruz, UESC,
Rod. Ilhéus Itabuna km 16, Salobrinho, Ilhéus, Bahia. Cep
45662900
2. Fundação Osvaldo Cruz, FOC
3. Escola Bahiana de Medicina e Sauúe Publica
4. Universidade Estadual do Sudoeste da Bahia, UESB
In order to clarify the HTLV introduction and dispersion
in the south of Bahia, we analyzed 29 samples from HTLV1 seropositive women. Before the blood collection, all of
them answered a standardized questionnaire. The DNA
was extracted by QIAgen Kit. It was performed a nestedPCR to the LTR region of the HTLV. The sequences were
submitted to the LASP HTLV-1 Automated Subtyping
Tool. The phylogenetic analyses were generated using the
neighbor-joining e máxima-verossimilhança methods.
The evolutionary model of Tamura-Nei with gamma
distribution was selected as the best adaptive model by
software Modeltest 3.7. The likelihood ratio was used
to calculate the statistical support for the branches
in trees. Bayesian tree were constructed to verify the
posterior probability statistical parameter. To evaluate
genetic ancestry of the population, it was analyzed
mtDNA ancestry markers and β-globina haplotypes.
From the total, 21 samples were successfully amplified
and sequenced and they were classified as HTLV-1 aA
(bootstrap support of 100%). The phylogeny analysis
showed multiple introductions of the virus in Brazil. In
addition, for the first time, Mozambique sequences were
grouped with Brazilian and South Africa sequences,
supporting the hypothesis that Africans infected
with the virus have been brought from the southern
regions of Africa. In relation to the genetic ancestry, the
African ethnicity was predominantly found by mtDNA
markers. In addition, the type benin was detected by
β-globin analyses. These data corroborate to clarify
the introduction and dispersion of this virus in Brazil,
especially in the Bahia. Financial support: PROPP-UESC
e FAPESB
HV157 - Detection Of The Pandemic
Norovirus Variant Gii. 4 - Sydney 2012 In Rio
Branco, Acre, Northern Brazil.
Silva, L.D., Rodrigues, E.L., Lucena, M.S.S., Lima, I.C.G.,
Soares, L.S., Oliveira, D.S., Mascarenhas, J.D.P., Linhares,
A.C., Gabbay, Y.B.
99
Human Virology: HV
Instituto Evandro Chagas, IEC, Rodovia Br 316 Km 07
Ananindeua, Pará
Noroviruses (NoVs) are an important cause of acute
gastroenteritis in humans worldwide and are considered
the second causative agent of viral gastroenteritis in
children under five years old. The human infections
are associated mainly to GII.4 genotype whose variants
have been associated with global epidemics of acute
gastroenteritis. The main objective of this study was
to analyze stool samples from children with acute
gastroenteritis collected between July and September
2012, obtained within the National Surveillance Program
of Rotavirus Gastroenteritis, coordinated by Brazilian
Ministry of Health. The detection of NoV was first
performed using a commercial enzyme immunoassay
(EIA). The viral genome was amplified by RT-PCR using
primers specific for region D of the viral capsid of NoV
GII (Cap C, Cap D1 and Cap D3) and primers for P2
region (EVP2F, EVP2R). DNA sequencing was performed
using the Big Dye Terminator Cycle Sequencing Ready
Reaction Kit. A total of 25 samples were collected of
children with acute gastroenteritis from Rio Branco,
Acre. Patient’s ages ranged from 4 months to 8 years
old. These samples were analyzed by EIA and 48%
(12/25) were positive for NoVs, which occurred mainly
in children between 6-12 months (42%-5/12). NoVs
genotype characterization, detected the New Orleans
2009 and Sydney 2012 GII.4 variants. The sequence
had a high nucleotide identity among them (range 98,8
- 99,5%) and differed 97.4 - 98.8% when compared
with other NoVs strains, in analysis of the region P2.
This study demonstrated the circulation of the two most
recently identified GII.4 variants, New Orleans 2009
and Sydney 2012 in the city of Rio Branco, Acre and this
represents the first detection of the recently emerged
GII.4 Sydney 2012 variant, in Brazil. Additional studies
are needed and continued surveillance will provide more
information about emergence, circulation and antigenic
diversification of the NoVs genotypes that predominate
in this region.
HV158 - Detection Of Astrovirus In Fecal
Samples From Children Under Five Years
Old From Rio Branco, Acre, Brazil.
Medeiros, T.B., Silva, L.D., Rodrigues, E.L., Lucena, M.S.S.,
Menezes, E.M.F., Lima, I.C.G., Resque, H.R., Soares,
L.S., Loureiro, E.C.B., Rodrigues, I.R.C., Silva, M.C.M.,
1. Seção de Virologia, Instituto Evandro Chagas, SAVIR/
IEC, Rodovia BR-316, Km 7, S/N 67030000 Levilândia,
Ananindeua-PA
2. Seção de Bacteriologia, Instituto Evandro Chagas,
SABMI/IEC, Rodovia BR-316, Km 7, S/N 67030000
Levilândia, Ananindeua-PA
3. Seção de Parasitologia, Instituto Evandro Chagas,
SAPAR/IEC, Rodovia BR-316, Km 7, S/N 67030000
Levilândia, Ananindeua-PA
The human astroviruses (HAstVs) have been associated
with outbreaks and sporadic cases of acute gastroenteritis
involving young children and other age groups
worldwide. The transmission of HAstVs occurs by the
fecal-oral route, person to person contact or by ingesting
contaminated water or food. Diarrhea and vomiting are
the main symptoms caused by these agents. The HAstVs
belong to the Astroviridae family, genus Mamastrovirus,
being divided into eight “classic” genotypes (HAstV-1
– HAstV-8), and the recently described VA1, VA2, VA3,
MLB1 and MLB2. The objective of this study was to
detect HAstVs in fecal samples collected from children
under five years old, and their correlation with
epidemiological aspects. Four expeditions to the city of
Rio Branco, Acre, were performed during the months of
February, April, June and August of 2012, with duration
of fifteen days each. Fecal collections were realized in
two emergency units (UPA). The detection of HAstVs was
done by reverse transcriptase-polymerase chain reation
(RT-PCR) using the primers pair Mon 269/Mon 270.
HAstVs were detected in 13 (3.2%) of the 401 samples
analyzed, being 2.9% (2/69) in June and 8.9% (11/123)
in August. The HAstVs were detected in 5.1% (10/194)
and 1.4% (3/207) of the samples, in both symptomatic
and asymptomatic groups, respectively. The distribution
of positive cases by age group demonstrated that the
female children of 0-6 months old (12.1%-5/41) were
the most affected group. The HAstVs has been considered
as an important etiological agent of acute gastroenteritis
in Brazil, as verified in Belém (13.1%-40/305), Rio
de Janeiro (13.5%-43/318) and São Paulo (28.2%66/234). The data obtained in this study demonstrate
the circulation of HAstVs in Acre and are important to
orient health actions, due to the inexistence of similar
studies in that region.
HV160 - Detection Of Norovirus In Fecal
Samples From Children With And Without
Acute Gastroenteritis From Rio Branco,
Acre, In The Year Of 2012
Rodrigues, E.L., Silva, L.D., Medeiros, T.B., Lucena, M.S.S.,
Menezes, E.M.F., Lima, I.C.G., Soares, L.S., Loureiro,
E.C.B., Rodrigues, I.R.C., Silva, M.C.M., Mascarenhas,
J.D.P., Gabbay, Y.B.
1. Instituto Evandro Chagas, IEC, Rodovia BR-316,
Km. 7. Ananindeua, Pará
100
Human Virology: HV
2. Universidade do Estado do Pará, UEPA, Rua do
Una, n.º 156. Belém, Pará
Norovirus (NoV) belongs to Caliciviridae family and are
a common cause of non-bacterial diarrheic outbreaks,
transmitted by the fecal-oral route, by contaminated
water and food or by person to person contact. This study
aimed to detect and analyse epidemiological aspects of
NoV infection in fecal specimens collected from children
under five years old, during four expeditions to Rio
Branco, Acre. A total of 401 samples were collected in
January, March, June and August of 2012. The specimens
were collected from children attended at the Emergency
Unit of the I and II District. The samples were tested by
a commercial enzyme immunoassay (EIA) and reverse
transcriptase-polymerase chain reaction (RT-PCR) using
the primers Mon 432-434/ 431-433, that are specific
for NoV genogroups GI and GII, respectively. A positivity
of 12.7% (51/401) was observed for NoV for at least
one method. The highest positivity 31.9% (22/69)
was verified in June. Analysis of the positive cases by
age group showed that males of 6-12 months old were
the most affected with positivity of 25% (9/36) and as
the second the females of 12-24 months old with 20%
(9/45). The frequency of vomiting observed in diarrheic
children, both positive and negative for NoV, was similar
in almost all months of collection, with exception of June,
when the positivity of 76.4% (13/17) was observed in
the NoV positive cases and 34.6% (9/26) in the negative
ones. Studies have demonstrated the importance of
NoV as etiological agent that required medical care. The
positivity verified in this study (12.7%) was a little higher
than 9.8% (30/305) detected in a surveillance carried
out in hospitals and emergency departments in Belém. In
Manaus the NoV were observed in 35.4% (171/483) of
the samples from Emergency Units. The data obtained in
this study are relevant considering the few information
available about the NoV circulation in Rio Branco. These
results may contribute to the improvement of Public
Health of this state.
HV174 - Investigation Of Dengue Virus In
Aedes Aegypti, In Juiz De Fora, Minas Gerais,
Brazil.
Sacchetto, L., Botelho, J., Duque, E., Campos, G.M.M.,
Pereira, M.S., Rosa e Silva, M.L., Kroon, E.G., Drumond,
B.P.
Lourenço Kelmer, s/n Campus Universitário/Bairro São Pedro
Gerais, INTRAVIRUS
3. Departamento de Vigilância Epidemiológica e
Ambiental PMJF, DVEA, Av. Rio Branco, nº 3353 - Centro
Juiz de Fora CEP 36021-630
4. Laboratório de Vírus, Instituto de Ciências Biológicas
UFMG, UFMG, Av. Antônio Carlos, 6627 - Pampulha - Belo
Horizonte - MG CEP 31270-901
Dengue virus (DENV) (Flavivirus, Flaviviridae) occurs as
four antigenically distinct but genetically related viruses
named DENV-1 to -4. DENV is transmitted by species
from Aedes genus (Culicidae), mainly A. aegypti. DENV1 to DENV-4 circulate in Brazil and the country has the
higher numbers of DENV in Latin America. Minas Gerais
state usually present high number of dengue cases and
until May 2013, 313,545 suspected cases and 88,881
confirmed cases were reported. The LIRAa (Aedes
aegypti infestation index rapid survey) presented an
increase of four times when the index from March/2012
(1.90%) was compared to the index from March/2013
(7.80%). An increase in suspected (3,877) and confirmed
(2,981) dengue cases, in 2013, was also observed. The
aim of this work was to perform a prospective study
of A. aegypti infection with DENV in Juiz de Fora-MG.
Larvae and mosquitoes were collected in epidemic and
non-epidemic periods in 2012 and 2013 and properly
identified. Pools of larvae (165 pools, each contained
50 larvae) and mosquito (53 pools, each contained 20
mosquitoes) were macerated and used for total RNA
extraction. Total RNA was used for cDNA synthesis
followed by nested-PCR to detect DENV. DENV was not
detected in none of mosquitoes pools tested. DENV
was detected in six pools of larvae (3.63%) obtained in
Central, Northwest, East and South regions. These results
reinforce the circulation of DENV in Juiz de Fora - MG and
in different regions of the city that are highly inhabited.
Moreover, as known for DENV, the vertical transovarian
transmission of DENV was detected here and may be
implicated in DENV maintenance in the Juiz de Fora
urban environment. Financial support: FAPEMIG, CNPq,
CAPES, UFJF, PROPESQ/UFJF.
HV176 - Three-Dimensional Models Of Ns3/4a
Protease Containing Resistance Mutations
To Protease Inhibitors From Patients With
Chronic Hepatitis C Protease Inhibitors
Naïve.
Hoffmann, L., Da Silva, M.L., Ramos, J.A., Valentin, E.S.,
Ürményi, T.P., Rondinelli, E., Bisch, P.M., Silva, R.
2. Instituto Nacional de Metrologia, Qualidade e
Tecnologia, INMETRO, Av. Nossa Senhora das Graças, 50 Xerém, Duque de Caxias, RJ, 25250020
101
Human Virology: HV
INTRODUCTION: New compounds are being considered
for anti-HCV therapy since the low sustained virological
rates with pegylated interferon and ribavirin (PEG-IFN/
RBV) treatment. NS3/4A protease inhibitors (PIs) are
already approved by Food and Drug Administration
(FDA) and by the Brazilian Sanitary National Agency
(Anvisa). However, resistance mutations often occur
and may influence on therapy efficacy. Identification
of these mutations since before the beginning of
PIs treatment is important to the correct clinical
management. OBJECTIVE: The aim of this work is to
assess the three-dimensional (3D) prediction models
to NS3/4A serine protease from patients treated with
PEG-IFN/RBV previously studied. We found already
described PIs resistance mutations in 3 of a cohort of
68 patients (4,4%). MATERIAL AND METHODS: The 3D
NS3/4A protease models were predicted by comparative
molecular modeling using software MODELLER and the
validation was done by Ramachandran plot, DOPE score
and calculating RMSD with template. It was used 2FM2
as the reference structure. RESULTS: In 3D models we
can observe a lot of amino acid alterations and some of
which are near Serine-139. This is one of the amino acids
that are found in the active site of the protease and the
target binding site of the most widely used PIs. It suggests
that it can interfere at PI and NS3/4A protease active
site ligation and consequently interfering in treatment
outcome. To better understanding the influence of these
mutations on PI ligation we are performing molecular
docking using AutoDock. CONCLUSIONS: 3D models
showed that the presence of mutations near NS3
protease active site may influence the PI ligation and
consequently the PI therapy efficacy. This approach can
suggest which patients will not benefit from treatment
with these drugs. Financial support: FAPERJ/PPSUS/MS,
INCT-INPeTAm/CNPq/MCT, CNPq and CAPES.
HV177 - Molecular Characterization
Of Astrovirus Affecting Hospitalized
Children From Belém, Pará, Northern
Brazil.
Portal, T.M., Siqueira, J.A.M., Carvalho, T.C.N., Oliveira,
D.S., Linhares, A.C., Mascarenhas, J.D.P. , Gabbay, Y.B.
Instituto Evandro Chagas, IEC, • Rodovia BR-316 km
7 s/n - Levilândia - 67030-000 - Ananindeua / Pará / Brasil
Astrovirus (AstVs) is a common viral pathogen that causes
gastroenteritis (GE) worldwide. They are classified in
eight classic types and others five new ones, described
as HAstVs VA1, VA2, VA3, MLB-1 and MLB-2. Elderly
and children are the most affected group when comes
to outbreaks, mainly due to person-to-person contact
and ingestion food and contaminated waters. During
the period of May 2008 to April 2011, 483 fecal samples
were collected from hospitalized diarrheic children,
under five years old in a pediatric clinic from Belem-Para,
Northern Brazil. These samples were initially tested for
rotavirus detection with negative results. They were
submitted to viral RNA extraction by the silica method
and tested with primers specific to norovirus (NoV)
and the classic HAstVs (Mon269/Mon270) detection.
After that, a subset of 125 negative samples for NoV and
HAstVs were also tested with primers SF0073/SF0076
that detect both classics and new MLB-1 and MLB-2
HAstVs. The nucleotide sequence was determined by
direct cycle sequencing and the chromatograms were
analyzed with BioEdit software and compared with
others registered in GenBank. A positivity of 3.5%
(17/483) was observed when using the classic HAstVs
primers which 94.1% (16/17) being characterized by
nucleotide sequencing: 64.7% (11/16) as HAstVs-1,
23.5% (4/16) as HAstVs-2 and 5.9% (1/16) as HAstVs-3.
In regard to the subgroup of 125 samples, two (1.6%)
were positive being classified as HAstVs-1 and HAstVs-8.
As verified in studies conducted in different countries
the HAstV-1 was the most prevalent. The HAstVs type 8
was not frequently found, but it already was described in
a study conducted in Belem, Para. The new types MBL1 and MLB-2 were not detected in this study. Maybe,
improvements in the technique are necessary to obtain
better results. Therefore, the researches of these agents
are important considering the few studies available in
Brazil and mainly in the Northern region.
HV180 - Molecular Diagnostic Of Herpes
Simplex Virus Type-1 In Serum Samples Of
Immunocompromised Patients
Lopes, A.O., Perse, A.S., Grinsztejn, B., Wagner, S., De
Paula, V.S.
1. Instituto Oswaldo Cruz, IOC, Av. Brasil, 4365 Manguinhos, Rio de Janeiro, Brazil
2. Instituto de Pesquisa Evandro Chagas, IPEC, Av.
Brasil, 4365 - Manguinhos, Rio de Janeiro, Brazil
Herpes is a recurrent viral disease, usually benign, can
be caused by herpes simplex virus type-1 (HSV-1) that
belong to Herpesviridae family. The HSV-1 can induces
102
Human Virology: HV
lesions around the mouth, but in immunocompromised
patients the virus may cause lasting and severe
manifestations that may lead to death. The treatment
involves the use of antiviral aciclovir, famciclovir,
velaciclovir. In relation to the laboratorial diagnosis, the
gold standard is the virus isolation, in many cases due to
low titers, the virus cannot be isolated. Another method
for the HSV diagnosis is the Polymerase Chain Reaction
(PCR), being a highly sensitive and specific, besides, it
allows the diagnosis of different samples such as blood,
saliva and lesion. The aim of this study was to detect the
HSV-1 in immunocompromised patients by qualitative
PCR. For this purpose, were enrolled in this study, 41
samples from HIV-positive patients collected during
2012 in the Instituto de Pesquisa Evandro Chagas/
Fiocruz. These samples were tested by conventional
PCR for gene gI (410 bp) and gG (269 bp), which codify
glycoprotein I and glycoprotein G of viral envelope,
respectively. The results showed that, to gI region, HSV
DNA was detected in 36,6% (15/41) of HIV positive
patients and to gG region 44% (18/41) of samples
were positive. Among HSV positives samples, 46% were
detected in men, in this group HSV DNA was detected in
both region. Among women, 38% were positive to gG
and 15% were positive to gI. PCR allowed the detection
of co-infection of HSV-1 in patients infected with HIV
and the detection was more frequent in the gG region.
In conclusion, this techniques can be used to detect coinfection HSV1/HIV and to monitoring HSV infection in
immunocompromised patients.
HV184
Detection
Of
Norovirus
Recombinant Gii.P21/Gii.3 In Hospitalized
Children For Acute Gastroenteritis From
Belém, Pará, Northern Brazil
Siqueira, J.A.M., Fumian, T.M., Barros, R.J.S., Reymão,
T.K.A., Portal, T.M., Júnior, E.C.S., Linhares, A.C.,
Instituto Evandro Chagas, IEC, Rod. BR 316, Km 07,
S/N, Levilândia, CEP: 67030-000. Ananindeua-Pará
The norovirus (NoV) RNA-recombination can increase
the virulence and lead to a mistake in molecular
epidemiological studies, having major implications in
vaccine design strategies. The present study reports the
detection of NoV recombinant GII.P21/GII.3 affecting
children hospitalized for acute gastroenteritis (AGE).
The fecal collection specimens occurred from May 2008
to April 2011. The enzyme immunoassay (EIA) and
reverse transcription-polymerase chain reaction (RTPCR) from region B (Mon 431-434) were used for NoV
detection. The samples with positive results by EIA and
negative by RT-PCR, were submitted to semi-nested RTPCR from region A (JV12Y(+)/JV13I(-) [1st Step]; GI(+)/
NoroII-R(-) [2nd Step]). The nucleotide (nt) sequence
was determined by direct cycle sequencing including
the most properly region D. In order to investigate the
possibility of a recombination event, ORF1/2 junction
region was analyzed (Mon 431/432-G2SKR) with the
SimPlot construction. A positivity of 35.4% (171/483)
was observed. The nt sequencing of A/B regions were
obtained in 52 positive samples, being 80.8% classified
as GII.4d, 7.7% as GII.7 and 11.5% as GII.b. Using the
region D, five of the six samples classified as GII.b
were characterized as GII.3 and three were confirmed
as recombinants by ORF1/2 junction region, when
compared with two parental strains [GII.b (AY68254)
and GII.3 (U02030)]. The breakpoint was identified in
nt 5070 located 15 nucleotides upstream of the ORF1/2
overlap. An international NoV working group recently
proposes a new nomenclature using both ORF1 and VP1
sequences, considering that recombination is a common
event. In order to have a better classification, they named
the GII.b strain as GII.P21. The NoV-recombination
GII.P21/GII.3 is one of the most detected worldwide,
being responsible for AGE outbreaks in Europe, Asia
and Australia. In this study, this strain was related with
severe cases of diarrhea leading to hospitalization,
demonstrating the high virulence of this genotype, what
reinforce the need of a continuous NoV-surveillance.
HV186 - Molecular Epidemiology Of
Alfaherpesvirus In Immunocompromised
Patients In Brazil
Perse, A.S., Lopes, A.Z., Almeida, A.J., De Paula, V.S.
4365
1. Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil,
2.
Hospital
HUGGUNIRIO
Universitário
Gaffree
Guinle,
Herpes simplex type 1 (HSV-1) and herpes simplex
type 2 (HSV-2) are classified in the Alphaherpervirinae
subfamily, possessing the ability to infect and cause
latency in sensory nerves . Certain situations such
as stress, hyperthermia, organ transplantation and
immunosuppression can lead to reactivation of
infection. During reactivation, the viral particles are
transported via anterograde transport along the
peripheral sensory neurons may cause an infection in
the tissue mucocutaneous, keratoconjunctivitis and
encephalitis. Based on the DNA sequence of clinical
isolates, divergence between different genotypes are
well described for herpesviroses human, but in Brazil
there are no information about molecular epidemiology
of the herpesviroses . This research aims to characterize
the genotypes of HSV-1 and HSV-2 in HIV/AIDS
circulating and study the epidemiology of these viruses
in Brazil. For this purpose, 72 samples of HIV patients
103
Human Virology: HV
reagents from a public Hospital were analyzed. The
polymerase chain reaction (PCR) assay was performed
to genes glycoprotein G (gG) and glycoprotein I (gI) from
HSV-1; and glycoprotein genes G (gG) and glycoprotein
B (gB) from HSV-2. Twenty six samples were positive
for the gene gG and thirty-three samples positive for
the gI gene of HSV-1; no sample were positive to HSV2. The PCR products were directed sequencing and
the results showed a homology between 90-99% with
the nucleotide sequences previously described in the
literature suggesting that the samples of this study
are closely related to samples from group A of HSV1 . Our data clearly demonstrate that 42 percente of
immunocompromised patients have HSV-1 DNA detect
in the serum samples. These results contribute to the
understanding of HSV1 epidemiology in Brazil and can
be useful in predicting disease progression and guiding
treatment initiation decisions.
HV189 - Serologic Surveillance For
Arbovirus In, Mazagão, Amapa State,
January -2013
Ferreira, M.S., Martins, L.C., Chiang, J.O., Rodrigues,
S.G., Rodrigues, D.S.G., Nunes-Neto, J.P., Santos, M.P.,
Vasconcelos, P.F.C.
1. Instituto Evandro Chagas, IEC, mileneferreira@iec.
pa.gov.br
2. Instituto Evandro Chagas, IEC, pedrovasconcelos@
iec.pa.gov.br
3. Secretária Municipal de Saúde de Mazagão-Amapá,
Almost all arboviruses are zoonoses maintained in the
wild environment. Therefore, people who maintain
closed contact with enzootic foci of arboviruses are
most at risk of becoming infected. Several arboviruses
are serious problems for the public health problems,
such as dengue Virus (DENV), Mayaro (MAYV) and
Oropouche (ORO) which occur in the Amazon region.
Due the report of a febrile outcreak a serological survey
to Arbovirus infections was performed in Mazagão
municipality, state of Amapa in January 2013. A total of
132 serum samples were collected from febrile patients
living in the urban area and in the neighborhood of
Magazão Municipality, Amapá state. Samples were
screened by hemagglutination – Inhibition (HI) test
against 18 of arbovirus antigens from genera Alphavirus
(East Encephalitis equine virus, Western Encephalitis
equine virus, Mayaro virus, Mucambo virus), Flavivirus
(Yellow fever virus, Dengue virus type 1, 2 3 and 4,
Saint Louis Encephalitis virus, Rocio virus, Ilheus virus)
and Orthobunyavirus (Caraparu virus, Guaroa virus,
Tacaiuma virus, Maguari virus, Oropouche virus and
Catu virus); samples were also assayed by IgM–ELISA to
DENV and YFV. From 132 human samples tested by HI,
16 (12.1%) were positive to alphaviruses; 131 (99.2%)
to flaviviruses and 113 (85.6%) to orthobunyaviruses.
By IgM-ELISA, a total of 90 serum samples were also
tested 64 (71.1%) of them were positive to DEN IgM,
suggesting recent infection by dengue and all serum
samples tested were negative for YFV. The serologic
results demonstrate the occurrence of a Dengue fever
outbreak in Mazagão municipality; finally, a very high
seroprevalence to other arboviruses of different genera
suggest a high circulation of these viruses in Mazagão.
Financial support: IEC/ SVC/MS
HV190 - Evidence Of Person To Person
Transmission Of Hepatitis A Virus In
Household Outbreaks
Lima, L.R., Hasselmann, B., Lewis-Ximenez, L.L., De
Paula, V.S.
Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil 4.356
Introduction: Hepatitis A virus is transmitted by fecaloral route through contact from person-to-person or
through ingestion of contaminated food or water. The
person-to-person transmission is easier especially
indoors where there are improper hygiene conditions
and high proportion of individuals susceptible. Thus,
the intimate family contact is a risk factor for disease
dissemination. Based on that, this work aims to evaluate
the intrafamilial transmission of HAV. Methods: Serum
samples were collected from patients with hepatitis
A (index case) and their family members (contacts) at
Ambulatory of Viral Hepatitis. Patients who agreed to
participate in the study signed an informed consent.
Thus, thirty families were included, total of 97 serum
samples. Serum samples were firstly submitted to
detection of IgG and IgM anti-HAV by ELISA and rapid
test. Then, HAV-RNA was detection by nested-PCR
employing primers for the VP1/2A region of the viral
RNA and HAV-RNA positive samples were sequencing.
Results and Conclusion: Among 30 families that were
investigated in 16 were detected evidence of household
transmission by serology and/or molecular biology.
Of the contacts include in this study 31% showed IgM
anti-HAV, 39,7% showed IgG anti-HAV and 29,3% were
susceptible to HAV. The majority (70%) of the patients
under 20 years old were susceptible to hepatitis A.
HAV-RNA was detected by nested-PCR in 42% (41/97)
of serum samples collected and all isolates sequenced
belong to HAV genotype I. In four families was possible
suggest the person-to-person transmission due high
nucleotidic identity (99,4% and 100%) between the
nucleotidic sequences of HAV isolates. This study
found a large amount of families exposed to household
outbreaks demonstrating that this place is favorable
for spread of hepatitis A, which is further facilitated
104
Human Virology: HV
by person to person transmission confirmed in two
household outbreaks and due large number of younger
still susceptible to infection. Financial Support: IOCFIOCRUZ and CAPES E-mail: [email protected]
HV196 - Comparative Analysis Of The Saliva
And Urine Samples For Congenital Cmv
Infection Screening.
Souza, G.O.S., Oliveira, J.S., Cardoso, E.S.C., Zeidan, G.C.,
Gadelha, S.R., Marin, L.J.
1. Universidade Estadual de Santa Cruz, UESC,
2. Centro Universitário Leonardo da Vinci,
UNIASSELVI
The cytomegalovirus (CMV) is the most frequent cause of
congenital infection worldwide and the infection can be
symptomatic or asymptomatic. Early diagnosis of CMV
in newborns is very important to avoid sequel and it can
be done by PCR from various clinical specimens. The
urine is considered the gold standard sample; however
there are some limitations to use urine, especially on a
large scale screening due the difficult to obtain during
the collection. The present study aimed to verify the
usefulness of saliva as compared with the use of urine
for the diagnosis of CMV infection in 1000 newborn
from Maternity Santa Helena- Ilhéus, Bahia. The study
was approved by the Ethics Committee of the UESC
(209/08). Saliva and urine samples were collected with
sterile swabs and sterile bags collectors, respectively.
The saliva samples were collected from 100% children
while the urine samples only 33.4%. The detection of the
viral genome in saliva and urine sample was performed
by PCR. It was detected and confirmed congenital CMV
infection in 13 infants. Considering only the 334 infants
that it was possible to collect both samples, it had been
detected 5 congenital infections (prevalence of 1.50%).
Analyzing the 666 infants that only saliva samples were
collected, 8 congenital infections (prevalence of 1.20%)
were detected. The comparison between the use urine
and saliva for detection of CMV viral genome showed
no significant difference (p = 0.7372). Besides that, it is
important to emphasize that the use of saliva samples
had provided more positive samples. These newborns
would not have the diagnosis of infection since it was
not possible to collect urine. Thus, our results suggest
that due the difficulty to obtaining urine for a newborn
on a large scale screening, saliva samples present a quick
and easy alternative to obtaining satisfactory results and
can be used as an alternative for the diagnosis of this
infection. Financial support: FAPESB e UESC.
HV197 - Hcv Detection In Acupuncture
Needles
Braga, A.C.S., Lemos Júnior, M.A., Carneiro, B.M., Silva,
J.B.G., Rahal, P.
1. Universidade Estadual Paulista, UNESP, Rua
Cristóvão Colombo, 2265, CEP 15054-000 - São José do Rio
Preto, SP
FAMERP, Av. Brigadeiro Faria Lima, 5416, CEP 15090-000
São José do Rio Preto, SP
Hepatitis C is a consequence of infection by hepatitis C
virus (HCV) and it is estimated that approximately 170
million people worldwide are chronically infected. Many
patients are asymptomatic and are usually diagnosed
after a long period of time, resulting in complications
such as cirrhosis and hepatocellular carcinoma. These
asymptomatic patients also represent a natural source of
the disease and the spread of HCV. This virus is infectious
through contact with blood and transmission can
occur by contaminated materials such as syringes and
needles. Many studies suggested acupuncture therapy
as a possible route of transmission however, there is
no studies confirming this hypothesis yet. Acupuncture
needles often penetrate the skin, subcutaneous tissue
and muscles and usually residual patient blood can be
found on those material. The aim of this study was to
investigate the presence of HCV RNA in acupuncture
needles used on HCV positive patients. Needles from
HCV positive patients were collected from two to four
different acupuncture sessions. HCV negative patients
were also included in this study as negative control. The
results obtained by Real-time PCR showed that in 50%
of HCV patients it was possible to detect the presence
of viral RNA in the samples. Needles collected from
different sessions from the same patient had the same
result. These data demonstrate that the acupuncture
therapy may indeed be a route of transmission of
HCV and underscore the importance of bio-security
procedures to prevent accidents potentially infectious.
HV205 - Hbv And Hdv Infections In HivInfected Patients In Midwest, Brazil
Puga, M.A.P.
Universidade Federal do Mato Grosso do Sul, UFMS,
rua filinto muller, cidade universitária, LAC-CCBS, sem
número
A cross-sectional study on prevalence of HBV and HDV
infection, risk factors and genotype distribution of
HBV infection was conducted among 848 HIV-infected
patients recruited at reference centers in the Midwest
Region of Brazil. Of the patients investigated, 222 had
serological markers of HBV infection. The prevalence
rate of HIV-HBV co-infection was 2.4%. No HIV-HBV
105
Human Virology: HV
infected patient presented as positive for anti-HDV
and one (0.1%) HIV/HBV patient was found to be
anti-HCV-positive. Male gender, increasing age, family
history of hepatitis, use of illicit drug and homosexual
activity were independent factors associated with HBV
exposure. The phylogenetic analysis based on the S gene
region revealed the presence of genotypes D (76.9%),
F (15.4%) and A (7.7%) among the study population.
This study demonstrates the low prevalence of HIV-HBV
infection and also highlights of early vaccination against
HBV as well as testing for HBV, HCV and HDV in all HIVinfected individuals.
HV206 - Compliance With And Response To
Two Hepatitis B Vaccination Schedules
Among Female Sex Workers In Campo
Grande, Mato Grosso Do Sul
Castro-Souza, L.
Universidade Federal do Mato Grosso do Sul, UFMS,
Rua Filinto Muller, cidade universitária, s/ número, LACCCBS
The most effective measure in combating Hepatitis B
virus (HBV) infection is the active immunization. Thus,
was offered the hepatitis B vaccine, in two different
vaccination schedules, in a total of 256 female sex
workers susceptible to HBV infection in Campo Grande,
MS, and also investigated the adhesion and response to
hepatitis B vaccine in this population. The two vaccination
schedule used was: accelerated (0, 1 and 2 months)
and conventional (0, 1 and 6 months) schedules. Of all
susceptible subjects, 230 (89.8%) individuals received
the first dose of vaccination schedules, accelerated
or conventional, and only 82 (35.6%) complied with
the full scheme. There was no significant difference in
compliance rate (p = 0.52), when the conventional and
accelerated vaccination schedules were compared.
Protective titers of anti-HBs were detected in those that
completed the three doses of HBV vaccine. Alternative
schemes for hepatitis B vaccination and health education
programs are needed for the control and prevention
against HBV infection, besides improving vaccination
coverage in these female sex workers.
HV213 - Genomic Typing Of Human Parvovirus
B19 Circulating During Outbreaks Of
Erythema Infectiosun In Niterói, Rj, Brazil
Cubel Garcia, R.C.N., Pereira, R.F.A., Macedo, D.F.R.,
Castro, T.X., Azevedo, K.M.L., Setubal, S., Oliveira, S.A.
1. Instituto Biomédico, Universidade Federal
Fluminense, MIP/CMB/UFF, Rua Prof. Hernani Melo 101,
Niterói, RJ. CEP:24210-130
2. Programa de Pós Graduação em Ciências Médicas,
PPGCM/UFF, Faculdade de Medicina, UFF
3. Disciplina de Doenças Infecciosas e Parasitárias,
UFF, DIP/HUAP/UFF, Rua Marquês do Paraná 303, Niterói
(RJ) CEP 24033-900
Human Parvovirus B19 (B19V), a member of the
Parvoviridae family, genus Erythrovirus, causes a wide
spectrum of clinical conditions. The most common
clinical presentation of B19V infection is the childhood
exanthem known as erythema infectiosum (EI). Previous
studies have demonstrated that the disease appears to
cycle in approximately 4-5 years. To date, B19V has been
grouped into three distinct genotypes: genotype 1, with
subtypes 1a (B19V) and 1b; genotype 2; and genotype
3, with subtypes 3a and 3b. The aim of this study was
to investigate the distribution of B19V genotypes during
two outbreaks of EI in Niterói, RJ. A total of 26 serum
samples collected from patients with EI attending at
general medical outpatient clinic at HUAP/UFF during
1999-2000 (20 samples) and 2004-2005 (6 samples)
were examined. Viral DNA was extracted from sera using
QIAamp DNA Blood Mini Kit (QIAGEN, Brazil) and a seminested PCR using primers pair P12/P16 (4127-4689)
and P13/P16 (4214-4689) for partial amplification of
the VP1/VP2 capsid gene was performed. The 476bp
amplicons were purified using GFXTM PCR DNA and Gel
Band Purification kit (GE, Healthcare, UK) and subjected
to direct sequencing using the BigDye terminator v.
1.1 cycle sequencing kit (Applied Biosystems,CA, USA).
Nucleotide and amino acid (AA) similarity with Genbank
database was assessed using BLAST tool. According to
the sequence analysis of VP1/VP2 capsid region, all the
26 strains shared higher nucleotide identity (100-99%)
with 1a B19V isolates and then were characterized
as belonging to the genotype 1a. It is well known that
genotype 1 is widespread around the world. In Brazil,
although genotype 1 is the more common, all three
genotypes have been identified. This is the first report
to determine the B19V genotypes circulating in different
outbreaks in Rio de Janeiro, Brazil.
HV214 - Stability Of Hepatitis B Virus Nucleic
Acid In Plasma Samples After 7 Days At 42°C
Almeida, R.W., Espírito-Santo, M.P., Sousa, P.S.F., Almeida,
A.J., Lampe, E., Fernandes, C.A.S., Morais, S.R.S., Bazzo,
M.L., Pires, A.F.N.P.C., Nery-Silva, C.R., Lewis-Ximenez,
L.L.
1. Laboratorio de Hepatites Virais, IOC/FIOCRUZ,
Av. Brasil, 4.365 - Pav. HPP, Manguinhos, Rio de Janeiro - RJ
CEP: 21040900
2. Laboratório Central de Saúde Pública Noel Nutels,
106
Human Virology: HV
LACEN/RJ, Rua do Resende, 118 - Bairro de Fátima CEP:
20.231-092 / Rio de Janeiro
3. Laboratório de Pesquisas III, Serviço de Análises
Clínicas, UFSC, HU, Campus Universitário, S/N°, TrindadeFlorianópolis-SC
4. Dpto. DST, AIDS e Hepatites Virais, Sec. Vigilância
em Saúde, Ministério da Saúde, SAF Sul Trecho 02, Bloco F,
Torre 1, Edifício Premium, ULAB 70070-600 -Brasília
Viral nucleic acid integrity in biological samples for
molecular testing is crucial for reliable laboratory
results. The aim of this study was to evaluate the stability
of hepatitis B virus (HBV) DNA in plasma samples for
external quality assessment panels (EQA) for HBV viral
load and furthermore identify shipping requirements for
sample storage. To assess the stability of plasma samples
containing different concentrations of HBV DNA, serial
dilutions were carried out on an infected sample with
HBV viral load of 6.40 log(10)IU/ml, yielding viral
loads of 5 log(10), 4 log(10) and 3 log(10) IU/ml that
were prepared in triplicate and incubated at 42oC for
up to 7 days and frozen at -70°C. Viral load testing for
HBV DNA was performed for all samples using COBAS®
AmpliPrep/COBAS® TaqMan® HBV Test, v2.0, Roche,
and compared to fresh frozen plasma (FFP) samples that
were not incubated and immediately stored at -70oC
(day 0), and used as a parameter to establish the range
of tolerable result for measurements made in the days
after. The results of this study demonstrate a decrease
of HBV DNA viral load tested after storage at 42°C for
up to 7 days that ranged from 0.005 to 0.30 log10 IU/
ml that did not exceed 0.5 log10, which is the estimated
intra-assay variation for molecular tests. As the decrease
of viral load was non-significant, shipments of hepatitis
B virus in plasma samples at temperatures of up to 42 °
C are suitable within 7 days. These findings confirm that
non-lyophilized samples for HBV DNA detection may be
shipped without dry ice or ice packs for short periods
of time, and thus diminishing costs. Financial support:
Brazilian Ministry of Health
HV216 - Standardization Of A Real-Time
Quantitative Pcr Assay For Detection Of
Hepatitis B Virus
Almeida, A.J., , Espírito-Santo, M.P., Sousa, P.S.F., Lampe,
E., Fernandes, C.A.S., Morais, S.R.S., Silva, I.A.S., Pinheiro,
S.X.S.L., Silva, L.D.A., Marques, V.A., Lewis-Ximenez, L.L.
1. Laboratorio de Hepatites Virais, IOC/FIOCRUZ,
Av. Brasil, 4.365 - Pav. HPP, Manguinhos, Rio de Janeiro - RJ
CEP: 21040900
LACEN/RJ, Rua do Resende, 118 - Bairro de Fátima CEP:
20.231-092 / Rio de Janeiro
The laboratory diagnosis of hepatitis B virus (HBV)
infection is based mainly on serological assays. Yet the
detection and quantitation of viral DNA is necessary
when addressing directly the question of infectivity
or when monitoring the viral load during therapy. We
described the validation of a real-time PCR assay for
HBV DNA quantification with TaqMan chemistry and
MGB probes. The method was calibrated on the basis of
serially diluted clinical samples positive for HBV DNA
tested by COBAS® AmpliPrep/COBAS® TaqMan® HBV
Test, v2.0. The sequences of the probe BS-1 and the
primers HBV-Taq1 and HBV-Taq2 were designed from
the conserved regions of HBV surface gene as described
by Weinberger and collaborators. However, we replaced
the TAMRA quencher for MGB NFQ and HBV DNA was
isolated from 200 ul of plasma using the High Pure
Viral Nucleic Acid kit (Roche Diagnostics, Mannheim,
Germany) according to the manufacturer’s instructions,
differently of the QiaAmp blood and tissue kit (QiaGen,
Hilden, Germany) cited by the author. Using a dilution
series of 100 to 105 UI of HBV DNA, as few as 2.5 UI/
mL could be reproducibly detected. The crossing points
were linearly proportional to the logarithm of the input
copy number over 6 orders of magnitude (R2= 0.99).
The calculated PCR efficiency for this assay, based on the
slope value of -3.5827 was 0.90. The assay is presently
being validated against a broad spectrum of viral load of
different genotypes. Financial support: FIOCRUZ
HV220 - Genetic Diversity Of Dengue Virus
Type 2 Isolated In Roraima Between 2008
And 2011
Siqueira, T.C.S., Granja, F., Sousa, D.D., Cordeiro, J.S.,
Lima Jr., W.P., Nascimento, I.A.S., Silva, G.A.V., Naveca,
F.G., Acosta, P.O.A.
1. Universidade Federal de Roraima, UFRR, Campus
Paricarana: Av. Cap. Ene Garcez, nº 2413. Bairro Aeroporto.
CEP: 69310-00
2. Leônidas e Maria Deane Institute, Fiocruz, ILMD,
Fiocruz
Dengue is an arboviral disease caused by the DENV
virus that belongs to genus Flavivirus, family Flaviridae,
transmitted mainly by the mosquito Aedes aegypti.
DENV has 4 serotypes: DENV1, 2, 3 and 4, beyond
of the intraserotype variability also is subdivided in
genotypes. Serotype DENV2 circulates in Brazil since
1990, where was in Rio de Janeiro (RJ) city. In Roraima
state, from 1999 the serotype DENV2 did not show
reports of circulation only in 2001 and 2004. This state
shows a hyperendemic situation of Dengue, place that
currently there is the 4 serotypes in circulation. The
present study had as objective analyze of the genetic
diversity of DENV2 isolated in Roraima state through
107
Human Virology: HV
phylogenetic analyze to provide important information
that assist in this serotype and its genotypes surveillance.
Then was accomplished viral isolation and indirect
immunofluorescence from C6/36 cells in suspicious of
DENV2 provided from LACEN-RR. Positive samples were
analyzed by RT-PCR e sequenced. A phylogenetic tree
was built with sequences of DENV2 from 2008 to 2011.
Isolated strains end up grouped in a clade together with
the Asian/American genotypes, genotype circulating on
Americas and only one circulating in Brazil. The analyze
results demonstrated that Roraima strains belongs to
this genotype without variation between 2008 and 2011.
High similarity (99%) was found with isolated strains
from RJ in 2008, entry route of DENV2 in Brazil and with
history of severe outbreaks caused by this serotype.
However, low similarity was found with Venezuela’s
strains, neighbor country and potential entry route for
new serotypes and/or genotypes in Brazil. This study
suggests that, probably, DENV2’s strains isolated in
Roraima came in through other states of Brazil instead
of Venezuela. Financial support: Universidade Federal de
Roraima- UFRR e REDE DENGUE/ CNPq
HV221 - Putative Role Of Enteric Viruses
In Oficcial Reports Of Hospitalization By
Acute Diarrheal Disease In Juiz De Fora, Mg
Assis, A.S.F., Valle, D.A., Reis, T.A.V., Barletta, V.H.,
Munck, A.K.R., Tibiriça, S.H.C., Carvalho, I.P., Rosa e
Silva, M.L.
José Lourenço Kelmer, s/n - Campus Universitário São Pedro
- CEP: 36036-330
Pedro Calmon, 550 - Cidade Universitária - Rio de Janeiro, RJ
Acute diarrheal disease (ADD) affects millions of children
worldwide often requiring hospitalization. Despite that,
usually the etiological agent is not identified. Among
the viral pathogens involved stand out the group A
rotavirus (GARV), norovirus (NoV), adenovirus (AdV)
and astrovirus (AstV), some of them associated with
high morbidity and mortality, especially in developing
countries. The purpose of this study was to investigate
the presence of these viruses in ADD cases, aiming to
verify their putative contribution in the official report
of infantile hospitalization (0 - 4 years) by ADD in Juiz
de Fora, MG. From January 2006 to December 2011, 505
diarrheal fecal samples were obtained from children
under 5 years old. Detection of viruses was realized by
PCR and RT-PCR. The rates of hospitalization for ADD
were obtained from Ministry of Health’s Hospitalization
Data System. It was observed that 157 (31.1%) fecal
samples were positive at least for one of the enteric
viruses tested. The prevalence of these viruses in this
study was: NoV (11.1% 56/505), GARV (10.9% 55/505),
AdV (10.9% 55/505) and AstV (2.2% 11/505). Coinfection was observed in 18 fecal samples involving
two viruses, mainly AdV-GARV (33.3% 06/18), AdVNoV (27.7% 05/18) and NoV-GARV (16.6% 03/18) and
three viruses, such as GARV-AstV-NoV (5,6% 01/18) and
GARV-AstV-AdV. The comparison of viral prevalence data
with official report showed an important reduction in
the number of hospitalization between 2006 and 2007
coinciding with the decrease of GARV prevalence, shortly
after the introduction of the Rotarix vaccine. On the other
hand, was observed a trend of increase from 2008 to 2011
associated with an important increment in prevalence of
NoV and AdV infections, probably indicating more severe
cases of ADD caused by these viruses. Altogether these
results suggest an important contribution of NoV, GARV
and AdV in cases of hospitalization by ADD. Financial
support: CAPES, CNPq, FAPEMIG and Propesq-UFJF
HV225 - Production Of Chimeric Protein
In Prokaryotic System For Diagnostic Of
Htlv-1
Carmo, A.P., Silveira, D.M., Daian, D.S.O., Martins, M.L.,
Da Fonseca, F.G., Stancioli, E.F.B.
Avenida Presidente Antônio Carlos, 6627, CEP 31270-901,
Belo Horizonte/ MG
2. GIPH – Interdisciplinary HTLV Research Group ,
GIPH, Alameda Ezequiel Dias, 321, CEP 30130-110, Santa
Efigênia, Belo Horizonte/MG
3. Setor de Pesquisa - Fundação HEMOMINAS,
HEMOMINAS, Alameda Ezequiel Dias, 321, CEP 30130-110,
Santa Efigênia, Belo Horizonte/MG
The Human T-lymphotropic viruses 1 and 2 (HTLV-1
and HTLV-2) are retroviruses transmitted sexually and
by breast feeding and contaminated blood transfusion,
sharing of contaminated needles and syringes, or
transplantation of infected organs and tissues. HTLV-1 is
associated with leukemia (ATL) and a mielopathy (HAM/
TSP), besides other inflammatory diseases. HTLV-2 is
not clearly associated with disease, but it has significant
impact on the morbidity of carriers. Laboratory testing
for HTLV-1 and HTLV-2 infections is mandatory routine
for blood transfusion and organ transplantation in
many countries worldwide. The most used tests for
the diagnosis of HTLV-1/2 are enzyme immunoassays
(ELISA/EIA), indirect Immunofluorescence (IFA),
Western blot (WB) and PCR assays. The aim of this study
was to construct a plasmid vector containing a coding
region for prokaryotic expression of a chimeric-HTLV-1
protein and validate its specificity by WB using sera of
infected individuals (HAM/TSP - HT and asymptomatic
108
Human Virology: HV
- AS) as well as negative controls. The target gene was
linked into an expression plasmid vector, pQE (Qiagen),
and used to transform an Escherichia coli strain suitable
for heterologous expression. Positive clones were
selected and the induction of protein expression was
performed using IPTG. After parameters’ optimization,
the recombinant protein was purified properly and
tested in a Multi Screen WB and these preliminary
results showed that both, HT and AS sera strongly
recognize the chimeric protein, and no reaction was seen
with the negative controls (noninfected individuals).
This work provides promising evidences that the
recombinant HTLV-1 protein was successfully expressed
in the prokaryotic expression system and that the
protein demonstrates specific interaction with HTLV-1
infected serum, which can be a suitable target for future
development of clinical diagnostic tests.
HV236 - Respiratory Viral Infections Among
Asthmatics Infants
Silva, R.C., Mendes, G.S., Amorim, A.R., Rojas, M.A.,
Couceiro, J.N.S.S., Goudouris, E.S., Prado, E.A., Cunha,
J.M.T., Santos, N.
Carlos Chagas Filho - 373, C. Universitária, I. Fundão, R
Janeiro, 21941-972
Asthma is as a chronic condition that affects a large
number of children worldwide. It emerges from a
complex interaction of genetic predisposition and
environmental factors. Acute viral respiratory infection
is one the leading cause of hospitalization of young
children and may be related to exacerbated asthma
episodes in all age groups, particularly in children.
The development of molecular tests facilitated the
understanding of the relationship between viral
infection and asthma exacerbation. The aim of this
study was to determine the rates of respiratory virus
infections in infants with exacerbation of asthma, treated
at the Emergency Service of the IPPMG/UFRJ. Asthma
inception or exacerbation was defined as an abrupt or
progressive worsening of dyspnea, wheezing, chest pain,
cough or a combination of those symptoms. Ninety-one
respiratory samples (nasal+oral swabs combined) were
obtained from 85 patients 2 to 13 year-old. The asthma
attack was classified by the attending physician as mild,
moderate or severe. Samples were analyzed by real time
PCR for virus detection. Thirty-three samples (36.26%)
were positive for at least one virus: 9 single infections
detected with HRV (9.89%), 5 with HBoV (5.49%), 3 with
FLUV (3.29%), 2 with HAdV and HRSV each (2.19%),
and 1 with KIPyV and HMPV each (1.09%). Additionally,
co-infections with these viruses were observed in 10
cases (10.99%): HAdV + HBoV (4 samples), HBoV +
HRV (3 samples), HAdV + HRSV (2 samples) and KIPyV
+ HRSV (1 sample). The majority of patients with
viral infection (78.8%; 26/33) presented moderate/
severe episode of asthma with clinical presentation of
dyspnea (96.9%; 32/33), wheezing (90.9%; 30/33),
and cough (84.8%; 28/33). These results suggest that in
the studied population, viral infections, especially AdV,
HBoV and HRV may be associated with exacerbation
and/or worsening of asthma attacks. Financial support:
CNPq, FAPERJ.
HV239 - Prevalence Of Insulin Resistance
Among Chronic Hepatitis C Patients And
Related Risk Factors
Caldas, G.C., Miguel, J.C., Silva, E.F., Marques, B.L.C.,
Villela-Nogueira, C.A., Almeida, A.J., Lewis-Ximenez,
L.L., Lampe, E., Villar, L.M.
1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365
2. Universidade Federal do Rio de Janeiro, UFRJ
3. Universidade Federal do Estado do Rio de Janeiro,
UNIRIO
There is an association between hepatitis C virus (HCV)
and insulin resistance (IR). The aim of this study was to
determine the prevalence of IR among chronic hepatitis
C patients, and to assess the association between
IR, laboratory parameters and clinical findings. Two
hundred thirty-eight chronic hepatitis C patients were
recruited at three Viral Hepatitis Reference Centers
in Rio de Janeiro. Socio demographic (sex and age)
and anthropometric [weight (kg), height (m), waist
circumference (cm), blood pressure (mmHg) and
body mass index (kg/m²)] data were obtained. Serum
specimens were used for determination of anti-HCV, HCV
RNA, HCV genotype, ALT, AST, GGT, alkaline phosphatase,
thyroid stimulating hormone, glucose, triglycerides,
HDL-cholesterol, VLDL- cholesterol, LDL-cholesterol
and insulin. Stage of hepatic fibrosis was determined by
non-invasive methods. IR was determined by HOMA-IR
where HOMA-IR >2 was defined as IR. All data analysis
was done using SPSS Statistics version 17.0. The mean
age of study population was 54.1 years (± 10.8 years)
and 57.6% were female. HCV genotype 1 was the
most prevalent (66.8%) and most of patients were
not submitted to antiviral treatment (82.8%). Mean
body mass index was 27.5Kg/m2 (±4.23) and 56.3%
of HCV patients presented high systemic arterial blood
pressure (BP) (> 130 x 85 mmHg). IR was observed in
152 patients (63.9%) and 57.2% of them were female.
HCV chronic patients presenting IR (HOMA >2) had
higher levels of triglycerides (p = 0.014), viral load (p <
0.006) and VLDL-cholesterol (p = 0.02), compared with
patients without IR. Age (p = 0.03), waist circumference
(p < 0.001), body mass index (p = 0.003) and weight
109
Human Virology: HV
(p = 0.001) were significantly higher in patients with
chronic HCV hepatitis and IR. In conclusion, this study
demonstrated high prevalence of IR among HCV-positive
patients demonstrating the necessity of preventive
measures in order to avoid adverse effects during HCV
treatment.
HV244 - Study Of Prevalence And Clinical
Aspects Of Congenital Cmv Infection In
Ilhéus, Bahia
Cardoso, E.S.C., Regina Raiol, M.R., Marques, M., Gadelha,
S.R., Cardoso, M.C., Marin, L.J.
Ilhéus
1. PMBBM, UESC, , Ilhéus
2. Maternidade Santa Helena do Hospital São José,
3. Departamento de Ciências da Saúde, UESC, , Ilhéus
4. Departamento de enfermagem, CESUP, Ilhéus
The cytomegalovirus (CMV) is common around the
world and it is the most common cause of congenital
infection, with prevalence between 0.2 to 3% of all
live births. This prevalence is higher in populations
where the maternal seropositivity is high. The vertical
transmission occurs via placenta, through the birth canal
or by breastfeeding. The congenital CMV infection may be
symptomatic or asymptomatic, but most newborns have
no symptoms at birth. However, these asymptomatic
children may develop late sequel such as hearing loss or
developmental delay. Despite of the high prevalence of
this infection, there is no epidemiological information
of congenital cytomegalovirus infection in the southern
Bahia. This study aimed to determine the prevalence
of congenital CMV infection in the Ilhéus region and to
evaluate clinical features of the infection. The study was
approved by the Ethics Committee on Human Research
of the UESC (209/08). It was analyzed 2,100 newborns.
The congenital CMV infection was determined by
detection of viral DNA by nested PCR in at least two
samples of saliva and / or urine before the third week of
life. The CMV congenital infection was confirmed in 23
newborn, showing an incidence of 1.1%. In relation to
the symptoms, 86.34% of patients were asymptomatic
at birth and 13.66% had symptoms. One of the children
died because the virus infection, a second showed
microcephaly and the third had abnormal hearing.
Newborns positive for the virus are been monitoring by
a medical group and it will be done laboratory exams
until they are three years old, in order to achieve the
benefits of the early diagnosis.
HV248 - Norovirus Associated With Acute
Gastroenteritis In The State Of Rio Grande
Do Sul
Andrade, J.S.R., Ferreira, M.S.R., Xavier, M.P.T.P., Fumian,
T.M., Leite, J.P.G., Portes, S.A.R., Miagostovich, M.P.
Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 Manguinhos - Rio de Janeiro - RJ
The genus Norovirus belongs to the family Caliciviridae
and are divided into five genogroups (G) and further
subdivided into 44 genotypes, including 16 GI, 23 GII,
2 GIII, 2 GIV, and 1 GV. GI and GII are responsible for
most infections in humans. NoV are the main agents of
outbreaks of acute gastroenteritis (AGE) worldwide,
affecting individuals of all age groups. The lack of data on
the molecular characterization of NoV in the state of Rio
Grande do Sul (RS) stands out by the number of outbreaks
of AGE reported in recent years. The aim of this study
was to determine the role of NoV in the etiology of AGE
outbreaks in the state of RS from 2004 to 2011, and to
investigate the genetic diversity of the viruses detected
during this period. For this purpose, we analyzed 2265
stool samples sent from the Central Laboratory of RS
(LACEN-RS) to the Laboratory of Comparative and
Environmental Virology (LVCA) from 741 outbreaks
of AGE occurred in this period. For simultaneous
detection of NoV GI and GII, it was performed a reverse
transcription followed by polymerase chain reaction
(RT-PCR), using the specific primers Mon 431-434, that
targets a partial region of the polymerase gene (region
B). For genotype characterization, sequencing was
carried out using primers targeting a partial region of
the capsid gene. NoV was detected in 36,1% (817/2265)
of the samples studied, and linked to 327/741 (44,1%)
of the AGE outbreaks. The molecular characterization
of GI and GII was performed by sequencing of genomic
amplification of nucleotides by two regions that encodes
viral capsid protein VP1 (regions C and D). Of this total,
110 viruses were characterized as GII and two as GI,
being the GII.4 genotype mostly detected, followed by
GII.6. In lower number were also characterized GII.2,
GII.3, GII.4, GII.6, GII.12, GII.13, GII.14, GII.15, GII.17,
GII.21, and GI.1 GI.3. With the subsequent sequencing
of the P2 region, also located in VP1, we identified five
variants of GII.4 circulating in the state, namely: 2003,
2004, 2006a, 2006b and 2010. The great diversity
of genotypes found and high prevalence of genotype
GII.4 and its variants supports the need to maintain a
molecular and epidemiological surveillance of these
viruses in the country, associating the emergence of new
variants of NoV with global outbreaks. Financial support:
CNPq/ FIOCRUZ-IOC
HV253 - Genetic Analyses Of Ha From
Pandemic And Post-Pandemic Influenza A
H1n1pdm09 Viruses Isolated In Rio Grande
Do Sul, Brazil
110
Human Virology: HV
Borges, L.G.A., Sant’anna, F.H., Fallavena, P.R.V.,
Gregianini, T.S., Matias, F., D’Azevedo, P.A., Veiga, A.B.G.
1. Universidade Federal de Ciências da Saúde de Porto
Alegre, UFCSPA, R. Sarmento Leite, 245 / sala 309 - Centro –
Porto Alegre-RS – Brazil. CEP 90050
2. Laboratório Central do Rio Grande do Sul, LACENRS, Av. Ipiranga, 5400, Jardim Botânico. Porto Alegre- RS
During the influenza 2009 pandemics in Brazil, Rio
Grande do Sul (RS) was the most affected state, with
over 3,000 confirmed A(H1N1)pdm09 cases. Studies
concerning the molecular evolution of this strain in
Brazil are scarce. The shortcoming is even worse in the
current post-pandemic period, since there is no data
available in relation to the evolution of the established
A(H1N1)pdm09 viruses In this study the hemagglutinin
(HA) segment of six Influenza A(H1N1)pdm09 genomes
were analyzed. Sequences were aligned using MUSCLE,
embedded in MEGA 5 software. Amino acid substitutions
were visually inspected using the sequences of archetype
strains California/04/2009 and California/07/2009
as references. For phylogenetic analyses, the aligned
sequences were first evaluated using the FindModel
software. The phylogenetic trees were reconstructed
using the maximum likelihood method implemented in
the PhyML program (v3.0 aLRT). The HA protein from
2011 isolates had 5 modifications in antigenic sites,
while that from 2009 isolates had 2 modifications.
The amino acid substitution HA Q310H, implicated
with high mortality rates, was found in the RS samples
AVS03 and AVS04 (2009). However, the alteration
D239N/G, that is associated with severe illness, was
not observed in the isolates. The modification E391K,
associated with changes in antigenic properties, is
present in the 2011 isolates. Studies have attempted to
correlate the presence of the amino acid modifications
in the major viral antigenic determinants HA proteins
with ill prognosis, pathogenicity and virulence. Isolates
presented changes in HA (K2E, Q310H and S220T). At
present it is evident that the A(H1N1)pdm09 viruses
persisted and are constantly evolving. Therefore,
monitoring the circulating strains is crucial to ensure
proper local prevention and control measures against
these pathogens.
HV254 - Emerging Variants Of Hepatitis
C Virus-Ns3 Protease From Chronically
Infected Patients By Next Generation
Sequencing.
Hoffmann, L., Valentin, E.S., Ramos, J.A., Ürményi, T.P.,
Rondinelli, E., Silva, R.
INTRODUCTION: New compounds are being released for
hepatitis C treatment targeted to HCV NS3 protease. The
actual treatment is pegylated interferon and ribavirin
(PEG-IFN/RBV) which results in sustained virological
response in only 50% of the treated patients. Resistance
mutations to protease inhibitors (PIs) are reported by
in vivo and in vitro assays. Therefore it is important
to verify the presence of resistance mutations in both
majority sequences and in quasispecies variants to assess
possible emerging resistances. OBJECTIVE: This work
aims to detect, in a dynamic approach, quasispecies of
HCV and PIs resistance mutations from HCV chronically
infected patients treated with PEG-IFN/RBV. MATERIAL
AND METHODS: 68 patients with chronic hepatitis C,
genotype 1, were selected from the Federal University
Hospital Clementino Fraga Filho, Rio de Janeiro. Blood
samples were collected at different time points (pretreatment, 48 hours, 7 days, 30 days and 3 months), viral
RNA was extracted and RT-nested PCR from partial NS3
protease gene were done. PCR-amplified products were
directed sequenced to identify the majority sequences.
From those in which resistance mutations were detected,
analysis of the quasispecies was done. PCR-amplified
products were sequenced by next generation sequencing
(NGS) using Ion Torrent technology. RESULTS: The
analyses of the majority sequences from three patients
showed the presence of the following resistance
mutations: patient 1, classified as non-responder, T54S;
patient 2, relapser, V36L and V55A; and patient 3,
sustained virological responder, T54S. Sequencing data
from NGS are being analyzed by bioinformatics tools.
Preliminary results of the quasispecies variants showed
high diversity among patients, but conserved pattern of
virus variability in samples of the same patient before
and during PEG-IFN/RBV treatment. CONCLUSIONS:
Assessment of NS3 protease gene sequences before the
PI therapy allow the knowledge of majority and minority
sequences with resistance mutations that can influence
in treatment efficacy. Financial support: CNPq, INCTINPeTAm/CNPq/MCT, CAPES, FAPERJ/PPSUS/MS.
111
Human Virology: HV
HV256 - Serological Survey Of Dengue Virus
Infection In Zona Da Mata, Mg
Siqueira, T.R., Veiga, R., Sutana, L.B., Oliveira, T.M.,
Botelho, J., Rosa e Silva, M.L., Kroon, E.G., Drumond, B.P.
1. Universidade Federal de Juiz de Fora, UFJF
3. Laboratório Lawall - Juiz de Fora, Minas Gerais,
Brazil, LAWALL
Gerais, INTRAVIRUS
Dengue virus (DENV) (Flaviviridae, Flavivirus) is the
most important arbovirus in the world. Any of the four
DENV types can cause asymptomatic disease, dengue
fever or severe dengue. The four serotypes of DENV
circulate in Brazil, including Minas Gerais (MG). In 2013,
a great epidemic has been taking place in Minas Gerais
with 313,545 suspected cases and 88,881 confirmed
cases. Juiz de Fora-MG had great epidemics of DENV
in last years and, until may 2013, 3,877 suspected
cases and 2,981 confirmed dengue cases and one fatal
case were reported, in Juiz de Fora-MG. The aim of
this work was to study the serological response to
DENV and haematological indicators (hematocrit and
platelet count) from patients with clinical suspect of
Dengue, during the 2013 epidemic in Zona da Mata- MG.
Serum samples were collected from 67 symptomatic
patients who were attended in a private laboratory.
The samples were examined using the Dengue IgM/IgG
Test Bioeasy. A total of 26 patients (38.8%) presented
DENV antibodies (4 IgM positive, 9 IgG positive and 13
IgM/IgG positive). Results of haematological indicators
were obtained from 45 patients. Six patients (2 IgM/
IgG positive, 1 IgM positive, 1 IgG positive and 2 IgM/
IgG negative) presented platelet count bellow the
reference values. Eleven patients presented leucopenia
(5 IgM positive and 4 IgG positive). One patient 85 years
old patient had platelet count bellow 100.000 p/mm3
(42.000 p/mm3) and normal hematocrit. None of the
other patients presented raised hematocrit or platelets
count below 100.000 p/mm3, what are indicators of
severe disease. Our results demonstrate once more the
circulation of dengue virus in Juiz de Fora, MG. Previous
studies indicated the circulation of Dengue virus 1 and
2 during the last epidemic periods. The serological tests
indicate primary and possibly secondary infections in
the patients. Further tests will be carried on to trace the
dengue serotypes circulating in the city during the 2013
epidemic. Financial support:FAPEMIG, CNPq, CAPES,
UFJF, PROPESQ/UFJF.
HV258 - Human Adenovirus Detection In
Hospital Fomites
Ganime, A.C., Carvalho-Costa, F.A., Santos, M.S., Costa
Filho, R., Leite, J.P.G., Miagostovich, M.P.
IOC-FIOCRUZ, Av. Brasil,4365; HPP-B205 Manguinhos, Rio
de Janeiro, RJ, Brasil CEP: 21040-360
2. Instituto Nacional de Cardiologia, INC
3. Hospital Pró-Cardíaco, HPC
The
monitoring
of
environmental
microbial
contamination in healthcare facilities could be a valuable
tool to determine pathogens transmission in those
settings; however it is limited to bacterial indicators.
Viruses are commonly found in those environments
and are rarely used for these procedures. The aim of
this study was to assess distribution and viability of a
human DNA virus on fomites in an Adult Intensive Care
Unit of a private hospital in Rio de Janeiro, Brazil. Human
Adenovirus (HAdV) were investigated in 141 fomites by
scraping the surface area and screened by quantitative
PCR (qPCR) using TaqMan System. A total of 63 samples
(44.7%) were positive and presented viral load ranging
from 2.48 x 101 to 2.1 x 103 genomic copies per milliliter
(gc/mL). Ten samples detected at cycle threshold <
38 were selected for virus isolation in A549 and/or
HEp2c cell lines and the viability was demonstrated
by integrated cell culture/nested-PCR in five out them.
Nucleotide sequencing confirmed all sample as HAdV and
characterized one of them as specie B, serotype 3 (HAdV3). Results highlight the risk of nosocomial transmission
via contaminated fomites and point out the use of HAdV
as a biomarker of environmental contamination.
HV260 - Molecular Detection Of Dengue
Virus In Patients During 2012/2013 Epidemics
In Juiz De Fora, Minas Gerais, Brazil
Botelho, J., Carvalho, E.D., Oliveira, T.M., Sutana, L.B.,
Rezende, I.M., Veiga, R., Fernandes, G.C., Rosa e Silva,
M.L., Kroon, E.G., Drumond, B.P.
1. Universidade Federal de Juiz de Fora, UFJF, R José
Lourenço Kelmer, s/n - Campus Universitário Bairro São
Pedro Juiz de Fora
2. INTRAVIRUS Rede de Pesquisa em Virologia do
Interior de Mina, INTRAVIRUS
3. Laboratório Lawall - Juiz de Fora, Minas Gerais,
Brazil, Laboratório Lawall
4. Centro de Pesquisa da Santa Casa de Misericórdia de
Juiz de, Centro de Pesquisa
Dengue virus (DENV) (Flavivirus, Flaviviridae) is the
most important arbovirus worldwide, being transmitted
by Aedes sp.mosquitoes. DENV exists as four different
serotypes: DENV-1 to DENV-4. The epidemiological
112
Human Virology: HV
scenario in Brazil is characterized by the co-circulation
of four DENV serotypes and the country has the higher
number of DENV in Latin America. Minas Gerais state
usually present high numbers of dengue cases and Juiz
de Fora, located at Zona da Mata Mineira, had great
epidemics of DENV in last years. The aim of this work was
to perform a prospective study of DENV in patients with
clinical suspect of DENV infection. Biological samples
were obtained from patients attended in Santa Casa de
Misericórdia (Juiz de Fora-MG). Serum samples were
used for total RNA extraction that was then used for cDNA
synthesis followed by nested-PCR to detect DENV. From
54 serum samples, one was positive for DENV-1, two were
positive for DENV-2 and another positive sample is being
typed. These results are in agreement with previous
findings of our group that demonstrated the circulation
of DENV-1 and DENV-2 in Juiz de Fora- MG. Although
DENV-4 has been presenting a great circulation in Brazil
during the 2013 epidemic it was not detected in Juiz de
Fora, MG, so far. The obtained amplicons are going to be
sequenced to confirm the results, to determine the viral
genotypes circulating in this city and to establish their
phylogenetic relationship. Financial support: FAPEMIG,
CNPq, CAPES, UFJF, PROPESQ/UFJF.
HV262 - An Outbreak Of Hand-FootAnd-Mouth Disease In Amapá, Brazil,
And
Molecular
Epidemiology
Of
Coxsachievirus A16
Burlandy, F.M., Campos, R.M., Tavares, F.N., Costa, E.V.,
Silva, E.E.
1. Instituto Oswaldo Cruz, IOC, Av. Brasil, 4365, cep
21045-900 – Rio de Janeiro - RJ
2. Instituto Evandro Chagas, IEC, Seção de Virologia
Rodovia BR-316, Km 07, s/nº Levilândia, Ananindeua- PA
Human Enteroviruses can cause a variety of diseases in
humans. Enterovirus 71 and coxsackievirus A16 (CVA16) are the main cause of hand-foot-and-mouth disease
(HFMD), but the former is the most common etiologic
agent. HFMD is a common childhood illness characterized
by fever and vesicular eruptions on hands, feet and in
the mouth, that usually affects children under age 10.
This study describes the virological investigation of a
HFMD outbreak occurred in Amapa State, Brazil, during
November and December (2009). Fecal specimens from
19 cases of HFMD were clarified and inoculated in RD
and HEp2C cells. A total of x (26,3%) specimens were
positive for virus isolation in RD cells. Isolates were
characterized at the 5’ non-coding region and molecular
typed by parcial sequencing of the VP1 gene as CV-A16.
To evaluate the genetic relationship and the molecular
epidemiology of CV-A16 in Brazil, samples from Amapa
outbreak were analyzed alongside to 5 other Brazilian
CV-A16 sequences obtained from sporadic cases of
HFMD and acute flaccid paralisys (AFP) occured in four
different Brazilian States between 1998 and 2011. In
addition, 12 international CV-A16 sequences related
to HFMD cases, obtained from the GenBank database,
were also analyzed. Overall the CV-A16 grouped in
87% similarity while the level of similarity between
the outbreak isolates and the other 5 Brazilian CV-A16
strains were about 98%, regardless the main illness
produced. All HFMD associated sequences clustered
separated from that isolated in AFP occurrences. CVA16 isolated from HFMD in other regions clustered
independently, indicating that Brazilian strains are
probably typical from this region and co-circulated with
those from surrounding countries. The results indicate
the CV-A16 as the etiological agent responsible for the
HFMD outbreak occurred in the Amapa State in 2009.
This is the first description and phylogenetic analysis
of HFMD caused by CV-A16 in Brazil. Financial support:
FIOCRUZ, CGLAB and CNPQ
HV263 - Molecular Epidemiology Of Denv2 American/Asian Genotype In São José Do
Rio Preto, São Paulo, Brazil
Vedovello, D., Colombo, T.E., Biselli, J., Pires, L., Depiere,
S., Nogueira, M.
FAMERP, Av. Brg. Faria Lima, 5416 - 15090-000, SJRP, SP
2. Universidade Estadual Paulista Julio de Mesquita
Filho, UNESP/IBILCE, R. Cristóvão Colombo, 2265, 15054000, SJRP, SP
3. Universidade Paulista, Unip - Rio Preto, Av. Pres.
Juscelino Kubitschek de Oliveira, 15091-450, SJRP, SP
Dengue virus (DENV) is the most disseminated arbovirus
affecting human populations. A third of the global
human population is at risk of infection with DENV
and approximately 50–100 million cases are reported
annually There are four closely related serotypes
of DENV (DENV1-DENV4) showing potentially cocirculating. There aren’t models that predict an epidemic
of dengue in endemic regions and the mechanisms by
which dengue virus causes severe illness remain to be
elucidated. Two epidemics caused by DENV2 occurred
in Brazil (1998 and 2007-2008) and studies reported
that the virus circulating in 2007-2008 was genetically
distinct from 1998. In this study we characterizated at
phylogenetic level the DENV-2 strains circulated during
the 2010 to 2013 epidemic in the São José do Rio Preto
city. Confirmation of DENV infection in patients SJRP
occurred by EIA for NS1 protein followed by confirmation
using a RT-M-N-PCR (RT-Multiplex-Nested-PCR) with
Flavivirus generic primers based on non-structural
protein (NS5): 1036 samples were incoming during
113
Human Virology: HV
the 2010 to 2013 years: 68 (6,56%) were positives for
DENV-2 (1 in 2010 year, 14 in 2011, 26 in 2012 and 27
in 2013). The envelope gene of DENV-2 positive samples
was completly sequenced (n= XXX). The Maximun
likelihood Phylogenetic tree was performed by 1485nt
corresponding to the entire gene. The analysis showed
that the São José do Rio Preto strains clustered in the
same genotype of the others brazilians strains and belong
to the same genotype (American/Asia) and forming a
single group. In our strains was verified similar grouping
that occurs on other studies with DENV-2 of that same
region. these previous studies show that after the
reintroduction of DENV-2 in Brazil (2007-2008 seasons)
no major antigenic changes in this gene has not yet been
observed. Financial support: CNPq - INCT-Dengue and
FAPESP
HV265 - Molecular Surveillance For
Arthropod-Borne Viruses (Arboviruses)
And Hemorrhagic Fever Viruses In Febrile
Patients From Rio De Janeiro
Campos, R., Meneses, M.D.F., Graeber-Gerberding, M.,
De Souza, L.M., Veiga, C.S.B., Fernandes, C.A., De Aguiar,
S.F., Schmidt-Chanasit, J., Ferreira, D.F.
1. Universidade Federal do Rio de Janeiro, UFRJ, UFRJ
Av. Carlos Chagas Filho 373 – , CCS, Instituto de Microbiologia
LACEN, LACEN Rio de Janeiro, RJ
3. Bernhard Nocht Institute for Tropical Medicine, BNI,
Hamburg, Germany
Mayaro virus (MAYV) is an arborivus (Togaviridae
family, Alphavirus genus), endemic in South America
and responsible for sporadic outbreaks of Mayaro
fever in rural communities of Brazil and Bolivia.
In this work, the flavonol quercetin along with its
3-O-glycosides guayjaverin, quercitrin, and a mixture
(2:1) of isoquercitrin and hyperin were isolated from the
methanol extract of the leaves of Brazilian shrub Bauhinia
longifolia. These flavonoids and the AcOEt and n-BuOH
fractions containing them were also investigated for their
in vitro antiviral activity against MAYV replication in
Vero cells. Quercetin was the most active among the pure
flavonoids, with selectivity index (SI) of 94 (IC50=10.3
μg/ml). AcOEt and n-BuOH fractions demonstrated the
highest activity among all the samples with SI of 623
(IC50=5.5) and 208 (IC50=2.8) respectively. At 25 µg/
mL quercetin, AcOEt and n-BuOH fractions were able
to inhibit MAYV in a dose-dependent manner by more
than 90 %, a strong inhibitory effect on viral replication
when compared to ribavirin (SI=8). Furthermore, MAYV
replication was inhibited about 84% by the flavonoid
isomeric mixture (isoquercitrin and hyperin) at 100 µg/
mL. Guayjaverin and quercitrin did not show significant
antiviral effect up to maximum tested concentration. Our
results showed B. longifoliaas as an interesting source
of quercetin derivatives with antiviral activity against an
alphavirus replication and that the presence of different
sugars decreased their antiviral activity. Although
quercetin and derivatives are fairly common in the plant
kingdom, this is the first report on the anti-Alphavirus
activity for these flavonoids. To date, there are no
licensed antiviral drugs for most mosquito transmitted
viruses. Therefore, the potential activity of quercetin,
AcOEt and n-BuOH against our alphavirus model is a
very important step in the search for new drugs against
these important pathogens. Financial Support: CNPq,
CAPES, FAPERJ, INBEB
HV267 - Use Of Saliva Samples For Hepatitis C
Epidemiological Studies In Brazil.
Medina, H.C., Miguel, J.C., Da Silva, E.F., Marques, B.L.C.,
Chagas, R.R., De Paula, V.S., Villela-Nogueira, C.A., Do
Ó, K.M.R., Coimbra-Motta, A.R.C., Flores P.P., Melo,
M.M.M., Milagres, F.A.P., Lewis-Ximenez, L.L., Lampe, E.,
Villar, L.M.
1. Viral Hepatitis Laboratory, Oswaldo Cruz Institute,
FIOCRUZ, LHV/IOC
2. Laboratory of Technological Development of Virology,
LDTV/IOC
3. Hepatology Division, Clementino Fraga Filho
University Hospi, HUCFF/UFRJ
4. Laboratory of Clinic Immunology, LCI/MS
5. Faculdade de Medicina da Universidade Federal
Fluminense, UFF
6. Federal University of Tocantis, UFT
7. Secretaria do Estado de Saúde de Pernambuco, SES/
PE
Large scale epidemiological studies for hepatitis C virus
(HCV) infection are difficult to conduct in Brazil, since
blood sampling and expensive sophisticated methods for
detection are less available in some parts of the country.
This study was conducted in order to evaluate antiHCV prevalence among individuals from three different
groups: i) individuals from high HCV endemicity
(Reference Laboratories for hepatitis diagnosis from
Southeast and Northeast regions); ii) individuals from
low HCV endemicity (general population from North,
Mid-West and Southeast regions) and iii) individuals
presenting some risk behavior (crack users or beauty
professionals). Saliva samples were obtained using
commercial device (Salivette, Sarstedt) from 825
individuals between years 2009 to 2012 and distributed
as follows: group 1 (n=200), group 2 (n= 305) and group
3 (n=320). Anti-HCV was assayed in saliva samples using
a commercial assay (Murex, Italy) where sample volume
114
Human Virology: HV
was increased compared to sera samples (serum sample
volume= 20�l and saliva sample volume=180�l) and
ROC curve was employed for cut off calculation. Mean
age (± standard deviation) was 38 (±16) years and 52%
were female. Anti-HCV prevalence varies according HCV
endemicity, where 26.5% from high HCV endemicity
group, 0.6% from low HCV endemicity group and
1.25% for individuals presenting some risk behavior.
These results show the potential of salivary samples for
anti-HCV detection among individuals from different
HCV endemicity what can facilitate the achievement
of epidemiological surveys. Financial Support: CAPES,
CNPq, FAPERJ.
HV271 - Hepatitis C Virus Infection In Crack
Users Institutionalized In Central Brazil:
Preliminary Results
Del-Rios, N.H., Araújo, L.A., Teles, S.A., Martins, R.M.B.,
França, D.D.S., Silva, L.N., Santos, N.C., Pinheiro, R.S.,
Louzeiro, L.L., Moreira, E.S., Ramos, J.S., Carneiro, M.A.S.
1. Instituto de Patologia Tropical e Saúde Pública,
UFG,Goiânia, IPTSP / UFG, Rua 235 - s/n - Setor
Universitário, Goiânia, Goiás
2. Faculdade de Enfermagem, UFG, Goiânia, FEN
/ UFG, Rua 227 Qd 68, S/N - Setor Leste Universitário Goiânia - Goiás
3. Pontifícia Universidade Católica de Goiás, Goiânia,
PUC - Goiás, Av, Universitária 1.440, Setor Universitário
Goiânia-Goiás
4. Hospital Espírita Eurípedes Barsanulfo, Goiânia,
Casa de Eurípedes, Via Ana Luzia de Jesus - Setor Rio
Formoso, Goiânia, Goiás
Hepatitis C virus (HCV) infection is a public health
problem associated with significant morbidity and
mortality. Crack use is prevalent among drug users in
Brazilian cities, and associated with severe drug use,
health and social problems. The common use and sharing
of hazardous makeshift paraphernalia are a key concern,
as these risks may be associated with oral injury and
including possible infectious disease transmission such
as the HCV. The aim of this study was to estimate the
prevalence of anti-HCV in crack users institutionalized
in Goiânia-GO city, and to identify risk behaviors to
this infection in this population. From august 2012
and january 2013, 307 crack users institutionalized
in the referral hospital for the treatment of chemical
dependency (Hospital Espirita Eurípedes Barsanulfo)
in Goiania, Goiás were interviewed about demographic
and risk characteristics for HCV infection. Blood Samples
were collected from all crack users and were tested by
enzyme-linked immunosorbent assay (ELISA) for the
presence of HCV antibodies (anti-HCV). The mean age was
29.8 years (SD: 8.5 years). The majority of participants
were: male (85%), with less than high school education
(61%) and sharing the paraphernalia of crack inhalation
(72.2%). The prevalence of anti-HCV was 3.6% (95% CI:
1.9-6.5). In the multivariate analysis, injecting drug use
(OR= 7.2; 95% CI: 1.4-35.8) and age over 40 years (OR=
24.9; 95% CI: 2.6-233.5) were independently associated
with HCV infection. The prevalence of HCV infection in
crack users is higher than general population. These
results reinforce the importance of Public Health
programs including health education, health promotion.
There is an urgent need for further research and for
targeted interventions for crack use in Brazil. Financial
support: FAPEG
HV272 - Profile Of Immunization Of Hepatitis
B Virus In The Male Prisoners Of Caruaru In
The State Of Pernambuco, Brazil.
Albuquerque, A.C.C., Nascimento-Júnior, J.A.A., Silva,
K.R.A., Coêlho, M.R.C.D., Silva, J.L.A., Morais, V.M.S.,
Cahú, G.G.M.
1. Faculdade Associação Caruaruense do Ensino
Superior, ASCES, Av. Portugal, n. 584 Bairro Universitário,
Caruaru-PE. Cep.: 55016-400
2. Laboratório de ImunopatologiaKeizo-Asami (LIKA),
Universidad, LIKA/UFPE, Av. Prof. Moraes Rêgo, S/N Cidade
universitária. Recife-PE
3. Programa de Pós-graduação em Medicina Tropical,
CCS/UFPE, Pós. Med. Trop./UFPE, Av. Prof. Moraes Rêgo,
S/N Cidade universitária. Recife-PE
Incarcerated population shows high vulnerability to
infectious diseases such as hepatitis B, due to the contact
with various risk factors, such as sex and drug use. The
aim of this study was to determine the prevalence in
inmates from the municipality Caruaru, Pernambuco,
Brazil that have been infected by Hepatitis B Virus
(HBV) or who was vaccinated. It was conducted a crosssectional descriptive in the period from May to July 2011,
which 1042 inmates were evaluated by the search of
anti-HBc and anti-HBs. It was found a 32.1% (334/1042)
of inmates with some kind of a serological marker for
HBV. From 1042 inmates, 87 (8.3%) had anti-HBc + antiHBs, 206 (19.8%) had only anti-HBs and 41 (4.0%) had
only anti-HBc. Mean age was 28.6 ± 10.1 years, with
ages between 18 and 94 years. A little less than a half
had between 6 months and 2 years of incarceration time
and 55.3% were married. Risk factors reported were:
tattoo (63.7%); intranasal cocaine (34.1%), sex with
another man (5.7%), condom use (60%), STDs (17.2%),
transfusion (5.3%). It was observed that prisioners
have already been in contact with HBV, but produced
neutralizing antibody, while others showed only
115
Human Virology: HV
antibody vaccination. However, there were prisoners
who could be ill, acute or chronic forms, due only to
the presence of anti-HBc. The prison population is a
high-risk group for the disease studied and therefore
screening tests, counseling and immunization programs
should be deployed in this environment.
HV273 - Identification Of Hepatitis B Virus
Genotypes
Among
Institutionalized
Patients From Goias State
Castro, I.A., Moraes, T.C., Cunha, M.P., Almeida, T.N.V.,
Souza, M.B.L.D., Fiaccadori, F.S., Cardoso, D.D.P.
Instituto de Patologia Tropical e Saúde Pública, IPTSP
- UFG, Rua 235 - s/n - Setor Universitário - CEP: 74605050 Goiânia - Goiás
According to WHO, approximately one third of the world
population (two billion people) show serologic evidence
of hepatitis B virus (HBV) infection, of these, 240 million
are chronic carriers of the virus. Institutionalized
and mentally handicapped individuals represent a
risk group for infection by HBV due to the special
behavior presented by them among other features.
Therefore, between July-2011 and August-2012 the
HBV infection prevalence was evaluated in a population
of institutionalized patients, with psychiatric and
neurological disorders, in the state of Goias. For this,
333 serum samples were screened for the presence of
serological markers, and the overall rate of HBV infection
was 12.9%. All the samples that were positive for any of
the markers were submitted to molecular analysis, and
HBV-DNA was detected in six out 57 samples (10.5%).
Patients with psychiatric and neurological pathologies
infected by HBV in an institutional environment are
considered chronic carriers of the virus and may become
a source of viral spread to HBV-seronegative individuals.
Thus, it is important to evaluate the genotypic profile
of this virus in order to provide information for the
development of prevention and control measures of
disease in this population. The six HBV-DNA positive
samples were subjected to amplification and sequencing
of the HBV genome regions S and preS2. After the quality
determination by Phred software the sequences obtained
were matched and compared with prototype strains
from the GeneBank and the phylogenetic analysis found
high similarity (98-99%) with genotype A. Genotype
A has been found by many authors in other Brazilian
populations, reflecting the circulation in the country and
Central-West region.
HV274 - Hiv And Hcv Seroprevalence In
Professional Sex Workers In The City Of
Caruaru-Pe.
Albuquerque, A.C.C., Melo, M.A., Souza, J.B., Leitão,
V.M.G.
Faculdade Associação Caruaruense do Ensino Superior,
ASCES, Av. Portugal, n. 584 Bairro Universitário, CaruaruPE. Cep.: 55016-400
The sex workers are more vulnerable to infectious
diseases due to risk factors such as promiscuity and
drug use. The aim of this study was to determine the HIV
and HCV seroprevalence in sex workers from Caruaru
city in Pernambuco. We conducted a cross-sectional
descriptive study, evaluating 66 sex workers, from 11
brothels from the period of November 2012 to March
2013. A questionnaire was applied to obtain information
related to the occupation and blood was collected in
order to detect HIV and HCV antibodies. Ages ranged
from 18 to 53 years old, with an average of 28.1 years
old. Infectious diseases seropositivity was observed in
3.0% (2/66) of the population and 1.5% (1/66) for HIV
and 1.5% (1/66) to HCV. It was observed that from 66
women studied, 21.2% started the profession with less
than 15 years old, 44.3% had more than four partners
per night, 71.2% had a tattoo on the body, 25.8% had
done transfusion of blood/blood products and 7.6%
used or injected drugs. The present study showed that
some women were infected with the etiologic agents
compromising public health and were not aware of
it. This reinforces the need for clinical and laboratory
monitoring, supporting, prevention and care programs
for these women.
HV276 - Performance Of Rapid Hepatitis C
Virus Antibody Assays Among High And
Low Risk Populations
Scalioni, L.P., Cruz, H.M., De Paula, V.S., Marques, B.L.C.,
Miguel, J.C., Silva, E.F., Oliveira, J.C., Marques, V.A.,
Portilho, M.M., Vilella-Nogueira, C.A., Motta-Castro,
A.R.C., Milagres, F.A.P., Lewis-Ximenez, L.L., Lampe, E.,
Villar, L.M.
1. Instituto Oswaldo Cruz, IOC, Av Leopoldo Bulhões,
1480 - HPP, sala B09
2. Universidade Federal de Tocantins, UFT
3. Hospital Universitario Clementino Fraga Filho/UFRJ
Rapid tests for detection of anti-HCV antibodies can
facilitate the access of diagnosis in limited resource
scenarios. The aim of this study is to evaluate the
performance of rapid tests for anti-HCV detection in sera
(S), whole blood (WB) and oral fluid (OF) samples from
populations with different endemicity profiles and risk
behavior for HCV. Biological samples were obtained from
3 groups: (I) 194 individuals referred to Viral Hepatitis
Centers at Rio de Janeiro who donate paired samples
116
Human Virology: HV
(S, WB and OF) evaluated by rapid tests WAMA ImunoRápido HCV (WAMA Diagnóstica)(T1) and Bioeasy HCV
Rapid Test (Bioeasy Diagnóstica Ltda)(T2) and, 174 oral
fluid samples tested in Oraquick HCV (Orasure)(T3); (II)
individuals residing in remote areas, where 430 paired
samples were tested by T1 and T2 and 459 oral fluid
samples by T3; (III) 200 paired samples from crack users
and beauty professionals tested at T1 and T2 and 43 oral
fluid samples tested in T3. Anti-HCV was evaluated in
sera samples by EIA and those reactive samples were
submitted to PCR. The reproducibility, repetitivity
and cross reactivity for other infections (dengue, HIV,
malaria and syphilis) were also evaluated. Sensitivity
and specificity of rapid tests varied respectively: group
I 99.09% and 100% at T2 test using sera or whole
blood; 98.18% and 93.75% at T1 test for sera; 95.35%
and 100% in T3 test for oral fluid; 90.91% and 93.75%
at T1 test for oral fluid and 86.36% and 100% at T2
test in oral fluid. At group II, T3 rapid test in oral fluid
presented the best performance with only 4 anti-HCV
false negative (FN) results compared to EIA, however all
of these samples did not have HCV RNA at sera. At group
III, T2 rapid test in whole blood and sera presented the
best performance without false positive (FP) or FN.
Reproducibility and repetitivity studies presented 100%
of concordance. At cross reactivity evaluation, 5 FN
results were found, being at T1 assay: 1 reactive sample
for dengue and another reactive sample for HIV, and at
T2 assay: 1 reactive sample to dengue, 1 reactive for HIV
and 1 reactive for Plasmodium vivax. We also observed
3 FP results at Wama assay among reactive samples for
P.vivax. In conclusion, rapid tests for anti-HCV detection
present appropriate sensitivity for detection of active
infection in populations with different HCV endemicity,
however the performance of those tests varies according
the manufacturer of the assay and the type of biological
samples employed.
HV280 - Evaluation Of The Ridascreen
Enzyme Immunoassays And The Ridaquick
Immunochromatographic Test For The
Detection Of Norovirus In Faecal Samples
Paula, F.L., Sardi, S.I., Pinho, A.C.O., Peixoto, I.B., Brandão,
C.J.F., Bandeira, A., Welby-Borges, M., Campos, G.S.
1. Universidade Federal da Bahia, UFBA, Av. Reitor
Miguel Calmon s/n - Salvador - BA. CEP 40.110-100
2. Universidade Federal do Recôncavo da Bahia, UFRB,
Av.Carlos Amaral, 1015 - Santo Antônio de Jesus - BA. CEP:
44.570-000
3. Hospital Aliança, HA, Av Juracy Magalhães Jr, 2096
- Salvador - BA. CEP 41920-900
Viral gastroenteritis is one of the most common illnesses
in humans worldwide, and different agents such as
rotavirus, astrovirus, adenovirus and calicivirus, which
include the Norovirus (NoV), have been associated
with the disease. Because of the rapid transmission, the
rapid detection of noroviruses is essential to implement
measures to reduce the rapid spread of gastroenteritis
infections caused by this virus. Diagnostic procedures
for NoV are based on the detection of virus in stool
samples by electron microscopy, enzyme immunoassay,
immunochromatography kits or reverse transcription
polymerase chain reaction (RT-PCR). Although RT-PCR
is used around the world as a standart tool for routine
diagnosis of NoV infection, this test is an expensive
and time consuming. Thus, a rapid and sensitive
diagnostic test for NoV detection is required. This study
aimed to evaluate the sensitivity and specificity of the
RIDASCREEN® Norovirus 3rd Generation ELISA assay
and rapid immunochromatographic RIDA®QUICK
Norovirus 3rd Generation (R-Biopharm, Germany)
kits in comparison with the RT-PCR as the reference
method, using the specific primers CAL-32 and MO3-N
(first pair) and primers JV-12 and ACAL-36 (second
pair). One hundred and eighty-one faecal samples
were collected from patients with acute gastroenteritis
at the Aliança Hospital in Salvador, Bahia, during
May-July 2012. All samples were testes with the two
antigen detection assays as well as with the RT-PCR
method. Compared with the RT-PCR based reference
the overall diagnostic sensitivies of the ELISA and the
immunochromatographic assay were 63.63% and
34.41% and the diagnostic specificities were 77.77%
and 96.29% respectively. These results suggest that the
both assays allow the rapid and economic screening of a
large number of samples and thus are useful diagnostic
tools for detection of norovirus infections; however
due to their sensitivities, RT-PCR is still required for
confirmed the results. Financial support: Fundação de
Amparo à Pesquisa do Estado da Bahia – FAPESB
HV281 - Asian Genotypes Of Dengue Virus 4 In
Brazil
Pinho, A.C.O., Sardi, S.I., Paula, F.L., Peixoto, I.B.,
Brandão, C.J.F., Bandeira, A., Fernandes, F.M.C., WelbyBorges, M., Campos, G.S.
1. Universidade Federal da Bahia, UFBA, Av. Reitor
Miguel Calmon s/n - Salvador - BA. CEP 40.110-100
2. Universidade Federal do Recôncavo da Bahia, UFRB,
Av.Carlos Amaral, 1015 - Santo Antônio de Jesus - BA. CEP:
44.570-000
3. Hospital Aliança, HA, Av Juracy Magalhães Jr, 2096
- Salvador - BA. CEP 41920-900
Dengue, an important viral disease transmitted to
humans by mosquitoes of the Aedes genus, represents
a serious public health problem in Brazil and other
117
Human Virology: HV
tropical countries. Infection with dengue virus (DENV)
causes a disease whose spectrum ranges from clinically
asymptomatic to severe clinical forms (hemorrhagic
dengue). DENV, member of the family Flaviviridae,
genus Flavivirus, is a positive single-stranded RNA, an
enveloped virus with four antigenic serotypes: DENV 1,
DENV 2, DENV 3 and DENV 4. The objective of this study
was to report DENV-4 genotype I isolates, which were
detected in Brazil in hospitalized patients. The patients,
who received care at a hospital in the city of Salvador
(Bahia, Brazil) in 2011, were positive for IgM/IgG antiDENV or the NS1 antigen. The viral RNA was extracted
from serum samples with QIAamp Viral RNA Mini kits
(QIAGEN, USA) for detection and serotyping of DENV
by RT-PCR (Reverse Transcriptase - Polymerase Chain
Reaction) and nested-PCR, respectively. The E gene from
the three DENV-4 samples was amplified using 2 pairs of
serotype-specific primers used in the RT-PCR reaction.
The molecular and phylogenetic analysis of the DENV-4
isolates demonstrated that the virus is genotype I and
is derived from Asian lines. The results of this work
reinforce the need of epidemiological molecular studies
to surveillance DENV infections in endemic countries,
such as Brazil. The introduction of DENV-4 in Salvador
is a cause for concern because epidemics of serotypes
1, 2 and 3 have occurred in Bahia in the past and the
introduction of a new serotype in a city with a population
that has been exposed to the other 3 DENV serotypes
may increase the incidence of clinically severe DHF with
grave or fatal prognoses. Financial support: PRONEXDENGUE CNPq and Fundação de Amparo à Pesquisa do
Estado da Bahia (FAPESB)
HV285 - Impact Of The W501r Substitution In
A Hcv Genotype 3a On Ns3 Helicase Function
Provazzi, P.J.S., Mukherjee, S., Hanson, A.M., Carneiro,
B.M., Calmon, M.F., Frick, D.N, Rahal, P.
UNESP-IBILCE, Rua Cristóvão Colombo, 2265. São José do
Rio Preto/SP. Brasil
2. University of Wisconsin- Milwaukee, UWM, 3210 N.
Cramer Street. Milwaukee, WI 53211. USA
The hepatitis C virus (HCV) chronically infects 170
million people worldwide. The recent approval of the
HCV specific directly acting anti-virals that are given in
a triple combination with PegIFN/RBV has increased
cure rates in genotype 1 patients to around 75%.
However, the genotype 3 presents resistant mutation to
protease inhibitors approved evidencing the need for
better understanding of the genotype 3. The amino acid
substitution W501R in the NS3 Helicase was reported
in a patient infected with HCV genotype 3a who did
not respond to interferon/ribavirin therapy. Since
other studies have shown that the substitution W501R
in a genotype 1a led to a normal ATPase, poor nucleic
acid binding and poor duplex unwinding, we analyzed
the impact of the W501R substitution in a genotype 3a
on helicase function in vitro. The helicase NS3 variant
sequence was cloned, expressed in E. coli, and purified
from soluble fraction. The methodologies of MBHA, FPSSB-DNA binding and ATP assay were used to evaluate
the helicase activity in RNA and DNA unwinding, DNAhelicase binding and ATPase, respectively. To evaluate
the replication of mutated variant in hepatoma cell line
Huh-7.5, the mutation W501R was inserted into the
subgenomic replicon pSGR-Luc-JFH1 and the luciferase
level was measured. The MBHA procedure showed that
the activity of DNA and RNA unwinding was faster in
NS3 helicase wild type than in the NS3 helicase mutant
protein. By the FP-DNA binding analysis was observed
a weaker DNA–NS3 helicase mutant binding than the
DNA – NS3 helicase wild type binding. The evaluation
of ATP hydrolysis activity revealed a decrease in the
velocity of NS3 helicase W501R mutant ATPase activity
when compared to the NS3 helicase wild. The replicon
cells analysis showed a total loss of replication ability
of the replicon carrying the mutation W501R when
compared to wild type replicon. These results suggest
that the patient has the HCV wild type sequences that
are maintaining the virus replication. Financial support:
FAPESP, CAPES, CNPq, NIH grant RO1 AI088001 and the
UWM Research Foundation.
HV287 - Impact Of The Emergence And ReEmergence Of Different Dengue Virus
Serotypes In The State Of Rio De Janeiro
Heringer, M., Nogueira, R.M.N., De Filippis, A.M.B.,
Lima, M.R.Q., Simões, J.B., Nunes, P.C.G., De Santis, B.G.,
Sampaio, S.A., Dos Santos, F.B.
Instituto Oswaldo Cruz/FIOCRUZ, IOC/FIOCRUZ,
Av. Brasil, 4365, Manguinhos, Rio de Janeiro - RJ. CEP 21040360
The state of Rio de Janeiro has been of great
epidemiological importance for introduction and spread
of dengue viruses (DENV) and over the last 27 years
was marked by extensive epidemics. The existence of a
continuous program of virological surveillance aims to
detect and monitor the circulation of DENV serotypes in
the state, where DENV-1, DENV-2, DENV-3 and DENV-4
co-circulate. Given the limited options for prevention and
control, it has been shown that laboratory diagnosis plays
an important role in the Epidemiological Surveillance
System, by continuous monitoring infections and
confirming new cases. The main objective of this study is
to describe the epidemiological, laboratory and clinical
dengue cases occurred in the State of Rio de in the
118
Human Virology: HV
period January 2010 to December 2012. A total of 2,833
dengue suspected cases were analyzed, and 1,323 cases
(47.5%) were confirmed. The MAC-ELISA confirmed
32.6% of the cases, the RT-PCR confirmed 56.3%, the
inoculated into C6/36 cells confirmed 33.1% of the cases
and NS1 antigen capture confirmed 27.5% of the cases
tested. DENV-2 was the prevalent serotype in 2010,
while during 2011 the prevalent serotype was DENV1. In 2011 the introduction of DENV-4 was detected, an
outbreak caused by this serotype was reported in 2012.
Our analysis has shown that patients with secondary
infection have a higher risk of presenting severe
forms of the disease (OR = 7,87 / 95%IC = 2,15-30,56
/ p <0,001). Moreover, paired analyzes, has shown the
severe forms were more frequent on children 15 years
old and under, among infected with DENV-2 2 (OR = 1,8 /
95%CI = 0,10-1,22 / p <0,05). From the total of the fatal
cases confirmed (n = 67), 60% were due to secondary
infections. Fatal cases were more frequent in children
15 years old and under in 2011 in comparison to other
years. The DENV-2 serotype was responsible for 42.8%
of deaths in 2010, DENV-1 was identified in 71.47% of
deaths in 2011 and in 2012, DENV-4 was responsible for
25% of deaths. Financial support: FAPERJ, CNPq, CAPES
and FIOCRUZ
HV288 - Detection Of Human Parechovirus
In Tonsils From Patients With Chronic
Adenotonsillar Hypertrophy
De Souza Luna, L.K., Doltrário, A.B., Proença-Modena,
J.L., Valera, F.C.P., Tamashiro, E., Anselmo-Lima, W.T.,
Arruda, E.
1. Centro de Pesquisa em Virologia - FMRP - USP, CPV
- FMRP - USP, Av. Bandeirantes, 3900 - Vila Monte Alegre.
14049-900, Ribeirão Preto - SP
2. Oftalmologia, Otorrinolaringologia, Cir. da Cabeça e
Pescoç, HCFMRP - USP, Av. Bandeirantes, 3900 - Vila Monte
Alegre. 14049- 900, Ribeirão Preto - SP
Respiratory viruses are frequently detected in
palatine tonsils and adenoids of patients with Chronic
Adenotonsillar Hypertrophy (CAH), a persistent
hypertrophy of tonsils and adenoids of unknown
etiology. In this study, human parechovirus (HPeV), an
emerging picornavirus related with a broad spectrum
of diseases similar to those caused by enteroviruses,
was detected by real-time RT-PCR targeted to the
conserved 5’UTR in nasal swabs (NS), nasopharyngeal
washes (NW) and tissue fragments of palatine tonsils
(PT) and adenoids (AD) obtained from patients (ages:
1-25 years; mean±SD: 6.24±3.26; median: 5.05) with
CAH who underwent tonsillectomy at the University of
Sao Paulo Hospital in Ribeirao Preto, Brazil. Samples
were collected from November 2011 to July 2012 and
were previously tested by real-time PCR for a panel of
common respiratory viruses. A total of 707 samples
from 194 individuals were tested, of which 655 (151 NS,
135 NW, 159 PT and 147 AD) were from 180 patients
with CAH, and 52 samples (14 NS and NW; 12 PT and
AD) were from a control group of 14 individuals without
CAH. HPeV was detected in 12 of 180 (6.66%) CAH
patients (1 NS, 2 NW, 4 PT and 8 AD) and 1 of 14 control
patients (a 2 year old female positive in both PT and
AD). HPeV was detected predominantly in tissues (80%)
when compared with respiratory secretions (20%),
suggesting that lymphoid tissues could be possible sites
of replication. To the best of our knowledge this is the
first report of HPeV infection in tonsils, and further
studies based on sequencing and phylogenetic analysis
shall be done to determine genotypes of these HPeV
strains. Financial support: FAPESP, CNPq.
HV289 - Male Anogenital Hpv: Leaving The
Role Of A Simple Vector?
Dobao, E., Afonso, L., Menezes, W., Nicol, A., Nery, J.,
Cavalcanti, S.
1. Universidade Fed Fluminense, UFF, Rua Ernani
Melo 101 Centro Niteroi
2. Santa Casa de misericordia do RJ, SCMRJ, Santa
Luzia 36 centro RJ
3. Instituto Oswaldo Cruz, IOC, Av Brasil, Manguinhos
Rio de Janeiro RJ
HPV infection and associated diseases in the male
population has assumed increasing importance,
especially because of the upward trends of anal carcinoma
in specific groups, such as men who have sex with men
(MSM), HIV seropositive and immunocompromised.
However, the recognition that man is no longer a mere
infection vector for this disease and has assumed a main
role is still poorly discussed. We believe that, as there is
no single medical specialty to treat HPV infection in men,
such as gynecology for women, there is a fragmentation of
knowledge and experience that needs to be widespread.
It is important a rising release of this condition among
physicians and patients, to bring out at the baseline this
diagnostic hypothesis, even when the clinical lesion is
not a typical anogenital wart, avoiding diagnostic losses
and further decrease of morbidity. In this study, we aimed
to present atypical lesions of anogenital HPV infection
in male patients to bring out this hypothesis in the
differential diagnosis of anogenital lesions. To achieve
results, we report 4 cases of atypical lesions in patients
infected with anogenital HPV, providing histopathology
and specific viral typing by PCR. It is important to notice
that patients have been misdiagnosed and mistreated
for herpes and candidiasis and to of them died. All of
them progressed to squamous cell carcinoma during
119
Human Virology: HV
these treatments. The knowledge about the behavior
of anogenital HPV infection in men has been full of
gaps, even among doctors and high-risk groups such as
MSM and HIV seropositive. Therefore, several patients
have been maintained without diagnosis, as sources
of infection or even suffering from high-grade lesions
with clinical unsatisfactory outcomes. Our goal with
these case reports is to contribute to the dissemination
of an emerging problem, stimulating discussion and
its recognition as a differential diagnosis in anogenital
lesions. Financial Support: PROAP/UFF, Capes
HV291 - CALICIVIRUS IN DAY CARE CHILDREN
IN THE CENTRAL WEST REGION OF BRAZIL:
ASYMPTOMATIC
VIRAL
EXCRETION
AND
SIGNIFICANT NOROVIRUS GENOMIC DIVERSITY
Santos, H.C.P., Mendanha, D.M., Fiaccadori, F.S., Lemes,
L.G.N., Turones, L.C., Cardoso, D.D.P., Souza, M.
IPTSP, Universidade Federal de Goiás, IPTSP/UFG,
Rua 235 s/n, Setor Universitário, 74605-050, Goiânia, Goiás,
Brasil
Caliciviruses (norovirus and sapovirus) are classified in
the Caliciviridae family. These agents are transmitted by
the fecal-oral route, through contaminated food, water
or fomites, by vomit aerosols and also through personto-person contact. The caliciviruses (CV) are a common
cause of acute gastroenteritis, and the noroviruses
(NoV) are considered the leading cause of epidemic
acute viral gastroenteritis worldwide. Outbreaks
commonly take place in semi-close settings such as
long-term care facilities, schools, hospitals, nursing
homes, and cruise ships. Molecular and epidemiological
data of the circulating CV strains among day care
children are still considered scarce, and the role of
asymptomatic CV excretion on viral transmission is still
undefined. Considering the high prevalence of CVs in
various populations in the world, and also the limited
number of studies involving children that attend day
care centers, the main objective of this study was to
monitor the occurrence of NoV and sapovirus (SaV) in
a day care center in Central West Brazil, and to describe
the molecular epidemiology of the circulating strains.
For this, fecal samples obtained from children in a
day care center, from October 2009 to October 2011,
were submitted to RNA extraction, followed by reverse
transcription, using a random primer. The samples
were tested by multiplexPCR, and the results confirmed
by monoplexPCR, for NoV and SaV detection. Genomic
sequencing and phylogenetic analysis of a partial
segment of the capsid region (region C) were carried
out on calicivirus positive samples. From the total 539
fecal samples 43 (8%) were positive for NoV and 25
(4.6%) for SaV. Positivity rates for CV were significant in
asymptomatic children (P<0.05), and virus circulation
was detected in all months of the study. Great genomic
diversity of CV was observed. The GII.6 NoV and the GII.4
NoV were the most and the least prevalent viral strains,
respectively. The SaV genotypes GI.1 and GI.3 were also
detected. Moreover, five CV outbreaks caused by distinct
viral strains were documented. The results from this
study contribute to the knowledge about NoV and SaV
molecular epidemiology, and also confirm the role of
these viruses in indoor outbreaks. Financial support:
CNPq & PRPPG/UFG
HV292 - Comparison Of The Performance Of
Hbsag Detection Among Dried Blood Spot
Samples (Dbs) From Hepatitis B Virus (Hbv)
Monoinfected And Coinfected With Hiv
Patients.
Flores, G.L., Miguel, J.C., Da Silva, E.F., De Oliveira, J.C.,
Potsch, D.F.V., Lewis-Ximenez, L.L., Lampe, E., Villar,
L.M.
Fundação Oswaldo Cruz, Fiocruz
The human immunodeficiency virus (HIV) and hepatitis
B virus (HBV) share the same routes of transmission
(parenteral and sexual route). Worldwide, chronic HBV
infection affects about 10% of HIV-infected patients. The
use of alternative biological samples, such as dried blood
spot (DBS) samples, may provide the access for the
diagnosis of HBV infection, especially in high risk groups,
which may be co-infected with HIV. This study aims to
investigate the performance of an enzyme immunoassay
(EIA) adapted for the detection of HBsAg marker in DBS
samples from patients with HBV mono-infection and coinfection with HIV. A total of 89 subjects were recruited
from Viral Hepatitis Ambulatory (IOC/FIOCRUZ) and
Clementino Fraga Filho Hospital (UFRJ), both located in
Rio de Janeiro. DBS and serum samples were obtained
from each individual and submitted to commercial
EIA (ETIMAK-4, Diasorin) for HBsAg detection. The
manufacturer’s protocol was followed for serum samples,
however the sample volume has been increased for
DBS (150 �L) and cut off value previously determined
by ROC curve was employed where reactive samples
presented optical density (OD) value higher than 0.115.
As results, HBsAg was detected in 89 serum samples
where 81 were mono-infected and 8 were co-infected
with HIV. The overall concordance of HBsAg detection
among sera and DBS samples was 87%. In the group
of mono-infected HBV individuals, the concordance for
HBsAg detection among sera and DBS was 88%, on the
other hand, among HBV/HIV co-infected individuals, the
concordance between tests was 75%. HBsAg detection
among DBS samples presented high concordance to sera
results among mono-infected and co-infected HIV/HBV
120
Human Virology: HV
patients, but this agreement was low among co-infected
HBV/HIV individuals. Nevertheless, a larger number
of HBV/HIV co-infected individuals and the analysis of
some clinical factors (HIV viral load and CD4 cell count)
should be include in this study in order to evaluate this
interference.
HV296 - Development And Evaluation Of
Molecular Tests For Hbv Dna Detection
And Quantification Among Sera Samples.
Portilho, M.M., Espírito-Santo, M.P., Marques, V.A.,
Miguel, J.C., Lewis-Ximenez, L.L., Lampe, E., Villar, L.M.
Fundação Oswaldo Cruz, Fiocruz
The molecular diagnosis of Hepatitis B virus (HBV) DNA
is important to determine and monitor the antiviral
treatment. However, commercial methods are expensive
to be implemented in areas with low resources. The
aim of this study was to develop a method for HBV DNA
quantification and to evaluate an “in house” qualitative
method for HBV DNA detection among sera samples.
Serum samples were obtained from 116 individuals (66
HBsAg reactive and 50 without HBV serological markers)
referred to Viral Hepatitis Reference Laboratory in Rio
de Janeiro. HBsAg reactive samples were submitted to
commercial real time PCR (COBAS® TaqMan HBV Test,
Roche Diagnostics). For HBV qualitative and quantitative
detection, DNA was extracted using “High Pure Viral
Nucleic Acid Kit” (Roche Diagnostics) and submitted
to one round PCR for core gene of HBV and a real time
PCR with TaqMan® probes for surface gene of HBV.
A recombinant plasmid was constructed using the
quantification panel of HBV (Optiquant HBV, Acrometrix,
Life Technologis) for standard curve. The analytical
sensitivity of in house real-time PCR was estimated at 10
HBV DNA copies/mL, ranging from 10 to 1x108 HBV DNA
copies/mL. Among HBsAg reactive samples, 64 were
quantified by commercial PCR (mean viral load=3.993 ±
1.922 log copies of HBV DNA/mL) and 28 were obtained
by quantitative PCR (mean viral load=3.761 ± 1.829 log
copies of HBV DNA/mL). Among individuals without
HBV markers, 2 samples were detected by in house real
time PCR (mean viral load=15.390 ± 2190 copies HBV
DNA/mL) and none of them was detected by in house
qualitative PCR. Qualitative “in house” PCR detected HBV
DNA in 50 HBsAg reactive serum samples, showing 75%
of agreement with commercial kit (p=1.000). In house
qualitative PCR for HBV DNA detection presented good
efficiency, while quantitative PCR must be optimized for
HBV DNA quantification in sera. These methodologies
can be useful for molecular detection of HBV in areas
with limited resources. Financial support: CNPQ, FAPERJ,
FIOCRUZ.
HV298 - The Role Of Human Parvovirus
B19
Co-Infection
With
Hepatitis
A
Virus In Cynomolgus Monkeys (Macaca
Fascicularis) Experimentally Infected
Pinto, M.A., Amado, L.A.L., Marchevsky, R.S., Garcia,
R.C.N.C., Almeida, A.J., Pelajo-Machado, M., Azevedo,
M.L.B., De Castro, T.X., Ramos, S., Hooper, K., Brown, K.
1. Universidade Estadual da Zona Oeste, UEZO,
Avenida Manuel Caldeira de Alvarenga
2. Instituto Oswaldo Cruz, Fiocruz, Avenida Brasil
4365
3. Biomanguinhos, Biomanguinhos, Avenida Brasil
4365
4. Universidade Federal Fluminense, UFF
5. Hospital Universitario Gaffree e Guinle, HUGG
6. Health Protection Agency
It has been suggested that B19V infection in association
with hepatitis A virus may contribute to fulminant
hepatic failure. However, there is no experimental study
available on the laboratory finds with B19 co-infection
with hepatitis A virus (HAV). Therefore, in order to
evaluate if the acute liver failure could be induced by
synergistic interaction between hepatitis A virus and
human parvovirus B19, nine cynomolgus monkeys
were inoculated with serum obtained from a fatal case
of fulminant B19 infection and fecal suspension of
acute case of hepatitis A. Six animals were followed by
hematological, biochemical and virological parameters
for fifty nine days. The principal diagnostic parameters
for monitoring acute hepatitis A in cynomolgus included,
titers of total antibodies and IgM to HAV, liver enzymes
(ALT and AST) elevation, viremia, HAV RNA shedding
and necroinflammatory liver lesions. Concerning
B19 infection, a reduced numbers of reticulocytes,
erythrocytes, lymphocytes, platelets, drop hematocrit
and hemoglobin levels were associated with high
detectable viral load of human parvovirus B19 replication
in the inoculated groups during the first 20-40 dpi. After
that period the viral load and anti-HAV IgM titers became
undetectable. The absence of megakaryocytes and lower
bone marrow cellularity were associated with high viral
load of B19V. IgG antibodies to human parvovirus B19
were detectable throughout the investigated period.
Signs of self cure of parvovirus B19 occurred in 2 of single
inoculated B19 and 1 of co-inoculated group during the
follow up. The results showed that inflammatory liver
injury induced by HAV in monkeys was not associated
with a worsening in the animals infected with B19V. It
is the first report that demonstrated the susceptibility
of cynomolgus monkey to human B19V, which qualifies
this animal as an useful model to a vaccine challenge,
121
Human Virology: HV
new antiviral trials, and pathogenesis studies, in order
to better understand the effects of B19V infection.
HV303 - Molecular Detection Of Adenovirus
In Stool From A Semi-Isolated AfricanDescendant Community In Ananindeua
City, Pará State, Brazil
Spada, P.K.P., Aragão, G.C., Teixeira, D.M., Kaiano, J.H.L.,
Lima, I.C.G., Oliveira, D.S. , Siqueira, J.A.M., Mascarenhas,
J.D.P., Gabbay, Y.B.
Instituto Evandro Chagas, IEC, Br 316, Km 7, S/N,
Bairro Levilândia. Ananindeua-Pará
Human adenoviruses (HAdV) belong to the family
Adenoviridae, genera Mastadenovirus which are
constituted by over 90 serotypes. Of these, 52 showed
the ability to infect humans and are classified into seven
species A-G. Serotypes 40 and 41 (HAdV-F) and 52
(HAdV-G) were related with gastroenteritis cases. The
poor sanitary conditions and health status of the majority
of the population are factors that increase its spread. The
African-descendant communities named Quilombola are
included in this group, which are characterized by living
partially isolated from the rest of society. The aim of
this study was the detection of HAdV in stool specimens
collected in the Abacatal Quilombola Community, located
in the frontier of Ananindeua and Marituba cities, in the
metropolitan region of Belém, Pará, Northern Brazil.
From April 2008 to July 2010, weekly visits were made
in this community to detect diarrheic episodes. The fecal
samples were submitted to DNA extraction by silica
method. The nested polymerase chain reaction (NestedPCR) was employed with primers that amplify a specific
hexon gene of 301 bp (Hex1deg/Hex2deg) in the first
reaction and an internal fragment of 171 bp (Hex3deg/
Hex4deg) in the second reaction. Samples were
sequenced, analyzed and compared to other obtained
from GenBank. The HAdV were detected in 61.5%
(48/78) of the diarrheic cases. Genomic sequencing
was realized in 18 (37.5%) positive samples, being 9
(50%) characterized as type F (serotype 41), 4 (22.2%)
as HAdV-C, 3 (16.6%) as HAdV-D, 1 (5.5 %) as HAdV-A
and 1 (5.5%) as HAdV-B. The prevalence observed in
this study (61.5%) was higher than one (2.6%- 10/380)
obtained among diarrheic children attended in hospitals
or health units from Belém. Species directly associated
with gastroenteritis cases (A and F) were dominant in
these samples (55.5%). Complementary studies will
be conducted in order to demonstrate co-infection
with other enteric viruses. These data are relevant,
considering the lack of epidemiological information
concerning the presence of these agents in Quilombola
communities either in the Northern Region as in other
regions of Brazil.
HV304 - Emerging Viruses In Recreational
Waters, Rio De Janeiro, Brazil
Vieira, C.B., Ferreira, M.S.R., Fioretti, J.M., Miagostovich,
M.P.
Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil 4365
Viruses excreted in feces of infected people are important
contaminants of surface water due to the continuous
discharge of domestic sewage. Although many infectious
causes of diarrhea have been established, approximately
40% of all diarrhea cases are of unknown etiology.
Recent studies have described a new and emergent virus
associated with diarrhea in water contaminated with
sewage as klassevirus (KV), aichivirus (AiV) members
of a Picornaviridae family and human bocavirus (HBoV)
belonging to Parvoviridae family. The aim of this study
was to demonstrate the circulation of these viruses in the
city of Rio de Janeiro using an environmental approach.
For this retrospective study, 24 surface water concentrate
samples obtained from an urban lagoon and concentrated
using an adsorption-elution method with a negatively
charged membrane were analyzed. All samples were
previously positive for human adenovirus. Nucleic acid
was extracted by QIAamp viral RNA mini kit® (Qiagen)
and qualitative tests of genomic amplification were used
to virus detection. One step reverse transcription-nested
polymerase chain reaction (RT-nPCR), using primers
that amplifies a region localized at RNA polymerase gene
of KV genome was performed. The AiV were detected by
RT-PCR using primers P3 to the junction region of the
genome 3C/3D. PCR for HBoV detection was carried out
using specific primers for the coding region of the gene
VP1/VP2. KV was detected in eight samples (33.3%)
and the nucleotide sequence analysis of the PCR product
characterized all of them as human KV 1. AiV were
detected in three (12.5%) and HBoV in just one sample
(4.1%). These results demonstrate the circulation of
these viruses in the environmental water surfaces and
pointed out the importance of conducting further studies
including clinical samples in order to elucidate the role
of this virus in cases of acute gastroenteritis in the city
and its impact in public health.
HV311 - Polymorphism Of Rotavirus
Genotype P[8] In Brazil: In Silico Analysis
Of Variant Strains Circulating In Rio De
Janeiro From 1996 To 2004
Maranhão, A.G., Silva, R.C., Norma Santos, N.
Carlos Chagas Filho - 373, I Fundão, R Janeiro - RJ, 21.941902
Rotaviruses (RVs) are members of the Reoviridae
family, and classified into eight species (A-H). RV
122
Human Virology: HV
species A (RVA) are the main etiologic agents of acute
gastroenteritis and responsible for nearly 400,000
deaths worldwide. The viral genome is enclosed within
a three-layered particle and consists of 11 segments
dsRNA. The outer capsid proteins VP7 and VP4 carry
independent neutralization and protective antigens.
A binary system is used to classify RVA into P and G
genotypes based on the specificity of the VP4 and VP7encoding genes, respectively. Thus far, 37 P genotypes
and, 27 G genotypes have been identified. Among the VP4
genotypes, P[8] accounts for 73.8% of global prevalence
of human RVA infections and hence its importance as
an effective vaccine candidate. VP4 is a trimeric protein
involved in cell attachment and membrane penetration.
High-level infectivity requires that VP4 be cleaved by
trypsin into two fragments, designated VP8* and VP5*.
Five important epitopes have been mapped on the VP8*
peptide: M1L10 (aa 1-10), I35R44 (aa 35-44), I55D66
(aa 55-66), V115G123 (aa 115-123) and L223P234 (aa
223-234). A major challenge in immunization is the
vast inter- and intragenotypic diversity accomplished
by RVA. Two currently available RVA vaccines includes
P[8] as an antigenic component. Therefore, it is possible
that genetic mutations and antigenic variations on the
VP4 gene of P[8] strains will influence the efficacy of the
RVA vaccines. The polymorphism of RVA-P[8] strains
circulating in Rio de Janeiro between 1996 and 2004
was evaluated. The partial VP4 encoding gene of 20
P[8] strains was sequenced and compared to reference
strains. The deduced amino acid sequences were used as
basis for in silico analysis of the VP4 protein. We observed
the circulation of three major P[8] lineages during the
studied period. Comparison between the VP8* trimeric
structures of a RVA reference strain (Wa) and Brazilian
P[8] strains showed mutations at amino acid residues
located at the epitopes I55D66 (aa 64) and V115G123
(aa 120-121). Although the RVA vaccine program has
clearly been successful in Brazil, these results suggest
the possibility of the emergence of P[8] strains that could
evade the immune response elicited by a RVA vaccine and
cause a vaccine breakthrough. Consequently, continuous
monitoring of RVA intragenotypes diversity is critical
to understand how it could affect vaccine effectiveness.
Financial support: CAPES, CNPq, FAPERJ
HV314 - Hepatitis E In São Paulo, Brazil:
Results From A Clinical Laboratory
Database 1997-2012
Passos, A.M., Pelegrini, A., De Sá, J., Granato, C.F.H.
1. Disciplina de Infectologia, Escola Paulista de
Medicina, EPM-UNIFESP, São Paulo, SP, Brazil
2. Grupo Fleury SA, , São Paulo, SP, Brazil
Hepatitis E (HEV) virus epidemiology in Latin America
is complex. Although serological studies performed
between 1997 and 2006 in Brazil show HEV prevalence
ranging from 0–8% in the general population and 0–18%
among at-risk groups, variations in the methodology and
assays performance makes it difficult to estimate the
real seroprevalence of HEV infection. This study aimed
to establish the frequency of HEV detection among
samples referred to a clinical laboratory with suspected
hepatitis E. A retrospective study was performed on
laboratory records regarding HEV between 1997 and
2012. Data collected comprised ELISA test for antiHEV IgG and IgM antibodies results, age, sex, year, and
hepatic enzymes levels: alanine aminotransferase
(ALT), aspartate aminotransferase (AST), total bilirubin,
gamma-glutamyl transferase and alkaline phospatase.
Between 1997 and 2012, 2,573 anti-HEV IgG and 404
anti-HEV IgM tests were performed. Individuals ranged
between 0–91 years and 52% were females. Overall
anti-HEV IgG positivity was 1.6% and anti-HEV IgM was
4.0%. Detection frequencies varied with year, ranging
from 0–8.6% for IgG and 0–8.8% for IgM. Interestingly,
the years of 2011 and 2012 displayed the highest IgG
frequencies, 5.9% (2/34) and 8.6% (12/139); IgM
frequencies for these years were 8.8% (3/34) and
5.8% (8/139), respectively. As expected, among the 40
samples in which anti-HEV IgG was detected, only 2
came from persons under 20 years of age. Conversely,
11 of the 15 anti-HEV IgM positive samples belonged
to this age group. Regarding hepatic enzymes, anti-HEV
IgG detection was significantly more frequent among
persons presenting elevated ALT (p=0.039), whereas the
low overall anti-HEV positivity and percentage of cases
with hepatic enzymes tests requests preclude further
associations. In conclusion, this study demonstrates a
low overall detection rate of anti-HEV, although year-toyear rates show significant percentages, indicating that
detection of anti-HEV antibodies should be included
more widely in the differential diagnosis of acute
hepatitis in this setting.
HV315 - Detection Of Mutations In The S
Region Of Hepatitis B Virus (Hbv) In Hiv
Infected Treatment-Naive Patients In
Central Brazil
Oliveira, M.P., Matos, M.A.D., Carneiro, M.A.S., Teles,
S.A., Pimentel, K.N., Del-Rios, N.H.A., Silva, A.M.C.,
Kozlowski, A.G., Reis, N.R.S., Martins, R.M.B.
1. Instituto de Patologia Tropical e Saúde Pública, UFG,
IPTSP-UFG, Rua 235 - s/n - Setor Universitário - GoiâniaGO-Brasil
2. Faculdade de Enfermagem, UFG, FEN-UFG, Rua
123
Human Virology: HV
227 Qd 68, S/N - Setor Leste Universitário - Goiânia-GOBrasil
The HBV infection occurs in a significant number of
individuals infected with HIV. Also, many of HBV-HIV coinfected patients have mutations in the HBV genome that
may have implications for the prognosis, diagnosis and
therapeutics of hepatitis B. Although sY100C substitution
in the S region of the viral genome has been related to a
low expression of the HBsAg, one in vitro study has shown
that this substitution did not affect the detection and/
or secretion of HBsAg. sT131N replacement has been
suggested as a natural polymorphism of genotypes A and
G, and it is associated with persistence of HBV even after
the anti-HBs seroconversion, as well as vaccine escape.
sD144A substitution is also associated to vaccine escape,
as well as immunoprophylaxis failure using HBIG, and it
is often found in patients with genotype A. This study
aimed to investigate the presence of mutations in the
S region of the HBV genome in HIV infected treatmentnaive patients in Central Brazil. This is a cross-sectional
study conducted in HIV infected treatment-naive
individuals attended at a reference hospital for infectious
diseases in Goiania city. After serological screening of
the population (n=505), 29 HBsAg-positive subjects
were selected for this study. HBV DNA was detected by
a semi-nested PCR followed by nucleotide sequencing of
the S region of HBV. The identification of mutations in
the viral genome was carried out by deduction of amino
acids from the sequences of nucleotides. Mutations
in the S region of HBV were found in 80% (16/20) of
the HBV DNA positive patients. Of these, six had the
substitution sY100C along with sT131N, and in nine
was detected sT131N isolated. One patient had a triple
mutation (sY100C, sT131N and sD144A) in the HBV
genome. All these patients were infected with genotype
A. The findings of this study demonstrate the presence of
substitutions in the S region of HBV in HIV seropositive
patients. Further studies are needed to elucidate the role
of these mutations. Financial support: FAPEG
HV317 - Prevalence Of Human Papillomavirus
In Women Attending Cervical Screening In
The Southeast Of Brazil
Candeias, J.M.G., Bolpetti, A.N., Pinto, G.V.S., Villa, L.L.,
Luque, A.L.F., Silva, M.G.
1. Instituto de Biociências - Depto Microbiologia e
Imunologia, IBB - UNESP, Distrito de Rubião Junior s/n Botucatu - SP
2. Faculdade de Medicina de Botucatu - Departmento
de Patologia, FMB - UNESP, Distrito de Rubião Junior s/n Botucatu - SP
3. Instituto Nacional de Ciência Tecnologia das Doenças
do HPV, INCT-HPV, Rua Dr. Cesário Mota Júnior, 61 - São
Paulo - SP
4. Secretaria de Saúde de Botucatu, Secretaria de
Saúde, Rua Major Matheus, 7 - Botucatu -SP
Introduction: Cervical cancer is the second leading
cause of women death worldwide and high-risk Human
Papillomavirus (HPV) is the causative agent of this
disease. Epidemiological data on the prevalence of HPV
in a given population is essential for the establishment of
effective preventative strategies. Objective: The objective
of this study was to determine HPV prevalence in women
seen at the Primary Health Care Units in Botucatu, São
Paulo State, Brazil. Patients and Methods: A total of 515
women in reproductive age were included in this study.
At the moment of specular exam, cervical samples were
collected to HPV status evaluation and with Pap smear
screening tests. HPV genotyping was performed using
Linear Array HPV Genotyping Test (Roche Molecular
Systems Inc.) and all smears were evaluated at the
Cytology Unit of the Department of Pathology according
to the Bethesda system criteria. This study protocol was
approved by the local Ethics Committee. Results: The
median age of the studied population was 32.9 years,
and the majority of HPV-infected women are less than
30 years-old (107, 61.8%). HPV DNA was detected in
173 (33.6%) women and the analysis revealed that 96
(55.5%) of those represented infections with a single
genotype, and 77 (44.5%) samples have multiple
genotypes infections. High- and low-risk HPV genotypes
were detected in 109 (63.0%) and 115 (66.5%) samples,
respectively. Moreover, the most prevalent high-risk
HPV genotypes were HPV-16 (15.6%) followed by HPV31 (9.3%) and HPV- 45 (8.1%). The most commonly
identified low-risk types were HPV-53 (9.3%) and
CP6108 (5.8%). Abnormal cytology was observed in 17
(3.0%) women. Discussion and Conclusion: We observed
a higher HPV prevalence (33.6%) and higher infections
rate with multiple genotypes in women in reproductive
age compared to other studies done in Brazil with
the same population. Also, we observed that HPV-16
was the most prevalent genotype in our population as
founded worldwide. Financial Support : FAPESP (Grant
#2012/01278-0), INCT- HPV and Capes.
HV319 - Identification Of G2 Rotavirus
Causing
Antigenemia
In
Children
Hospitalized For Acute Gastroenteritis In
Belém, Pará, Brazil.
Barros, R.J.S., Vinente, C.B.G., Abreu, E., Reymão,
T.K.A., Guerra, S.F.S., De Oliveira, A.S.L., Fumian, T.M.,
Gabbay, Y.B., Soares, L.S., Justino, M.C.A., Linhares, A.C.,
Mascarenhas, J.D.P.
124
Human Virology: HV
1. Instituto Evandro Chagas, IEC, BR-316, Km 7, S/N°.
Levilândia. Ananindeua-Pa
2. Programa de Pós-Graduação em Virologia, PPGV/
IEC, BR-316, Km 7, S/N°. Levilândia. Ananindeua-Pa
Group A rotavirus is a major cause of acute
gastroenteritis, causing > 450.000 deaths annually,
mostly in developing countries. Recent studies have
shown the ability of rotavirus to evade gastrointestinal
tract and infect different organs, causing atypical clinical
manifestations. The aim of this study was to determine
a possible association between rotavirus G genotypes
identified in blood and fecal samples. Paired serum and
fecal samples were collected from children hospitalized
for acute gastroenteritis in a pediatric hospital in Belém,
Brazil, from March 2012 to March 2013. All recruited
children were aged less than 6 years and their parents
or guardians signed an informed consent form before
any study procedure. Quantitative polymerase chain
reaction (qPCR) was performed to detect viral RNA in
clinical samples. Positive strains were subjected to RTand Nested-PCR for genotype identification. Seventytwo paired (stool and serum) samples were collected:
47.2% (34/72) and 43.1% (31/72) of fecal and
serum specimens were positive by qPCR, respectively.
Positivity was observed in paired clinical samples in
30.5% (22/72) of cases. The most common genotype
found was G2 in 40.9% (9/22) of paired samples (serum
and corresponding feces). Twenty-one (95.4%) fecal
samples were G2 rotavirus genotype and only one (4.6%)
G1 rotavirus genotype. In 59.1% (13/22) of serum
samples reacting positive by qPCR, we were unable to
further determine the G genotype. To our knowledge
this represents the first study to assess antigenemia
by rotavirus in Brazil. Our data show that antigenemia
was associated with G2 rotavirus infection, reflecting
the current predominance of this genotype in Belém,
Brazil. Further analyses are needed to assess whether
G2 antigenemia translates into a more severe clinical
outcome. Financial support: Instituto Evandro Chagas/
SVS/MS; Coordenação de Aperfeiçoamento de Pessoal
de Nível Superior.
HV320 - Prevalence Of Antibodies Against
Hepatitis C Virus (Anti-Hcv) Infection
Among Type 2 Diabettes Patients.
Villar, L.M., Vasques, A.C., Geloneze, B., Miguel, J.C.,
Silva, E.F.,
1. Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365
2. Universidade de Campinas, UNICAMP
Chronic hepatitis C virus (HCV) has become the global
“epidemic” with an estimated 123 million people
currently infected worldwide. At the same time, type
2 diabetes is also rapidly emerging as a global health
care problem that threatens to reach pandemic levels
by 2030. Prevalence of HCV in the general population
in Brazil is 1.38%, but little information is known
regarding HCV prevalence among patients with type 2
diabetes. The objective of this study was to investigate
the prevalence of HCV infection in type 2 diabetes.
Serum samples from 411 individuals with type 2
diabetes referred to reference hospitals from 3 states
from Brazil (Minas Gerais, São Paulo and Ceará) were
included. Defining type 2 diabetes was done according
to the American Diabetes Association guidelines (2008).
The current research was approved by the Fiocruz ethics
committee. Demographic data rec-orded included age
and gender. Measurements of fasting glucose, aspartate
aminotransferase (AST), alanine aminotransferase
(ALT), gamma glutamyltransferase (GGT) were
performed following standard laboratory procedures.
Insulin was determined by electrochemiluminescence
method. HCVAb screening was done using commercial
enzyme immunoassay (Murex anti-HCV v.4.0, Diasorin)
following manufacturer’s instructions. Population was
comprised by 251 (61.07%) females and mean age±
standard deviation was 56.8 ± 28.6 years. The prevalence
of HCV in type II diabetes was 1.7%. Median values for
biochemical data were 23 U/L for ALT, 21 U/L for AST,
32 U/L for GGT, 144 mg/dl for glucose and 11.4 µU/L
for insulin. We concluded that HCV prevalence is slightly
prevalent among type 2 diabetic patients compared to
general population in Brazil.
HV321 - Complete Genome Sequence And
Characterization Of Hepatitis D Virus
Genotype 3 In Brazil
Marques, V.A., De Almeida, A.J., Lewis-Ximenez, L.L.,
Lampe, E.
Fundação Oswaldo Cruz, FIOCRUZ, Avenida Brasil,
4365 – Manguinhos, Rio de Janeiro - R.J, Brasil
Hepatitis D virus (HDV) co- or super-infection is a major
health risk for persons with acute or chronic Hepatitis
B virus infection due to HDV infection is associated
with a more severe form of hepatitis and increased risk
of complications. Currently, there are eight genotypes
of HDV distributed over different geographic areas.
Previous data have described HDV-3 as the most frequent
in Brazil, being associated with cases of fulminant
hepatitis. The aim of this study is to characterize the
genetic variability of full HDV-3 genome. The HDV strain
was isolated from a treatment-naive male patient with
chronic HDV infection, 25 years-old, who followed at the
Viral Hepatitis Ambulatory, Rio de Janeiro, Brazil. HDV
RNA was extracted from 200 ul serum using a High Pure
Viral Nucleic Acid Kit, according to the manufacturer’s
125
Human Virology: HV
instructions. Amplification was performed by RT-PCR
using five pairs of primers that cover the entire HDV
genome. PCR products were submitted to direct nucleotide
sequencing. The consensus sequence was obtained after
alignment with HDV-3 full-length genome sequences
available in GenBank. The phylogenetic analysis and the
deduced amino acid sequence were performed using
MEGA v.5 software package. The genome of the sample
identified in this study consisted of 1673 nucleotides
and showed only 88.7% similarity with the sequences
of genotype 3 characterized in others countries of South
America. A more inclusive phylogenetic analysis using
41 partial (nucleotide positions 908-1267) reference
sequences, from different HDV genotypes, confirmed that
the Brazilian isolates belong to genotype 3. The region of
LHDAg (large HDAg) from the Brazilian sample contains
multiple amino acid substitutions, which are conserved
in complete sequences of genotype 3 from Venezuela
and Peru. However, the analysis of the carboxy-terminal
region of the LHDAg of HDV-3 isolated from Brazilian
samples, including the sample of this study, showed some
degree of diversity when comparing one to each other.
In conclusion, the great genetic difference found among
this isolate and the other full-length characterized HDV3 from South America highlight the need of more studies
in this area to clarify the extend of genome variability of
Brazilian HDV isolates.
HV325 - Low Prevalence Of Hepatitis E In
A Riverside Community In The Far West
Amazon, Acre, Brazil
Gardinali, N.R., Salvador, S.B.S., Mejido, D.C.P., Pinto,
M.A., Baptista, M.L., Pereira, T.M., Arruda, R.A.,
Montovani, S.A., Silva-Nunes, M., Oliveira, J.M.
Instituto Oswaldo Cruz/ Fiocruz - Laboratório de
Desenvolvimento Tecnológico em Virologia and Laboratório
de Enterovírus; Universidade Federal do Acre
Hepatitis E virus (HEV) infection is the major cause of
epidemic and sporadic hepatitis in developing countries
with poor sanitation conditions. Genotypes 1 and 2
are associated with enteric, human infection whereas
genotypes 3 and 4 are primarily zoonotic and associated
to the consumption of raw or undercooked meat (pork,
wild boar and/or deer). In Brazil, HEV genotype 3 is
largely disseminated among swine herds, but only a
single human autochthonous case has been described
up to now. Among swine handlers the anti-HEV IgG
seroprevalence is estimated in the 6 to 8%, whereas in
urban areas it´s around 2%. In the present study, the
seroprevalence of HEV antibodies was evaluated in the
general population of Mâncio Lima (AC, Brazil), located
at extreme western Amazon. Only 0,5% and 15% of
the riverine population has electricity and toilets with
sinkhole, respectively, but not treated water. The food
is based on wild meat, cassava flour, cereals and some
vegetables. Seven hundred serum samples were tested
for anti-HEV IgG by EIA using the recomWell HEV kit
(Mikrogen, Neuried, Germany). Besides the potential risk
of acquiring HEV infection, either by the consumption of
wild meat as well by the poor conditions of sanitation,
the overall prevalence of anti-HEV was found to be low
(3,8%) in Mâncio Lima, which
HV326 - Niche Modeling Evidencing The
Spatial Speciation Of Arenavirus Reservoirs
In South America
Oliveira, A.L.R., Bisordi, I., Souza, R.P.
Centro de Virologia - Instituto Adolfo Lutz, NDTV CV - IAL, Av. Dr. Arnaldo 355 CEP: 01246-902 São Paulo,
SP Brasil
Arenaviruses are associated with severe hemorrhagic
disease in humans in Africa and South America.
Among the natural reservoir of Arenavirus in South
America, the genus Calomys is specially important as
both Argentinean and Bolivian hemorrhagic fevers
are associated with Calomys musculinus and Calomys
callosus respectively. Popularly knew as “Vesper mouse”
the genus Calomys is a frequent inhabitant of the South
American open vegetation forms. In order to understand
the evolution of Arenavirus in South America it is
necessary to understand the temporal and geographical
distribution of Calomys. This study aims to describe
the spatial partiotining of Calomys in South America
and analysis its influence in the current distribution of
Arenavirus. In the current study, the MAXENT ecological
niche modeling algorithm was utilized to model the
distribution of Calomys callosus, Calomys musculinus and
Calomys tener, reservoirs of Machupo, Junin and Pinhal
(unpublished data) arenaviruses respectively. Cases of
the disease were also plotted and analyses against the
same set of environmental layers in order to understand
the distribution of the disease in relation to reservoir
distribution and the possible existence of natural nidality
within rodent subpopulations. The resulting analysis
suggests that Calomys callosus, Calomys musculinus and
Calomys tener presents a near parapatric distribution,
with little area overlap. Population niches overlaps
and produce a continuum of similar ecological roles
across an environmental gradient. The typical area of
occurrence of Calomys tener is the open formations of
southeastern Brazil. The occurrence of Pinhal virus is
within the area of occurrence of Calomys tener, but the
low incidence of the virus do not allow further analysis.
Calomys callosus occurs in Bolivia, Paraguay, Northern
Argentina and western Brazil. The niche model predicts
the existence of the species in Central Brazil and in the
126
Human Virology: HV
Northeastern Caatinga. All cases of Bolivian Hemorrhagic
fevers studied were restricted to the northern portion
of Calomys callosus distribution, indicating a strong
natural nidality. The same phenomenon is observed with
Calomys musculinus and the Junin occurrence. Further
analysis are necessary to uncover the evolutionary
process that led to the current distribution. Financial
support
HV330 - A Viral Meningitis Outbreak
Associated With Echovirus 18 In São Paulo
State, Brazil
Carmona, R.C.C., Machado, B.C., Vieira, H.R., Vilanova,
B.C., Souza, C.A., Timenetsky, M.C.S.T., Katz, G.
1. Instituto Adolfo Lutz, IAL, Av. Dr. Arnaldo, 355, Sao
Paulo, SP, Brasil, 01246-902
2. Centro de Vigilancia Epidemiologica do Estado de
Sao Paulo, CVE
Human enteroviruses (HEVs) are responsible for a wide
spectrum of clinical disease. They are the most common
cause of viral meningitis and represent a serious publichealth problem, especially during outbreaks. The aim of
this study was to describe the HEVs serotype responsible
for an outbreak of 11 suspected cases of aseptic
meningitis among children from two schools in the City
of Bauru, São Paulo State, Brazil, between October and
November of 2012. Cerebrospinal fluid (CSF) samples
from 05 children were sent at the Adolfo Lutz Institute
for research of HEVs. Cell culture, RNA extraction and
Real Time Polymerase Chain Reaction (PCR) were
performed on each sample to determine the presence
of HEVs. Samples which were positive for enterovirus
in cell culture were subject to reverse transcription PCR (RT-PCR) and VP1 partial sequencing to identify
the etiological agent of the outbreak. The serotype of
each isolate was determined by BLAST search of the
VP1 amplicon sequence available in GenBank. All CSF
specimens were diagnosed as enterovirus-positive by
real time-PCR. Phylogenetic analysis of two successfully
sequenced samples revealed echovirus 18 (E-18) as
the etiological agent.E-18 was reported as cause of an
outbreak of aseptic meningitis in schoolchildren from
City of Bauru, São Paulo State, Brazil. Rapid detection
and identification of HEV serotypes in clinical specimens
are important in appropriate patient management and
epidemiological investigation. Additionally, we illustrate
the utility of molecular methods for the detection and
typing of enteroviral infections. Financial support:
Fapesp 2012/50234-5
HV331 - Emerging Enteric Viral Infections
In Children And Adults With And Without
Diarrhea
Mendes, G.S., Silva, R.C., Reis, F.C., Lima, D.P., Amorim,
A.R., Santos, N.
Universidade Federal do Rio de Janeiro, UFRJ, Cidade
Universitária - Ilha do Fundão - CCS - RJ
Acute diarrhea (AD) is a major problem of public health.
A variety of virus is involved in the etiology of AD.
Among virus pathogens, rotavirus (RV), norovirus (NoV)
and astrovirus (AstV) are the most common agents
associated to AD. Other viruses such as Aichi virus
(AV) and newly described viruses such as salivirus/
klassivirus (SV/KV) and cosavirus (CosV) are emerging
as possible AD etiologic agents. In this work, we evaluate
the frequency of enteric viruses (RV, NoV, AstV, AV, SV/KV
and CosV) among children and adults with and without
AD in State of Rio de Janeiro. For this purpose, 225 stool
samples collected from 2010 to 2012 were examined
for the presence of viral genome by using conventional
and real-time RT-PCR methodologies. Viral RNA was
detected in 46 (20.4%) samples. Of those, 28 (60.9%)
were from individual between 16-81 years of age and
18 (39.1%) from children between 1-15 years of age.
Forty-one samples were positive for well-established
enteric pathogens: RV was the most common virus
detected (71.7%; 33/46), followed by NoV (13%; 6/46),
co-infection of RV+NoV was detected in 2 samples
(4.3%). Eighteen of those samples were collected from
individuals with AD and 23 from individual without AD.
Emerging viruses were detected in 5 samples, confirmed
by sequence analysis: SV/KV (8.8%, 4/46) and, AV (2.2%,
1/46). CosV was not detected. Samples positive for SV/
KV were collected from 3-, 29-, 36- and 44-years old
individuals without AD; the samples positive for AV came
from a 2-year old child without AD. All samples positive
for emerging viruses were collected in 2010. The results
demonstrate that SV/KV and AV circulated among adult
and children in Rio de Janeiro, although in low rates.
However, it was not possible to associate theses agents
to AD. Extensive epidemiological surveillance of novel
enteric viruses may provide a better understanding of
the distribution, genetic diversity, and association of
the viral agents associated with AD. Financial support:
FAPERJ, CAPES, CNPq.
HV335 - Epidemiological Evaluation Of Hsv1 And Hsv-2 In Risk Behavior Groups
Dos Santos, A., Lima, L.R., Perse, A.S., Motta-Castro,
A.R.C., Castro, L.S., Rezende, G., De Paula, V.S.
1. Fundação Oswaldo Cruz - Instituto Oswaldo Cruz,
Fiocruz-IOC, Av. Brasil, 4365 - Manguinhos, Rio de Janeiro
2. Universidade Federal de Mato Grosso do Sul, UFMS,
Av. Sen. Filinto Müller, 1 - Campo Grande - MS
127
Human Virology: HV
Both Herpes simplex virus type 1 and Herpes simplex
virus type 2 (HSV-1 and HSV-2) are highly prevalent
worldwide. HSV-1 is widespread in general population,
while HSV-2 is more usual among risk behavior groups
such as men who have sex with men (MSM) and
female sex workers (FSW). Genital herpes can cause
considerable morbidity and may lead to congenital and
neonatal infections. This clinical manifestation of Herpes
simplex viruses can be caused by either HSV-1 or HSV-2
and is the most prevalent sexually transmitted infections
in industrialized countries. Besides that, genital herpes
is highly associated with sexual risk behaviour groups as
MSM and FSW. The aim of this study was to evaluate the
prevalence and incidence of HSV-1 and HSV-2 in two risk
behavior groups, MSM and FSW, from Mato Grosso do
Sul, Brazil. For this purpose, 683 samples (283 samples
from MSM and 400 samples from FSW) were tested by
enzyme-linked immunosorbent assay for IgG and IgM
anti-HSV-1/HSV-2. The IgM anti-HSV-1/HSV-2 positive
samples were tested by multiplex PCR to evaluate the
presence of HSV-1 or HSV-2. The results demonstrated
that the prevalence of the MSM group is 82,58% and
from the FSW group is 99,5%. No individual from MSM
group was positive for IgM anti-HSV-1/HSV-2 and in FSW
group five samples were positive (1,24%). The multiplex
PCR demonstrated 2 negative samples, 1 positive sample
for HSV-2 and 2 positive samples for HSV-1 and HSV-2.
Our results demonstrated high prevalence of HSV-1/
HSV-2 and underscore the need for education on safer
sex practices among risk behavior groups.
HV337 - Hepatitis B Virus (Hbv) Infection
Among Female Sex Workers In Central
Brazil: Prevalence, Risk Behaviors And
Genotypes
Matos, M.A., França, D.D.S., Caetano, K.A.A., Carneiro,
M.A.S., Martins, R.M.B., Matos, M.A.D., Pinheiro, R.S.,
Kerr, L.R.F.S., Mota, R.M.S., Teles, S.A.
1. Faculdade de Enfermagem, Universidade Federal
de Goiás , FEN/UFG, Rua 227 Qd 68, S/N - Setor Leste
Universitário - Goiânia - Goiás - Brasil
2. Instituto de Patologia Tropical e Saúde Pública.,
IPTSP/UFG, Rua 235 - s/n - Setor Universitário. Goiânia,
Goiás-Brasil
3. Universidade Federal do Ceará, UFC, Av. da
Universidade, 2853 - Benfica, Fortaleza - CE. Brasil
Hepatitis B infection is one of the most frequent infectious
diseases and represents a serious problem of public
health worldwide, particularly due to the risk of chronic
complications. Female sex workers (FSW) have been
recognized as a population at higher risk for hepatitis
B virus (HBV) infection due to their social vulnerability
and factors inherent to professional activity. The aim
of this study was to estimate the prevalence and risk
factors/behaviors associated with HBV infection, and to
detect HBV genotypes circulating in FSW in Goiânia-GO,
Central Brazil. FSW were recruited during May 2009 to
June 2010, using Respondent- Driven Sampling. A total
of 402 FSW were interviewed about demographic and
risk factors for HBV infection and tested for detection of
HBV markers (HBsAg, anti-HBc and anti-HBs) by ELISA
(Hepanostika Uniform Organon Téknika and Biokit). All
HBsAg-positive samples were tested for the presence of
HBV DNA by nested polymerase chain reaction (PCR),
and genotyped by sequencing of the S gene. The overall
HBV prevalence was 16.9% (IC 95%: 11.4 – 23.3). Four
FSW were HBsAg positive, 161 anti-HBs positive and 63
anti-HBc positive. The HBV DNA was detected in three
serum samples. All were identified as subgenotype A1.
The multivariate analysis showed lower education,
earlier age at first sexual intercourse, cocaine use,
disagreement on condom use, obtaining male condom
in the workplace, and ignoring signals and symptoms of
sexually transmitted Diseases (burning pain on urination,
genital ulcers/sore, and itching) were independently
associated with HBV prevalence (p < 0,05). The present
findings offer a starting point to planning effective
interventions to prevent HBV infection and other STDs
among FSW. Financial support: CNPQ
HV339 - Pyrosequencing As A Useful Tool
For Detection Of Lamivudine Resistance
Mutations In Hiv/Hbv Coinfected Patients
Spitz, N.T.D., Lago, B.V., Moraes, M.T.B., Gomes, S.A.,
Soares, C.C.
Fundação Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365,
Manguinhos, Rio de Janeiro/RJ
Chronic hepatitis B virus (HBV) is common in human
immunodeficiency virus type-1 (HIV-1) infected
individuals with a prevalence ranging from 5 to 20%
in various studies of HIV-infected patients. Both share
similar routes of transmission and can lead to chronic
disease, cancer, and death, and neither can be eradicated
with the use of current therapies. Reverse-transcriptase
(RT) is an important enzyme for the replication of
both viruses and for this reason it is used as a target in
antiretroviral therapy. Lamivudine (LAM) is a nucleoside
analogue which inhibits RT and is used in treatment
against HBV and HIV. However, its clinical benefit has been
compromised by the emergence of resistant viral strains
carrying specific mutations in HBV and HIV RT genes. In
HBV, the primary LAM-resistance mutation (rtM204V/I)
affects viral replication and compensatory mutations
(rtL180M, rtV173L) that partially restore replication
efficiency are often co-selected. The aim of this study
128
Human Virology: HV
is to evaluate by pyrosequencing, the incidence of LAM
resistance mutations in both viruses. RtM204V/I were
successfully analyzed in 23 samples. Mixed population
(wild type -wt- and mutant strains) was found in 69.6%
(16/23) of samples. Only rt204V mutant population was
found in 21.7% (5/23) of samples and in 2 (2/23; 8.7%)
only wt strains were found. Compensatory mutation
rtL180M was investigated in 14 samples and only wt
strains were found. RtV173L was studied in 20 samples.
Only wt strains were found in 90% (18/20) and only
rt173L mutant population was found in 10% (2/20) of
the samples. Mutant subpopulation was found in some
samples percentages lower than 10%, showing that
pyrosequencing is a very sensitive technique that may
be useful in detecting and quantifying subpopulations of
resistant viruses, that may be not be detected by other
methods. It can be useful in predicting the appearance of
mutant strains that can derail the treatment, improving
the outcome of therapy. Financial support: Fiocruz,
CNPq/PIBIC
HV340 - Hyperendemic Circulation Of
Dengue Virus Serotypes 1, 2 And 4 In São José
Do Rio Preto, São Paulo, Brazil
Colombo, T.E., Silva, M.L.C.R., Vedovello, D., Reis, A.F.N.,
Cury, A.A.F., Oliveira, F.H., Cruz, L.E.A.A., Bronzoni,
R.V.M., Nogueira, M.L.
1. Universidade Estadual Paulista Júlio de Mesquita
Filho , IBILCE/UNESP
FAMERP, São José do Rio Preto, SP, Brazil
3. Departamento de Vigilância de São José do Rio Preto,
DV/SJRP, São José do Rio Preto, SP, Brazil
Dengue is the most common arboviral infection
worldwide and it is caused by four distinct serotypes
(DENV 1-4). São José do Rio Preto (SJRP), São Paulo has
been presenting a hyper endemic circulation of DENV
since 2008, when three serotypes started circulating
in the city. This is a report of DENV transmission in
SJRP from 2011 to 2013. We used serum samples of
suspected and confirmed DENV patients provided by
the Health Secretariat to profile DENV circulation. The
viral surveillance was based on Multiplex RT-PCR with
Flavivirus generic primers based on non-structural
protein (NS5) were performed, followed Nested assays
with species-specific primers for the identification of
DENV 1-4. There were 997 cases confirmed in SJRP
from January 2011 to March 2013. We amplified 783
samples for DENV and 327 (41,5%) were positive for
DENV-1, 78 (10%) DENV-2, 375 (48%) DENV-4 and 3
(0,5%) DENV-1/DENV-4 coinfection, showing a complex
pattern of serotypes circulation. DENV-1 was the first
and only serotype to cause autochthonous DENV cases
in SJRP from 1990 to 1998. Only in 2008, DENV-1 was
detected again in SJRP. It was also the main serotype in
the 2011 outbreak. DENV-2 was introduced in the city
in 1998 and DENV-4 in 2011. Thus, we show that three
different serotypes of dengue have been detected in
the city in different proportions and the impact of this
hyperendemic circulation should be further evaluated
for epidemiological purposes.
HV344 - Epidemiological Profile Of
Pandemic Influenza A Cases In Southern
Brazil: Post-Pandemic Period And Vaccine
Baccin, T.G., Gregianini, T.S., Kretzmann, N.A., Gorini da
Veiga, A.B.
1. Univerdidade Federal de Ciências da Saúde de Porto
Alegre, UFCSPA, R. Sarmento Leite, 245 Anexo I B: CENTRO,
Porto Alegre / RS
2. FEPPS-Instituto de Pesquisas Biológicas-Labaratório
Central, IPB/LACEN-RS, Av. Ipiranga, 5400 - Jardim Botânico
- Porto Alegre/RS
Influenza viruses are highly contagious and circulate
in all geographical regions. Although it causes mild
symptoms in the majority of cases, illnesses can result
in hospitalizations and deaths mainly among highrisk groups. During the 2009 pandemics caused by
influenza A(H1N1), the State of Rio Grande do Sul (RS)
alone confirmed 3,585 influenza A(H1N1) cases. In
2010, a massive vaccination program was applied in
RS when 44.9% of the population joined the program.
During the 2011, 1,501 cases of SARI and Influenzalike illness were notified and nasopharyngeal samples
were collected. A total of 1,433 samples was sent to
the Central Laboratory in Porto Alegre (LACEN-RS)
for viral detection by real time reverse transcriptionpolymerase chain reactions. Only 107 (7.5%) cases of
the A(H1N1) virus were confirmed versus 182 (12.7%)
cases of seasonal influenza A. The incidence of both
influenza types virus was higher in patients aged 0-10
years old, differently of the pandemic period when the
patients more frequently affected were 21-30 years old
group. The median viral load was higher in patients
infected with seasonal, in comparison to those infected
with A(H1N1) virus (1.86(0.06-157.58) vs. 0.05(0.00202.44)), contrary of pandemic period. The median viral
loads were different between females and males only in
patients infected with seasonal virus and females had
highest viral load in relation to male (11.7{0.15-340.34}
versus 0.81{0.02-47.3}, p=0.02). In 2011 most of the
patients that were infected by influenza A virus (79%,
p<0.001), did not receive vaccine. The presence of fever,
cough, dyspnea, myalgia and rhinorrhea were the most
frequent symptoms (positivity >60%). Nevertheless,
fever and dyspnea showed a positive correlation with
129
Human Virology: HV
infection by A(H1N1) virus (p<0.05). Curiously, in 2011
only patients infected by pandemic virus died (12.9%,
p=0.001) in contrast with 2009 pandemic period when
6% of patients infected by pandemic virus died. In other
hand in the whole population (5.3%) the mortality rate
was similar that observed in the pandemic period (5.9%).
After the pandemic period (2009), influenza A(H1N1)
virus reemerged only in May 2011 and co-circulated
with influenza A seasonal and B viruses. Wherever we
don´t know what is happening with the pandemic virus
selection. These analyses provide important scenery
about the host-pathogen interaction after massive
exposure during pandemic period. Financial Support:
FEPPS and Ministério da Saúde
HV347 - Comparative analysis of the HBV/A1
full-length genome: The role of the slave
trade in the spread of HBV/A1 in Brazil
Lago, B.V., Mello, F.C.A., Motta-Castro, A.R., Gomes, S.A.
Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil,
4365, Manguinhos, Rio de Janeiro, Brasil
Hepatitis B virus (HBV) infection is one of the major public
health problems, especially in developing countries. It is
estimated that 2 billion people have been infected with
HBV worldwide and more than 240 million are at risk of
developing cirrhosis and hepatocellular carcinoma due
to chronic infection. Among them, 65 million are living
in Africa. It have been established that HBV subgenotype
A1(HBV/A1), the most prevalent Brazilian genotype,
has an African evolutionary origin. Studies conducted in
isolated Afro-Brazilian communities, which are closed
to external contact since the slavery, found almost
exclusively HBV/A1, suggesting that it was introduced
in Brazil by the slave trade. The aim of this study is to
compare HBV/A1 isolates from different African regions
with Brazilian isolates in order to investigate, throughout
genetic identity, which African regions/countries have
contributed to dissemination of HBV/A1 in Brazil.For
this purpose, 50 samples, previously classified as HBV/
A1 from different Brazilian regions were selected. Up
to now, thirty-seven HBV full-length genomes were
amplified by PCR assay.Twenty-one HBV/A1 genomes
were successfully sequenced and compared with 150
HBV/A1 sequences available in GenBank/NCBI.Three
clones from 10 different samples were also sequenced in
order to verify subpopulation divergences.Phylogenetic
analysis demonstrated that Brazilian sequences are
more closely related to Asian/East African sequences
than with sequences from south-western African
regions (genetic distance values: 0,17 versus 0,26).A
higher identity between Brazilian and Somalian samples
(0,18) suggested that most of the captives who were able
to perpetuate HBV/A1 infection belonged to this region.
These results suggest that HBV infected slaves brought
to Brazil came mostly from the East African coast, and
probably exported during the late 19th century through
Mozambican route by Portugese sailors. However,
evolutionary studies are necessary to confirm this
hypothesis and to establish the routes involved to the
spread of HBV/A1 in Brazil.
HV348 - Active Human Herpesvirus 6 And
7 Infections In Plasma Of Patients With
Encephalitis And Neurological Diseases:
An Alternative Of The Use Of Cerebroespinal
Fluid Detection.
Tavares, C., Bonatelli, M., Nucci, A., Costa, S., Bonon, S.
University Of Campinas, UNICAMP, Cidade
Universitária “Zeferino Vaz” - Faculty Of Medical Sciences
The aim of this study was to identify the incidence of
HHV6-A, B and HHV-7 in patients suspected of having
CNS infections and to differentiate patients with signs
and symptoms of encephalitis and non-encephalitis
at the Hospital of Clinics, Campinas, SP, Brazil. A
cerebrospinal fluid (CSF) and a plasma examination by
nested polymerase chain reaction (N-PCR) for HHV6 and HHV-7 was performed and compared. Criteria
for diagnosis of HHV-CNS infections included fever,
headache, seizure, altered consciousness, etc. A total of
53 patients, 26 males and 27 females aged between 0.0574 years (median=23 years old), were enrolled in this
study. Thirteen patients had active HHV-6 and/or HHV7 infection (24.5%). The incidence of HHV-6 and HHV-7
active encephalitis infections was 44%. The incidence of
HHV-6 viral encephalitis was 40%; HHV-7 encephalitis
was detected in 36%. Coinfection HHV6+HHV7 occurred
in 20%. There were no HHV6-A infections observed.
The incidence of active HHV infections was noticeably
higher in encephalitis patients (p = 0.005). These
findings suggest that infection with HHV-6 and HHV-7
is frequently associated with encephalitis among others,
which demonstrates that these pathogens have a high
potential for neuro-invasiveness. Nested-PCR in CSF may
be helpful in the detection of patients with HHV-CNS
infection and non HHV-CNS infection and plasma can be
used in situation were is impossible to collect the LCR to
examination. This study confirms that the PCR analysis
of plasma is a valid tool for the diagnosis of neurological
diseases associated with herpesvirus and can be used
to evaluate the clinical impact of the lymphotropic
herpesviruses and their role as human pathogens in CNS
infections. Finnancial Support: FAPESP
HV350 - The Use Of Antigenemia Test For
Detection Of Active Human Herpesvirus 6 & 7
(Hhv-6 And Hhv-7) And Its Relationship With
130
Human Virology: HV
Antigenemia For Human Cytomegalovirus
In Brazilian Transplanted Patients.
Oliveira, R., Gulin, A., Pancielli, P., Lima, C., Vigorito, A.,
Rossi, C., Costa, S., Bonon, S.
University of Campinas-Faculty of Medical Sciences,
FCM/UNICAMP, Cidade Universitária “Zeferino Vaz”
The aim of this work is to use antigenemia (AGM)
assays to detect and monitor active infections caused
by HHV-6 and HHV-7 in patients undergoing HSCT, as
well as evaluating the clinical impact of these viruses
in relation to active human cytomegalovirus infection
(CMV). Methods: Fifty seven patients undergoing HSCT
were monitored weekly, from day 0 until day 100 of
the post-transplantation period, using antigenemia
assays and a plasma Nested PCR (N-PCR) technique for
the detection of active betaherpesvirus infections and
to avoid the detection of latent infections. Methods:
HHV-6 and HHV-7 antigenemia assays were developed
in peripheral blood mononuclear cells from HSCT
patients with the use of monoclonal antibodies specific
for these viruses and peroxidase staining. Active HCMV
infection detection was performed using a commercial
immunofluorescence kit. Results: Using plasma N-PCR
and/or antigenemia assays for HHV-6 and HHV-7, 53 out
of the 57 patients monitored had active betaherpesvírus
infections (93%); in 68.4% the infection was caused
by HCMV, in 68.4% by HHV-6 and in 78.9% by HHV-7.
Detection of active betaherpesvírus infections using
antigenemia assay for HCMV, HHV-6, HHV-7 occurred,
respectively, in 29/57 (50.9%), 39/57 (68.4%) and
45/57 (78.9%); triple infections occurred in 15/53
(28.3%), double infections occurred in 29/53 (54.7%)
while mono-infection occurred in 10/53 (18.9%).
Conclusions: The standardization and development
of HHV-6 and HHV-7 antigenemia assays appear to be
effective in the diagnosis of active infections caused by
these herpesviruses and can be used to detect active
herpesvirus infections, especifically. The possibility
of their activation during immunosuppression may
suggest their participation in progression of HCMV
infection in patients after hematopoietic stem cell
transplantation (HSCT) and the management of the
patients can be improved. Future studies can be done to
use HHV-6 and HHV-7 antigenemia to quantify the viral
load of these virus in blood of patients and to monitor
the antiviral treatment in comparation to Nested-PCR
plasma detection and Real Time PCR and to study the
real necessity of monitoring patients to HHV-6 and HHV7 infections after the transplants. Finnancial Support by
FAPESP
HV352 - Genetic Diversity Of Dengue Virus
Serotype 1 In Boa Vista - Rr, Brazil
Sousa, D.D., Cordeiro, J.S., Granja, F., Siqueira, T.C.S.,
Nascimento, I.A.S., Lima Junior, W.P., Silva, G.A.V.,
Naveca, F.G., Acosta, P.O.A.
1. Universidade Federal de Roraima, UFRR, Campus
Paricarana: Av. Cap. Ene Garcez, nº 2413. Bairro Aeroporto.
CEP: 69310-00
2. Instituto Leônidas e Maria Deane - FioCruz - AM,
ILMD - FioCruz - AM
3. Programa de Pós-graduação em Recursos Naturais,
PRONAT - UFRR
Dengue is the most important human arboviral disease
and the major health problem in developing countries.
Dengue virus (DENV) is an arbovirus that belongs to
genus Flavivirus family Flaviviridae, classified in four
antigenically distinct serotypes DENV-1-4. Roraima is
hyperendemic for dengue and shows the circulation
of four serotypes after DENV4 reintroduction in 2010.
Between 2007 and 2011,14.078 cases of febrile illnesses
were noticed in State which dengue infection was
discarded by laboratory methods of anti-dengue IgM
and/or NS1 antigen-capture ELISA (NS1) and whose
etiologic agent was not identified. The aim of this study
was to evaluate the accuracy of dengue diagnose in NS1
negative samples in comparison with Real-time RT-PCR
(qPCR) in 2012. In 986 samples from patients with
presumptive diagnose for dengue 78,8% were negative
by ELISA assay (Platelia™DENGUE-NS1-Ag, BIORAD®)
used in Central Laboratory of Roraima, this is the primary
diagnose method used in the health system of the state
in the acute phase of disease. 150 samples were selected
from the NS1 negative total to perform qRT-PCR. RNA was
extracted with Axygen Bioscience® kit and subjected to
a TaqMan qRT-PCR that detects any serotype genome,
developed by Gurukumar, 2009 adapted by Naveca,
2012, from these samples 21,3% were positive by this
test. Among the possible causes of false-negative NS1
number are the high sensitivity/specificity of qPCR and
the fact of Roraima be a hyperendemic state, in which
a high rate of secondary infection is expected, as know
this fact decreases the sensitivity of NS1 tests due to
the immune-complexes formed. Future studies may be
conducted to evaluate these hypotheses, as well as the
relation between serotypes and negativity of NS1. The
data should be an alert to the health system in the sense
that acute phasepatients are discarded by laboratorial
assays; this phase needs constant care due to the
possibility of HFD/DSS, important in an endemic area.
Financial support: Universidade Federal de Roraima UFRR
HV354 - Il28b And Itpa Alleles Frequency In
Brazilian Patients With Hcv
131
Human Virology: HV
Delvaux, N., Costa, V.D., Costa, M.M., De Almeida, A.J.,
Villar, L.M., Villela-Nogueira, C.A., Coelho, H.S.M., PolloFlores, P., Esberard, E.B.C., Uaraná, T., Lewis-Ximenez,
L.L., Lampe, E.
4365 - Manguinhos, Rio de Janeiro - CEP: 21040-360
2. Hospital Universitário Clementino Fraga Filho da
UFRJ, HUCFF da UFRJ, Rua Rodolpho Paulo Rocco, 255 Cidade Universitária - Ilha do Fundão - RJ
3. Hospital Universitário Antônio Pedro da UFF, HUAP
da UFF, Rua Marques de Paraná, 303 - Centro - Niterói - Rio
de Janeiro
Hepatitis C virus (HCV) infects about 170 million
people worldwide and it is estimated that over two
million individuals are infected in Brazil. The treatment
of patients with chronic HCV infection is still a major
challenge both in terms of clinical effectiveness and
cost-effectiveness. Several studies have shown that, in
addition to viral factors, host genetic variants near genes
of interleukin 28B (IL28B) and inosine triphosphate
pyrophosphatase (ITPA) are strongly associated with SVR
and protecting against hemolytic anemia, respectively.
In IL28B gene, a single nucleotide polymorphism (SNP)
in rs12979860 revealed that the CC genotype is rather
associated with SVR than CT or TT. In ITPA gene, in
rs1127354, patients that bear the CC genotype are
more likely to develop anemia than AC/AA genotypes,
whereas, in rs7270101 reduced hemoglobin is higher
in patients with the AA genotype than with AC/CC
genotype. Another important aspect to be studied is the
genetic variation of polymorphisms in different ethnic
groups. Several studies demonstrated that the frequency
of the CC genotype of IL28B is higher in patients with
European ancestry than in individuals of African descent.
In ITPA, genotypes CC/AC (rs1127354) are found at
lower frequency in the Caucasian population than in the
eastern. In contrast, the genotypes AC/CC (rs7270101)
are found more in whites, but were not detected in Asians.
Thus, different polymorphisms in both genes need to be
examined in the Brazilian population to obtain national
results. We aimed to verify the frequency of alleles in the
SNP rs12979860 (IL28B), rs1127354 and rs7270101
(ITPA) in Brazilian samples. One hundred eighty three
HCV infected patients were analyzed by DNA sequencing.
Concerning the rs12979860, CC, CT and TT variants were
detected, respectively, in 30% (55/183), 49% (89/183)
and 21% (39/183). Regarding the rs1127354, 96.2%
(176/183) showed CC genotype and 3.8% (7/183) AC
genotype. On rs7270101, 82.5% (151/183) showed AA
genotype, 17% (31/183) AC genotype and 0.5% (1/183)
CC genotype. These preliminary results demonstrated
that the CT genotype of rs12979860 in IL28B, and
the CC genotype of rs1127354 and the AA genotype
of rs7270101 in IPTA gene were the most frequent in
Brazilian patients. Financial support: FAPERJ, CNPq,
Plataforma PDTIS/FIOCRUZ (RPT01A).
HV360 - Preliminary Research Of Antibodies
Against Hantavirus In The Population
From Jataí County, Goiás
Costa, V.G., Novaes, D.P.S., Flor, E.C., Ramos, C.D.L.,
Gaban, L., Souza, L.O., Paula, C.R., Pimentel, V.A., Silva,
D.P.B., Moreli, M.L.
1. Universidade Estadual de Goiás, UEG, Jataí, GO
2. Laboratório de Virologia, Universidade Federal de
Goiás, UFG, Rodovia BR 364, km 192, Parque Industrial,
3.800, Jataí-GO
Emerging diseases are of great interest for public human
and animal health systems, especially those with high
mortality, such as hantaviruses. Hantavirus, family
Bunyaviridae, is transmitted to humans through aerosols
of excreta from infected wild rodents. Hantaviruses,
emerging in the Americas since 1993, causes
cardiopulmonary syndrome. Currently, Brazil present
the highest number of cases (1573) in the Americas
with 633 deaths. The state of Goiás has recorded cases
of illness and is located between endemic states for
hantavirus, being Jataí county the third in this state in
number of cases of illness. However, no epidemiological
studies related to the disease in this region. Accordingly,
with aim to know the levels of IgG antibodies against
hantavirus and to become individuals more aware about
the illness, this research was conducted in Jataí. The
project was approved by the Ethics Committee of Federal
University of Goiás (n° 348/2010). The participants
resided in peri-urban and rural areas and the samples
were collected on filter paper, through use of disposable
microknife in the fingertip. Aditionally, it was applied a
questionnaire. Subsequently, samples in the filter papers,
diluted in PBS buffer, were processed by ELISA test,
using N protein of Araraquara virus. 323 serum samples
were collected and processed, of which 52% were males
and 48% females. Age of participants ranged from 10
to 78 years and was observed seroprevalence IgG antihantavirus of 2.2%. There was no association between
seroprevalence of hantavirus and gender of participants
by Fisher test (p=0.123). There was also no statistical
difference by Fisher test seropositive compared to the
urban and rural areas (p=0.279) (p<5%). Based in our
results the seroprevalence of IgG anti-hantavirus in
population of Jatai was 2.2%. In conclusion, due to the
majority of city population is unaware of disease is need
public health policies aimed at awareness severity of
hantaviruses.
132
Human Virology: HV
HV366 - Searching For Antivirals For Use
In Infections By Htlv-1: Evaluation Of New
Adamantane Derivatives
Franco, G.M., Souza, J.G., Canestri, L.O.R., De Fátima, A.,
Souza-Fagundes, E.M., Barbosa-Stancioli, E.F.
Antônio Carlos, 6627, Pampulha - Belo Horizonte - MG, CEP:
31270-901
Human T-lymphotropic virus 1 (HTLV-1), a human
retrovirus, is the causative agent of an aggressive T-cell
leukemia known as adult T-cell leukemia (ATL) and a
neurodegenerative disease called HTLV-1 associated
myelopathy/tropical spastic paraparesis (HAM/TSP),
besides other inflammatory diseases. Nevertheless,
therapeutic approaches to HTLV-1-related pathologies
are still limited. The aim of this study is the evaluation of
two new adamantane derivatives, ADA1 and ADA2 having
in common the moiety (C10H15), for which antiviral
properties had already been described to Influenza
A, Rubella virus and HIV. Preliminary data are being
evaluated in MT2 cells, a human cell lineage permanently
infected with HTLV-1. The citotoxicity of the derivatives
was evaluated in the concentrations of 1µM, 0.01µM
and 0.0001µM for 72h (MTT assay), and, concomitantly
a Western Blot (WB) assay was performed in the same
conditions by using the total proteins extracted from
the cells, after centrifugation. The supernatant of these
cells was used to detect cytokines in a flow citometry
assay (CBA Th1/Th2/Th17 - BD). Both derivatives did
not present toxicity to MT2 cells in any of the dilutions
tested. In the WB assay, a pool of HTLV-1 serum from
positive HAM/TSP patients indicated variation in the
protein profile of MT2 treated cells that were drug
and concentration dependent, highlighting the protein
modulation by ADA1 in the 0.0001µM concentration.
The cytokines profile analyzed did not demonstrate
significant variation, however, the supernatant of MT2
treated cells with ADA1 in the 0.01µM concentration
showed an expression a little higher of IL-6, IL-10 and
IFN-γ than the other drug and concentrations. These
preliminary data demonstrate that ADA1 can be a
possible antiviral candidate.
HV368 - Development Of A Tetravalent Dna
Chimeric Vaccine Against Dengue Virus
Guimarães, G.F., Moura, L.R., Nascimento, E.J., Marques,
E.T.A., Gil, L.H.V.G.
1. Universidade Federal de Pernambuco , UFPE, Rua
Professor Moraes Rego, sn/Departamento de Genética
2. University of Pittsburgh, CVR, 3501 Fifth
Avenue/9022 Biomedical Science Tower 3 Pittsburgh, PA
15261
3. Centro de Pesquisas Aggeu Magalhães, CPqAM/
FIOCRUZ-PE, Rua Professor Moraes Rego, sn
Dengue virus has four antigenically distinct serotypes
(DENV-1 to DENV-4) classified in the Flaviviridae Family,
genus Flavivirus. As there is no specific treatment for
dengue, the development of a vaccine is a priority.
Development of DNA vaccines encoding antigens specific
for dengue is considered a viable approach. The use of
optimized sequences targeted to the antigen processing
compartment with the membrane protein associated
Lysosome (LAMP), has been shown to enhance immune
responses compared to unmodified DNA vaccines
encoding native antigens. Vaccine plasmids encoding
pre-membrane and envelope (prM/E) proteins for
the four dengue serotypes were constructed with
and without LAMP. After confirmation of the DNA
sequences, HEK-293 cells were transfected with the
plasmids for confirmation of protein expression and
cellular trafficking. Subsequently, BALB/c mice were
immunized 3 times, three weeks interval, with 100 μg
of either monovalent (mono-DNA) or tetravalent (tetraDNA) endotoxin-free plasmid formulations. Three
weeks after the last immunization, serum samples were
collected for virus-specific antibody response analysis
by ELISA and PRNT. Then, animals were sacrificed and
their spleenocytes harvested for T cell response analysis
by IFN-γ ELIspot using prM/E overlapping peptides.
Overall, dengue LAMP plasmids constructs elicited
higher levels of virus-specific IgG2a, higher neutralizing
antibody titers as well as stronger T cell responses
than its counterpart without LAMP. On the other hand,
tetra-DNA induced a greater antibody levels and lowers
antibody neutralization titers as compared to monoDNA. T cell epitope repertoire was reduced by tetraDNA, suggesting that epitope dominance among dengue
serotypes might have influenced T cell activation,
compromising vaccine efficacy. Induction of concomitant
protective immunity against all dengue serotypes has
proven to be challenging. Our study provides insights
about vaccine efficacy and dengue antigen formulations.
HV381 - Hpv-6 Lcr Sequence Variability
Detected In Laryngeal Papillomatosis
Impacts Upon Viral Transcriptional
Activity
Bonfim, C.M., Sichero, L., Sobrinho, J.S., Nogueira, R.L.,
Kupper, D.S., Valera, F.C.P., Nogueira, M.L., Villa, L.L.,
Rahal, P.
1. Universidade do Estado de São Paulo, UNESP/
IBILCE, Rua Cristóvão Colombo, 2265 - Jardim Nazareth
2. ICESP, Instituto do Câncer , Av. Dr. Arnaldo, 251 Cerqueira César - São Paulo - SP - CEP: 01246-000
3. Faculdade de Medicina de Ribeirão Preto, FMRP, Av.
133
Human Virology: HV
Bandeirantes, 3900 - Monte Alegre - CEP: 14049-900 Ribeirão
Preto/SP
FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro São José
do Rio Preto, 15090-000
5. Escola de Medicina da Universidade de São Paulo,
USP, Av. Dr. Arnaldo, 455 - Cerqueira César - CEP: 01246000 - São Paulo - SP - Brasi
6. Instituto Nacional de Ciência e Tecnologiadas
doençasdo HPV, INCT, Rua Dr. Cesário Motta Jr. n º 61 - Cep:
01221-020 - São Paulo
Recurrent respiratory papillomatosis (RRP) is
characterized by the development of papillomas, which
are benign tumors in the upper respiratory tract. This
disease is associated to Human Papillomavirus (HPV)
infection, mainly by types 6 and 11 which are considered
oncogenic low-risk HPV. The LCR (long control region)
contains cis-regulatory elements for cellular and viral
transcription factors (TF) that modulate viral early
gene expression and replication. Nucleotide alterations
within the LCR may overlap TFs elements and impact
upon the binding affinity, the transcriptional activity
and ultimately on the clinical outcome associated to
HPV infections. Our aim was to characterize molecular
variants of HPV among individuals diagnosed with RRP
and to analyze the impact of LCR nucleotide divergence
upon viral early transcription. We analyzed 11 biopsy
specimens of juvenile laryngeal papillomatosis and 9
of adult laryngeal papillomatosis. HPV-6 was found
in 14 (70%) samples and HPV-11 in 6 (40%) samples.
Sequencing of the HPV-6 LCR revealed five genomic
variants not described previously. Computational
analysis showed that nucleotide changes detected
overlap potential binding sites for transcription factors
such as Foxa-1, Elf-1 and Gata-1. The HPV-6vc variant was
10 times more active than the HPV-6a molecular variant.
Further, we observed that other alterations observed
strongly impacts transcriptional activity indirectly
measured by luciferase assays. To our knowledge, this
is the first report describing differences in promoter
activity among naturally occurring variants of HPV-6.
Research in this area is anticipated to provide important
information concerning the biological significance of
HPV-6 intratype genomic variability.
HV385 - Epidemiology Of Hepatitis A In Rural
Settlements In Central Brazil
Pinheiro, R.S., Matos, M.A., Caetano, K.A.A., Araújo, L.A.,
Del-Rios, N.H.A., Moraes, L.C., Rodrigues, F.P., Silva,
A.M.C., Carneiro, M.A.S., Martins, R.M.B., Teles, S.A.
1. Laboratório de Virologia/ IPTSP/UFG, IPTSP-UFG,
Rua 235 - s/n - Setor Universitário - CEP: 74605050 - Goiânia
- GO
2. Faculdade de Enfermagem/Universidade Federal
de Goiás, FEN/UFG, Rua 227 Qd 68, S/N - Setor Leste
Universitário - Goiânia - GO
3. Faculdade de Enfermagem/UEMS, UEMS/MS,
Rodovia Dourados - Itahum Km 12 Cidade Universitária
79800000 - Dourados, MS
4. Secretaria Municipal de Saúde de Jataí-GO, SMSJataí-GO, ua Riachuelo, 2762, B. Vila Fátima CEP: 75.800000
5. Hospital das Clínicas/Universidade Federal de Goiás,
HC/UFG, 1ª Avenida, s/n - Setor Leste Universitário - 74.605020 - Goiânia - Goiás
Hepatitis A virus (HAV) infection constitutes a serious
public health problem, being responsible for about
1.5 million new infections worldwide each year. Poor
sanitary conditions particularly lack of safe water and
sewerage systems have been associated with increased
HAV prevalence. In Brazil, there are more than 1. 200.000
families living in rural settlements. Most of them have no
access to safety water, and many had lived previously in
landless camping in poor hygiene conditions. The aim
of this study was to estimate the prevalence of hepatitis
A among people living in rural settlements in Central
Brazil. During 2008-2010 and 2011, individuals living
in rural settlement in Goias (n= 435) and Mato Grosso
do Sul (n= 364) were interviewed and blood samples
were collected and tested for HAV antibodies (total antiHAV) by ELISA, respectively. Inclusion criteria for the
study were: living in the settlement and aged ≥ 5 year.
This study was approved by the Ethical and Research of
the Clinical Hospital of the Federal University of Goias
(n.127/2010) and Federal University of Mato Grosso do
Sul (n.1027/2007), update with the approval in 2011.
Globally 86.7% (95% CI: 84.2 – 88.9) of individuals had
been previously infected by HAV, ranging from 16.2%
(95% CI: 9.3 – 26.7) to 98.7% (95% CI: 97.3 – 99.3) in
those aged 5-9 years and 30 years or over, respectively.
Increasing age, living in rural settlements of Mato Grosso
do Sul, and had lived previously in landless camping
were independently associated with HAV infection in
this population (p < 0.05). Infants living in rural settlers
should be a target population for hepatitis A vaccination.
HV390 - Prevalence Of Hepatitis C Virus In
A Rural Settlement’s In State Of Goiás,
Central Brazil
Araújo, L.A., Del-Rios, N.H.A., Martins, R.M.B., Teles,
S.A., Silva, A.M.C., Diniz, F.A., Santos, L.S.M., Marques,
J.M.S., Matos, M.A., Caetano, K.A.A., Andrade, A.A.,
Carneiro, M.A.S.
134
Human Virology: HV
UFG,Goiânia, IPTSP / UFG, Rua 235 - s/n - Setor
Universitário, Goiânia, Goiás
2. Faculdade de Enfermagem, UFG, Goiânia, FEN
/ UFG, Rua 227 Qd 68, S/N - Setor Leste Universitário Goiânia - Goiás
Hepatitis C virus (HCV) is a predominant cause of chronic
hepatitis, cirrhosis and hepatocellular carcinoma
worldwide. HCV infection is endemic in many countries,
with an estimated approximately 150 million HCVinfected people worldwide. Studies have shown that many
families had lived previously in landless camping in poor
hygiene conditions. These adverse conditions favor the
occurrence of infectious diseases such as hepatitis viral
fecal-oral transmission (A and E) and sexual/parenteral
(B, C and D). This study aimed to determine the HCV
infection prevalence, analyze associated risk factors
and also to identify these virus genotypes and subtypes
among people living in rural settlement’s in State of Goiás,
Central Brazil. A total of 464 settlers were interviewed
and blood samples were collected. All samples (sera)
were tested for the presence of antibodies to HCV (antiHCV) using an enzyme-linked immunosorbent assay
(ELISA) and immunoblot. Anti-HCV-positive samples
were submitted to HCV RNA detection by polymerase
chain reaction (PCR) with primers complementary to
the conserved area of the 5’ non-coding (NC) region
of HCV and genotyped by line probe assay (LiPA). This
study was approved by the Ethical and Research of
the Clinical Hospital of the Federal University of Goiás
(n.127/2010). The mean age of the study population was
37.6 years (SD: 19.9 years) and 73.7% had up to nine
years of formal education. Four samples were anti-HCV
positive, resulting on a prevalence of 0.9% (95% CI: 0.32.3). Genotyping of HCV RNA positive samples revealed
the presence of genotypes, subtype 1a. Individuals
reported positive surgical procedures, drug use, blood
transfusions and multiple sexual partners. This research
showed low prevalence of hepatitis C in the population
studied. However, epidemiological investigations are
relevant for analyze the effectiveness of intervention
measures for control and prevention of this infection.
Financial support: CNPq
HV399 - Plasma Proteins Profile Of Hepatitis
C Virus Infected Patients Using A Dige-Ms/
Ms Approach
Trinta, K.S., Brunoro, G.V.F., Lewis-Ximenez, L.L., Lampe,
E., Perales, J.
1. Laboratório de Toxinologia, IOC - FIOCRUZ, IOC FIOCRUZ, Av. Brasil, 4365, Manguinhos, Rio de Janeiro. CEP
21040360
2. Laboratório de Hepatites Virais, IOC - FIOCRUZ,
IOC - FIOCRUZ, Av. Brasil, 4365, Manguinhos, Rio de
Janeiro. CEP 21040360
HCV infection is a global public health problem. Although,
some of infected individuals can spontaneously eliminate
the virus, most patients develop chronic infection,
which over time can lead to complications, such as,
liver cirrhosis and hepatocellular carcinoma. Whereas,
many studies have been conducted on the virus and
on the natural diversity of their genome sequence,
relatively little is known about how this virus modulate
the metabolism of the host and the consequences of
these changes at molecular level. Here, we employed a
proteomic approach using a DIGE-MS/MS analysis to
compare plasma proteomic profiles from twelve healthy
blood donors against twelve HCV infected individuals of
which seven evolved to spontaneous clearance and five to
chronic infection. For each group, samples were collected
from the beginning of the infection and approximately
24 weeks after. In order to minimize the dynamic range
effect in plasma analysis, samples were depleted from
the six most abundant plasma proteins using an affinity
chromatography. Proteins were then analyzed by DIGE
associated with a MALDI-TO/TOF mass spectrometer.
Protein identification were performed using the MASCOT
search engine and then filtered to meet at least 95%
identification confiability using the software Scaffold.
The results showed a significant number of differentially
detected spots in samples collected from the acute
phase of patients who had spontaneous clearance and
chronic infection when compared with controls. A
smaller number of differentially detected spots were
found in the same patients after six months. There was
little difference in the number of differentially detected
spots among patients in the same group when compared
the two collection points. We were able to identified
nine proteins differentially expressed. All of them were
synthesized in the liver and are associated with the acute
phase of several pathologies. This work has generated
an important amount of data related to differentially
expressed proteins in the plasma of patients with
hepatitis C in different conditions of the illness that
altogether, in the future, associated with specific studies
of pathophysiology, can contribute to better understand
this disease. Financial support: CNPq e CAPES.
HV400 - Study Of The Association Between
Polymorphisms In The 3’ Utr Region Of
Cyp2b6 Gene And The Effectiveness Of AntiHiv Therapy.
Almeida, T.B., Arruda, M., Brindeiro, R.M., Tanuri, A.,
Cardoso, C.C.
Laboratório de Virologia Molecular - IB - UFRJ, LVM
135
Human Virology: HV
- UFRJ, Av. Carlos Chagas Filho 373, CCS, Bloco A, Sala 121,
CCS, UFRJ, RJ, Brasil
Alexandre Ferronato, 1200 - Setor Industrial Sul, Sinop - MT,
78550-000
Nearly 8 million HIV+ patients are currently undergoing
HAART (Highly Active Antiretroviral Therapy). However,
the treatment is not effective for all these patients, and
about 10-20% of them do not reach therapeutic success.
HAART effectiveness is limited mainly by the emergence
of drug resistant viruses but also by host factors
affecting drug absorption, activation and metabolism.
Since therapeutic success depends on the maintenance
of appropriated drug levels, the genes coding for
enzymes involved in antiretrovirals (ARVs) metabolism
are important candidates for pharmacogenetic studies.
The aim of this study was to investigate the association
between single nucleotide polymorphisms (SNPs) in
the 3’ UTR region of the gene coding for CYP2B6, which
metabolizes efavirenz and nevirapine. For this purpose,
we have conducted a case-control study including 95 HIV+
individuals undergoing first-line HAART for at least 6
months, including 33 cases of HAART failure (viral loads >
50 copies/mm3) and 62 controls with undetectable viral
loads. Patients were selected from the cities of Curitiba
and Porto Alegre. SNP genotyping was performed
by direct sequencing. Only 7 SNPs (rs138892132,
rs189811422, rs28969429, rs145450819, rs3211391,
rs28969421 and rs189966711) out of the 56 already
described in CYP2B6 3’UTR were observed in our sample.
The SNPs rs145459819 and rs3211391 were absent
among controls and excluded from further analysis.
Results of the logistic regression models showed that
the G allele at rs189811422 confers protection against
HAART failure (OR = 0.33; 95%CI=0.12-0.9; p=0.02 for
the AG/GG group). These results suggest that SNPs in
CYP2B6 regulatory region may also affect efavirenz and
nevirapine clearance, probably due to differences in
gene expression. The data obtained in the present study
reinforce the role of host genetics in HAART effectiveness.
This knowledge may be crucial to define better therapy
regimens according to the genetic profile of the patients.
Financial support: CNPq and FAPERJ.
Arboviruses are zoonoses that depend on animal species
to replicate and spread within the environment. In terms
of public health, the most important arboviruses are the
ones transmitted by mosquitos. Mosquito collection is
an important tool to investigate viral circulation patterns
within urban settings and forests. Our goal was to assess
the presence of arboviruses in mosquitoes collected at
urban/forest transition areas from October 2011 to April
2012. We used manual aspirators to collect mosquitoes
from São José do Rio Preto (SP) and Sinop (MT) which
are areas with known active arboviral circulation. The
specimens were grouped in pools according to date of
collection, site, gender and genus/species. Viral RNA was
extracted using TRIZOL and the pools were tested with
a Hemi-Nested-Multiplex-RT-PCR that uses generic and
specific primers to amplify Flavivirus and Alphavirus.
We collected 302 mosquitoes that were grouped in 141
pools. More than 55% of the samples were analyzed.
One pool containing Aedes scapularis was positive for
dengue 4 (DENV-4) and six pools were positive for Culex
flavivirus (CxFV). These pools were sequenced and the
results were confirmed. This is the first report of DENV
in Aedes (Ochlerotatus) scapularis. Although we cannot
discuss data on the competence of this mosquito as
DENV vector, the report itself is an important warning
for the investigation of its role in dengue transmission
dynamics. This prelimary data is also in accordance
with what was found in the city of São José do Rio Preto
in 2007/2008, when the circulation of CxFV was first
detected. It is likely that this virus has established a
continuous circulation in the region. The detection of
these viruses in transition areas is extremely useful to
understand the spread of viruses that were primarily
circulating in urban areas. DENV, which is mainly a
disease from urban settings in Brazil, may be radiating
to wider areas through other vectors from Aedes genus.
HV402 - Arbovirus Occurrence Among
Mosquitoes Collected At Urban/Forest
Transition Areas From São José Do Rio
Preto/Sp And Sinop/Mt (Brazil).
Ozanic, K., Carvalho, C.P.T., Parra, M.C., Pereira, E.F.,
Bronzoni, R.V.M., Nogueira, M.L., Mondini, A.
FAMERP, Av. Brigadeiro Faria Lima, 5416 - 150900-000 - São
José do Rio Preto, SP
2. Universidade Estadual Paulista, UNESP, Rodovia
Araraquara - Jaú Km 1, 14801-902 - Araraquara, SP
HV403 - ENTROPY LEVEL ON RESISTANCE
POSITIONS OF HEPATITIS C NS3 PROTEIN
SUBTYPES 1A AND 1B AGAINST PROTEASE
INHIBITORS FROM DIFFERENT GEOGRAPHICAL
LOCATIONS
Alves, R., Queiroz, A.T.L., Todão, J.S., , De Carvalho,
I.M.V.G.
Instituições
The hepatitis c virus (HCV) infection is a major public
health problem and several new drugs that targets
specific viral proteins (DAA) are on clinical trials or
already approved for use. Clinical trials characterized
several mutations associated to treatment failure.
136
Human Virology: HV
However, the high mutation rate and HCV quasispecies
characteristics make it hard to draw any conclusions
about natural polymorphism of patients naive of
treatment from different geographical locations. To
obatain more information 1277 HCV NS3 protein
genotype 1a and 1b sequences from patients without
expousure to DAA treatment were obtained from
LosAlamos and Genbank databases. The datasets were
separated according to geographical location (Europe,
USA and Brazil) and subtype (1a and 1b). Phylogenetic
reconstructions were performed for genotypes and
geographical confirmation clades. The analysis of naive
resistance mutations was performed translating nucleic
acids sequence into amino acids. Shannon entropy was
calculated for every associated resistance position of the
protease domain (181 aa) in each geographical group.
Naive resistance mutations were observed up to 5% at
positions 36, 41, 43, 54, 80, 109, 155, 156 and 168 mixed
in all three geographical groups and both genotypes.
The position 80 showed significant difference on the
geographical analysis with the highest level on US
genotype 1a samples (Entropy = 0,79309) and low-level
entropy on Brazilian genotype 1a samples (Entropy =
0,2155). The information complexity of NS3 protein Q80
position on geographical locations is important to be
analyzed when compared with the absence of resistance
mutation Q80K on Brazilian naive samples and the
high level presence on American and European naive
samples (Q80K = 36 %). However, all three genotype
1b geographical groups presented low entropy level of
Q80K and a high level of entropy at position 170. This
high complexity information pattern on that position of
genotype 1b sequences is associated to V170I natural
polymorphism, not described yet as resistance mutation.
Studies on resistance against the HCV DAA treatments
make it clear that naive patients natural polymorphisms
are associated with discontinuation of treatment and,
the different geographical patterns of both subtypes,
raising important questions about the impact that same
subtype natural polymorphism in different countries
can have on the protocol of treatment.
HV405 - Twenty-Five Years Of Denv-1 In
Brazil:
Virological
And
Molecular
Surveillance Of Strains Isolated Between
1986 And 2011
Nogueira, F.B., Dos Santos, F.B., Castro, M.G., Nunes,
P.C.G., Filippis, A.M.B., Faria, N.R.C., Simões, J.B.S.,
Sampaio, S.A., Santos, C.R., Nogueira, R.M.R.
Instituto Oswaldo Cruz, IOC/FIOCRUZ, Av. Brasil,
4365 - Manguinhos, Rio de Janeiro - RJ, 21040-900
In Brazil, the activity of dengue virus (DENV) increased
significantly after the introduction of DENV-1 in the
state of Rio de Janeiro (RJ) in 1986, the DENV-2 (1990),
DENV-3 (2000) and DENV-4 (2011). Between 2000 and
2001, the co-circulation of DENV-1, 2 and 3 was oberved,
with the latter predominating in the following years.
In 2009, DENV-1 re-emerged in several regions of the
country, including the Southeast. As some samples may
be potentially more virulent than others, the impact of
those viruses over the population may be estimated by
monitoring those viruses. Given the re-emergence of
DENV-1 in the country, we propose to characterize viral
strains isolated since this serotype introduction (1986)
until the year of 2011. The viruses were isolated in
clone C6/36 Aedes albopictus cell culture for extraction
of viral RNA. Overlapping fragments of approximately
900 bp were amplified for partial genome (envelope
gene - E) sequencing in both directions on an automated
sequencer from the PDTIS/IOC Platform. Sequence
analysis was performed by Chromas 1:45 software,
sequences alignment by CLUSTAL W and phylogenetic
analysis by MEGA 5. The results obtained based on the
E gene sequencing showed that DENV-1 strains recently
isolated in State of Rio de Janeiro, Espírito Santo, Minas
Gerais, Mato Grosso do Sul, Alagoas and Ceará, belong to
genotype V (America / Africa), but grouping into distinct
clades. The analysis of the identity from 495 amino
acids (AA) of the E gene demonstrated the presence of
mutations that resulted in changes of AA in domains I
and III of this protein. These changes were conserved
in the strains of three different lineages characterized
and wer responsible for the differentiation of those in
the phylogenetic analysis. The low circulation of DENV-1
and the low percentage of identity of the newly isolated
viruses compared to those from the 80s, suggests that
the re-emergent DENV- 1 did not evolved locally, but
resulted from independent viral introductions in the
country. Financial support: CNPq, FAPERJ, FIOCRUZ.
HV407 - Epidemiological Profile Of Hepatitis
B In Roraima State Between 2007 And 2012
Granja, F., Barros, J.A., Lima Jr., W.P., Ferreira, J.C., Sousa,
D.D., Naveca, F.G., Acosta, P.O.A.
1. Universidade Federal de Roraima, UFRR
2. Laboratório Central de Roraima, LACEN-RR
3. Intituto leonidas e maria deane, ILMD, Fiocruz
The hepatitis B is an infectious disease with high
transmissibility, mobility and lethality, showing as acute
or chronic form, taking the second place among the most
frequent viral hepatitis in Roraima State. The objective
of this study was describe the epidemiological profile
of the hepatitis B carriers at in Roraima between 2007
and 2012. A descriptive study was made, retrospective,
having as source Information SINAN (Sistema de
Informação de Agravos de Notificação) of the Health
137
Human Virology: HV
Ministry of Brazil. In this period were registered 1812
new cases of viral hepatitis which 561 (31%) were
hepatitis B. As for the distribution in relation to sex we
found that 58,5% of the carriers are men. In relation to
race we found that 59,9% brown; 24,42% caucasian;
6,06% black; 3,92% indigenous; 1,07% yellow and
4,63% without information. The range age predominant
were between 20 and 29 years with 25,5% of the new
detected cases, this data can be related to the vaccination
coverage, which has not yet reach the ideal percentage.
Being Roraima an endemic area, all of the hepatitis B
carriers are tested to Delta hepatitis, and it showed in
this period a rate of co-infection of 4,92%. Relative to
the Roraima States counties, Mucajaí showed its highest
rates of detection in 2012 with 117/100.000 habitants,
followed by Caracaraí and Boa Vista with similar
detection rates of 26/100.000 habitants. Although
recent advances in relation to diagnosis, treatment and
prophylaxis of hepatitis B, it remains as an important
health public problem in current days. This information
can help in definition and implementation of measures
to reduce the negative impact of the infection, looking
for the reduction of new cases, noticing the vaccination
coverage, and helping the planning of actions to disease
control as way to reduce global effects of this serious
health problem.
HV416 - First Report And Molecular
Characterization Of An Autochthonous
Hepatitis E Virus Genotype 3 Infection In
A 10 Years Old Female Liver Transplant
Recipient In Brazil
Passos, A.M., Pelegrini, A., Porta, G., Miura, I.K., Pugliese,
R.P.S., Danesi, V.L.B., Porta, A., Guimarães, T., Seda, J.,
Antunes, E., Granato, C.F.H.
1. Disciplina de Infectologia, Escola Paulista de
Medicina, EPM-UNIFESP, São Paulo, SP, Brazil
2. Grupo Fleury SA, , São Paulo, SP, Brazil
3. A.C.Camargo Cancer Center, , São Paulo, SP, Brazil
Hepatitis E virus (HEV) causes acute and chronic
hepatitis in organ transplant recipients. Serological
evidence for HEV infection has been demonstrated in
various population groups in Brazil, and only a few
acute cases have been confirmed among healthy and
immunocompromised patients. To date, however, no
cases of HEV infection in children have been reported
in Brazil. This study aimed to identify and characterize
the presence of HEV-RNA among patients referred to
a clinical laboratory to perform anti-HEV antibodies
tests. A retrospective study was performed on 54
serum samples previously subjected to ELISA test for
anti-HEV antibodies in 2012. HEV-RNA was detected
trough Real-Time RT-PCR in one confirmed case, with
positive anti-HEV IgM and IgG antibodies. In 2006, a 4
years old female presented with unexplained increased
liver enzymes and biopsy confirmed acute cellular
rejection, approximately 3 years after a living donor
liver transplantation due to biliary atresia. This scenario
remained unchanged over 6 years. Anti-HEV IgM and IgG
tested positive in 2012. Serological tests and biopsy ruled
out hepatitis B virus, hepatitis C virus, cytomegalovirus
and Epstein-Barr virus. Anti-nuclear antibodies also
tested negative. The patient presents with good general
state of health, whereas liver enzymes remain elevated
to date. The serum sample retrospectively tested for
HEV-RNA was obtained in 2012, when the patient was
admitted at the hospital for a follow-up biopsy. The HEV
strain isolated in this study using a sequence analysis of
a 304-nt ORF2 fragment (Brazilh4, GenBank accession
number KF152884) shares 87–93% homology to
sequences of human HEV previously characterized by
our group in Brazil, and 83–97% homology to swine
HEV from Brazil. Phylogenetic analysis revealed this
human HEV strain clustered together with strains
characterized as genotype 3 subtype 3b. In conclusion,
HEV infection should be incorporated in the differential
diagnosis of acute hepatitis and acute cellular rejection
among liver transplant recipients, including pediatric
patients. Financial support: FAPESP 2012/22925-3 e
2013/03701-0
HV424 - Characterization Of Recombinant
Hepatitis A Virus-Like Particles For
Diagnosis Kit Development
Caiado, B.V.R., Sena, J., Sousa, R.C.V., Pacheco, M.F.T.,
Marques, E.T.A., Dhalia, R.
1. Universidade Federal de Pernambuco, UFPE, Av.
Prof. Moraes Rego, 1235 - Cidade Universitária, Recife - PE CEP: 50670-901
2. University of Pittsburgh, , PA, USA
3. Faculdade Maurício de Nassau
4. Centro de Pesquisas Aggeu Magalhães, CPqAM/
FIOCRUZ, Av. Professor Moraes Rego, s/n – Cidade
Universitária – Recife/PE . CEP 50.670-4
Hepatitis A virus (HAV) is the main form of acute
viral hepatitis worldwide, constituting an important
health problem. In order to monitoring/control HAV
transmission, it is critical to differentiate HAV from other
liver-affecting diseases. Commercial diagnostic kits
available are based in inactivated HAV that grows very
slowly, in cell culture, limiting antigens production. An
attractive strategy to increase viral antigens production
is the expression of virus-like particles (VLPs). The HAV
genome is encoded in a single-stranded RNA molecule
coding for 4 structural proteins (VP4-VP2-VP3-VP1) and
138
Human Virology: HV
7 non-structural proteins (2A-2B-2C-3A-3B-3C-3D) that
are expressed as a polyprotein precursor, lately converted
to individual proteins mainly by 3C viral protease
cleavage. Here we described three different approaches
to generate HAV-VLPs in recombinant baculovirus
systems: 1- expression of all structural proteins fused to
2A and 3C, interspaced by a DNA spacer (VP4-VP2-VP3VP1-2A-DNA spacer-3C); 2- expression of all structural
proteins (VP4-VP2-VP3-VP1) and 3C, using bicistronic
vector; 3- expression of VP4-VP2 and VP3-2A (from
Foot-and-Mouth Disease Virus – FMDV)-VP1-2A, also
using bicistronic vector. Synthetic baculovirus optimized
DNAs coding for all strategies were chemically produced,
cloned and used to generate recombinant bacmids by
site directed transposition. Bacmids were screened by
PCR to confirm corrected integration and after that used
to transfect Spodoptera frugiperda 9 (Sf9) insect cells,
in order to generate recombinant baculovirus. Currently
all cloning strategies were obtained, and bacmids were
successfully recovered. For the first strategy we also
already have recovered baculovirus. For the next step,
we are planning to infect Sf9 cells in order to generate
baculovirus from the second and third strategies.
Obtained VLPs are going to be purified and characterized
trough sucrose gradient sedimentation and electronic
microscopy, respectively. Finally all VLPs are going to be
validated in terms of immunogenicity, using referenced
HAV human sera panels, aiming to develop a VLP-based
diagnosis kit. Financial support: FIOCRUZ-PE, CNPq and
CAPES.
is a phosphorylated and glycosylated protein that acts as
a kinase and can bind to RNA; along with NSP2, form the
viroplasm interacting with VP2 and NSP6. Until now, 11
NSP5 genotypes (H1-H11) were established. The aim
of this study was to investigate the genetic diversity
of NSP5 gene from RVA detected in children in the
Triangulo Mineiro region, Brazil, period 2005 to 2011.
Twenty-six rotavirus samples were selected, submitted
to nucleic acid extraction, NSP5 amplification by RT-PCR,
followed by sequencing and phylogenetic analysis. Long
electropherotype samples clustered into three distinct
NSP5 genotypes: eight samples clustered within the
branch H1 and were found to be associated with G1P[8],
G9P[8] and G12P[8]; other 2 samples fell into H6 branch
and were associated with G12Pnon-typed(NT) and
one sample clustered within the branch H3, associated
with G3P4. The fifteen short electropherotype strains
clustered within the branch H2 and were associated
with G2P[4] and G8P[4]. Triangulo Mineiro H1 and H2
genotypes samples split equally into two sub-clusters
distinct from prototypes strains; interestingly one clade
of H2 strains were formed by samples from 2006 to
2008 years and the other by strains from 2008-2010.
H6 wild type samples showed close relationship with a
strain from Paraguay. H3 was closely related with a cat
RVA from Italy and another Brazilian human strain. This
study provides valuable information for understanding
the diversity and evolution of RVA strains which is
of great importance for current vaccination national
program. Financial support: Plataforma sequenciamento
ILMD-Fiocruz Amazonia, FUNEPU
Av. Frei Paulino, 30. Bairro: Abadia, Uberaba-MG
2. Instituto Leônidas e Maria Deane - Fiocruz Amazônia, ILMD - Fiocruz
4365, Manguinhos, Rio de Janeiro/RJ, CEP 21040-900
HV427 - Phylogenetic Analysis Of Nsp5
Gene From Group A Rotavirus Detected In
Cases Of Infantile Diarrhea In Triângulo
Mineiro Region, Brazil, From 2005 To 2011
Dulgheroff, A.C.B., Silva, G.A.V., Naveca, F.G., Domingues,
A.L.S.
Rotavirus A (RVA) is the main cause of acute gastroenteritis
in children worldwide and a monovalent vaccine against
rotavirus (G1P[8]) was introduced into the brazilian
immunization program since 2006. Rotavirus genome
consists of 11 segments of double-stranded RNA and
particles are formed by a triple capsid, where the outer
layer is composed of VP4 and VP7 proteins encoded
by the fourth and ninth genomic segments, used in
a dual classification system to define P and G types,
respectively. Recently, a new classification system based
on characterization of 11 segments of RVA was proposed.
Non-structural protein 5 (NSP5), encoded by segment 11
HV429 - Hepatitis Delta Virus (Hdv)
Prevalence Among Blood Donors In
Luanda, Angola
Savassi-Ribas, F., Spitz, N.T.D., Borges, L.F., Varella, R.B.,
Gomes, S.A., Soares, C.C.
HDV is a subviral pathogen of humans, a satellite of
hepatitis B virus (HBV) that depends on the envelope
protein of HBV for its assembly and propagation. HDV is
highly endemic in Mediterranean coutries, Middle East,
Central Africa and northern parts of South America. Of
the 240 million chronic carriers of HBV worldwide, more
than 15 million have serological evidence of exposure
to HDV. Although Africa is considered an endemic
region for this infection, for many countries, there is no
available data in the literature. The aim of this study was
to investigate the seroepidemiological and molecular
profile of HDV in blood donors from Luanda, Angola.
213 serum samples and 151 whole blood samples were
139
Human Virology: HV
analyzed. Originally, samples were subjected to HBsAg
detection. HBsAg was found in 19.2% (41/213) and
9.3% (14/151), respectively. All reactive samples were
tested for anti-HDV and positive were tested for HDAg.
Blood samples were not tested for HDV markers. Of the
41 HBsAg positive serum samples, 22% (9/41) were
anti-HDV positive and 43.9% (18/41) were in the gray
zone. HDAg was detected in two anti-HDV positive
samples. Anti-HDV positive and HBsAg reactive samples
were subjected to RT-PCR for viral RNA detection, which
was not found in any sample. Our results shows a still
high prevalence of HBV in Angolan general population
and also describes a high seroprevalence of HDV among
these HBsAg carriers. Studies about HDV epidemiology in
sub-Saharan countries are scarce, these data contributes
for a better understanding of HDV circulation in African
continent. Financial support: Cnpq and FIOCRUZ
HV430 - Prevalence Of Hepatitis C Virus
Infection In Patients With Disorder OncoHematological In Central Brazil
Marinho, T.A., Pessoni, G.C., De Moraes, A.A., Dos
Santos, M.A.C., Teles, S.A., De Matos, M.A.D., Martins,
R.M.B., Da Silva, L.N., De Oliveira, M.P., Tamíris, A.M.,
Kozlowski, A.G.
IPTSP-UFG
2. Faculdade de Enfermagem, FEN-UFG
3. Associação de Combate ao Câncer de Goiás, ACCGHAJ
4. Universidade Federal de Goiás, UFG
According to the World Health Organization (WHO),
approximately 150 million people are chronically
infected with hepatitis C virus (HCV) and 350 million
people die each year from liver complications related
to infection. HCV, as well as hepatotropic can infect
and replicate in peripheral blood lymphocytes and
mononuclear cells can induce a weak disorder oncohematological. As the etiology of most diseases
onco-hematological is still unknown, some authors
have suggested the role of this virus in the genesis
of lymphomas. This study aimed to investigate the
seroepidemiological profile of the hepatitis C infection
among patients with disorder onco-hematological
attended at two hospitals in reference to the treatment
of these diseases (Hospital Araujo Jorge e Hospital das
Clinicas) in Goiania, Goias. A total of 350 patients were
interviewed for socio-demogrphic characteristics and
risk factors for HCV infection. Blood samples were
collected and sera were tested for the presence of
antibodies to HCV (anti-HCV) using an enzyme-linked
immunosorbent assay (ELISA) and immunoblot. The
anti-HCV positive samples were submitted to HCV RNA
detection by polymerase chain reaction (PCR) and
genotyped by the Line Probe Assay (LiPA). The HCV
infection prevalence was 0.9% (95% CI: 0.22 to 2.7) in
patients with diseases onco-hematological. The viral
RNA was detected in 0.57% (2/3) of anti-HCV positive
samples, and the genotype/subtype 1b, were identified
in the study population. Risk characteristics, reported
by individuals anti-HCV positive, use non-injecting drug
use, blood transfusion before 1994, tattooing, surgery
and multiple sexual partners. This research showed
low prevalence of hepatitis C in the population studied.
However, epidemiological investigations are relevant for
analyze the effectiveness of intervention measures for
control and prevention of this infection.
HV431 - Lamivudine-Resistant Mutations
(Rtl180m/M204v)
In
Recombinant
Of
Hepatitis B Virus (Hbv) Genotypes A/G From
Treatment-Naïve Patient With Chronic
And Occult Hbv Infection
Barros, J.J.F., Lewis-Ximenez, L.L., Peres, L.R., Sousa,
P.S.F., Mello, F.C.A., Gomes, S.A., Moraes, M.T.B.
1. Fundação Oswaldo Cruz/Instituto Oswaldo Cruz,
FIOCRUZ/IOC, Av. Brasil, 4365, Manguinhos - Rio de Janeiro
- RJ - Brasil CEP: 21040-360
2. 1Laboratório de Virologia Molecular, Instituto
Oswaldo Cruz,, LVM, Pavilhão Hélio e Peggy Perreira (HPP),
sala B15
3. Ambulatório de Hepatites Virais, Laboratório de
Hepatites Vi, , Pavilhão 108
Chronic hepatitis B virus (HBV) infection is a serious
global health problem an important cause of morbidity
and mortality in endemic areas. Approximately 2 billion
people in the world have been infected by HBV and
nearly 400 million individuals worldwide have been
infected with chronic hepatitis B virus (HBV). Occult HBV
infection is defined by detectable HBV genome in the
absence of surface antigen (HBsAg, the main serological
marker of active infection). The cause of an overt HBV
infection becoming an occult one is unknown. Drug
resistance in hepatitis B virus (HBV) patients treated with
Nas (nucleotide analogues), such as, lamivudine (LAM)
has been associated with the emergence of polymerase
gene mutations within the Reverse-transcriptase (RT)
region. In this study, a recombinant of HBV A/G for S
region presenting primary LAM-resistance mutation
(rtM204V) and rtL180M isolated from a treatmentnaïve patient with occult HBV infection is reported. The
patient was a 23-year-old Brazilian male with classical
acute infection (seropositive for HBsAg, HBeAg and
anti-HBc in 10/2008. After six months, all serological
markers became negative except anti-HBc but HBV
140
Human Virology: HV
DNA was detectable in low titles <104 copies/mL. This
patient was monitored for HBV markers for about three
years with a total of 14 serial serum samples available.
Genomic regions of S, pre-C and C genes were PCR
amplified, followed by nucleotide sequencing and also
subjected to pyrosequencing to verify the presence of
mixture of genotypes. Phylogenetic trees of HBV isolates
were obtained using the Neighbor Joining Method and
recombination analysis was carried out using SIMPLOT
version 3.5.1. In this study we describe HBV recombinant
of genotypes A/G in the S gene during occult infection.
Mutations were found at codon (or AA) rtL180M/
M204V motif in the RT domain of the HBV polymerase
for two recombinant A/G subgenotypes during occult
infection, although the patient was treatment naïve. The
results obtained from pyrosequencing analysis suggest
the transmission of the HBV recombinant A / G occurred
during the chronic phase of infection. Since the HBV
surface and polymerase genes overlap, mutations in the
RT domain can affect the amino acid sequences of the
HBsAg protein, especially the “a” determinant or T-cell
epitope, leading to alterations of immunogenicity and
can lead to chronic disease. HBV molecular monitoring
should be employed for an adequate management in
HBV occult infection.
HV432 - Molecular Characterization
Of Rotavirus From Patients With Acute
Gastroenteritis In Salto City, North
Uruguay
Tort, L.F.L., Victoria, M., Garcia, M., Lizasoain, A.,
Arreseigor, E., Lopez, P., Cristina, J., Leite, J.P.G., Colina,
R.
st
1. University of Republic, UDELAR, 1350, Gral. Rivera
2. Centro de Investigaciones Nucleares - UdelaR, UdelaR
3. Salto Public Hospital, MSP
4. Fundacao Oswaldo Cruz, FIOCRUZ, Av. Brasil 4365,
Manguinhos, 21040-360, Rio de Janeiro, Brazil
Group A Rotavirus (RVA), are the major cause of acute
gastroenteritis (AG) in children under five years old
worldwide. RVA are the leading cause of hospitalization
and death due to AG among infants of this age group,
mostly in developing countries. In this study, we analyzed
clinical samples of young children (between 0 and 5 years
old) with AG who were treated in two health institutions
of Salto city, Uruguay: Salto Public Hospital and Salto
Medical Center. 136 clinical samples were collected from
February 2011 to June 2012. 119 of them were fecal
material and 17 were vomit. Viral RNA extraction was
performed by commercial kit according to manufactures
instructions and cDNA was generated using random
hexamer primers. Worldwide standardized specific
Nested Multiplex PCR protocol directed against outer
capsid protein genes VP4 and VP7 were conducted for
RVA genotype determination. VP4 and VP7 consensual
fragment of the positive samples were sequenced and
phylogenetic analysis were carried out in order to
confirm the genotypes. RT-PCR analysis of the samples
showed that 39% were positive for RVA (n=48). Until
now, thirty-eight DNA sequence were obtained from
RVA RT-PCR positive samples (1ST round consensual
fragment of VP7 and/or VP4 genes). The Phylogenetic
analysis revealed the following genotypes distribution:
P[4]G2 (n=9), P[8]G2 (n=4), P[8]G3 (n=1), P[8]G12
(n=1), P[ND*]G2 (n=14), P[4]GND (n=4), P[8]GND (n=5).
These results represent the first studies demonstrating
the circulation of RVA in the North region of Uruguay.
Interestingly, our data revealed a high prevalence of G2
and the first identification of emerging genotype P[8]
G12 in our country. * (ND = Not-determined) Financial
support: PDU, UdelaR.
HV439 - Evaluation Of Dengue Viral Load On
Different Days After Disease Onset
Silva, F.M.F., Castro-Jorge, L.A., Feitosa, A.L.P., Abrão,
E.P., Sobral, M.C.M., Espósito, D.L., Romano-Passos, L.M.,
Fonseca, B.A.L.
1. Health Center of Sumarezinho, CSE Sumarezinho,
2. School of Medicine of Ribeirão Preto, FMRP, USP, Av.
Bandeirantes, 3900 - Monte Alegre - CEP: 14049-900
Dengue virus (DENV) is a significant public health
problem in tropical and subtropical regions of the world.
Dengue pathogenesis is complex and the relationship
between viral and host factors involved in dengue severity
remains unclear. The present study aimed at to evaluate
the magnitude of dengue viral load on samples collected
at different days after onset of symptoms. Samples were
collected from 316 patients attended at Health Centers
of Ribeirao Preto city (Sao Paulo, Brazil) from 2007 to
2011. NS1 viral protein or IgM antibodies and genome
detection were used to confirm dengue infection.
Dengue virus genome was amplified by real time RT-PCR
using the QuantiTect Virus kit (QIAGEN). Analyzing the
viral load according to the day after disease onset, it was
observed a clear difference between days 0 to 4, and after
day 5, coinciding with the initial proposal to divide the
disease course in the acute phase (0 to 4 days after onset
of symptoms) and recovery (after 5 days). Evaluating
the viral load of each individual serotype, it was possible
to observe a clear difference between the two stages of
the disease. DENV-1 and 3 showed the largest difference
between the two phases (p <0.0001). DENV-2 showed
less of a difference, but still significant (p = 0.0220). We
conclude that, independent of the serotype, the viral
load in DENV-infected patients falls quickly after the
141
Human Virology: HV
fifth day of symptoms onset (convalescent phase). Thus,
to investigate the association of viral load with dengue
severity, viral load must always be considered separately
in two stages of the disease. Financial Support: FAPESP,
CNPq.
HV440 - Genetic Diversity Of Noroviruses
Associated With Infantile Gastroenteritis
In Triangulo Mineiro Region, Brazil.
Figueiredo, E.F., Dulgheroff, A.C.B., Silva, G.A.V., Naveca,
F.G., Domingues, A.L.S.
Pça. Manoel Terra, 330, Uberaba, MG, CEP38025-015,
Microbiologia/DMIP/ICBN
2. Instituto Leônidas e Maria Deane - Fiocruz Amazônia, ILMD-FIOCRUZ, Rua Terezina, 476, Manaus AM, CEP: 69057070, Lab. de Biodiversidade em Saúde
Enteric adenoviruses and astroviruses are agents of
diarrheal disease, a common cause of morbidity and
mortality in developing countries. Adenoviruses are
nonenveloped, double-stranded DNA viruses, members
of the family Adenoviridae, genus Mastadenovirus.
They are classified into 6 subgroups (A to F); enteric
adenoviruses are members of subgroup F, serotypes
40 and 41. Astroviruses are nonenveloped viruses with
positive sense single-stranded RNA genome, members
of Astroviridae family, genus Mamastrovirus; human
astroviruses have been classified in eight serotypes (1 to
8). Informations on variability of these agents are scarce
in Brazil, so the aim of this study was to characterize
and analyze the genetic diversity of Adenoviruses and
Astroviruses detected in fecal samples from cases of
infantile gastroenteritis occurred in the Triangulo
Mineiro region, MG, from 2006 to 2010. Twelve samples
positive for astrovirus and thirty three samples positive
for adenovirus were subjected to nucleic acid extraction,
amplification by RT/PCR and sequencing. The viral
sequences were compared to that from reference and
field strains circulating in Brazil and other countries,
obtained from GenBank and submitted to phylogenetic
analysis. Partial sequence from adenovirus hexon
protein gene has been determined and samples were
divided into five different clusters corresponding to
subgroups F, C, B, E and A. Adenoviruses type F were the
most prevalent (60.6%); viruses of types C (21.2%) and
B (12.2%) represent the second and third types most
commonly found in these samples. Astrovirus samples
clustered into three classic groups: seven samples
clustered within the branch corresponding to serotype
1; four samples fell into branch of serotype 2 and one
sample clustered within the branch of serotype 3. These
results provide information on the genetic diversity
of viral agents and aspects associated with infantile
gastroenteritis, contributing to a better monitoring and
control of these infections. Financial support: FUNEPU/
UFTM, FAPEMIG, Plataforma sequenciamento ILMDFiocruz Amazonia.
HV445 - Seroepidemiological Evaluation Of
Hbv, Hcv And Hiv In An Institutionalized
Population Of Goiás, Brazil
Cunha, M.P., Moraes, T.C., Castro, I.A., Souza, T.C.D.,
Souza, M.B.L.D., Cardoso, D.D.P., Fiaccadori, F.S.
IPTSP / Universidade Federal de Goiás, IPTSP / UFG,
Rua 255, esquina com 1° Avenida, 3° Andar, Sala 420, Setor
Leste Universitário
The hepatitis B virus (HBV), hepatitis C virus (HCV) and
human immunodeficiency virus (HIV) are transmitted
mainly by vertical, parenteral and sexual routes, and
infection by these agents remains an important health
problem worldwide. In this context, institutionalized
individuals with mental problems constitute a risk
group for acquisition of HBV, HCV and HIV infection due
to their low awareness of the risks of viral infection,
and also because of their prolonged stay in long-term
facilities. Therefore, the main purpose of this study
was to determine the prevalence of HBV, HCV and HIV
serological markers in an institutionalized population
with psychiatric and neurological disorders, located in
the State of Goiás, Brazil. Blood samples were collected
from 333 participants, and the sera were analyzed for
the presence of serological markers of HBV (HBsAg,
anti-HBsAg, anti-HBc), HCV (anti-HCV) and HIV (antiHIV) infection, by enzyme-linked immunosorbent assay,
using commercial kits. The overall prevalence for HBV
infection was 12.9% (43/333) and for HIV was 0.63%
(2/313), none of the samples was positive for anti-HCV.
Only 4.2% (14/333) of the population had serological
evidence of previous vaccination against hepatitis B
virus. The susceptibility to HBV, characterized by the
absence of all serological markers, was observed in
82% of the population. Only one sample positive for
anti-HIV was also positive for anti-HBc and anti-HBe.
The results from this study reveal the presence of HBV
and HIV serological markers in the population studied,
demonstrating the importance of the development of
strategies for prevention and care for these infections in
long-term facilities.
HV447 - Neutralizing Antibodies For
Mayaro Virus In Horses From The Pantanal
Wetlands, Brazil
Pauvolid-Corrêa, A., Juliano, R., Velez, J., Schatzmayr, H.,
Nogueira, R.M.R., Komar, N.
1. Empresa Brasileira de Pesquisa Agropecuária
142
Human Virology: HV
Pantanal, Embrapa Pantanal, Rua 21 de Setembro 1880,
Corumbá, MS 79329-900, Brasil
2. Fundação Oswaldo Cruz, Fiocruz, Av. Brasil 4365,
Rio de Janeiro, RJ 21045-900, Brasil
3. Centers for Disease Control and Prevention, CDC,
3150 Rampart Road Ft. Collins, CO 80521, United States
HV453 - Detection Of Respiratory Virus
And S. Pneumoniae In Pediatric Patients
Attended In A Terciary Hospital Of
Fortaleza- Ceará Post Pneumococcal
Conjugate Vaccine (10-Valent)
Silva, F.E.R., Oliveira, N.S., Ocadaque, C.J., Alves, A.A.,
Moura, F.E.A.
The Brazilian Pantanal hosts large concentrations of
diverse wildlife species, including migratory birds, and
therefore this region is potentially important for arbovirus
studies in South America. Neutralizing antibodies for
equine encephalitis viruses have been reported in
Pantanal equines. To better understand the alphavirus
circulation in the region, a serosurvey for Mayaro virus
(MAYV) was conducted with 760 equines from 15 beef
cattle ranches of the Brazilian Pantanal. The sera were
titrated by 90% plaque-reduction neutralization test
(PRNT90) for MAYV and the positive samples then
tested for three other alphaviruses previously reported
in Brazil, including Eastern equine encephalitis virus
(EEEV), Western equine encephalitis virus (WEEV)
and Venezuelan equine encephalitis virus. Serum was
considered seropositive when it reduced at least 90%
of the formation of plaques of MAYV and its neutralizing
antibody titre was four-fold greater than what was
observed for the other tested alphaviruses. From a total
of 760 equines, of which 277 were immunized with
bivalent vaccine composed of EEEV and WEEV and 483
were unvaccinated, 45 (5.9%) had neutralizing reactivity
(PRNT90 titre ≥ 1:10) for MAYV regardless of vaccine
status. Employing the criterion of four-fold greater titre
among all alphaviruses tested, four (0.5%) horses from
three different ranches and with no history of equine
encephalitis viruses vaccination were seropositive for
MAYV. Three out of four MAYV-seropositive horses had
monotypic neutralization reactions, with PRNT90 titre
1:40 for MAYV and < 1:10 for all other alphaviruses
tested. While a serosurvey of non-human primates and/
or local human residents would be more instructive
for MAYV studies, due to the conservative criteria used
for interpreting serologic results, we consider that the
detection of monotypic neutralization reactions to MAYV
in Pantanal horses, which lacked travel history outside
the region, is evidence of MAYV circulation in the region.
Because cross-reactivity among arboviruses may occur,
we encourage more encompassing serosurveys using
other Brazilian alphaviruses, including Pixuna and
Mucambo viruses, as well as efforts to isolate virus to
definitively confirm the circulation of MAYV in the region,
and consequently, identify vectors and vertebrate hosts
that are involved in the its local maintenance cycle and
transmission. Financial support: CNPq, CAPES, Fulbright
Universiade Federal do Ceará, UFC, R. Cel Nunes de
Melo, 1315 Cep 60430-270 Rodolfo Teófilo Fortaleza - Ceará
Pneumonia is responsible for high rates of mortality
in infants and toddlers in developing countries with
nearly 1,4 million deaths annually. Pneumococcal
pneumonia is responsible for many of these deaths. The
pneumococcal conjugate vaccine (10-valent) is included
in the childhood immunization schedule of the Health
Ministery since March of 2010. The present study has as
objectives: (1) Identify the respiratory virus and the S.
pneumoniae serotypes in the nasopharyngeal aspirates
of patients attended for pneumonia in the Hospital
Infantil Albert Sabin from January of 2011 to May of 2013
(2) Compare the S. pneumoniae circulating serotypes in
the study population with the ones within the vaccine.
Methodology: The viruses were detected through
indirect immunofluorescence and the S. pneumoniae
were isolated in sheep blood agar with gentamicin for
posterior serotyping through multiplex PCR. During
this period 674 samples were collected in which were
identified 172 S. pneumoniae (25.52%), at least one
virus in 189 samples (28.04%) and co-infection of S.
pneumoniae and virus in 41 samples (6.08%). The most
detected virus were the Respiratory Sincicial Virus (126
samples – 18.69%), followed by Influenza A (39 samples
– 5.79%) and Adenovirus (28 samples – 4.15%). Among
the 39 serotypes of S. pneumoniae researched, the most
found were 6A/B, 14, 19 A and 19F with 22%, 6.9%,
6.3% and 4.4%, respectively. Between the four main
serotypes of S. pneumoniae found, three (6B, 14 and
19F) are present in the pneumococcal conjugate vaccine
(10-valent) composed by the serotypes 1, 4, 5, 6B, 7F, 9V,
14, 18C, 19F and 23F. Financial support: CNPq e FUNCAP
– PPSUS 2009
HV454 - Comparative Study Of Nosocomial
Infections Viral Detection In Young
Children In Fortaleza- Ceará, Brazil.
Oliveira, S.B., Ocadaque, C.J., Alves, A.A., ‘, Thomazelli,
L.M., Durigon, E.L., Moura, F.E.A.
1. Universidade Federal do Ceará, UFC, R. Cel Nunes
de Melo,1315. Cep:60430-270 Rodolfo Teófilo - Fortaleza -CE
2. Universidade de São Paulo, USP, Av. Prof. Lineu
Prestes, 1374, Cidade Universitária-São Paulo-SP. Cep:
05508-900
143
Human Virology: HV
Laboratory tests are extremely important in the
correct etiology identification of the viral nosocomial
respiratory infections. There is great diversity of
diagnosis methods that include molecular and immune
techniques available. The objective of this study was
to perform the comparison between the results of the
indirect immunofluorescence assay (IFA) and qRT-PCR
in the investigation of respiratory viruses in samples of
nasopharyngeal aspirates of patients with nosocomial
respiratory infection attended in wards of the Hospital
Infantil Albert Sabin in the year of 2013. Methodology:
samples were analyzed by IFA and qRT-PCR for research
of respiratory syncytial virus (HRSV), adenovirus
(HAdV), influenza A and B (FluA and FluB). Out of 60
analysed samples, IFA identified 34/60 positive samples
(56,66%) for at least one virus which 17 were for HRSV,
2 for Ad, 13 for FluA, none for FluB and 3 coinfections:
FluA+ HAdV, FluA+FluB, FluA + HRSV. The qRT-PCR
assay detected 52/60 positive samples for at least one
virus (86,66%); 23 HRSV, 4 HAdV, 8 FluA, none FluB and
17 co-infections which were represented by HRSV+FluA
(6/17), HRSV+ HAdV (5/17), HRSV+FluA+ HAdV (4/17)
and HAdV +FluA (2/17). Overall, the rate of detection
of viruses increased 30% with use of qPCR. There are
few published studies on viral respiratory nosocomial
infections in Brazil, therefore the choice of good method
is crucial for the identification of the viruses involved.
Financial support: USP, UFC.
HV457 - Epidemiological And Clinical
Profile Of Viral Nosocomial Respiratory
Infections In A Children’s Terciary
Hospital In Fortaleza –Ce, Brazil.
Oliveira, S.B., Ocadaque, C.J., Alves, A.A., Florêncio,
C.M.G.D., Moura, F.E.A.
Universidade Federal do Ceará, UFC, R. Cel Nunes de
Melo,1315. Cep:60430-270 Rodolfo Teófilo - Fortaleza -Ce
Nosocomial respiratory infections (NRI) constitute a
serious public health problem. The main objective of
this study was to identify the respiratory viruses in the
nasopharyngeal aspirates of children hospitalized that
presented NRI in the wards of a children’s hospital in
Fortaleza, from January to May of 2013. Metodology:
Indirect immunofluorescence assay was carried out to
detect Respiratory Sincytyal virus (HRSV), Adenovirus
(HAdV), Influenza (FluA e FluB) and Parainfluenza
(PIV1,2,3) antigens. Results: 77 samples were collected
and 46 (59.74%) of them were positive for at least
one virus. HRSV (20/46) and the FluA (13/46) were
predominant over the other researched viruses. There
were seven cases of co-infection: HAdV + PIV3 (2
cases), HRSV+PIV3 (2 cases); FluA+FluB, HAdV +FluA,
RSV+FluA (one case each). The study population was
predominantly represented by males (66.24%) and
child in the first year of life (42.85%). The most frequent
admission diagnostic in NRI cases were pneumonia
(40%), neurologic disease (13.33%), osteomyelitis
(8.33%) and surgery (8,33%). The main symptoms
observed in the patients with NRI were coughing
(94.80%), coryza (68.83%), fever (66.23%), nasal
obstruction (51.94%), dyspneia (50.64%) and sneezing
(48.05%). The presence of several associated symptoms
was frequent. Out of the total, 71.67% of the NRI were
diagnosed as upper respiratory tract infections of which
40% of the patients manifested symptoms during the
first week of hospitalization. The study contributes to
the understanding of the role of viruses in the etiology of
the NRI in a country where the importance of this theme
is underestimated. Financial support: UFC.
HV458 - Detection Of Human Rhinovirus
And Coronavirus In The Infant Pneumonia
In An Equatorial City Of Brazil
Florêncio, C.M.G.D., Oliveira, F.M.S., Silva, F.E.R.,
Durigon, E.L., Thomazelli, L.M., Moura, F.E.A.
1. Universidade Federal do Ceará, UFC, R. Cel Nunes
de Melo, 1315 Cep 60430-270 Rodolfo Teófilo Fortaleza Ceará
2. Universidade de São Paulo, USP, Av. Prof Lineu
Prestes,1374,sl 225,Cid. Universitária São Paulo SP Cep
05508-900
Pneumonia is important cause of morbidity and
mortality in young children, mainly in developing
countries. The respiratory viruses are noteworthy as
etiologic agents of this disease. The human rhinovirus
(HRV) and coronavirus (HCoV) are associated generally
to common colds, but its role in the etiology of
pneumonia has been reported in some recent studies.
Nasopharyngeal aspirate were collected from children
with pneumonia attended in the emergency rooms
and pediatric ward of Hospital Infantil Albert Sabin in
Fortaleza,Ceará (Northeast Brazil), from January 2011 to
October 2012. The samples were submitted to indirect
immunofluorescence assays to detect seven respiratory
viruses (respiratory syncytial virus, influenza A and B,
adenovirus and parainfluenza 1, 2 and 3). The negative
samples for this test were selected and submitted at the
real time- PCR (qPCR) for HRV and for all four serotypes
of HCoV (OC43, NL63, 229E e HKU1). A total of 425
samples were analyzed for qPCR resulting in 142 positive
samples for HRV (33,4%) and 84 positive samples for
HCoV (19,7%). Twenty cases of co-infection HRV-HCOV
were observed in the samples analyzed. These findings
emphasize the importance of the HRV and HCoV in the
etiology of childhood pneumonia as single agent or in
144
Human Virology: HV
co-infection. Financial support: CNPq e FUNCAP-PPSUS
2009
HV467 - Preliminary Analysis Of Panbio
Dengue Elisa Kit In The Detection Of Ns1
Antigen In Association With Igm Elisa
Costa, V.G., Policarpo, O.F., Novaes, D.P.S., Moreli, M.L.
1. Laboratório de Virologia, Universidade Federal de
Goiás, UFG, Rodovia BR 364, km 192, Parque Industrial,
3.800, Jataí-GO
2. Laboratorio Elzevir Ferreira Lima, , Rua Joaquim
Caetano esq/Rua Caçu, Setor Divino Espirito Santo, Jatai -GO
Dengue is a re-emergent disease, and it is one of the
major public health concerns in the world. The estimate
is that annually 230 million cases take place, resulting in
21.000 deaths per year. Dengue virus (DENV), flavivirus
genus, is an increasing endemy in Brazil; therefore, it
triggers major national public health campaign that
focuses on the control of its main transmitter, known
as Aedes aegypti mosquito. This vector is today found
all over the country. DENV is able to affect anyone and
does not have a specific treatment or available vaccine
for control purposes. Here, study aimed to report on
the performance of commercial dengue NS1 detection
test in samples collected belatedly and in combination
with a dengue IgM ELISA. The study site was in Jataí
county, state of Goias, which recently reported a
dengue epidemic. The samples were available from the
serum bank of the medical center municipal health by
permission of responsible. Subsequently, the samples
suspected dengue, and collected from the sixth day of
symptom onset were processed by ELISA Dengue NS1
and IgM ELISA in the laboratory of Virology, Federal
University of Goiás. So far were processed by ELISA 94
samples, of which 55% were men and 45% women.
Participants’ age ranged 01-85 years and sample
collection occurred in the years 2011 and 2012. 13
samples were positive for dengue IgM by ELISA and
only two these were positive by ELISA test, which
detects NS1 antigen. The most common symptom were
fever, headache and myalgia and laboratory aspects
were leukocytosis and thrombocytopenia mild. The
sensitivity (15%) of ELISA dengue NS1 declined rapidly
as the samples were collected more later, probably this
is due to drop in viremia and an increase in antibody
titer. Our results showed that NS1 ELISA technique is
not advisable to use it from the sixth day of symptoms,
and should be employed IgM ELISA. In conclusion, the
availability of these two methods are a powerful tool in
the diagnosis of DENV.
HV468 - An In-House Real Time Rt-Pcr
Protocol
Is
More
Sensitive
Than
Conventional Rt-Pcr For Dengue Virus
Detection In Distinct Periods Of Dengue
Infections.
Abrão, E.P., Silva, F.M.F., Castro-Jorge, L.A., Feitosa, A.L.P.,
Sobral, M.C.M., Espósito, D.L., Fonseca, B.A.L.
1. Fac Med Rib Preto - Universidade de São Paulo ,
FMRP - USP, Av. Bandeirantes 3900, 14049-900, Centro de
Pesquisa em Virologia
2. Health Center of Sumarezinho, Ribeirão Preto, SP,
Brazil
Background: Dengue is the most important arthropodborne disease in the tropical and subtropical areas
worldwide. Dengue results from any of the dengue
virus (DENV) infection and is characterized by a
broad spectrum of clinical manifestations, ranging
from asymptomatic infection to severe dengue. Aim:
The present study aimed to compare two molecular
techniques (conventional RT-PCR and real time RTPCR) for the detection of DENV in samples collected
from patients in different periods of disease onset.
Methodology: Samples were collected from 273 patients
attended at the Health Centers of Ribeirao Preto city (Sao
Paulo, Brazil) with a probable diagnosis of dengue. Blood
samples were forwarded to the Laboratory of Molecular
Virology for dengue diagnosis up to 8 days from the
beginning of the disease. DENV genomes were amplified
by a conventional RT-PCR (Lanciotti et al., 1992) and
by an in-house real-time RT-PCR using the QuantiTect
Virus kit (Qiagen) and detected according each method.
Results: The real-time RT-PCR assay was able to detect
up to an equivalent of 10 RNA copies for all the tested
serotypes. Particularly in DENV-1 and DENV-3 samples
it was possible to detect as few as 4 RNA copies. Due to
this high sensitivity, some samples considered negative
from the conventional RT-PCR assays turned-out to be
positive in the real-time RT-PCR analyses. Conclusions:
We conclude that the real-time RT-PCR technique is of
much higher sensitivity and may be of high relevance for
dengue diagnosis. Financial Support: FAPESP, CNPq.
HV471 - Mutations Associated To Antiviral
Drug Resistance In The Ns3 And Ns5b
Genomic Regions Of Hcv In TreatmentNaïve Patients From Southern Brazil
Vidal, L.E.L., Germano, F.N., Basso, R., Oliveira, N.,
Silveira, J., Martínez, A.M.B., Soares, M.A., Santos, A.F.
1. Universidade Federal do Rio de Janeiro, UFRJ, Rua
Professor Rodolpho Paulo Rocco, s/nº. Ilha do Fundão
2. Universidade Federal do Rio Grande, FURG, Rua
Gen. Osório, s/nº - Centro - Rio Grande
3. Instituto Nacional do Câncer, INCa, Rua André
Cavalcante 37, Lapa, Rio de Janeiro
145
Human Virology: HV
The combination of pegylated-interferon and ribavirin
has been used in the treatment of hepatitis C virus (HCV)
infection. However, most patients infected with genotype
1 do not achieve sustained virological response (SVR). In
view of these limitations, intense investigation on drugs
targeting viral enzymes resulted in the development
of over 40 new compounds: the direct acting antivirals
(DAA). To characterize baseline resistance-associated
polymorphisms for DAA, we obtained plasma samples
from 159 HCV treatment-naïve patients from Rio Grande/
Brazil. Viral RNA was extracted and NS3 and NS5b
regions were PCR-amplified, sequenced and aligned.
Mutation analysis was carried out through inferred
amino acid translation and phylogeny was performed
using Neighbor-joining. Prevalence of subtype 1a was
41% (65/159) and 1b was 18% (29/159). Prevalence of
subtypes 2b and 3a were 7% (3/159) and 27% (43/159),
respectively. We found three resistance-associated
polymorphisms in NS3, two of these related to approved
drugs, and eight polymorphisms in NS5b. Two resistant
amino acid genetic signatures were characterized in
NS3: 175L (1a) and 176G (1b). In NS5b, two resistance
signatures (71V and 499A) were only detected in
subtype 1a. There were no genetic barrier differences
towards resistance between genotypes 1 and 3 in NS3,
except for codon 175, which is a signature of subtype
1b. In NS5b, we characterized 13 polymorphisms in
genotypes 1 and 3, which could predict higher or lower
barrier to resistance acquisition in these genotypes. We
further obtained active wild-type and double mutant
(T54A e V170I) NS3 protease expression, which will
be used in phenotypic assays with NS3 newly approved
inhibitors. Our data suggest that the mutations and
natural polymorphisms associated to resistance found
could harm future treatment of patients with DAA,
and this demonstrates the necessity to carry out HCV
subtyping.
HV473 - Molecular Characterization Of
Adenoviruses And Astroviruses Associated
To Infantile Gastroenteritis In Triangulo
Mineiro Region, Brazil.
Bueno, L.M.T., Dulgheroff, A.C.B., Figueiredo, E.F., Silva,
G.A.V., Naveca, F.G., Domingues, A.L.S.
Praça Manoel Terra, 330 CEP:38025-015 , Uberaba, MG Microbiologia/DMIP / ICBN
2. Instituto Leônidas e Maria Deane / Fiocruz Amazônia, ILMD, R. Terezina, 476, Manaus/AM. CEP:
69.057-070 - Lab. de Biodiversidade em Saúde
Enteric adenoviruses and astroviruses are agents of
diarrheal disease, a common cause of morbidity and
mortality in developing countries. Adenoviruses are
nonenveloped, DNA viruses, members of the family
Adenoviridae, genus Mastadenovirus. They are classified
into 6 subgroups (A to F); enteric adenoviruses are
members of subgroup F, serotypes 40 and 41. Astroviruses
are nonenveloped viruses with RNA genome, members
of Astroviridae family, genus Mamastrovirus; human
astroviruses have been classified in eight serotypes (1 to
8). Informations on variability of these agents are scarce
in Brazil, so the aim of this study was to characterize
and analyze the genetic diversity of Adenoviruses and
Astroviruses detected in fecal samples from cases of
infantile gastroenteritis occurred in the Triangulo
Mineiro region, MG, from 2006 to 2010. Twelve samples
positive for astrovirus and thirty three samples positive
for adenovirus were subjected to nucleic acid extraction,
amplification by RT/PCR and sequencing. The viral
sequences were compared to that from reference and
field strains circulating in Brazil and other countries,
obtained from GenBank and submitted to phylogenetic
analysis. Partial sequence from adenovirus hexon
protein gene has been determined and samples were
divided into five different clusters corresponding to
subgroups F, C, B, E and A. Adenoviruses type F were the
most prevalent (60.6%); viruses of types C (21.2%) and
B (12.2%) represent the second and third types most
commonly found in these samples. Astrovirus samples
clustered into three classic groups: seven samples
clustered within the branch corresponding to serotype
1; four samples fell into branch of serotype 2 and one
sample clustered within the branch of serotype 3. These
results provide information on the genetic diversity
of viral agents and aspects associated with infantile
gastroenteritis, contributing to a better monitoring and
control of these infections. Financial support: FUNEPU/
UFTM, FAPEMIG, Plataforma sequenciamento ILMDFiocruz Amazônia.
HV480
Prevalence
And
Genetic
Characterization
Of
Human
T-Cell
Lymphotropic
Virus
Type
1
Among
Oncohematologic Patients In Central
Brazil
Kozlowski, A.G., Carneiro, M.A.S., Matos, M.A.D.,
Marinho, T.A., Pessoni, G.C., Silva, A.M.C., Oliveira, M.P.,
Andrade, A.A., Araújo, L.A., Martins, R.M.B.
UFG,GOIÂNIA, IPTSP/UFG, Rua 235 - s/n - Setor
Universitário - CEP: 74605050 - Goiânia - Goiás
2. Faculdade de Enfermagem, UFG, GOIÂNIA, FEN/
UFG, Rua 227 Qd 68, S/N - Setor Leste Universitário - Goiânia
- Goiás
Human T-cell lymphotropic virus type 1 (HTLV-1) is
the etiological agent of major diseases such as adult
146
Human Virology: HV
T-cell leukemia/lymphoma (ATL), HTLV-1-associated
myelopathy/tropical spastic paraparesis (HAM/TSP),
and other inflammatory diseases. Based on analyses of
the HTLV-1 long terminal repeat (LTR) region, 7 genetic
subtypes have been defined (a-g). The 1a or Cosmopolitan
subtype is the most widespread. There is currently very
little data on HTLV-1 prevalence among oncohematologic
patients. In Brazil, a high prevalence was reported among
these patients in Rio de Janeiro (9.01%). The aims of this
study were to estimate the prevalence of HTLV-1 among
patients with oncohematologic diseases in Central Brazil
and to carry out genetic characterization of respective
isolates. A total of 345 patients attended at Hospital
Araújo Jorge/ACCG, from June 2011 to February 2012,
and at the Hospital das Clínicas/UFG, from June to August
2012 in Goiânia City, were studied. Blood samples were
collected from all individuals and screened by ELISA for
the presence of antibodies to HTLV-1/2. Positive samples
were also tested by polymerase chain reactions (PCR),
followed by sequencing and phylogenetic analysis. Of
345 patients, 6 were found to be anti-HTLV-1/2 positive
and 3 (0.87%; 95% CI: 0.22-2.73) were confirmed as
being infected by HTLV-1. Sequencing and phylogenetic
analysis of the HTLV-1 LTR region demonstrated that
these isolates belonged to the Transcontinental (A)
subgroup of the Cosmopolitan (a) subtype. Although the
HTLV-1 infection was more frequent in this population
than in the local blood donors, it was lower than that
reported in oncohematologic patients in Rio de Janeiro,
Brazil. Financial Support: FAPEG
HV483 - Detection Of Dengue Virus In Larvae
Of Aedes Aegypti In Belo Horizonte, Minas
Gerais In 2012-2013
Figueiredo, L.B., Rosa, J.C.C., Martins, C.P.S., Miranda,
D.P.J., Brito, C.B., Rocha, E.S.O., Pessanha, J.E.M., Kroon,
E.G.
Antônio Carlos, 6627 - Pampulha Caixa Postal 486 31270901 - Belo Horizonte
Dengue is the most important arboviruses disease in
humans in tropical areas of the world. Dengue virus
(DENV) belongs to the Flavivirus genus in the Flaviviridae
family and it consists of four serotypes, DENV-1, DENV2, DENV- 3 and DENV-4. The virus is the causative agent
of dengue fever and dengue hemorrhagic fever. DENV
is transmitted to humans mainly by Aedes aegypti
mosquitoes but also by Aedes albopictus. The mosquitoes
acquire the infection through blood-feeding on infected
individuals or by transovarial transmission. The first
dengue epidemic in Belo Horizonte, Brazil was reported
in 1996, where DENV-1 were detected and associated
with dengue cases. However, a major epidemic in Belo
Horizonte was reported in 1998 with predominance
of DENV-2 and co-circulation with DENV-1. The Health
Department from Minas Gerais State reported in the
first months of 2013 more than 29.161 cases of dengue
in Belo Horizonte. The current dengue epidemiological
situation in Minas State is characterized by the cocirculation of the four serotypes and it is considered
an area of high endemicity. In order to determine the
circulation of DENV in Belo Horizonte, we have analyzed
random samples of A. aegypti and A. albopictus larvae
collected from November 2012 to February 2013 in
nine districts in the city. The total of 4.393 larvae A.
aegypti and 91 larvae A. albopictus were splitted up
into 242 pools formed of up to 30 larvae each. The pools
were macerated in 500 µl Leibowitz L15 medium and
centrifuged. The RNA of each pool was extracted using
RNA Qiamp Kit (QIAGEN, USA), a RT-PCR was performed
to detect viral RNA using primers described by Lanciotti
et al. (1992). The total infection rate reached 3.7% of the
analyzed pools with prevalence of 56% DENV-1, 22%
DENV-2 and 22% DENV-3 in A. aegypti. Although the
DENV transovarial transmission rate is low the larvae
infection is important for circulation and maintenance
of DENV in nature.
HV484 - Genetic Variability Of Hepatitis
B Virus And Hepatitis C Virus In
Brazilian Patients With And Without
Hepatocellular Carcinoma
Araujo, O.C., Barros, J.J.F., Do Ó, K.M.R., Nabuco, L.C.,
Moraes, M.T.B., Niel, C., Villela-Nogueira, C.A., Araujo,
N.M.
1. Departamento de Hepatologia, HUCFF, UFRJ,
RJ, Brasil., HUCFF-UFRJ, Rua Rodolpho Paulo Rocco, 255.
Cidade Universitária, Ilha do Fundão, RJ, Brasil
2. Laboratório de Virologia Molecular, IOC-FIOCRUZ,
RJ, Brasil., IOC-FIOCRUZ, Av. Brasil, 4365. Manguinhos, Rio
de Janeiro, RJ, Brasil
Hepatocellular carcinoma (HCC) is one of the commonest
cancers worldwide. The major risk factors for developing
HCC are chronic hepatitis B virus (HBV) and hepatitis
C virus (HCV) infections. Several mutations in these
viruses have been associated to hepatocarcinogenesis. In
this study, we investigated and compared the prevalence
of HBV and HCV genotypes and mutations in patients
with and without HCC and their association with clinical
outcome. A cohort of 51 HBV chronic patients (12 HCC
and 39 non-HCC) and 106 HCV chronic patients (40
HCC and 66 non-HCC) were enrolled in the study. HBV
core promoter (CP) and pre-S/S regions, as well as, HCV
core region, were analyzed by PCR-direct sequencing
method. HBV subgenotypes A1 (61.1%), A2 (16.7%),
D1 (2.8%), D6 (5.5%), D7 (2.8%), F2 (5.5%), F4 (2.8%)
147
Human Virology: HV
and a coinfection F4/G (2.8%) were found in non-HCC,
whereas A1 (90.0%) and A2 (10.0%) were detected in
HCC-patients. CP mutations C1653T, T1753V, A1762T
and G1764A and pre-S/S deletion were more prevalent
in HCC-patients than in non-HCC (20.0%, 33.3%, 66.7%,
50.0% and 12.5% versus 17.6%, 22.2%, 37.0%, 40.7%
and 11.8%, respectively). In addition, mean ALT and AST
levels were higher in patients carrying C1653T, T1753V,
A1762T, G1764A, pre-S/S deletion or subgenotype
A1. However, only T1753V mutation was significantly
associated with elevated transaminases (p<0,05). HCV
subtypes 1a, 1b and 3a were found in both HCC and
non-HCC patients, with the following prevalences:
42.5%, 35.0% and 22.5%, and 43.9%, 40.9% and 15.2%,
respectively. Prevalence of core mutation at amino acid
position 70 in HCV subtype 1b was significantly higher
in patients with liver cirrhosis and HCC than in patients
without advanced liver disease (p<0,05). Genotypes
and specific mutations in HBV and HCV may be useful
biomarkers of disease progression and early HCC
detection. Financial support: CAPES, FAPERJ, FIOCRUZ.
HV486 - Characterization And Phylogenetic
Analysis Of Hepatitis B Virus In Nonhuman
Primates Samples From Rondônia State.
Cunha-Pereira, A.V., Vieira, D.S., Botelho, L.F., Zanchi,
F.B., Araujo, M.S., Messias, M.R., Santos, A.O., Ozaki, L.S.,
Pereira, L.H.S., Salcedo, J.M.V.
1. Fundação Oswaldo Cruz Rondônia, FIOCRUZ RO,
Rua da Beira, 7671 Bairro - Lagoa
2. Instituto de Pesquisa em Patologias Tropicais de RO,
IPEPATRO, Rua da Beira, 7671 Bairro - Lagoa
3. Fundação Universidade Federal de Rondônia , UNIR,
4. Virginia Commonwealth University
The hepatitis B virus belongs to Hepadnaviridae family
that includes virus that infects birds and mammals,
among these, some nonhuman primates such as
Chimpanzees (Pan troglodytes), woolly monkeys
(Lagothrix lagothricha), orangutans (Pongo pygmaeus),
gorillas (Gorilla gorilla) and gibbon species different.
These virus are phylogenetically distinct of other HBV
variants, and it was suggested that there is one specific
genotype for each primate specie. The virus transmission
to primates as from humans has been reported, however,
transmission from nonhuman primates to human
remains to be clarified, once there are still no published
data that confirms this hypothesis. Our study aims the
identification and characterization the hepatitis B virus
in nonhuman primates samples from Rondonia state.
It was analyzed 21 samples of nonhuman primates.
We obtained the viral DNA using the lysis by guanidine
isotiacianate method (adapted). For conventional PCR
it was use 20uL of DNA using primers that amplifies
1.5 and 1.7kb fragments. For nested PCR it was used
2uL of amplicons using primers that amplifies a 741pb
fragment correspondent to RT/S region from viral
genome and posteriorly the fragments were sequenced.
The sequences’ clustering was realized using the online
software ClustalW (PBIL) and the phylogenetic trees
was obtained using GeneBee ClustalW 1.83 version.
Of these 21 samples analyzed in this study, 12 were
positive and 09 were negative. Of these positive samples,
we obtained the sequence of RT and S regions from 3
samples and we observed 81 to 91% similarity with HBV
variants from primates and 83 to 95% similarity with
variants isolated from human. The most similarity (93 to
95%) was observed among the samples and A2 human
genotype. That virus isolated by our were from New
World primate, different of others already been isolated
previously (Old World Primates). Phylogenetic analysis
we can observe that the virus isolated by our are similar
to the A2 genotype from human HBV
HV488 - High Rate Of Dengue Virus Detection
In Aedes Aegypti And Aedes Albopictus
Larvae During The Peak Of Outbreak In
March/2013 In Belo Horizonte.
Rosa, J.C.C., Figueiredo, L.B., Martins, C.P.S., Marins, K.S.,
Brito, C.B., Miranda, D.P.J., Pessanha, J.E.M., Bonjardim,
C.A., Ferreira, P.C.P., Kroon, E.G.
Antônio Carlos, 6627 - Pampulha Caixa Postal 486 31270901 - Belo Horizonte
Dengue virus (DENV) is an emerging mosquito-borne
flavivirus which causes dengue fever and dengue
hemorrhagic fever. The DENV complex consists of 4
serotypes named DENV1 - DENV4. DENV is transmitted
to humans mainly by Aedes aegypti mosquitoes,
which acquire the infection through blood feeding on
infected individuals or by transovarial transmission.
In the beginning of 2013, several outbreaks have been
documented in many regions of Brazil with the cocirculation of four serotypes (DENV-1, DENV-2, DENV3 and DENV-4). The Health Department from Minas
Gerais State reported in the first months of 2013 more
than 29.161 cases of dengue in Belo Horizonte. In the
present study, we present the data of DENV surveillance
in Aedes sp larvae collected during March of 2013 from
nine districts in the Belo Horizonte city. A total of 493
larvae were collected and divided in 32 and 7 pools
of A. aegypti and A. albopictus respectively totalizing
39 pools with up to 30 larvae in each. The samples
were macerated in 500 µl Leibowitz L15 medium and
centrifuged. The RNA was extracted using RNA isolation
the Qiamp Viral RNA Kit (QIAGEN, USA) and used to
obtain the corresponding cDNA strand. A real-time PCR
148
Human Virology: HV
using two pairs of consensus primers to 5′ untranslated
region (UTR) was performed in order to detect DENV in
the samples. The real time PCR data showed high rate of
DENV detection in A. aegypti and A. albopictus larvae.
DENV-1/DENV-3 and DENV-2/DENV-4 were detected
in 26 and 14 pools of A. aegypti (67%) respectively. We
have also detected DENV-1/DENV-3 in four from the
seven pools of A. albopictus analyzed. Although in minor
sampling, the DENV detection in A. albopictus larvae
suggests that this mosquito may have participated as a
vector of DENV during outbreaks in Belo Horizonte. In
addition, it is important to improve surveillance and
control systems of the A. albopictus, a competent virus
reservoir.
were: parainfluenza 1, parainfluenza 2, parainfluenza
3, influenza A, adenovirus, and respiratory syncytial
virus. Two samples showed triple infection, 3 samples
showed dual infection, and all the others involved
monoinfection. Discussion and Conclusion: The amount
of viral agents causing IRAs detected in this study is
43.3%, which is consistent with the data from other
studies. The most prevalent viruses were parainfluenza
1 and 2, together with the adenoviruses, followed by
the respiratory syncytial virus, the latter being the most
common cause of respiratory tract infections. With this
preliminary data, this study enables an estimation of the
frequency of viral agents responsible for IRAs in children
of the city of Porto Velho, contributing to the etiologic
characterization of these pathogens.
1. Fundação Oswaldo Cruz Rondônia, FIOCRUZ RO,
Rua da Beira, 7671 Bairro - Lagoa
2. Instituto de Pesquisa em Patologias Tropicais de RO,
IPEPATRO, Rua da Beira, 7671 Bairro - Lagoa
3. universidade Federal de Rondônia, UNIR,
4. Centro de Pesquisa em Medicina TRopical de RO,
CEPEM RO, Rua da Beira, 7671 Bairro - Lagoa
Centro de Virologia - Instituto Adolfo Lutz, NDTV CV - IAL, Av. Dr. Arnaldo, 355 - Cerqueira Cesar CEP 01246000 São Paulo - SP. Brasil
HV489 - Etiologic Identification Of Acute
Viral Respiratory Infections Among
Children In Porto Velho-Rondônia
Vieira, D.S., Santos, J.V., Ludervanhe, F.R., CunhaPereira, A.V., Botelho, L.F., Santos, A.O., Silva Lima, N.C.,
Benevides Matos, N., Salcedo, J.M.V.
Introduction: Acute respiratory infections (IRAs)
are considered public health problems, especially in
developing countries, causing great morbidity and
mortality in the pediatric population between 0 and
6 years. Although IRAs can be caused by various
etiological agents, viruses are the main source of these
infections. According to studies conducted in Brazil,
there are few reports on the prevalence of these diseases,
particularly in the northern region, where the state
of Rondônia is located. On the basis of these data, the
aim of this study was to characterize the viral etiologic
agents responsible for these infections. Methodology:
The study was conducted at the Cosme and Damião
Children’s Hospital in Porto Velho-RO, a reference in
pediatric care in this state. This study included children
of both genders, aged between 0 and 6 years, presenting
clinical symptoms of IRAs. Approximately 1 to 2 ml of
nasopharyngeal secretion was collected. Diagnosis
by indirect immunofluorescence was used for initial
screening. All samples were subjected to molecular
tests for identification and characterization of the main
viruses responsible for IRAs. Results: Thirty samples
were processed by indirect immunofluorescence; 14
were positive, of which 5 were from male and 9 from
female children. The viruses detected in these samples
HV500 - Evaluating A Commercial Kit Of
Dengue Virus Igm Capture Test
Silveira, V.R., Souza, R.P., Suzuki, A., Barbosa, V.M.,
Montoro, M.G., Oliveira, A.L.R., Curti, C.P., Cunha, M.S.,
Rocco, I.M., Bisordi, I.
Dengue virus infection is still a serious Public Health
Problem in most of the Tropics and the demand for fast
and precise diagnostic tools is rising as new cases are
continually being detected. The present work evaluates
the serological test for Dengue infections applying
an ELISA IgM Capture Dx Select Test, lot n° X 122248,
produced by Focus Diagnostics. The test was compared
to an in house ELISA – IgM test commonly used in the
diagnostic routine of Public Health laboratories. A total
of 180 sera samples were analyzed by both techniques
and sensitivity, positive and negative predictive values
and Kappa concordance were calculated. The dispersion
of the results was also studied and the regression
curve of this distribution was calculated and analyzed.
The results showed high sensitivity (98.0%), negative
predictive values of 100% and a positive predictive
value of 73.4%, indicating a good performance of this
kit. The Kappa Index of 0.901 using 90 samples tested
simultaneously in both tests points to a high degree
of repeatability, thus indicating the methodology as a
robust diagnostic test. The scatter diagram showed the
correlation of absorbance data obtained for 90 samples
tested against both methodologies. A positive correlation
with the absorbance values was revealed, demonstrating
that the values obtained between the tested kits present
a variation in the level of dispersion in the ratio of 1.104,
which is equivalent to a variation in the order of 10.4% in
the readings obtained from comparing one test with the
other. The regression calculated an R² of 0.8168 showing
149
Human Virology: HV
that 81.68% of the results are consistent and statistically
valid. The analyzed data suggest that the test presents
a good sensitivity and an adequate repeatability. Based
on these findings, it is possible to suggest that the ELISA
IgM Capture Dx Select Test may be an appropriate tool
for Dengue serological diagnostic. Finacial support: the
kits were donated by MEDIVAX.
HV511 - Htlv-1 Proviral Load In Ham/Tsp
Patients And Non-Ham/Tsp Individuals
Rosadas, C., Cabral-Castro, M.J., Peralta, J.M., PuccioniSohler, M.
Universidade Federal do Rio de Janeiro, UFRJ, Rua
Rodolpho Paulo Rocco, 255 - Cidade Universitária - Ilha do
Fundão - Rio de Janeiro
HTLV-1 is a member of Retroviridae family that
infects approximately 800.000 individuals in Brazil.
Although the majority of infected individuals remain
asymptomatic this virus is the etiological agent of
a degenerative neurological disorder called HTLVassociated myelopathy/tropical spastic paraparesis
(HAM/TSP). The diagnosis of HAM/TSP is based on
clinical and laboratorial criteria, as proposed by WHO.
This criteria consist of two levels of ascertainment:
probable and definite. The “definite” diagnose considers
slowly progressive paraparesis and anti-HTLV-I
antibodies in blood and CSF. Thus, nor the detection of
proviral DNA, neither the proviral load is included in
this criteria. Previous studies demonstrated a higher
proviral load (PVL) in HAM patients then in symptomatic
individuals. The present study aim to evaluate the HTLV1 PVL in PBMCs of definite HAM/TSP and non-HAM/
TSP individuals from Rio de Janeiro, Brazil. The HTLV1 PVL of PBMCs was determined by TaqMan real time
PCR targeting HTLV-1 tax gene of 18 HAM/TSP and 7
non-HAM/TSP individuals. The mean of PVL of HAM/
TSP and non-HAM/TSP individuals was 36.3 (9.5) and
8.3 (3.6) /100 PBMCs, respectively. This difference was
statistically significant (P=0.02). Two individuals from
non-HAM/TSP group presented proviral load similar to
HAM/TSP patients (PVL:18.8 and 24.5/100PBMCs. One
of them is a 27 year old, HAM/TSP patient’s son. The other
one is a patient with clinical suspicion of lymphoma.
Therefore, these individuals should be monitored
frequently. Two HAM/TSP individuals presented a
proviral load higher than 100%, indicating that there
are more than one provirus per PBMC. Conclusion: PVL
of HAM/TSP individuals is higher than in non-HAM/
TSPindividuals. The determination of proviral load may
contribute to define HAM/TSP diagnosis. Moreover the
proviral load can be used as a prognostic tool and also
assists in monitoring of HTLV-1 infected individuals.
HV512 - Dengue Cases Associated To Abiotic
And Biotics Factors In Belo Horizonte,
Minas Gerais From January 2010 To November
2012.
Miranda, D.P.J., Marins, K.S., Sonoda, I.V., Nascimento,
J.C., Pessanha, J.E.M., Figueiredo, L.B., Bonjardin, C.A.,
Ferreira, P.P., Kroon, E.G.
1. Universidade Federal de Minas Gerais, UFMG, Av
Presidente Antonio Carlos 6627
2. Laboratório de Zoonoses - Secretaria Municipal de
Saúde , Lab-zoonose -PBH, Avenida Afonso Pena 1212
3. Gerência de controle de zoonoses- Secretaria
Municipal de, SMSBH-GCS , Avenida Afonso Pena 1212
Dengue virus is the most important human arboviral
pathogen worldwide. It is estimates by WHO that over
40% of the population is at risk of acquiring dengue and
there may 50 million of dengue infectious every year.
There are four serotypes of dengue viruses, DEN1-4,
which can be transmitted mainly by Aedes aegypti and
Aedes albopictus. The last twenty years dengue has
been a problem for Brazil and a major concern for public
health authorities. Belo Horizonte, capital of Minas
Gerais state is an important economic polo and has a
large highway network allowing a large movement of
people. Since 1996, Belo Horizonte has been suffering
dengue outbreaks. Many control programs have been
used as source for understanding dynamics of dengue
transmission which includes entomological surveillance.
The Municipal Health department of Belo Horizonte
had been monitored ovoposition of Ae.aegypti and
Ae.Albopictus through the whole year, supporting data
for wide spread dispersion of the vector, to perform
better control actions. Nevertheless, many others factors
can be responsible for dengue transmission as spread of
each of four serotypes, immunological state of population
as well ecological and social variables. The aim of this
work was to show a correlation between number of eggs
laid in ovitraps and cases of dengue in Belo Horizonte,
from January 2010 to November 2012. Oviposition traps
were displayed for one week in residential areas of Belo
Horizonte, four times per year: January, April, August
and November. After one week of exposition, paddles
of ovitraps were removed and sent to entomological
lab where eggs were counted. Statistical program was
used to make the correlation between number of eggs
and dengue cases. Results showed that there was no
correlation between number of eggs and dengue cases
in this period. Although the data obtained by monitoring
the number of eggs was not enough to predict a dengue
outbreak, they give support and enable the adoption
of integrated policies and strategies for dengue control
with others biotic and abiotic factors.
150
Human Virology: HV
HV518 - Molecular And Phylogenetic
Characterization
Of
Dengue
Virus
Serotype 1 Circulating In Roraima State
Silva, G.A.V., Sousa, D.D., Acosta, P.O.A., Granja, F.,
Naveca, F.G.
1. Instituto Leônidas e Maria Deane, Fiocruz Amazônia,
Brazil, ILMD-Fiocruz
2. Universidade Federal de Roraima, UFRR
Dengue viruses (DENV) are the most important
arboviruses over the world. Several reasons contribute
to its worldwide dispersion; including the lack of an
effective vaccine that protects against all four serotypes
simultaneously. After its first introduction during the
1981 epidemic in the Roraima state, dengue virus
serotype 1 (DENV-1) was reintroduced in 2000, being
consequently isolated in nine of the last 13 years. This
work aimed to characterize the full-length envelope gene
among 13 samples collected between 2008-2010. All
viral strains were isolated from patients that presented
classic dengue fever in C6/36 cells. After one passage,
cell supernatant was removed for viral RNA isolation,
cDNA synthesis and amplification using DENV-1 specific
primers, resulting in 1,724bp, encompassing the
envelope gene. Sanger’s nucleotide sequencing reaction
was conducted and the capillary electrophoresis was
performed in an ABI 3130. All Roraima’s sequences
were aligned with other 61 sequences available at
the GenBank, representing all DENV-1 genotypes,
using the MAFFT algorithm implemented in Geneious
software. The evolution model that best fits the dataset
was inferred with JmodelTest 2.1.3 and a maximum
likelihood phylogenetic reconstruction was conducted
with PhyML. All samples showed 25 variable sites in
the nucleotide sequences alignment, and five sites
of residues substitutions. Phylogenetic inference
revealed that all samples belongs to the genotype V, a
well-established genotype in Brazil since the eighty’s
decade. Furthermore, all studied samples grouped in
a monophyletic clade in the lineage III, together with
Venezuelans, Colombians and Mexicans strains, as well
as with other Brazilians strains from Alagoas 2010
and Rio de Janeiro 2011. Continuous studies on the
molecular characterization of dengue circulating strains
are necessary, especially in international border states
like Roraima, which may serve as an important route for
dispersion of epidemics lineages.
HV521 - Virological And Serological
Markers Of Dengue Infection In Central
Brazil: An Approach Of Ns1ag Test As A
Screening Tool For Viral Isolation
Silva, V.L., Argolo, A.F.L.T., Ramos, C.H., Silva, M.M.J.,
Silva, L.F.F., Féres, V.C.R., Silveira, L.A., Martelli, C.M.T.
1. Laboratório de Saúde Pública Dr. Giovanni
Cysneiros, LACEN-GO, Av. Contorno, Nª 3.556, Jardim Bela
Vista - Goiânia - GO-Brasil / Cep: 74853-120
2. Instituto de Patologia Tropical e Saúde Pública UFG, IPTS-UFG, Rua 235 - s/n - Setor Universitário - CEP:
74605050 - Goiânia - Goiás - Brasil
3. Faculdade de Farmácia - UFG, FF-UFG, Av.
Universitária, esq. com 1ª Avenida, Setor Universitário, CEP:
74605-220, Goiás
The State of Goias located in Central Brazil, has
experienced epidemic and non-epidemic periods of
DENV transmission since 1994 (DENV1), DENV2 (1998),
DENV3 (2002) and DENV4 (2011). An important
outbreak is ongoing in the region with more than
125,000 cases notified during the first fourth months
of 2013. In 2009 NS1Ag was introduced in Public
Health Laboratories in Brazil to increase the detection
of DENV in early infections also as screening tool to
improve the viral isolation. To evaluate the efficiency
of serological and virological markers in laboratorial
dengue diagnosis we analyzed samples data processed
in LACEN-GO during January to April 2013. Data were
extracted from GAL lab software and analyzed by Excel
2010. Routinely samples from the epidemiological
surveillance to dengue diagnosis were performed: (1)
blood (viral isolation) or serum (NS1Ag test) with ≤5
days post onset of symptoms (DPO); (2) serum with
>5DPO (IgM test); (3) paired samples with ≤5DPO were
screened by NS1Ag (serum) and when positive the
matched blood were also tested by viral isolation. Total
of 14,164 samples from patients with dengue symptoms
were received in virology section at LACEN-GO during
Jan-April 2013. 10,103 samples were tested by IgM
(68.6% positive), 1,846 by NS1Ag (22.1% positive) and
491 by viral isolation (35.8% positive) with DENV1
(44.3%) and DENV4 (55.7%) detected. Among paired
samples 257/862 (29.8%) were positive by NS1Ag and
the matched blood were screened to viral isolation with
203(78.9%) positive results yielding 46.3% DENV1 and
53.7% DENV4 detected. In our routine, IgM remains
the more efficient serological marker in detection of
DENV infection with 98% of predictive positive value
considering 70% of dengue prevalence in the setting.
Moreover this result pointed the high quality of dengue
diagnostic from the clinical team. The positivity of NS1Ag
ranged 22-30%. Many studies describe large range in
sensibility of NS1Ag test which can vary among different
serotypes, primary or secondary and timing of infection.
However the increased positivity in viral isolation (35.8
to 78.9%) promoted by NS1Ag as triage tool resulted in
greater ability to identify circulating serotypes in line
with those detected by usual viral isolation beyond the
best use of resources. Additionally the support by the
151
Human Virology: HV
epidemiological surveillance was essential for this study
also to the constant improvement of dengue diagnosis in
Goias. Financial support:-
HV524 - Complete Genome Characterization
Of A Dengue Virus Serotype 4 Isolated In
Manaus, Am
Nascimento, V.A., , Silva, G.A.V., Souza, V.C., Souza,
K.B.A., Naveca, F.G.
Instituto Leônidas e Maria Deane, ILMD, Rua Terezina,
Manaus-AM
The Dengue virus (DENV) belongs to the Flaviviridae
family, genus Flavivirus and is recognized as four
distinct serotypes named DENV-1 to DENV-4. Brazil
faces epidemics caused by DENV since 1981-82, when
serotypes 1 and 4 were isolated from human cases in the
Roraima State. To date few complete genomes DENV4 have been described in Brazil, and all of then were
sequenced after primarily isolation in C6/36 cells. For
that reason the aim of this study was to characterize,
directly from plasma, a specimen detected in ManausAM. The sample BrAM005/11 was collected in May
2011 from a patient with classic dengue fever that was
initially confirmed as a dengue case by multiplex RTPCR. Thereafter, cDNA was produced using a primer that
targets the last 21nt in the 3’UTR of DENV-4 genome. The
full-length genome was amplified in eight overlapping
amplicons, which were submitted to Sanger’s nucleotide
sequencing followed by capillary electrophoresis in
an ABI 3130 genetic analyzer. Electropherograms
were assembled on Geneious software 6.1.5 using the
GenBank reference sequence. All 118 full-length DENV4 genomes available, representing the four genotypes,
were aligned with this sample using the MAFFT
algorithm implemented in Geneious, and a neighborjoining phylogenetic reconstruction was performed with
genotyping purposes. The complete genome sequence
of BrAM005/11 is 10,649 nt long and according to the
phylogenetic analysis is a representative of the genotype
II. With regarding to the polyprotein comparisons,
three residues substitutions, K66R (capsid); S2910G
and L3327I (NS5) were observed only in this sample.
Furthermore, when the present sequence was compared
to other five DENV-4 genomes collected in Manaus 2011,
seven residues substitutions F49L and K66R (capsid),
E554G (envelope) and T2492A, I2565V, S2910G, L3327I
(NS5) were observed only in this sample. Further studies
are being conducted in order to evaluate those mutations
and its importance for viral evolution.
HV527 - Human Respiratory Syncytial Virus
(Hrsv) Infects Tonsils Of Patients With
Chronic Adenotonsillar Disease
Criado, M.F., Proença-Modena, J.L., Sesti-Costa, R.,
Santos, R.I.M., Silva, M.L., Paula, F.E., Saturno, T., Prates,
M.C., Faria, F.M., Tamashiro, E. , Valera, F.C.P., AnselmoLima, W.T., Arruda, E.
Instituto Leônidas e Maria Deane, ILMD, Rua Terezina,
Manaus-AM
The Dengue virus (DENV) belongs to the Flaviviridae
family, genus Flavivirus and is recognized as four
distinct serotypes named DENV-1 to DENV-4. Brazil
faces epidemics caused by DENV since 1981-82, when
serotypes 1 and 4 were isolated from human cases in the
Roraima State. To date few complete genomes DENV4 have been described in Brazil, and all of then were
sequenced after primarily isolation in C6/36 cells. For
that reason the aim of this study was to characterize,
directly from plasma, a specimen detected in ManausAM. The sample BrAM005/11 was collected in May
2011 from a patient with classic dengue fever that was
initially confirmed as a dengue case by multiplex RTPCR. Thereafter, cDNA was produced using a primer that
targets the last 21nt in the 3’UTR of DENV-4 genome. The
full-length genome was amplified in eight overlapping
amplicons, which were submitted to Sanger’s nucleotide
sequencing followed by capillary electrophoresis in
an ABI 3130 genetic analyzer. Electropherograms
were assembled on Geneious software 6.1.5 using the
GenBank reference sequence. All 118 full-length DENV4 genomes available, representing the four genotypes,
were aligned with this sample using the MAFFT
algorithm implemented in Geneious, and a neighborjoining phylogenetic reconstruction was performed with
genotyping purposes. The complete genome sequence
of BrAM005/11 is 10,649 nt long and according to the
phylogenetic analysis is a representative of the genotype
II. With regarding to the polyprotein comparisons,
three residues substitutions, K66R (capsid); S2910G
and L3327I (NS5) were observed only in this sample.
Furthermore, when the present sequence was compared
to other five DENV-4 genomes collected in Manaus 2011,
seven residues substitutions F49L and K66R (capsid),
E554G (envelope) and T2492A, I2565V, S2910G, L3327I
(NS5) were observed only in this sample. Further studies
are being conducted in order to evaluate those mutations
and its importance for viral evolution.
HV532 - Respiratory Viruses Detection
Among Young Children In Palivizumab
Prophylaxis Program
Watanabe, A., Perosa, A.H., Moreira, L.P., Guatura, S.B.,
Weckx, L.Y., Monteiro, A.I., Granato, C., Bellei, N.
Universidade Federal de São Paulo, UNIFESP, Rua
Pedro de Toledo, 781 - 15º andar
152
Human Virology: HV
Respiratory infections are caused by a large group
of viruses and are one of the most frequent infectious
syndromes in childhood which can be followed by
complications and a significant morbidity. They are a
major cause of consultations in primary care services.
The present study analyzed the occurrence of respiratory
viruses among children samples up to 2 years old
presenting acute respiratory symptoms attended in a
pediatric ward of a Sao Paulo city tertiary hospital. All
enrolled patients were prophylactically treated with
monoclonal antibody (Palivizumab®). Symptomatic
children were referred by a pediatrician to the research
team every time suspected of an acute respiratory
syndrome of probable viral etiology and a nasal swab
was collected. Conventional RT-PCR was applied for
detection of rinovirus (HRV), metapneumovirus (hMPV)
, adenovirus (AdV) and real time PCR for influenza A/B
(Flu A/B) detection. We studied 73 nasal swabs from
children (median of 1 year, 3 months - 2 years) attended
between April to September 2008. In the present study,
86% of children were premature and the most frequent
symptoms were coryza, cough, fever and wheezing.
Among analyzed samples 39.4% were HRV positive,
5.6% AdV, 2.8% Flu A, 1.4% hMPV and no Flu B was
detected. In a previous study, with the same population,
respiratory syncytial virus (HRSV) was detected in 20%
of studied samples by conventional PCR. Respiratory
viral infection was frequently detected in young children
receiving prophylaxis with Palivizumab® during
autumn and winter season. Despite the high frequency
of HRSV (20%), others respiratory viruses (47.3%)
were also detected in a high frequency contributing to
respiratory viral illness among premature pediatric
patients. Financial support: no financial support Área:
Virologia Humana Apresentador: Aripuanã Watanabe
Arquivo: Watanabe I.doc
workers and HIV patients. The viral load evaluation was
made by RT-qPCR. HRV was detected in 17.3% of the
samples. The HRV infection was higher in symptomatic
patients (20.9%, 68/325) than in asymptomatic patients
[(11.5%, 23/200; p = 0.005)]. The HRV-A was detected
in 74.5% (38/51) of the sequenced samples, followed
by HRV-C (19.6%, 10/51) and HRV-B (5.9%, 3/51).
The mean of viral load in HRV positive samples was
1.76 E+07 copies/mL. The group of children and HIV
seropositive patients presented higher and lower viral
load (109 and 102copies/mL) respectively. The mean of
viral load in symptomatic patients was similar to that in
asymptomatic patients with no statistically significant
difference. The comparison between immunocompetent
and immunocompromised adult patients showed a trend
towards higher viral load among immunocompromised.
The viral load of HRV-A was significantly greater when
compared to HRV-C (p ˂ 0.001). The HRV A species,
most often detected in the studies, presented the higher
viral load when compared with the HRV-C species. In
symptomatic patients the immune status seems to
contribute to the range of viral load when comparing
immunocompetent
and
immunocompromised
patients. We conclude that viral load does not seem to
be the most relevant factor for the clinical outcome of
infected patients. Financial support: CAPES, FAPESP
2009/17384-0 Área : Virologia Humana Apresentador:
Aripuanã Watanabe Arquivo: Watanabe II.doc
Universidade Federal de São Paulo, UNIFESP, Rua
Pedro de Toledo, 781 - 15º andar
Dengue is the most important human arboviral disease
and the major health problem in developing countries.
Dengue virus (DENV) is an arbovirus that belongs to
genus Flavivirus family Flaviviridae, classified in four
antigenically distinct serotypes DENV-1-4. Roraima is
hyperendemic for dengue and shows the circulation
of four serotypes after DENV4 reintroduction in 2010.
Between 2007 and 2011,14.078 cases of febrile illnesses
were noticed in State which dengue infection was
discarded by laboratory methods of anti-dengue IgM
and/or NS1 antigen-capture ELISA (NS1) and whose
etiologic agent was not identified. The aim of this study
was to evaluate the accuracy of dengue diagnose in NS1
HV533
Rhinovirus
Infection
In
Symptomatic And Asymptomatic Patients
Camargo, C.N., Melchior, T.B., Watanabe, A., Granato, C.,
Bellei, N.
The human rhinovirus (HRV) infections are among
the most frequent causes of common colds, and
asymptomatic infections occur in 9% to 30% of cases.
This study showed the occurrence of HRV in symptomatic
and asymptomatic patients and the relationship
between viral load and rhinovirus species in respiratory
samples from adults and children, using the RT-qPCR
methodology. A total of 525 samples were analysed
from symptomatic children and their asymptomatic
caregivers, symptomatic and asymptomatic health care
HV536 - Dengue False-Negative Cases In
Roraima, Brazil: An Approach About The
High Number Of Negative Ns1 Assays
Nascimento, I.A.S., Meneses, C.A., Sousa, D.D., Lima
Junior, W.P., Granja, F., Silva, G.A.V., Naveca, F.G., Acosta,
P.O.A.
1. UNIVERSIDADE FEDERAL DE RORAIMA,
UFRR, Campus Paricarana: Av. Cap. Ene Garcez, nº 2413.
Bairro Aeroporto. CEP: 69310-00
2. Instituto Leônidas e Maria Deane - FioCruz - AM,
CpqLMD
153
Human Virology: HV
negative samples in comparison with Real-time RT-PCR
(qPCR) in 2012. In 986 samples from patients with
presumptive diagnose for dengue 78,8% were negative
by ELISA assay (Platelia™DENGUE-NS1-Ag, BIORAD®)
used in Central Laboratory of Roraima, this is the primary
diagnose method used in the health system of the state
in the acute phase of disease. 150 samples were selected
from the NS1 negative total to perform qRT-PCR. RNA was
extracted with Axygen Bioscience® kit and subjected to
a TaqMan qRT-PCR that detects any serotype genome,
developed by Gurukumar, 2009 adapted by Naveca,
2012, from these samples 21,3% were positive by this
test. Among the possible causes of false-negative NS1
number are the high sensitivity/specificity of qPCR and
the fact of Roraima be a hyperendemic state, in which
a high rate of secondary infection is expected, as know
this fact decreases the sensitivity of NS1 tests due to
the immune-complexes formed. Future studies may be
conducted to evaluate these hypotheses, as well as the
relation between serotypes and negativity of NS1. The
data should be an alert to the health system in the sense
that acute phasepatients are discarded by laboratorial
assays; this phase needs constant care due to the
possibility of HFD/DSS, important in an endemic area.
Financial support: Univerdidade Federal de Roraima UFRR
HV537 - Risk Factors Associated To Human
Papillomavirus (Hpv) Cervical Infection In
Women At Reproductive Age
Pinto, G.V.S., Bolpetti, A.N., Vieira, E.P., Candeias, J.M.G.,
Machado, M.C.H.S., Silva, M.G.
Faculdade de Medicina de Botucatu - Departmento
de Patologia, FMB - UNESP, Distrito de Rubião Junior s/n Botucatu - SP
2. Instituto de Biociências - Depto Microbiologia e
Imunologia, IBB - UNESP, Distrito de Rubião Junior s/n Botucatu - SP
3. Secretaria de Saúde de Botucatu, Secretaria de
Saúde, Rua Major Matheus, 7 - Botucatu -SP
HPV is the worldwide most commonly sexually
transmitted virus with a global estimate prevalence of
around 10%. Epidemiologic studies have been conducted
to identify the countless factors associated with HPV
cervical infection. So, in order to identify these, a study
has been done with samples collected from women at
reproductive age, attended by the Basic Health Clinics
of the city of Botucatu, São Paulo State, Brazil, between
the years of 2012 and 2013. Socio-demographic,
behavioral and clinical data were obtained through
interviews. At the each visit a cervical smear specimen
was collected for HPV testing and conventional cervico-
vaginal cytology. HPV genotyping was performed
using Linear Array HPV Genotyping Test (Roche
Molecular Systems Inc.) and all smears were evaluated
at the Cytology Unit of the Department of Pathology
according to the Bethesda system criteria. The variable
analysis associated with HPV infection was adjusted
using a stepwise logistic regression method to analyze
qualitative and quantitative variables. The software used
for that analysis was the SAS version 9.2. The observed
prevalence of HPV was 33.6% and the altered cervicovaginal cytology prevalence was 3.2%. The factors
associated with HPV infection were: age under 20 years
(OR= 6.455, CI= 1.722-24.194); being single (OR= 10.52,
CI= 5.524-20.00); schooling under 8 years (OR= 2.440,
CI= 1.219-4.885) and practice of passive oral sex (OR=
2.760, CI= 1.501-5.075). Therefore, by the present data,
the HPV prevalence in women at reproductive age in
the city of Botucatu is higher when compared with the
global estimates. We believe that the understanding of
the risk factors associated with the HPV infection will
allow the implementation of major impact measures
to reduce the high rates regarding the infection by this
virus. Financial support: FAPESP (2012/01278-0) and
CNPq (134190/2012-2)
HV547 - Real-Time Pcr Application In
Diferent At Risk Population From Sao
Paulo Hospital
Moreira, L.P., Watanabe, A.S.A., Silva, E.R.M., Guatura,
S.B., Granato, C., Bellei, N.
Universidade Federal de São Paulo, Unifesp, Rua Pedro
de Toledo, 781 - 15°andar - Vila Clementino - SP
In Brazil there are few studies related to respiratory
infections caused by human parainfluenza virus
(HPIV). There is a lack of information about incidence,
risk factors and outcomes among different patients
populations. HPIVs are divided into 4 different types,
although most clinical infections are due to types 1, 2,
and 3. The incidence of infection caused by this viral
agent has been reported between 2% to 7%. The aim
of the study was to investigate the occurrence of HPIVs
1, 2, 3 and 4 in different patients hospitalized and nonhospitalized with respiratory symptoms in a tertiary
hospital in Sao Paulo. Patients included in the study were
in hematopoietic stem cell transplant (HSCT) program,
recipients of kidney transplants (Tx Renal), children
with congenital heart disease (CARDIO) and adults
and children hospitalized with suspected of H1N1/
pdm/2009 (sH1N1) infection. Included patients were
those who had a clinical picture of acute respiratory
infection or asymptomatic patients who have contact
with patients presenting with infection. The present
study analyzed the diagnostic for HPIV 1, 2, 3 and 4
154
Human Virology: HV
by Real Time Reverse Transcription-PCR (RT-PCR) in
these patients. We studied 1087 samples from patients
attended between March 2002 to December 2012, these
samples were HSCT (N=383), Tx Renal (N=250), Cardio
(N=130) and sH1N1 (N=324) and were collected in a
ward or in the ambulatory. The virus was detected in
76 samples (7%). The HPIV-3 was the most frequently
detected (61.8%), followed by HPIV-2 (15.8%), HPIV4 (14.5%) and HPIV-1 (9.2%). The positivity for HSCT
group was of 8.4% and for sH1N1 was 7,7%, followed
by cardio (6.9%) and 4.0% for Tx renal. So, a significant
percentage (63.2%) of positive cases had comorbidity,
demonstrating that the incidence of infection, mainly in
immunocompromised patients, is underestimated when
using conventional methods of laboratory detection. it
reinforces the need of establishing a rapid and sensitive
differential diagnosis of respiratory viruses.
HV552 - Small Mammals Versus The
Emergence Of Viral Diseases: A Prospective
Study In Rural Areas Of Minas Gerais State
Amaral, C.D., Borges, I.A., Costa, G.B., Abrahão, J.S.,
Kroon, E.G., Vieira, F.N., Ambrósio, L.L.D., Sacchetto, L.
, Marques, C., Paglia, A., Drummond, B.P., Leite, S.M.S.,
Trindade, G.S.
Antônio Carlos, 6627, Pampulha BH-MG
2. Universidade Federal de Juiz de Fora, UFJF, R-José
Lourenço Kelmer,Campus Universitário - Bairro São Pedro,
Juiz de Fora
3. Instituto Federal de Educação, Ciência e Tecnologia,
IFET
Emerging infectious diseases frequently present a viral
etiology and may involve humans and small rodents as
seen for several zoonotic viruses. Alterations in wild
environments affect directly public health, facilitating
the emergence of unexpected zoonosis. This work
intends to gather a fauna prospection of small mammals
at two rural areas of Minas Gerais state and use molecular
approaches to identify viruses these animals have had
contact with, exploring their roles as hosts or reservoirs.
Rio Pomba and Serro cities are currently under the
spot. From an effort of 9600 traps, 96 animals were
caught (1%). Forest, pasture and domiciliary areas were
covered. Preliminary field results demonstrated that
74.5% of rodents and 25.5% of small marsupials have
been caught. A greater number of individuals are seen at
rain forest (62.7%), whereas higher diversity is observed
at savannah. Calomys (40,7%) and Akodon (26.5%)
represent the genera most captured at rain forest;
both are potential hosts of arenaviruses. Marsupials as
Didelphis (34.2%) and Marmosops (13.2%) were more
abundant at savannah. More than half of all rodents
came from pastures, suggesting a close contact among
wild and domestic life. It is worth to mention that
Hantavirus are maintained in nature in wild reservoirs
as Akodon and Oligoryzomis, this last representing
7,4% of our trapped rodents. Mus musculus (1,9%)
was also suggested to be associated with Vaccinia Virus
natural circulation. Up to date, qPCR was realized for all
serum samples; results were negative for Dengue virus
serotypes 1, 2, 3 and 4. Further experiments concerning
other viruses are currently being performed as several
pathogens are possibly associated with the sampled
genera of mammals. The identification of hosts and
potential reservoirs constitutes a strategy to minimize
and contain the onset of several viral infectious diseases
– the first steps have been taken.
HV553 - Occurrence Of Hpivs 1, 2, 3 And 4
Among Hospitalized And Non-Hospitalized
Risk Group Patients.
Parmezan, S.N., Moreira, L.P., Camargo, C.N., Bellei, N.
Universidade Federal de São Paulo, Unifesp, Rua Pedro
de Toledo, 781 - 15°andar - Vila Clementino - SP
In Brazil there are few studies related to respiratory
infections caused by human parainfluenza virus
(HPIV). There is a lack of information about incidence,
risk factors and outcomes among different patients’
populations. HPIVs are divided into 4 different types,
although most clinical infections are due to types 1, 2,
and 3. The incidence of infection caused by this viral
agent has been reported between 2% to 7%. The aim
of the study was to investigate the occurrence of HPIVs
1, 2, 3 and 4 in different patients hospitalized and nonhospitalized with respiratory symptoms in a tertiary
hospital in São Paulo. Patients included in the study
were in hematopoietic stem cell transplant (HSCT)
program, recipients of kidney transplants (Tx Renal),
children with congenital heart disease (CARDIO) and
adults and children hospitalized with suspected of
H1N1/pdm/2009 (sH1N1) infection. Included patients
were those who had symptoms of acute respiratory
infection or asymptomatic patients who have contact
with patients presenting with infection. The present
study analyzed the diagnostic for HPIV 1, 2, 3 and 4
by Real Time Reverse Transcription-PCR (RT-PCR) in
these patients. We studied 1087 samples from patients
attended between March 2002 to December 2012, these
samples were TCTH (N=383), Tx Renal (N=250), Cardio
(N=130) and sH1N1 (N=324) and were collected in a
ward or in the ambulatory. The virus was detected in
76 samples (7%). The HPIV-3 was the most frequently
detected (61.8%), followed by HPIV-2 (15.8%), HPIV4 (14.5%) and HPIV-1 (9.2%). The positivity on TCTH
was 8.4% and on sH1N1 was 7.7%, followed by cardio
155
Human Virology: HV
6.9% and 4.0% for Tx renal. A significant percentage
(63.2%) of positive cases presented comorbidity,
demonstrating that the incidence of infection, mainly in
immunocompromised patients, is underestimated when
using conventional methods of laboratory detection. It
reinforces the need of establishing a rapid and sensitive
differential diagnosis of respiratory viruses.
HV554 - Protein Profile Of A Bacteriophage
Associated With Nosocomial Infections
Caused By Multi-Drug Resistant Bacteria
Duarte, V.S., Dias, R.S., Silva, C.C., Honda, E.R., Nunes,
M.V.M., Machado, B.L.L., Xavier, G.F., De Souza, F.O., De
Paula, S.O.
Universidade Federal de Viçosa, UFV, Avenida Peter
Henry Rolfs, s/n - Campus Universitário - LIVM
The bovine mastitis in large etiology, causes great
economic losses worldwide. Besides costly illness causes
public health problems such as food poisoning and the
emergence of multi drug resistant bacteria. Looking
for an alternative to antibiotics, the phage, which is
based on the use of phage or bacteriophage, which are
viruses that infect bacteria, appears as an option for the
treatment of clinical and subclinical mastitis. There was
an isolated lytic bacteriophage specific for Streptococcus
spp. and Escherichia coli, two major etiological agent.
From water samples from central funding network
and sewage treatment, proceeded to the viral isolation
and viral aliquots were confirmed by morphological
analysis by transmission electron microscopy. Ten
microliters were pipetted over a grid (200 meshes),
previously coated with Formvar and incubated at room
temperature for five minutes and the excess removed
with filter paper. Viral particles adhered were contrasted
with 2% uranyl acetate for twenty seconds and analyzed
electronic microscope Zeiss EM 109 TEM operated at 80
kV. We found a bacteriophage caudate belonging to the
order Caudovirales, family Myoviridae with icosahedral
heads and short noncontractile tail. After morphological,
studies will be undertaken for further molecular and
serologic studies in vivo.
HV559
Evolutionary
Dynamics
Of
Influenza Virus A (H3n2) During 19992012 In The Southern, Southeastern And
Northeastern Brazilian Regions
Born, P.S., Resende, P.C., Siqueira, M.M., Motta, F.C.,
Bello, G.
1. FUNDAÇÃO OSWALDO CRUZ, Fiocruz, Av. Brasil,
4365, RJ, 21040360
2. Laboratório de Vírus Respiratórios e do Sarampo/
IOC/Fiocruz, LVRS/IOC/Fiocruz-RJ, Av. Brasil, 4365, RJ,
21040360
3. Laboratório de Aids e Imunologia Molecular/IOC/
Fiocruz-RJ, LabAids/IOC/Fiocruz, Av. Brasil, 4365, RJ,
21040360
The influenza infection is the most frequent cause of
acute respiratory illness requiring medical intervention
affecting individuals in all age groups. The subtype
A(H3N2) has been dominant in most seasonal influenza
epidemics since 1968. Analyses suggest that the
evolutionary dynamics of the influenza H3N2 is modeled
by a complex interaction between the high mutation
rate of the virus, gene rearrangements and selection
exerted by the immune system. In Brazil, the knowledge
of influenza virus epidemiology and evolution is still
incipient. Thus, our objective is to reconstruct the profile
of evolution and geographical spread of influenza H3N2
in Brazil during 1999-2012 and to understand the role
of Brazil in the dynamics of global virus spread. For
this, a total of 205 Brazilian sequences (HA1 portion
of HA gene) as well as sequences from other South
American countries (n = 58), Australia (n = 96), Hong
Kong (n = 72), United Kingdom (n = 58) and New York
(n = 70) were analyzed by Maximum Likelihood and
Bayesian methods. The phylogenetic tree of Brazilian
influenza A(H3N2) sequences showed a strong temporal
structure, with a clear increase in the genetic divergence
over time. The mean rate of evolution of the HA1 portion
of HA gene was estimated at 4.7x10-3 substitutions/
site/year. Despite great intermixed of influenza
sequences from different countries and form different
Brazilian regions, distribution of viral sequences in the
phylogenetic tree was not completely random and some
level of geographic structure was evident. The strongest
supported migration events occur between southern
and southeastern Brazilian regions at the local level, and
between Brazil and both other South American countries
and New York at global level. This analysis also indicates
that Brazil has less epidemiological linkages than others
countries and possibly play a minor role as hub for
international dissemination of influenza A(H3N2) virus.
Financial support: IOC/FIOCRUZ, DECIT/MS, CAPES
HV567 - Mayaro Virus Circulation In Urban
Areas During Dengue 4 Outbreak In Mato
Grosso, Brazil
Zuchi, N., Heinen, L.B.S., Santos, M.A.M., Vininski, A.E.,
Ueda, S.K., Pereira, F.C., Gondim, B.H.F., Souto, F.J.D.,
Dezengrini-Slhessarenko, R.
156
Human Virology: HV
2. Secretaria de Vigilância em Saúde, SVS, Centro
Político Administrativo. Rua D, S/Nº - Bloco 05. Cuiabá - MT
3. Secretaria Estadual de Saúde, SES, Centro Político
Administrativo, Palácio Paiaguas, Bloco D - Cuiabá - MT
4. Laboratório Central de Saúde Pública de Mato
Grosso, MT-Laboratório, Rua Thogo da Silva Pereira, 63 –
Centro. Cuiabá - MT
Arboviruses occur in tropical areas, posing a significant
problem for human health. Mayaro (MAYV) is an
Alphavirus belonging to Togaviridae family, transmitted
by Haemagogus janthinomys and Aedes aegypti
mosquitoes. MAYV is endemic in the Amazon region,
reported during human outbreaks in surrounding States.
Serology has been demonstrated in Indians in 1967 in MT.
We collected 604 serum samples from patients with acute
febrile illness suspected of harboring dengue infection
between Jan-July/2012. Samples were submitted to
viral RNA extraction (QIAmp viral RNA mini kit), RTPCR (Alphavirus, 433 bp) followed by semi-nested-RTPCR (MAYV 270 bp; AURAV 98bp; EEEV 124 bp; WEEV
208 bp; VEEV 400 bp). Amplicons were sequenced and
analyzed with MEGA/BLASTn. We found 16/604 (2.6%)
positive for MAYV in Cuiabá, Várzea Grande, Nossa Sra
Livramento and Sorriso: 2/16 (12,5%) positive only
for MAYV and 14/16 (87,5%) co-infected with DENV-4.
Mayaro causes a mild febrile illness with a short viremic
period, which is clinically mistaken with Dengue Fever.
The findings suggest MAYV is circulating in urban areas
of MT, probably transmitted by Aedes aegypti. These
aspects, combined with absence of routine laboratorial
diagnose in MT to other arboviruses besides Dengue
serotypes, may contribute to the lack of comprehension
of MAYV infection dynamics, emphasizing the necessity
of surveillance improvement and the establishment of
fast and specific diagnostic tools in the State.*Financial
support: CNPq/CAPES/FAPEMAT/UFMT.
HV568 - Dengue And Saint Louis Encephalitis
Virus Circulation In Mato Grosso, Brazil
In 2012
Heinen, L.B.S., Zuchi, N., Santos, M.A.M., Ueda, S.K.,
Vininski, A.E., Pereira, F.C., Gondim, B.H.F., Souto, F.J.D.,
Dezengrini-Slhessarenko, R.,
2. Laboratório Central de Saúde Pública de Mato
Grosso, MT-Laboratório, Rua Thogo da Silva Pereira, 63 –
Centro. Cuiabá - MT
3. Secretaria de Vigilância em Saúde, SVS, Centro
Político Administrativo. Rua D, S/Nº - Bloco 05. Cuiabá - MT
4. Secretaria Estadual de Saúde de Mato Grosso, SES/
MT, Centro Político Administrativo, Palácio Paiaguas, Bloco
D - Cuiabá - MT
Flavivirus genus comprises many arboviruses
transmitted mainly by mosquitoes in tropical areas.
Dengue virus serotypes (DENV1-4) are the most
prevalent worldwide, posing an important public health
issue. Serology for Saint Louis Encephalitis (SLEV) has
been described in equines from MT, however SLEV
distribution is poorly unknown in the State. We tested
604 serum samples collected in 2012 from patients with
acute febrile illness in MT by RT-PCR with genus-specific
primers to Flavivirus (958bp) and species-specific semiN-PCR (DENV-1 472 bp; DENV-2 316 bp; DENV-3 628
bp; DENV-4 222 bp; YFV 253 bp; SLEV 232 bp; WNV 195
bp; ROCV 230 bp; BSQV 388 bp; IGUV 254 bp; ILHV 474
bp). Positive amplicons were submitted to sequencing.
Among 604 patients, 317 (52.48%) were positive for
DENV-4, 24 (3.97%) for DENV-1, 1 (0.17%) for DENV-2,
1 (0.17%) for DENV-3 and 2 (0.33%) for SLEV. Positive
results were confirmed by sequencing. From these
patients, 9 were co-infected with DENV-1/4, 1 with DENV2/4 and 2 with SLEV/DENV-4. Co-infections are frequent
when there is co-circulation of different serotypes,
especially in hyperendemic areas. Most of the cases are
primoinfections in adults residents of urban areas. As
Dengue febrile cases are relatively common every year
in the State, immunity to different serotypes influences
population susceptibility to infection. In this regard,
DENV-4 was identified for the first time in MT in 2012,
being the most prevalent serotype during this epidemic.
SLEV status is probably underestimated in MT. Birds are
reservoirs and mosquitoes as Culex sp., A. trianulattus
and Sabethes belisarioi are vectors. Serology and virus
identification/isolation have been described in humans,
equines, mosquitoes and birds in the Amazon region,
SP and South Pantanal.This is the first report of human
infection by SLEV in Cuiabá. Further studies involving
phylogeny analysis and entomological surveillance are
necessary to comprehend Flavivirus dynamics in MT.
*Financial support: CNPq/CAPES/FAPEMAT/UFMT.
HV569 - Cytomegalovirus (Cmv) Infection
In Patients Living With Hiv/Aids, Belém,
Pará, Brazil.
Silva, D.F.L., Arruda, L.M.F., Silva, N.F., Sagica, F.E.S.,
Moraes, M.M., Santos, T.V.R., Jr., J.L.S.A., Sousa, R.C.M.
1. Instituto Evandro Chagas, Iec/Svs/Ms, Br 316 Km 07
2. Núcleo De Medicina Tropical, Nmt/Ufpa, Av.
Generalíssimo Deodoro S/N
3. Faculdade De Medicina Da Ufpa, Fmufpa, Av.
Generalíssimo Deodoro S/N
157
Human Virology: HV
Due the increase in the prevalence of HIV/aids in the
world, the infection by CMV became a serious problem of
public health because of the immunodeficiency caused
by HIV and the reduction TCD4+ cells. The aim of this
research was to describe the clinical, epidemiological
and molecular aspects of CMV in patients living with
aids admitted to the Hospital Barros Barreto, Belém-Pa.
We performed serological method and PCR in Real Time
(qPCR) for detection of DNA and quantification of the
CMV viral load. The socio-economic data indicated high
frequency of individuals with incomplete level of basic
education (35.3%) and low family income. The medical
data revealed co-infection with several pathogenic
agents, the frequent ones being lung tuberculosis,
neurotoxoplasmosis, extrapulmonary tuberculosis and
diarrhea. The serological profile of the patients was IgG+/
IgM- (99.6%) and IgG+/IgM+ (2.1%). In the analysis for
qPCR, 55,8% of individual presented CMV viral load and
the average was 107479,48 copies/ml. During the study,
49 individuals had died, of which 63.3% were positive
in qPCR and one IgM+ by serological method. It was
observed significant difference among the proportions
(z=1,859; p=0,0315) of individuals who died with
positive diagnosis for CMV by qPCR in relation to the
surviving and positive individuals for the same diagnosis
method. The relative risk of mortality in patients with
co-infection HIV/CMV was evaluated. This analysis
showed that risk increases about two times when
patients present this morbidity condition (RR=1,66;
p=0,0449). The largest occurrence of positives in qPCR
was observed when the lymphocytes TCD4+ were in
levels <100/mm3. The individuals were negative when
the analysis registered >200 cels/mm3. These results
demonstrated that the lymphocytes TCD4+ in levels
<100/mm3 constitute important risk factor for the
occurrence of cytomegalovirosis. We concluded also that
the method qPCR is the best way for diagnostic of CMV in
imunodepressed patients.
HV570 - Dengue Virus-2 Detection In Larvae
Of Aedes Aegypti In The City Of Belo
Horizonte In 2012
Marins, K.S., Miranda, D.P.J., Rosa, J.C.C., Martins,
C.P.S., Pessanha, J.E.M., Figueiredo, L.B., Bonjardin, C.A.,
Ferreira, P.P., Kroon, E.G.
1Laboratório de Vírus, Departamento de Microbiologia,
Instit, UFMG, Av. Antônio Carlos, 6627
2. Gerencia de controle de zoonoses- Secretaria
Municipal de S, SMSBH-GCS
Dengue is the most important arboviral infecction
worldwide. It is a great concern in tropical and
subtropical areas. The World Health Organization
estimates that 40% of the population are living in risk
area and over 50 million persons are infected each year.
Dengue virus is classified in four serotypes (DENV1 to DENV-4) and mainly transmitted by the Aedes
aegypti. The mosquito vector has been found in Belo
Horizonte since 1986 and many outbreaks already have
occurred. In 2013 there was an outbreak, with almost
40.000 confirmed cases so far. In 2012 only 558 cases
were notified. The northwest district of Belo Horizonte
showed the highest number of dengue cases.The aim of
this study was to detect DENV in larvae of Aedes aegypti,
from oviposition traps displayed at northwest region of
Belo Horizonte in November 2012. Eggs from 30 paddles
were collected and hatched in laboratory conditions.
Each larva was identified into specie by morphological
characteristics and separated into 30 pools ranging from
4-30 larvae. Viral RNA was extracted and subsequent RTPCR, qPCR using primers to the 5 ‘UTR region and C-prM,
was performed. From the 30 pools analyzed, 3 (10%)
were positive in qPCR and PCR. The amplified DNA was
purified and sequenced. The sequences obtained were
analyzed and compared with standard samples and then
used to construct the phylogenetic tree. Phylogenetic
analysis of the sequences indicated that these samples
belonged to DENV-2 Asian-American genotype.
HV571 - Orthobunyavirus Ocurrence In
Humans With Febrile Acute Illness And
In Culex Quinquefasciatus Mosquitoes In
Mato Grosso, Brazil
Cardoso, B.F., Serra, O.P., Zuchi, N., Heinen, L.B.S.,
Gondim, B.H., Pereira, F.C., Santos, F.A.L., Santos,
M.A.M., Souto, F.J.D., Dezengrini-Slhessarenko, R.
1. Laboratório Central de Saúde Pública do Mato
Grosso, MT- Laboratório, R Tenente Thogo da Silva Pereira
63 - Centro Sul - Cuiabá/MT
Cuiabá - MT
3. Secretária de Vigilância em Saúde, SVS, Centro
Político Administrativo, Palácio Paiaguas, Bloco D. Cuiabá/
MT
4. Secretária Estadual de Saúde, SES, R. Treze de Junho,
1055 - Centro Sul Cuiabá - MT
The genus Orthobunyavirus, family Bunyaviridae
comprises several arboviruses already detected in
Brazil. Oropouche (OROV) is considered the most
prevalent arbovirus after Dengue virus in the country,
being the most prevalent in the Amazon region.
Epidemiological situation of these viruses in MT is
unknown. RNA was extracted with QIAmp viral RNA kit
from serum samples of 604 patients with acute febrile
illness from Mato Grosso (2012). Pools of adult female
158
Human Virology: HV
Culex quinquefasciatus (n=319) and Culex sp. (n=138)
were collected with Nasci aspirators and hand net in
200 points in Cuiabá between January and April, 2013.
Total RNA was extracted (Trizol) from 50 pools of Culex
quinquefasciatus and 5 of Culex sp. RNA from human
samples (n=604) and mosquitoes pools (n=55) were
submitted to reverse transcription (Superscript III)
with primer BUN-S (Orthobunyavirus; segment S). The
cDNA of 98 human samples and 55 pools of mosquitoes
were submitted to N-RT-PCR with primers BUN-C/
BUN-S and BS-C e BS-S, this latter amplify the segment
S of Simbu group orthobunyaviruses (300 bp). Results
demonstrate 1/98 (1%) human sample from Cuiabá and
2/50 (4,0%) pool of Culex quinquefasciatus positive for
an Orthobunyavirus from Simbu group. The sequences
(mosquitoes and human sample) presented 84-94% of
identity with OROV sequences from IEC/Para. In urban
centers, Culicoides paraensis and Culex quinquefasciatus
are considered vectors for OROV. C. quinquefasciatus
is an excellent reservatory, transmitting OROV only in
high viremic levels. Oropouche fever is clinically similar
but milder than Dengue Fever and, serology has been
demonstrated in humans in two cities from Pará in the
border with MT, affected by Cuiabá-Santarém highway.
This is the first report of OROV in MT. * Project developed
with funds from CAPES, CNPq and PROPEQ / UFMT.
HV576 - Development Of A Real-Time Pcr
Plataform For Viral Meningitis Diagnosis
Oliveira, D.B., Almeida, G.M.F., Botelho, L.M., Abrahão,
J.S., Bonjardim, C.A., Trindade, G.S., Ferreira, P.C.P.,
Kroon, E.G.
Universidade Federal de Minas Gerais, UFMG, Avenida
Antônio Carlos, 6627, Caixa Postal 486, Bloco F4, Sala 258
31270-901 Bel
Meningitis is a worldwide disease, which main etiologic
agents are viruses, bacteria and fungus. Viruses are the
main causes of central nervous system (CNS) infection
around the world. In Brazil, there are 11,500 cases
/ year putative reported cases of viral meningitis.
However, for most cases there is no identification of the
etiological agent. Human Herpesvirus 1 (HHV 1), Human
Herpesvirus 2 (HHV 2), Human Herpesvirus 3 (HHV 3),
viruses from the Enterovirus genus (ENTV) and viruses
from the Flavivirus genus (FLAV) are the main etiological
agents of viral meningitis. The objective of this work was
to develop a real-time PCR platform for HHV 1, HHV 2,
HHV 3, ENTV and FLAV diagnosis in cerebrospinal fluid
(CSF) of patients with clinical suspect of viral meningitis.
Primers were designed (or based on literature), targeting
conserved regions in the genome of these virus (HHV 1,
HHV2, HHV 3 and HHV 5) or genus (ENTV and FLAV).
The viral isolates HHV 1 EK, HHV 2 (ATCC VR 590), HHV
3 HC05, Enterovirus C (Sabin) and Yellow fever virus
(17D strain) were used during the initial primer tests.
In order to obtain the control plasmids, the amplicons
were cloned in pGEM ®-T Easy system. These plasmids
were sequenced and used to calculate the reactions
efficiency. To test the analytical sensitivity, a matrix
that mimics the CSF with known amounts of viral load
was used. The reactions used in this platform showed
high efficiency114% for HHV1 and HHV2, 113% for
HHV 3, 110% ENTV and 92% FLAV. When an analytical
sensitivity test was performed, our data demonstrated
high sensitivity, with detection limit up to 1 PFU/µl
for HHV 1, ENTV and FLAV. Therefore, the described
tests showed that our platform can be useful for rapid
diagnosis of viral meningitis, in the health system. In
the future, it can be used as a tool for monitoring and
control of meningitis caused by virus. Financial Support:
FAPEMIG, CNPq, CAPES.
HV579 - The Risk For The Dengue Hemorrahgic
Fever In An Association Study In Brazil
Nascimento, J.H.F., Melo, P.R.S., Rani, M.R.S., Blanton,
R.E.
1. Universidade Estadual de Santa Cruz, LAFEM/
UESC, Rodovia Jorge Amado, km 16, Bairro Salobrinho,
Ilhéus/BA. CEP 45662-900
2. Case Western Reserve University, CWRU/CGHD,
2103, Cornell Rd. Celeveland, OH. 44106. USA
The dengue virus (DENV) infection has become one
of the most important arthropod-borne diseases,
particularly in Latin America and Asian where the
outbreaks occur regularly. The dengue infection outcome
is a result on interactions between the virus, immune
system response and human genetic factors, as in most
multifactorial biological process. Despite the severity of
the DHF, only 2 – 4% of those with secondary infections
will develop and only 1%, DSS. This observation
suggests that human genetic factors may in part, at least,
interfere in DENV infection outcome. The post-genomic
era has created new methods for understanding the role
and relationship between genetic factors and diseases,
identifying candidate genes, however the knowledge
of the host genetics influence on dengue severity is
limited. The goal of this study is to identify SNPs in
candidate genes (IL28B, JAK1, CD209, MICB and PLCE1)
in association with clinical presentation of Dengue in
samples from the state of Bahia and Mato Grosso (Brazil).
We perform genotyping assays in 300 samples (94 DHF
and 206 DF), using ABI Taqman Allelic Discrimination
Assay. The statistical analyses were performed using the
VassarStats. Differences were assessed by chi-square
test. The Fisher test was used to evaluate the association
between IL28b, the rs12979860 TT genotype, JAK1, the
159
Human Virology: HV
rs11208534 genotype AA, and the risk of developing
the hemorrhagic form of the fever. Tests were two-sided
and p<0.05 were considered significant. Furthermore, to
evaluate the ancestry influence, in this study, we use 10
ancestry markers. It’s noteworthy that understanding
the host response and the pathogens mechanisms is
determinant in developing vaccines and drugs, relating
to efficiency and safety, besides, it’s important for
improving health aspects in developing countries, which
some diseases represent huge challenges to public
health, such as in Brazil, where the DHF is among the
most severe infectious grievances. Financial Support:
CNPq
HV589 - Emergence Of A New Dengue Serotype
In Southeast Asia
Vasilakis, N.
University of Texas Medical Branch , UTMB, USA
Sylvatic dengue viruses (DENV) are both evolutionarily
and ecologically distinct from human DENV and are
maintained in an enzootic transmission cycle. Evidence of
sylvatic human infections from West Africa and Southeast
Asia suggests that sylvatic DENV come into regular
contact with humans. Previously, we have demonstrated
experimentally in surrogate models of human infection
and mosquitoes that adaptation was not required for
urban transmission and thus emergence into the human
transmission cycle is high. Critically, the underlying
mechanisms of dengue emergence will provide key
insights into the epidemiology and risk of arboviral
infections in Southeast Asia; these may also lead to the
preparation of guidelines for arbovirus surveillance,
control and outbreak management. The objective of this
study was to investigate the nature and breadth of the
newly emerged novel sylvatic dengue transmission by
determining the distribution, ecology and behavior of the
sylvatic mosquito species that facilitate its maintenance
in the zoonotic cycle. Our research focused on the
sylvatic transmission cycle in Sarawak, Malaysia, where
this cycle was recently detected and critically where
human infections have been identified, including those
responsible for severe disease. Phylogenetic analysis
indicates that this virus is basal to all other serotypes
suggesting its deep ancestral origin. Serology based on
the plaque reduction neutralization test indicates that
the antigenic relationship of the newly emerged virus
is significantly different than any of the other four types
of dengue viruses. Our results indicate the isolation and
characterization of a new sylvatic dengue serotype that
has not yet emerged and established into the human
transmission cycle. This finding has major implications
for the long-term control of dengue using vaccines
currently under development.
HV590 - Dengue Viruses In The State Of Rio
Grande Do Norte, Brazil, 2010-2012
Branco, M.S.D., Sousa, D.M.C., Monteiro, J.D., Costa,
D.M.P., Costa, C.D., Lima, T.L.C., Almeida Junior, R.F.,
Roque, A.C.M., Aquino, A.A., Farias, K.J.S., Fernandes,
J.V., Araújo, J.M.G.
1. Universidade Federal do Rio Grande do Norte ,
UFRN, Departamento de Microbiologia e Parasitologia, CB,
Campus Universitário, Natal
2. Laboratório Central Doutor Almino Fernandes,
LACEN-RN, Rua Cônego Monte, 410 - Quintas Cep: 59.037170. Natal-RN
Dengue is a mosquito-borne viral infection caused by
one of the four dengue virus serotypes (DENV-1 to 4),
belonging to genus Flavivirus, family Flaviviridae. In this
study, we present the results of a laboratory surveillance
conducted in the State of Rio Grande do Norte during the
period from 2010 to 2012. A total of 1,581 cases, reported
between January 2010 and December 2012 at various
health centers in the state, were studied by the method
of virus isolation and / or RT-PCR for viral detection and
typing. The infection was confirmed by virus isolation in
27% of the cases, while the RT-PCR confirmed 24% of
the cases studied; the union of the two methodologies
confirmed 30% of the cases studied. This study detected
the circulation of all four serotypes of dengue virus in
Rio Grande do Norte, with the circulation of DENV-1,
DENV-2, and DENV-3 in 2010, and the circulation of
DENV-1, DENV- 2, and the introduction of DENV-4 in the
state in 2011, after a 30-year period without registration
in the country. In 2012, only the circulation of DENV-4
was detected. Regarding the spatial distribution, almost
60% of positive cases occurred in Natal and Parnamirim.
The monthly distribution showed a greater number of
positive cases in the months of April (21%) and May
(23%) (X2: 61.13, df = 11, p <0.0001). The most affected
age group was 0-10 years with 38% positive cases, and
only in 2012, the age group 11-30 years was the most
affected with 51.33% of the cases (X2: 27, 83, df = 6, p =
0.0001). Regarding gender, females represented 52% of
the cases. Continuous monitoring of circulating serotype
is critical for dengue surveillance not only to detect the
introduction of a new serotype, but also to understand
the transmission on disease severity and the shift from
age groups among different populations and regions.
HV592 - Detection Of Herpes Simplex Virus
Type 1 In The Genital Tract Of Pregnant
And Nonpregnant Women
Lima, E.G., Miranda, C.A.N., Cobucci, R.N.O., Lima,
D.B.S., Fernandes, T.A.A.M., Araújo, J.M.G., Fernandes,
J.V.
160
Human Virology: HV
1. Universidade Federal do Rio Grande do Norte,
UFRN, Campus Universitário
2. Universidade Potiguar, UnP, Av Salgado filho - Natal
RN
3. Universidade do Estado do Rio Grande Norte, UERN,
Mossoró - RN
Herpes simplex virus (HSV) has two closely related
serotypes, HSV-1 and HSV-2, which are a common
cause of sexually transmitted disease. HSV-1 is usually
transmitted during childhood via non-sexual contact
and traditionally has been associated primarily with
orofacial infections. However, HSV-1 has emerged during
the last decades as the main causative agent of genital
herpes. Recent studies have shown a greater proportion
of first-episodes of genital herpes were caused by HSV1. In pregnant women the virus can reach the fetus or
neonate, causing neonatal herpes, which is a potentially
devastating disease. The aim of this study was to
evaluate the prevalence of genital infection by HSV-1,
correlating with the results of cytologic and colposcopic
examinations and to identify risk factors. Included in
this study were 236 patients- 106 pregnant and 130
nonpregnant attended in the screening program for
cervical cancer, in Natal/RN, Brazil, during the period
2011-2012. The patients were examined by colposcopy,
and then two cervical specimens were collected, one
for the cytologic exam and the other for analysis by
PCR to amplify a sequence of the genome of HSV-1.
Statistical analysis was performed by comparison tests
of proportion and univariate logistic regression to
calculate odds ratios and their respective confidence
intervals, considering significant a p-value ≤ 0.05. The
overall prevalence of HSV-1 infection was 28.4%, being
21.7% in pregnant and 33.8% in non-pregnant women,
there significant difference. No correlation was observed
between the presence of the virus and the occurrence of
cervical changes detected by the cytologic or colposcopic
examinations. Analysis of the relationship between
genital infection by HSV-1 and socio-demographic
variables and sexual activity revealed no association.
We found a high prevalence of genital infection by HSV1, with a higher rate among non-pregnant women, but
this was not found to be associated with the presence of
cervical changes nor with socio-demographic variables
and sexual activity.
HV593 - Lack Of Knowledge As A Risk Factor
In Human Papillomavirus (Hpv) Infections
Venezuela, R.F., Monetti, M.S., Kiguen, A.X., Frutos, M.C.,
Mosmann, J.P., Juan Ferrari, J., Luis Kremer, L., Rosa
Molina R., Hugo Bolatti, H., Javier Aguilar, J., Jorge Paván,
J., Carlos Alonso, C., Alberto Wolfenson, A., Claudia
Amusategui, C., Cecilia Cuffini, C.
1. Instituto de Virología-FCM.UNC, , Enfermera
Gordillo s/n. Ciudad Universitaria. Córdoba, Argentina
2. Catedra de Ginecología. Htal. Nacional de Clínicas.,
, Santa Rosa 1564. Córdoba, Argentina
3. Servicio de Infectología. Hospital Nacional de
Clínicas, , Santa Rosa 1564. Córdoba, Argentina
4. Laboratorio de Reproducción y Androgenesis, ,
Chacabuco 1123. PB. Córdoba, Argentina
5. Dpto de Tocoginecología Quirúrgica. Htal Materno
Neonatal, , Av Cardeñosa 2900. Córdoba, Argentina
6. Cátedra de Química Biológica. Facultad de
Odontología, , Haya de la Torre s/n. Ciudad Universitaria.
Córdoba, Argentina
7. Cátedra de Bacteriología y Virología. FCM-UNC, ,
Santa Rosa 1095. Córdoba, Argentina
8. Administración Provincial de Seguro de Salud, , M. T
de Alvear 758. Córdoba, Argentina
9. Facultad de Matemática, Astronomía y Física., ,
Av Medina Allende s/n. Ciudad Universitaria. Córdoba,
Argentina
10. Instituto de Educación Superior. “Dr Domingo
Cabred”,Deodoro Roca s/n. Parque Sarmiento. Córdoba,
Argentina
Most HPV studies are oriented to the etiology and
natural history of the infection, and their relationship
with cancer, however, there are few studies aimed at
evaluating the population` knowledge. Objective: To
analyze the degree of knowledge of the population
about HPV and its prevention. From July to November
2012, we conducted a survey with 27 multiple-choice
items, to first-year university students of: National
University of Cordoba (UNC), the Institute Dr. Domingo
Cabred; patients of service: gynecology of two public
hospitals (HP), infectology of HP, a private laboratory
and one of UNC, and employees and affiliates of the
biggest provincial health care insurance. The survey
consisted of two sections: individual characteristics
and Basic knowledge of HPV. Volunteers aged 18 to 80
participated (N=1,297). Most were single, with access
to secondary education, jobless, heterosexual, without
history of STIs and HPV heard about through the media.
The total number of correct responses (CR) was 44.92%.
The frequency of Pap (84.97%) was the best and the
protection for condom use (9.79%), the worst. The RC
for relationship HPV and cervical cancer was 62.07%;
and with warts 40.02%. Almost 55% did not know
about types of HPV that the vaccines protect. Statistical
analysis shows that: women, single people, workers, the
better educated, those who have had an STI or HPV and
receiving information through medical or educational
establishments have greater knowledge of the topic. Only
161
Human Virology: HV
0.15 % of participants answered all questions correctly.
This is the first study in Cordoba city, which assesses
knowledge about HPV among people over 18 and
demonstrates lack of knowledge. This lack of knowledge
is a risk factor and as such, prevention programs, not
only should emphasize diagnosis and the vaccines, but
also incorporate new communication strategies that
allow the arrival of information accurately, to different
strata of society.
HV594 - Prevalence Of Genital Infection
By Herpes Simplex Virus Type 2 In Pregnant
And Nonpregnant Women
Miranda, C.A.N., Lima, E.G., Cobucci, R.N.O., Lima,
D.B.S., Fernandes, T.A.A.M., Araújo, J.M.G., Fernandes,
J.V.
1. Universidade Federal do Rio Grande do Norte,
UFRN, Campus Universitário
2. Universidade Potiguar, UnP, Av Salgado filho - Natal
RN
3. Universidade do Estado do Rio Grande Norte, UERN,
Mossoró - RN
Herpes simplex virus type 2 (HSV-2) is a neurotropic
virus, which infects epithelial cells after it is transported
to the neurons, generally of the lombosacrais ganglia,
where it remains latent and may be reactivated
periodically. It is the most common cause of anogenital
ulcers and during pregnancy may cause eye or skin
lesions, meningoencephalitis, disseminated infections,
or foetal malformations. The aim of this study was
to evaluate the prevalence of genital infection by
HSV-2, correlating with the results of cytologic and
colposcopic examinations, and to identify risk factors.
Participants included 236 women (106 pregnant and
130 nonpregnant) enrolled in a screening program for
cervical cancer in Natal / RN, in the period 2011-2012.
The patients answered a standardized questionnaire
and underwent a colposcopy examination. Then, two
cervical specimens were collected—one for cytologic
examination and the other for analysis by PCR to amplify
a sequence of the genome of HSV-2. Statistical analysis
was performed by comparison tests of proportion and
univariate logistic regression to calculate odds ratios
and their respective confidence intervals, considering a
significant p-value of ≤ 0.05. The overall prevalence of
HSV-2 infection was 16.5%, with 17.9% in pregnant and
15.4% in non-pregnant women. There was no significant
difference between the two groups. A higher proportion
of women tested positive for HSV-2 among those who
had changes in both colposcopy and cytology, with
no significant difference between pregnant and nonpregnant. Analysis of the relationship between genital
infection by HSV-2 with socio-demographic variables
and sexual activity revealed an association with
ethnicity, marital status, and number of sexual partners.
The women in this study had a high prevalence of genital
infection by HSV-2, with higher rates among single white
women who had multiple sexual partners over their
lifetime. No association with pregnancy was found.
HV595 - Detection Of Human Papillomavirus
(Hpv) In Oral Cavity Lesions: Comparison
With Other Risk Factors
Venezuela, R.F., Angel, T., Frutos, M.C., Kiguen, A.X.,
Monetti, M.S., Sollazo, M., De Prato, R.F., Cuffini, C.
1. Instituto de Virología-FCM.UNC, , Enfermera
Gordillo s/n. Ciudad Universitaria. Córdoba, Argentina
2. Cátedra de Estomatología. Facultad de Odontología.
UNC, , Haya de la Torre s/n. Ciudad Universitaria. Córdoba,
Argentina
Human papillomavirus (HPV) is considered the causative
agent of cervix cancer; however, its relationship with
oral cancer is controversial. Objectives: To detect the
presence of HPV genotypes in lesions of the oral cavity
and its correlation with other risk factors. Material and
Methods: Presence of HPV was studied by polymerase
chain reaction in samples from benign lesions (9 cases),
potentially malignant lesions (30 cases), neoplasias
(16 cases) and healthy mucosae (30 control). The
results from the different groups were compared; in
addition to their clinical histopathological variables and
conventional risk factors (tobacco smoking and alcohol
consumption, mainly). Results: HPV was detected in
88.89% of the samples from oral benign lesions, 41.38%
of oral PML samples and 56.25% of oral neoplasias. HPV
was not detected in the control group. The most prevalent
genotypes were 16 and 6. Together, these two genotypes
reached 55% of the total number of cases. A significant
association was observed between HPV and male gender,
tobacco smokers, alcohol drinkers and benign lesions.
Tobacco smoking and alcohol intake were associated
to neoplasias. Conclusions: Our results showed that
conventional risk factors like tobacco smoking and
alcohol drinking, have more influence than HPV in the
development of oral neoplasias; however, 56.2% of the
neoplasias tested positive for HPV; the percentage of
HR-HPV detection increased with the severity of the
lesions, suggesting its possible involvement in malignant
processes. PIO-MincytCba N 170/2011.
HV596 - Mutation Study Associated With
Carcinogenesis Of Human Papillomavirus
Genotype 16, Detected In Cervical Lesions.
Mosmann, J., Frutos, M.C., Monetti, M., Kiguen, A.X.,
Venezuela, R.F., Cuffini, C.
162
Human Virology: HV
Instituto de Virología Dr JM Vanella, FCM-U. N. de
Córdoba, Ciudad universitaria. Cba. Argentina
Human papillomavirus (HPV) is responsible for one of
the most frequent sexually transmitted infections. The
first phylogenetic analysis of LCR region was performed
by Ho et al. Currently, 4 variants have been described:
African (Af-1; Af-2), Asian-American (AA) and European
(E). Smith proposed sub-lineages of the E variant and
other investigators claim that specific mutations in the
E6 and LCR sequences could be related to persistent viral
infections. The aim of this study was the phylogenetic
study of HPV16 sequences of cervical samples in order to
detect the circulating lineages and analyze the presence
of mutations related to malignancies. Fifteen samples
of HPV16 were studied, they were analyzed by PCR for
L1, E6 and LCR regions and sequenced. Phylogenetic
trees were constructed by Maximum Likelihood with
parameters suggested by JModelTest 3.7, with boostrap
and 1000 pseudoreplica. The phylogenetic analysis
determined that 86% of the samples belonged to the
variant E, to AF-1 7% and to AF-2 another 7%. The
most frequent mutation detected in LCR sequences was
G7521A, in 80% of the analyzed samples; it affects the
binding site of a transcription factor (YY1) that could
contribute to carcinogenesis. Other nucleotide changes
were detected in LCR which could affect the regulation
positive or negative of HPV transcription. In the E6
sequences, the most common mutation was T350G
(L83V) in 67% of the samples, associated with increased
risk of persistent infection. These results are the first
contribution on molecular epidemiology of HPV16
in Cordoba. The high detection rate of the E variant is
consistent with the patterns of human migration. The
importance of the study of circulating variants and the
analysis of the presence of changes in the nucleotide
structure is significant, in two areas: in molecular
epidemiology and also in the impact of these variations
on Public Health Affairs when they are correlated to the
evolution towards malign processes.
HV599 - Comparative Analysis Between
Two Instruments With Potential Use For
Multiplex Assays In An Automated System
Loureiro, B.O., Silva, L.B.R., Mello, M.B., Fonseca, B.P.F.,
Marques, C.F.S., Silva, E.D., Pinto, A.G.
Bio manguinhos/Fiocruz, BM/Fiocruz, Av. Brasil, 4365
- Manguinhos- Rio de Janeiro - RJ
Considerable progress has been observed in virological
diagnosis during the recent decades, especially in
regards to speed, flexibility and operability. The Enzyme
Linked Immuno Sorbent Assay (ELISAS) represented
a remarkable breakthrough, and is still widely used
today. However, this technology shows an important
disadvantage compared to modern methods, since it is
not suitable for multiplex assays, a major improvement,
especially for blood centers. The multiplex bead array
assays (MBBA) has proven to be a robust and modern
option for the development of serological multiplexes
assays. Among the options for MBBA, xMAP ® technology
(Luminex, Austin) is the one with great processing
capacity of multiple analytes in a single sample
(multliplex). The technology is based on microfluidics,
and on polystyrene microspheres of 6.5 micrometers
in diameter as capture support for molecules, which
can include any type of protein. Each microsphere
is internally filled with different proportions of two
fluorescent dyes, which creates different sets of
microspheres, enabling simultaneously detection of
different targets. The aim of this work was to analyze
the performance of two instruments from Luminex (LX
200 and MAGPIX) for qualitative diagnosis of HIV and
HCV. The main advantage of LX200 is the possibility of
using more analytes (100) than Magpix (50). The main
advantages of Magpix over Luminex 200 are: lower cost
of purchase and maintenance, and less space required.
These characteristics have great relevance for high
throughput laboratories , where several instruments are
required. For this study, 83 reference samples (including
positive samples for HIV and HCV and negative samples)
and backgrounds were selected. The samples were
analyzed in parallel by both instruments, and the results
(MFI values) were used for statistical analysis. The
correlation coefficient was calculated and the result
obtained (90,76%) and suggested a strong correlation
between the two LX200 and MagPix, corroborating
previous findings and allowing for the free choice
between these instruments, according to the application
and laboratory needs, regarding multiplex capability.
HV600 - Comparison Of The Directigen Ez
Flu A+B Test, The Quickvue Influenza A+B
Test And The Bioeasy Influenza Ag A/B/A
H1n1 Pandemic Test For Rapid Diagnosis Of
Influenza Virus Infection
Colmanetti, T.C., Barboza, J.D.B., Macedo, P.V., Thomazelli,
L.M., Oliveira, D.B.L., Durigon, E.L.
Instituto de Ciências Biomédicas USP, ICB - USP, Av.
Prof. Lineu Prestes, 1374 - Cidade Universitária
Influenza is an acute, typically febrile, respiratory
illness having outbreaks of varying severity with the
winter months heavily affecting children and the elderly.
While both Influenza type A and B can cause epidemic
outbreaks, Influenza A outbreaks generally increases
the rates of hospitalization for lower respiratory tract
disease amongst infants and children. Due to a higher
163
Human Virology: HV
mortality rate it is essential to differentiation between
Influenza and other respiratory viruses. The virus is
preventable by vaccination and can now be managed
with specific antivirals. This study aimed to compare
the diagnostic performances of three enzyme-linked
immunosorbent assays; Directigen EZ Flu A+B (BD,
Maryland, USA), QuickVue Influenza A+B test (Quidel,
San Diego, USA) and Bioeasy Influenza Ag A/B/A H1N1
Pandemic (Bioeasy, Belo Horizonte, BRA) with viral
culture (Influenza A) and clinical samples (Influenza
B) previously quantified by Real-time RT PCR. All the
tests were performed in accordance to the manufacturer
instructions. For the first test we used a series of dilutions
(1, 1/5, 1/10, 1/20, 1/40) of the Influenza A sample
T-25 (ct = 23.22) isolated in MDCK cells with a viral
load of 1.04e5 copies of DNA to compare the diagnostic
performances of the Directigen and the QuickVue. With
the second test we used the same methodology for
Influenza B clinical nasopharyngeal wash sample R-950
(ct = 30.06) with a viral load of 4.15e3 copies of DNA
to compare the Directigen and the Bioeasy. Our study
demonstrated the effectiveness of the test by returning
no invalid results (n=20) from heavily diluted samples.
The detection of Influenza A ranged from a 20 fold
dilution by Directigen and 10 fold by QuickVue while
Influenza B had a 5 fold dilution for both Directgen and
Bioeasy assays. In conclusion, our findings suggests that
Directigen has a higher diagnostic yield than QuickVue
for influenza virus type A and the same yield that Bioeasy
for influenza B virus. All assays showed good accuracy
and speed with results being obtained within 15 and 20
minutes, including labor and incubate time. Financial
support: FUSP
HV605
Differential
Diagnosis
Of
Cytomegalovirus And Bk- Virus Infections
In Renal Transplant Recipients Inpatient Belém / Pa, Brazil.
Arruda, L.M.F., Silva, D.F.L., Cruz, A.C.R., Sagica, F.E.S.,
Cavalcante, M.D., Felipe, N.S., Marluce, M.M.
Instituto Evandro Chagas, IEC/SVS/MS, Ananindeua,
Pará, Brasil
The incidence of opportunistic viruses such as
cytomegalovirus and BK virus is increasing worldwide,
there is increasingly a need for a differential diagnosis
to identify and quantify the viral load in individuals
suffering from infections caused by such viruses.
The transplanted organs such as kidney need
immunosuppressant to prevent rejection of the graft,
which can trigger CMV and / or BKV infections. The
study made the differential diagnosis of CMV and BKV
infections in 111 kidney transplant at Ofhir Loyola
Hospital, for the period 14/06/10-11/04/13, through
the Polymerase Chain Reaction Real Time (Q-CMV and
Q-BKV). Which were made according to the instructions
of the manufacturer Nanogen Diagnostics kits, the
7500 Real Time PCR System Apllied Biosystem. Of the
111 treated, 70 (63,06%) were male adults. Calculating
the average viral load of CMV (CVCMV) according to
the presence or absence of symptoms, it was found to
119.673 symptomatic and 2.413 asymptomatic (t = 1,87
p = 0,03 p < 0,05). Calculating the Chi-square CVCMV
with the presence of symptoms, we obtain the CVCMV
greater significance than the BKV viral load (CVBKV)(X2
=29,19 p<0,0001).The CVBKV of 46,12 copies / ml was
detected in a male patient aged 42, who also presented
CVCMV 1219,20 copies / ml. Comparing symptomatic
and CVCMV low or high according to the standard limit
(1.034 copias/ml - 66,660 milhoes copies / ml), checked
by Fisher Test CVCMV found that high is proportional
to the presence of clinical manifestations observed in
patients (p<0,01). As cadres of fever, diarrhea, vomiting,
abdominal pain, weight loss weight, asthenia, leukopenia,
cough among others. In this study was concluded that
CMV was the main virus associated with opportunistic
infection among renal transplant, through its significant
incidence and verification of a co-infection with BKV in
a study patient.
HV606 - P53, Cyclin D1 And P16 Protein
Expression In Samples Of Penile Carcinoma
Of Infected Patients By High Risk Hpv.
Camilo, H.P., Mota, M.T.O., Calmon, M.F., Bonfim, C.M.,
Arruda, J.G.F., Soares, F.A., Bonilha, J.L., Rahal, P.
1. Instituto de Biociências, Letras e Ciências Exatas
- UNESP, IBILCE/UNESP, Rua Cristóvão Colombo, 2265
Bairro: Jd. Nazareth 15054-000 São José do Rio Preto
2. Faculdade de Medicina de São José do Rio Preto ,
FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro. São José
do Rio Preto
3. Departamento de Anatomia Patológica, Hospital
A.C. Camargo, , A.C. Camargo, R. Professor Antônio Prudente,
211, Liberdade CEP 01509 - 010. São Paulo - SP
Penile carcinoma (PC) is a rare invasive tumor with
high morbidity resulting from the disease itself and/or
treatment. The human papillomavirus (HPV) is divided in
high risk (HR) and low risk (LR), according to oncogenic
potential. Moreover, in the last years HR HPV has been
found as major risk factor observed to PC development.
Two viral proteins, E6 e E7, have been associated with
destabilization cell mechanisms in other carcinomas
types caused by HPV; however, the involved molecular
mechanisms in the viral replication and its host cells
interaction are not elucidated yet. The aim of this project
was to verify expressions of proteins p53, cyclin D1 and
164
Human Virology: HV
p16, which are cell proteins responsible by cell cycle, in
PC samples. In 60 samples was verified HPV presence
and its genotypes by INNOLiPA® kit (HR HPV: 22; LR
HPV: 11; Negative samples:27) and from these, 36 slides
were prepared and utilized to imunohistochemical assay
to verify the quantitative expression of p16, p53 and
cyclin D1 by optical desitometry. A comparative study
was performed between slides from infected patients
samples by HR HPV and without infection patients. p53
e cyclin D1 proteins showed low expression in HR HPV
when compared with negative HPV samples, nonetheless
p16 protein showed an increase expression in HR HPV
comparing with negative samples (p<0,05). Studies with
other carcinoma types have been demonstrated viral
proteins capacity of deregulating cell cycle of host. The
viral protein E6, has been associated to degradation
of p53 protein, as well as E7 protein to destabilize
phosphorylation pathway of Rb protein (pRb), which
Cyclin D1 and p16 protein are closely related. However,
because it is a rare carcinoma, there are not many studies
with samples of PC. Therefore, our data can contribute
to understand PC carcinogenesis, and can also be of
great importance for patients’ diagnosis and prognosis,
and may even define new biomarkers useful for clinical
analysis.
HV607 - Quantitative Antigenemia Assay To
Monitoring Cmv Therapy And Disease In
Liver Transplant Patients
Cunha, A.G., Cunha, A.M.G., Solla, D.J.F., Zantieff, R.,
Galvão-Castro, B., Meyer, R.
1. Universidade Federal da Bahia, UFBA, Campus do
Canela, Instituto de Ciências da Saúde, Pós-graduação em
Imunologia
2. Fundação Oswaldo Cruz, FIOCRUZ - LASP, Rua
Waldemar Falcão, 121, Candeal
3. Escola Bahiana de Medicina e Saúde Pública,
EBMSP, Campus do Cabula e Brotas, Centro de HTLV
Active Cytomegalovirus (CMV) infection is a major cause
of graft loss and patient death in solid organ transplant.
Our goal was to start CMV quantative antigenemia to
monitor active infection, assessing disease development
and the need of specific antiviral therapy in liver
transplants. From march 2007 through march 2009, 33
liver recipients were monitored for active CMV infection.
CMV seroprevalence was 89% in liver recipients
and 70% in organ donors. Fluorescence quantative
antigenemia for the detection of pp65 antigen was used
for active CMV infection diagnosis (CMV-Brite-Turbo).
Patient monitoring occurred for periods of six months to
one year, and the antigenemia assay was positive in 52%
(17/33) of patients, with 41% of which (7/17) presenting
at least ten positive cells in 200,000 White Blood Cells
(WBC) assessed. Positive assay occurred in an average of
63.5 days after transplant, varying from 27 to 259 days.
Leukopenia related to thrombocytopenia was frequently
seen in patients with ten or more positive cells (84%)
and was rare in patients with less than ten positive cells
(<20%). Weakness and gastrointestinal disturbances
were the most frequent symptoms. All patients with at
least ten positive cells were treated using Gancyclovir
in order to get a negative antigenemia. Patients with no
symptoms and less than ten positive cells were controlled
through immunosuppression management, evolving
to a negative assay in the follow-up. CMV quantitative
antigenemia assay was efficient in post-transplant
monitoring of liver recipients, demonstrating a high
frequency of active CMV infection. Patients with at least
ten positive cells in 200,000 WBC presented high risk
of CMV disease. Immunosuppression management was
sufficient for the control of CMV infection in most patients
with less ten positive cells. This study was approved by
Ethnics Committee of the institutions involved and all
patients signed consentiments to participate. Financial
Support: CNPq and FAPESB
HV608 - Cmv And Hhv-6 Co-Infection In Liver
Transplant Patient
Cunha, A.M.G., Cunha, A.G., Costa, S.C.B., Andrade, P.D.,
Galvão-Castro, B., Meyer, R.
1. Universidade Federal da Bahia, UFBA, Capus do
Canela
2. Escola Bahiana de Medicina e Saúde Pública ,
EBMSP, Campus Cabula
3. Fundação Oswaldo Cruz , FIOCRUZ - LASP, Brotas
4. Universidade Estadual de Campinas, UNICAMP,
Barão Geraldo
5. Hospital Português, HP, Graça
Cytomegalovirus (CMV) is the leading viral infection
among liver transplant recipients, contributing to
morbidity and mortality. However, little is known about
HHV-6 and CMV co-infection in liver transplant recipients
(LTR). We have reported a case of a 56-year-old man who
underwent orthotopic liver transplantation. CMV IgG
was positive. Postoperative period was uneventful. On
the 21st postoperative day (POD) he was rehospitalized
due to high fever (38.5°C) and skin rash. He developed
Leukopenia and liver dysfunction. Serologic assays
were performed for detection Herpes simplex virus,
Dengue virus, Measles virus and syphilis, all of which
were negative. Nested-PCR in serum samples was
positive for HHV-6 and CMV antigenemia was negative.
Immunosuppressive therapy was reassessed. Patient
presented progressive improvement of WBC and clinical
status, with no fever or skin rash, discharged again in
165
Human Virology: HV
the 34th POD. CMV antigenemia persisted negative on
the 45th POD, but became positive on the 60th POD,
with high number of positive cells (465 positive cells in
200,000 WBC). A new hospitalization was needed for i.v.
Gancyclovir, discharged on the 78th POD, with a negative
CMV antigenemia. Another hospitalization occurred on
the 116th POD due to right thigh cellulitis and fever
which latter presented as muscular abscess. Drainage
was performed and antibiotic started, improving local
infection. The last hospitalization occurred on the 190th
POD, due to brain lesions and mental disorientation.
Lab reports revealed Corynebacterium sp. and Candida
guilliermondii. New antibiotic treatment was performed
and he evolved without neurologic sequelae. This case
suggests that HHV-6 active and symptomatic infection
may be a serious and potentially life-threatening
pathogen following liver transplantation. HHV-6
active infection cause fever, leukopenia and probably
contributed for CMV reactivation, bacterial sepsis and
neurologic disease. Clinical manifestations of HHV-6
infections in these patients are not subject to such a clear
consensus and it is important to continue investigating
HHV-6 pathogenesis in liver transplant. Financial
Support: CNPq and FAPESB
HV611 - Seroprevalence Of Antibodies
Against Hs1 And Hsv2 In Brazilian Patients
With Pemphigus, Familiars And Neighbors.
Machado, A.R.S.R., Dos Santos, P.V.W.G., Nascimento,
M.P., De Paula, N.A., Machado, A.M., Roselino, A.M.
as control groups of pemphigus patients. It was observed
similar seroprevalence in the four studied groups for
HSV1 (91.5 to 96.1%), and for HSV2 (18.1 to 30.8%)
when compared to Brazilian population (95% and 22%,
respectively). In relation to HSV1, the medians of RU
(relative units) resulted 176.1 for PF, 207.3 for PV, 163.6
for familiar and 184.2 for neighbor groups. Interestingly,
there was higher anti-HSV1 titers in PV group when
compared to PF, familiar and neighbor groups (p<0.05).
There was no significance amongst the groups for HSV2.
Searching for HSV1 and HSV2 antigens in 47 serum or
plasma pemphigus samples resulted negative by realtime PCR. In conclusion, the results confirm that HSV1
may be related to the pathogenesis of PV, suggesting
that probably there is a particular genetic profile with
no participation of HSV1 transmission by familiars since
their titles of anti-HSV1 were lower than the others
studied groups.
HV612 - Implementation Of Rt-Pcr In The
Confirmation And Identification Of Denv
Serotypes Circulating In Patients With
Suspected Dengue Virus Infection At The
Hospital Das Clinicas, Unicamp, Campinas/
Sp
Mompean, P.V., Fajardo, T.C.G., Padovani, R., Vedovello,
D., Nogueira, M.L., Colombo, T.E., Araki, C.S., Bonon,
S.H.A., Costa, S.C.B.
Faculdade de Medicina de Ribeirão Preto - USP, FMRPUSP, Av. Bandeirantes, 3900, Monte Alegre, Ribeirão Preto, SP
– 14049-900
1. University of Campinas, UNICAMP, Cidade
Universitária “Zeferino Vaz” -Distrito de Barão Geraldo
2. Faculty of Medicine of São José do Rio Preto,
FAMERP, Av. Brg. Faria Lima, 5416 - Vila São Pedro São José
do Rio Preto
Pemphigus are autoimmune blistering diseases
characterized by autoantibodies against desmogleins
(Dsg), responsible for intraepidermic acantholysis.
While pemphigus vulgaris (PV) affects the skin and
mucous membranes, related to antibodies against
Dsg1 and Dsg3, pemphigus foliaceus (PF) affects only
the skin by anti-Dsg1. Our research group has been
studying the epidemiology and immune and genetic
aspects of pemphigus in the northeastern region of Sao
Paulo state, endemic region for both forms of PF and PV.
Their pathogenesis has been related to viral infections,
amongst others factors. In genetically predisposed
patients, the herpes simplex virus has been considered
as exacerbating or triggering PV. Although several
studies establish a serological epidemiology against
HSV1 and HSV2 in general population, there are no
reports in a PF or PV population. The aim of this study
was to determine the prevalence of antibodies against
HSV1 and HSV2 by ELISA assay in 149 PF and 92 PV sera
samples, comparing with 59 familiars and 26 neighbors
Introduction: According to the Health Secretary of
Campinas, in the first three months of this year (2013),
932 cases of dengue were reported, a number almost
equal to the 981 cases recorded the previous year (2012).
The advance of the disease has been so considerable that
by March 2013, 498 cases had already been recorded.
There are now six cases of dengue hemorrhagic fever,
versus the total of seven cases recorded over all of
last year. The most important thing is that the health
network knows how to accurately and agilely diagnose
these cases in order to avoid the evolution of the disease.
Objectives: In order to prevent patient complications
related to reinfection and to better control new
outbreaks, the goal of this study is to implement a rapid
method which uses reverse transcriptase polymerase
chain reaction (RT-PCR) to detect/confirm cases of
suspected dengue and to identify serotypes circulating
in patients - from Campinas and the region - treated at
HC/UNICAMP. Methods: The study are been conducted in
the Virus Laboratory of FCM / UNICAMP and utilize RT-
166
Human Virology: HV
PCR to detect viral RNA, identifying the DENV serotype
with which the patient is infected. Highly specific and
sensitive, this test is able to quickly confirm the DENV
serotype. Results: Utilizing plasma samples from
patients who were treated for suspected DENV infection
at UNICAMP, Campinas / SP in April 2013, a pilot study
found that 50% of suspected cases were positive for
DENV; of which 30% were positive for DENV-1 and 20%
for DENV-4. Conclusion: For the detection and typing of
suspected dengue cases, the implementation of RT-PCR
will allow for appropriate treatment to be instituted and
additional studies to be carried out. Furthermore, it will
help to increase the number of cases which are reported.
Alarmingly fast and aggressive, the spread of serotype
4 may trigger severe dengue disease, and it is only with
early diagnosis that an individual can take measures to
prevent and/or control this phase.
HV613 - Antibody Response And Protection
Against Dengue Virus 2 In Mice Immunized
With A Recombinant Vesicular StomatitisDengue Virus Vaccine
Lauretti, F., Miquelitto, F., Chattopadhyay, A., Pinto, L.B.,
Catro-Jorge, L., França, R., Rose, J.
1. Faculdade de Medicina de Ribeirão Preto, FMRPUSP, Av. Bandeirantes 3900
2. Yale University, Yale, New Haven/CT
Dengue, a mosquito-borne Flavivirus infection caused
by four related viruses (DENV1 to 4), is a major public
health problem in the tropics and subtropics. Although
the vaccine development has accelerated in recent years
there is no licensed vaccine yet. We are constructing a
recombinant Vesicular Stomatitis-DENV (rVSV-DENVs)
virus to test as a live attenuated vaccine in BALB/c mouse
model. The rVSV-DENV2 is based on expression of the
immunogenic domain III of envelope protein E (EDIII).
To investigate the vaccine protection, four groups of
BALB/c mice were immunized by intramuscular route
with: heat-inactivated DENV2, VSV-DENV2 EDIII, wild
type VSV or mock-infected. At 15th day mice were
boosted and at 30th day blood was collected to determine
antibody response. The animals were then challenged
with intracranial inoculation of 50DL50 of neurovirulent
DENV2 and followed for 21 days for signs of paralysis
or sickness. The total antibody titers of VSV-DENV2 EDII
vaccine were similar to heat inactivated DENV2, 1:160
and 1:200 respectively. But the neutralizing antibody
response, classically related to protection, was null to the
VSV-DENV2 EDIII vaccinees. Only animals immunized
with heat inactivated DENV2 produced neutralizing
antibody response. Although, the neutralizing antibody
response was absent, the VSV-DENV2 vaccine protected
100% of animals in the challenge experiments but with
some signs of paralysis. This protection reinforces the
idea that cell mediated immunity also plays an important
role in the protection of DENV infection. We are testing
others constructions of VSV-DENV1 and 2 that express
the entire prM and E proteins, aiming to construct one
safe and efficacious vaccine based on VSV platform.
HV615 - Screening For Hepatitis B Virus (Hbv)
In Maracanã Construction Workers
Bottecchia, M., Do Ó, K.M.R., Moraes, M.T.B.
1. Fundação Instituto Oswaldo Cruz, FIOCRUZ, Av.
Brasil, 4365 - Manguinhos, Rio de Janeiro - CEP: 21040-360
2. Hospital Alcides Carneiro, HEAC, Rua Vigário
Correas,1345 - Petrópolis - RJ, 25720320
PURPOSE OF THE STUDY: The purpose of this study was
to screen for hepatitis B virus (HBV) in Maracanã stadium
construction workers. It is part of the “Ball begins with
B and Champion with C” campaign that started on July
2012, with the objective of analyzing 12 stadiums that
will be part of the World Cup in 2014 and were under
construction/renovation. METHOD: Out of the 5500
construction workers, 1200 were tested for HBsAg. Sera
from HBsAg positive patients were collected for additional
tests. Sequencing of the HBV polymerase was carried out
in the DNA Sequencing Platform PDTIS/FIOCRUZ, using
BigDye Terminator model 3730 (Applied Biosystems,
Foster City, CA). HBV genotyping and subtyping are been
conducted by using phylogenetic analyses. SUMMARY OF
RESULTS: From the 1200 individuals analyzed, 8 (0,6%)
were HBsAg positive. Serum HBV-DNA was detectable in
6/8 (75%) patients and all these 6 patients were antiHBe positive. All of them were male with mean age of
50 years. CONCLUSION: The prevalence of HBV in the
Maracanã construction workers was lower. The most
probable route of transmission was the injection in the
army in the 80s decade. None of them heard about viral
hepatitis. This kind of campaign is very important to
prevent and educate the population.
HV616 - The Influence Of Amino Acid
Substitutions In Ns5b On Treatment
Response In Patients With Chronic
Hepatitis C Infection
Ramos, J.A. , Leão, F.B., Lopes, M.F. , Hoffmann, L., De
Souza, E.V., Ürményi, T.P., Silva, R., Rondinelli, E.
Instituções
Hepatitis C is a health problem which affects
approximately 180 million people worldwide. The NS5B
region is an HCV’s non-structural gene that encodes the
RNA polymerase RNA dependent, a key enzyme in the
virus life cycle and an important target for drugs that
aim it’s inhibition. The catalytic site is found in the B, C, D
167
Human Virology: HV
and E domains, it’s a very conserved site and mutations
in this region might interfere in it’s function and provide
resistance to the treatment. That way, it was availed if the
amino acid substitutions in these domains influenced
the response to treatment in patients infect with HCV
genotype 1. Besides that, it was also availed the presence
of resistance mutations for drugs that act in this region.
55 treated patients infected with HCV genotype 1 were
availed. Those domains were sequenced. The response
and non-response patients sequences were compared as
well as the resistance mutations. It was found that the
response patients had a major number of substitutions
than the nonresponse ones. Furthermore it was observed
a major amino acid switching in the 2671 and 2755
positions in nonresponse patients. Relative to resistance
mutations the found replacements were A338V and
C223Y, with the A338V being present in 75% of the
response patients with the 1a genotype and 95% of the
nonresponse patients with the 1b genotype and C223Y
being present in 10% of the response patients with the
1a genotype and 12% of the nonresponse patients with
1b genotype. The C316N and S368A replacements were
also found, the first one being present in 17% of the
response patients and 30% of the nonresponse patients
with the 1b genotype and the second one being present
in 7% of the nonresponse patients with the 1a genotype.
Therefore we can observed that in the population
the major number of substitutions were related with
a successful treatment, as well as the observation of
polymerase inhibitors resistance mutation in patients
that were never treated with such drugs.
HV620 - Screening Of Fecal Samples,
Obtained From Asymptomatic Children,
Using
A
Commercial
Enzyme-Linked
Immunosorbent Assay
Santos, H.C.P., Turones, L.C., Castro, I.A., Cunha, M.P.,
Fiaccadori, F.S., Souza, M.
IPTSP, Universidade Federal de Goiás, IPTSP/UFG,
Rua 235 s/n, Setor Universitário, 74605-050, Goiânia, Goiás,
Brasil
Noroviruses (NoVs) are important etiological agents of
acute gastroenteritis (AGE). It is estimated that these
agents are responsible for over 50% of the outbreaks
worldwide. Although most cases of NoV infection present
with AGE symptoms, some studies have also reported
NoV excretion by asymptomatic individuals. The NoVs
also exhibit great genomic and antigenic variability, and
the detection and characterization of the NoVs strains
is based, mainly, on molecular techniques, such as the
Reverse Transcription Polimerase Chain Reaction (RTPCR). However, there is still not a consensus among
researchers on which primer pairs are the most suitable
for NoV detection. Antigen detection commercial kits
have also been recently developed and have been
offered as a rapid an efficient method for the detection
of these agents, especially during outbreaks. However,
controversial results related to the specificity and
sensibility of these tests have been reported. Therefore,
the aim of this study was to screen fecal samples that had
been previously tested positive by RT-PCR for norovirus
and∕or sapoviruses (SaV), using a commercial ELISA kit
(RIDASCREEN® Norovirus 3rd Generation, R-Biopharm,
Darmstadt, Germany), according to the manufacturers’
instructions. For this, a panel of 60 fecal samples was
tested. These samples were obtained mainly from
asymptomatic children that attended a philanthropic
daycare center in Goiânia, from October-2010 to
October-2011. From the total 60 samples, 40 had
tested positive for NoVs by RT-PCR, and from these, 14
were also positive by the ELISA Kit (sensitivity of 35%
when compared to the molecular method). Therefore,
three GI NoV RT-PCR-positive samples and 22 GII NoV
RT-PCR-positive samples were not detected by the kit.
Furthermore, one sample that was positive, by RT-PCR
for both GI and GII NoVs was also not detected by the
kit. None of the 20 SaV-positive samples were detected
by the ELISA kit (100% specificity when compared to
RT-PCR). These results suggest that screening of fecal
samples by molecular techniques, especially those
samples that have low viral load, such as those obtained
from asymptomatic cases, should not be replaced by
antigen-detection kits.
HV623 - Correlation Of The Presence
Of Jc Polyomavirus (Jcpyv) And Human
Citomegalovirus (Hcmv) In Glioblastoma.
Da Silva, G.C., Stangherlin, L.M., Silva, M.C.C.
Universidade Federal do ABC, UFABC, Av. dos Estados,
5001 - Bairro Bangu - Santo André -SP
The JC polyomavirus (JCPyV or JCV) belongs to
Polyomaviridae family, Polyomavirinae subfamily
and is a ubiquitous virus present worldwide. The
infection in immunologically competent individuals is
normally asymptomatic and occurs in the childhood
or adolescence.At adulthood, approximately 50-80%
individuals are seropositive. In immunocompromised
individuals the virus can reactivate and infect the
central nervous system (CNS). In the CNS JCV infects
glial cells, including astrocytes and myelin production
cells, named olygodendrocytes. The most common
disease caused by this virus is the progressive multifocal
leukoencephalopathy (PML), a fatal disease that caused
by lytic infection in olygodendrocytes. Some studies
report a possible relation between JCV and cancer.
However, conflicting reports of the presence of the JCV
168
Human Virology: HV
genome in brain tumours exist. In addition, a study has
demonstrated that Human Cytomegalovirus (HCMV), a
Beta-herpesvirus possibly implicated with brain cancer
malignancy, is capable of induce JCV replication in vitro.
In the present study we aimed to detect the presence of
JCV and HCMV viral DNA in glioblastoma tumor tissues.
So far five tumor samples were tested by real-time
PCR for the presence of both viruses. HCMV DNA was
detected in all samples (100%) and JCV in 4 samples
(80%). Despite a low number of tested specimens the
results suggest a positive association between HCMV
and JCV in glioblastoma. We are currently tested more
samples for the presence of viral DNA and RNA in tumor
tissues.
YMDD motif), and one with patterns L80I, L180M and
M204I. All of these mutations were present in patients
with genotype A (one A1 and two A2). Prevalence of
drug-related resistance mutations varies according to
treatment duration and the level of genetic barrier for
the drugs used. Once the drug therapy is initiated it is
extremely important to monitor viral load and identify
those mutations in order to support clinical decisions
about patient management and also to prevent the
emergence of multidrug-resistant viruses.
1. Centro de Pesquisas Gonçalo Moniz, FIOCRUZ,
Salvador-BA
2. Lab Serv de Gastro-Hepatologia / de Pesquisa e
Infectologia, SGH/LAPI, Salvador-BA
3. Ambulatório Magalhães Neto, HUPES-UFBA,
Salvador-BA
Introduction: Renal transplantation has been widely
used in the last 20 years in order to promote the
treatment and possible cure for some diseases. However,
concerning the diversity and complexity of this kind of
treatment, it is observed that it contributes to increase
the number of patients infected with the so-called
opportunistic infections. Immunosuppression, used in
transplantation to prevent graft rejection, has potent
effects on cell-mediated immunity. It results in a high
incidence of severe and prolonged infection. The active
cytomegalovirus infection has an important role in
complications related to pediatric kidney transplants
because more than half of the newly transplanted
patients are affected by this virus, and also, it is the agent
responsible for morbidity and mortality of these patients
in about 20% of the cases. In spite of this, information
about this subject is scarce in literature. Pediatric renal
patients with pretransplant negative HCMV serology,
who receive an organ from a HCMV-seropositive donor
group, are particularly a high risk group for developing
the disease caused by HCMV. The administration of the
ganciclovir doses to patients is extremely important
to control active infection and subsequent disease
associated. This requires a laboratory surveillance
of patients from the day of transplantation until 6
months after it, using rapid and early techniques to
diagnose active infection caused by HCMV and providing
early treatment for preventing HCMV disease and
consequently rejection of the transplanted organ. This
study aims to determine the incidence, etiology and risk
factors for HCMV active infection. In order to achieve this
goal, will be studied, prospectively, 30 pediatric patients
who have received a kidney, consecutive, at the Service
HV625 - Mutations Associated With Drug
Resistance In Patients With Chronic
Hepatitis B Infection
Santos, M.I.M.A., Stoecker, A., Rugieri, S.P., DominguezSouza, B.F.C., Rosário, M.O.H.V., Paraná, R., Reis, M.G.,
Silva, L.K.
Hepatitis B virus (HBV) infection is a public health issue.
The Brazilian public health system (SUS) has provided
antiviral drugs for chronic hepatitis B treatment for over
10 years, but a system for monitoring for drug-related
resistance mutations is not available. This study aims
to determine the presence of HBV mutations associated
with resistance to nucleos(t)ide analogs among 55
patients with chronic HBV infection-naïve and treated
from University Hospital Professor Edgard Santos,
Salvador-BA (HUPES-UFBA). Briefly, HBV-DNA was
PCR amplified with primers deduced from HBV S and
P genes and sequenced using ABI Prism 3730 (Applied
Biosystems, USA). Two to six forward and reverse
sequences of each isolate were assembled and conflicting
sites were revised using software CLC Main Workbench
v. 5.0 by visual inspection of the electropherograms.
Consensus sequence lengths ranged from 1011 to 1034
bp and encompassed the entire rt domain (from amino
acid 1 to 344). Those sequences were submitted to
the HBV drug resistance database (HBVrt DB, Stanford
University, USA) to retrieve each mutation according to
genotype and treatment. HBV genotype A1 (83.6%) was
the most prevalent followed by genotype A2 (7.3%), F
(3.6%), and C1, D2 and D4 (1.8% each). Three patients
(5.5%) exhibited resistance mutations to LAM and
ENT, two with patterns L180M and M204V (within the
HV628 - Surveillance Of Active Human
Cytomegalovirus Infection (Hcmv) In
Pediatric Renal Transplantation Patients
Menoni, S.M.F., Costa, S., Bonon, S.
1. Universidade Federal De Mato Grosso Do Sul, Ufms,
Av: Ranulpho Marques Leal, 3484 – Três Lagoas – MS
2. Universidade Estadual De Campinas, Unicamp, •
Endereço: Cidade Universitária “Zeferino Vaz” - Faculty Of
Medical Sciences
169
Human Virology: HV
of Nefropediatria from the Department of Pediatrics,
FCM / UNICAMP, from the day of transplantation until
6 months after it. At the end of the study, there will be a
descriptive analysis of the cases.
HV631 - Standardization Of Human
Adenovirus Detection Using Molecular
Methods In Eye Swab Samples Of Patients
With Viral Conjunctivitis Symptoms
Baldi, C., Fajardo, T.C.G., Costa, S.C.B., Bonon, S.H.A.
University of Campinas, UNICAMP, Campus
Universitario Zeferino Vaz SN - Cidade Universitaria,
Campinas
Acute viral conjunctivitis is one of the most common
health disorders and, although it does not often cause
serious complications, has a strong economic impact
due to its contagiousness and morbidity. The Human
Adenovirus (AdvH) is of the family Adenoviridae and
is a major pathogen associated with eye infections
worldwide. The ophthalmologic manifestations of this
virus, including severe epidemic keratoconjunctivitis
(CCE), are almost exclusively caused by serotypes
AdvH - D8, AdvH - D19, and AdvH - D37. The less severe
faringoconjuntival fever is mainly caused by serotype
B11. Therefore, a pattern for detecting AdvH in ocular
swab specimens is desirable and may aid in therapeutic
management to minimize the impact of these infections.
Thus, we analyzed 49 patients who presented the
signs and symptoms of viral conjunctivitis to the
Ophthalmology Department at Hospital das Clinicas /
Unicamp. Three eye swab samples were collected from
each patient: one prior to topical therapy on the day of the
first visit (day 0), one on day +5 of therapy and one +10
days after therapy. This study used a randomized design
which was created by ophthalmologists to study the
efficacy of dexamethasone 0.1% / povidone-iodine 0.4%
in the treatment of patients with acute viral conjunctivitis
as well as the combination’s effect on viral replication,
where it has been shown to be effective. Dexamethasone
is an effective corticosteroid which has been widely used
alone as a topical agent or in combination with other
agents. Povidone-iodine is a common antiseptic used to
inhibit various viruses, bacteria, fungi and even some
parasites, which has been described as effective in the
treatment of acute viral conjunctivitis. The main goal
of this work was to standardize the detection of AdvH
infections in eye swab samples using the Polymerase
Chain Reaction (PCR). This was done to determine the
prevalence of infections caused by AdvH in patients
with signs and symptoms of conjunctivitis. The results
showed that on day 0, 41/49 samples (83.7%) were
positive for adenovirus conjunctivitis. After the use of
dexamethasone 0.1% / povidone-iodine 0.4% on day +5,
13/41 samples (31.7%) were positive and after 10 days,
6/41 samples (14.6%) were positive for conjunctivitis
causing adenovirus. We conclude that PCR is a good
detector of infections caused by AdvH and that the
therapy was effective.
HV632 - Polyomavirus Active Infections In
Pediatric Renal Transplantation Patients
Menoni, S.M.F., Costa, S., Bonon, S.
1. Universidade Federal De Mato Grosso Do Sul, Ufms,
Av: Ranulpho Marques Leal, 3484 – Três Lagoas – MS
2. University Of Campinas, Unicamp, Cidade
Universitária “Zeferino Vaz” - Faculty Of Medical Sciences
Introduction: The polyomavirus (BK and JC) is an
opportunistic virus because of its ability to latency
and reactivation in conditions of immunosupression,
and, as a consequence, it is considered one of the most
important pathogen in imumnossupresed patients.
They penetrate into the respiratory tract spreading
through the bloodstream and are excreted in the urine
of infected patients, mainly by establishing latency in the
urinary tract. In case of viremia, and, the consequently
establishment of the disease, it could cause infection in
the central nervous system, in the case of JC virus. On
the other hand, the BK virus would cause diseases in
the urogenital tract, and, in renal transplanted patients,
are reported to cause graft rejection. Objectives: This
work aims to use PCR and nested PCR (N-PCR) to
detect polyomavirus DNA in samples of plasma and
urine from renal pediatric transplantation recipients
to assist in the treatment of this infection. Patients and
Methods: Were studied 40 biological samples from 10
patients, 2 samples of plasma and 2 samples of urine
of each patient, in different periods. Carried out DNA
extraction using commercial kits (Axygen Scientific,
Inc.), was subsequently made a simple PCR to detect
viral DNA using primers that identify the two types of
polyomavirus (JC and BK). The polymerase chain reaction
(PCR) is considered the standard method to perform
the detection and identification of viruses. Results: As a
result, only 1/40 (2.5%) samples were positive for BK
virus (10% of patients). Conclusion: Early detection
of viremia is of extremely importance to transplanted
patients because it could ensure adequate treatment of
infection by avoiding damages in the transplanted organ.
HV633 - Human Herpesvirus (Hhv) As Possible
Etiologic Agents Of Cancer Of Head And
Neck In Adults And Elderly Patients
Torres, S.V.S., Bonatelli, M.Q.A., Chone, C.T., Bonon,
S.H.A., Costa, S.C.B.
170
Human Virology: HV
Universidade Estadual de Campinas, FCM/UNICAMP,
Caixa-Postal:6111
Introduction: Elderly people succumb to viruses more
often than the young, not because they have weakened
immune systems, but, ironically, because their natural
defenses are working too hard. This exaggerated
response means that older people are more likely to
suffer physical effects as their bodies’ battle viruses.
Viruses that have been identified as causative agents
for a large proportion of these diseases have also been
associated with various malignant states. Concomitantly,
the number of cases of oral cancer (considered to
occur usually around or after the fifth decade of life)
reportedly has been increasing among young adults. The
oncogenic potential of herpesvirus and their possible
role in the development of malignant conditions, in
particular cancer of head and neck has been described.
Objective: The aim of this study is to evaluate the
presence of DNA of human herpesvirus directly in
biopsies removed surgically of tissue affected of cancer.
Patients and Methods: Twenty patients, aged from 45 to
75 years old, with diagnoses of cancer of the head and
neck were included in this study. Fresh biopsy of cancer
lesion samples were removed surgically and DNA was
extracted to verify the presence of DNA of Epstein-Barr
virus (EBV), Human Cytomegalovirus (HCMV), Human
Herpesvirus 6 (HHV-6) and HHV-8 – Human Herpesvirus
8 (causative agent of Kaposi’s sarcoma) using NestedPCR. Results: Four fresh samples biopsies of cancer were
analyzed for the presence of DNA of EBV, HCMV, HHV6 and HHV-8 and as results, 25% was positive for EBV
virus and negative for the other herpesvirus. Conclusion:
The preliminary studies are considered promising as
first findings have shown consistency with the fact that
EBV is associated with more advanced nasopharyngeal
tumor. This research can determine the presence of
herpesvirus in areas affected during the treatment and
can define the plan to decrease the negative effects
of events that may occur with the progression of the
disease.Financial Support: CAPES
HV644 - Detection Of Dengue Virus Serotype
1 In Mosquitoes Aedes Albopictus Captured
In The Urban Zone Of Manaus, Am, Brazil
Cardoso, A.J.L., Luz, S.L.B., Figueiredo, L.T.M., Costa,
C.A.
1. Instituto Nacional de Pesquisa da Amazônia, INPA,
Av. André Araújo, 2936, Aleixo, CEP 69060-001, Manaus –
AM
2. Instituto Leônidas e Maria Deane / Fundação
Oswaldo Cruz, ILMD/FIOCRUZ, Rua Terezina, 476.
Adrianópolis, CEP: 69.057-070, Manaus – AM, Brazil
3. USP, Faculdade de Medicina de Ribeirão Preto, CPVFMRP-USP, Avenida Bandeirantes, 3900, Monte Alegre, CEP
14049-900 - Ribeirao Preto, SP
The Amazon has the highest biodiversity on the planet,
as well as the largest number of arboviruses isolated.
Among these, we highlight the flaviviruses, both produce
the highest rate of human diseases, such as the severity of
the same. Dengue virus belongs to the family Flaviviridae,
genus Flavivirus, species Dengue virus (DENV) and has
four serotypes: DENV-1, DENV-2, DENV-3 and DENV-4,
and is the main arboviruse worldwide and are of major
importance for our country, and its main vector in the
urban cycle is the mosquito Aedes aegypti, and, in the
sylvatic cycle, the Aedes albopictus, both anthropophilic,
and its mainly activity is diurnal, and this develops in
tropical and subtropical areas. Dengue cases only began
to be reported in the state of Amazonas from 1998.
Currently, virological surveillance of mosquito vector is
used, and can serve as warning systems for monitoring
dengue outbreaks, preventing epidemics. Mosquitoes
collected were identified and grouped in amounts of
up to 10 animals per well (pool), according to data of
collection and neighborhood, and then stored at -70ºC.
An amount of 722 mosquitoes were captured, and, from
these, 8 were females of Aedes albopictus, and were
organized in 3 pools. The pools were macerated and RNA
were extracted with the kit Axygen; these extracts were
subjected to RT-PCR (reverse transcription followed by
polymerase chain reaction) for detection of the genus
Flavivirus, followed by a Multiplex-Nested PCR for
identification of viral serotype. Among the 3 samples
analyzed, we found 1 (33,3%) amplicons positive for
Dengue virus, serotype 1 (DENV-1). The technique
proved to be effective for the identification of dengue
virus direct in vectors. These results demonstrated
that the circulation and transmission of dengue virus
serotype 1 have been occurring in the city of Manaus by
females of A. albopictus during the last year as part of a
streaming situation.
HV648 - Identification Molecular Human T
Cell Lymphotropic Virus Tipe I/Ii (Htlv-I/ Ii)
By Nested Polymerase Chain Reaction(Pcr)
In Patients With Indeterminate Serology
Coinfected With Tuberculosis(Mdr-Tb)
Huatuco, E.M.M., Terreros, H.M., Astocondor, M.M.,
Mayta, P.H., Flores, A.S., Rojas, G.P., Borja, N., Barbosa,
M.L., Oliveira, D.B., Dos Santos, T.A., De Oliveira, K.E.G.,
Durigon, E.L., Do Rosario, J.S.C.
1. Major National University of San Marcos, UNMSM,
Lima , Peru
2. Universidade de Sao Paulo, USP-ICB-II, Brazil
3. Universidade de Sao Paulo, USP, Brazil
171
Human Virology: HV
The Human T lymphotropic virus (HTLV) is mainly
spread by blood transfusion, by breastfeeding and
sexual contact. The virus is spread in the World, in
Peru there are endemic geographic regions. In the 5%
infected population develops oncogenic diseases, T cell
leukemias in adults and neurological as tropical spastic
paraparesis. The virus in the host alters functional
behavior of the cellular immune response, can cause
immunosuppression. The main problem in diagnosis
is the presence of cases indeterminate serology, not
present antibodies at screening and confirmatory tests
(ELISA, Western blot). The aim of this study was to
determine a prototype to define molecular amplification
seropositive. Molecular amplification protocol used was
the Nested-PCR for HTLV-1 in patients indeterminate
serology with multidrug-resistant tuberculosis (MDR_
TB). Was determined as a prototype technique effective
lymphotropic virus detection in infected individuals
of tuberculosis co-infected with HTLV-1 and from
mononuclear cells in peripheral blood lymphocytes. It
was confirmed that the technique help the detection
of HTLV-1 and HTLV-2, showing the presence of two
types by restriction enzymes a panel of endonucleases.
The investigation allowed us to develop the molecular
proviral amplification test, which helped to determine
the circulation of both types of virus in Peru. Studies
should continue because of the existence of subtypes
that should be detected timely. These results allow us to
suggest that this technique is implemented in molecular
diagnostic health centers, especially when the results of
diagnosis with serological profiles are dubious and pay
close attention in endemic areas, in order to prevent the
spread.
HV650 - Immunization With Neuraminidase
Deficient Influenza Virus Is Highly
Immunogenic And Non-Pathogenic To Wild
Type And Immunocompromised Mice
Barbosa, R.P.A., Salgado, C.A.P., Garcia, C.C., Lima,
B.H.F., Lopes, O.G.A., Rachid, M.A., Peixoto, A.C., De
Oliveira, D.D.B., Silva, M.A.A., Zirke, C.A., Cotrim, M.T.,
Costa, E.A., De Freitas, G.M.A., Russo, R.C., Gazzinelli,
R.T., De Magalhães, A.V.M.
7. University of Massachusetts Medical School, ,
Worcester, Massachusetts, USA
Recombinant influenza viruses are promising viral
platforms to be used as antigen delivery vectors. To this
aim, one of the most promising approaches consists
to generate recombinant viruses harboring partially
truncated neuraminidase (NA) segments. To date, all
studies have been pointed to safety and usefulness of this
viral platform. However, some aspects of the inflammatory
and immune responses triggered by those recombinant
viruses and their safety to immunocompromised hosts
remained to be elucidated. In the present study, we
generated a recombinant influenza virus harboring a
truncated NA segment (NA-Δ) and evaluated the innate
and inflammatory responses and the safety of this
recombinant virus to wild type or knock-out (KO) mice
with impaired innate (Myd88 KO) or acquired (RAG KO)
immune responses. Our results showed that recombinant
influenza virus harboring truncated neuraminidase
segment abrogated lung and systemic inflammatory
response in wild type mice and were completely harmless
to KO mice. We also demonstrated that vNA-Δ infection
could prevent unbalanced cytokine production that
strongly contributes for lung damage in infected mice.
In addition, the recombinant influenza virus was able to
trigger both local and systemic virus specific humoral
and T CD8+ cellular immune responses which protected
immunized mice against the challenge with a lethal
dose of homologous A/PR8/34 influenza virus. Taking
together, our findings indicate that the neuraminidase
deficient virus results in mild lung inflammation,
induces a strong protective immunity against influenza
challenge and are safe even to immunocompromised
hosts. Financial support: FIOCRUZ/PDTIS-Vacinas,
and National Institute for Vaccine Development and
Technology (CNPq/FAPEMIG Nº 015/2008), CNPq/
MAPA/SDA Nº 064/2008, and Universal FAPEMIG. CNPq
provided fellowships to, RPAB, TMC, CAZ, GAOL, ACP,
BHFL, CCG, MAR, EAC, RCR, AMVM and RTG.
1. Laboratório de Imunopatologia, Centro de Pesquisas
René Rach, FIOCRUZ, Belo Horizonte, Minas Gerais, Brasil
2. Laboratório de Imunoparasitologia
3. Laboratório de Imunofarmacologia, Departamento
de Bioquímic
4. Laboratório de Imunologia e Mecânica Pulmonar,
Departamento
5. Departamento de Patologia Geral
Microbiologia, Instit, UFMG, Belo Horizonte, Minas Gerais
Immunobiologicals in VIROLOGY -IV
173
Immunobiologicals in Virology: IV
IV48 - Use Of Recombinant Envelope Proteins
For Serological Diagnosis Of Dengue Virus
Infection By Liquid Microarrays
Melo, K.M.S., Nascimento, E.J.M., Cordeiro, M.T.,
Marques, E.T.A., Dhalia, R.
1. Centro de Pesquisas Aggeu Magalhães-Fundação
Oswaldo Cruz, CPqAM-FIOCRUZ, Av. Professor Moraes
Rego,s/n.Campus da UFPE-Cid. Universitária,Recife/
PE,Brazil
2. Center for Vaccine Research, University of Pittsburgh,
CVR, Pitt, 9014 Biomedical Science Tower 3, 3501 Fifth
Avenue, Pittsburgh, PA, USA
Dengue is one of the major viral disease transmitted by
mosquitoes, that affects tropical and subtropical areas
worldwide. The disease is caused by dengue flavivirus,
which is represented by four distinct serotypes (DENV14). Among the viral proteins, the structural ENV
protein strongly contribute to the process of immune
response triggered by the virus, and is important for
the development of diagnostic kits. ELISA assays used
for dengue diagnosis, based on antibody detection, have
limitations such as cost and processing time, among
others. Here, we performed the analyses of several
commercially available ENV proteins formulations
of the four DENV serotypes, plus the analysis of two
home-made recombinant ENV constructions, using the
liquid microarray technique for diagnostic purposes.
The commercial proteins formulations included: fulllength proteins, domains I/II only, domain III only,
and proteins containing immunodominant regions,
bacterial-expressed, and were purchased from the
companies ProSpec and MyBioSource. The two homemade proteins(DENV1 ENV and DENV2 ENV) were
screened from sequences of South American isolates
in public databases, and include the domains I/II of the
original protein, bacterial-expressed. Each protein was
tested in multiplex assays against an human cohort
containing DENV infected sera, healthy individuals and
YF vaccinated patients (supported by CONEP #12138).
These assays were performed in 45 min and detect
both immunoglobulin M (IgM) and IgG in a capture
format. The median fluorescence intensity were used to
construct ROC curves. The sensitivity-specificity of the
home-made antigens assays were 92%-90%(DENV1
ENV) and 89%-97%(DENV2 ENV), respectivally. Among
the commercial proteins, the chimerical proteins
containing immunodominant regions of DENV3
and DENV4 presented the best perfomance(DENV3,
87%-81%/DENV4 96%-81%, sensitivity-specificity,
respectivally). These results suggest that recombinant
proteins can be used in diagnostic assays for dengue to
overcome safety issues associated with the use of whole
virus. Furthermore, the recombinant proteins applied to
liquid microarray platform proved to be a very promising
technique in the development of diagnostic kits, with
potential commercial applications, generating a robust
test to analyse with high precision a large number of
samples in a short time, with low final cost.
IV69 - Recombinant Dengue Virus Type 2
Helicase Expressed In Escherichia Coli
Preserves Biological Properties Of The
Native Protein
Bizerra, R.S.P., Amorim, J.H., Alves, R.P.S., Ferreira, L.C.S.
Vaccine Development Laboratory, University of São
Paulo, ICB USP, Avenida Prof. Lineu Prestes, 1374, sala 118,
ICB USP, São Paulo, Brazil
Dengue fever is a common mosquito-born illness
caused by dengue virus (DENV) and constitutes a
global economic burden and a public health threat.
The development of an effective vaccine for the control
of dengue fever is a priority for countries where the
disease prevails. The nonstructural 3 protein (NS3) of
DENV is considered essential on viral replication and
maturation. The helicase domain (NS3H), in particular,
contains most of epitopes recognized by cytotoxic T
lymphocytes, required for the elimination of the infected
cells. With this perspective, we propose to develop a
vaccine based on the incorporation of a recombinant
form of NS3H derived from a DENV serotype 2 (DENV2)
isolate. As part of this initial proposal, we report here
the generation of a recombinant NS3H with preserved
structural and immunological features regarding the
native viral protein. The NS3H sequence was obtained
after reverse transcription of the genome of the DENV2
JHA1 strain followed by cloning in a pET series vector
and purification of the recombinant protein by nickel
affinity chromatography. Initially, the protein was found
in the insoluble extract of the E. coli BL21 DE3 RIL strain.
Attempts to apply different refolding methods were
unsuccessful but testing of different protein expression
conditions led to the production of soluble recombinant
protein. After protein purification, immunizations
carried out with BALB/c mice resulted in the generation
of NS3H-specific polyclonal antibodies. The anti-NS3H
sera reacted with the native protein in cells infected
with DENV2. Furthermore, the recombinant protein
was recognized by antibodies from infected mice and
humans. Further biophysical analyses indicated that the
recombinant NS3H protein shows structural features
compatible with the native protein. Collectively, the
results demonstrate that the recombinant NS3H protein
preserves important conformation and antigenic
determinants of the native virus protein and represents
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV
174
a valuable reagent both for the future testing of vaccines
and diagnostic tools. Financial support: FAPESP
IV71 - A Mouse Model For Dynamic
Characterization Of Peste Des Petits
Ruminants Virus (Morbillivirus) Infection
In Mice In View Of Novel Therapeutic Or
Vaccine Development
Comerlato, J., Minet, C., Roehe, P.M., Franco, A.C., Albina,
E., De Almeida, R.S.
1. CIRAD Baillarguet , CIRAD, Campus international
de Baillarguet, G-34398 Montpellier Cedex 5, France
2. CIRAD Guadalupe, CIRAD, CIRAD, UMR CMAEE,
F-97170 Petit-Bourg, Guadeloupe, France
Rua Sarmento Leite, 500, sala 208, ICBS. CEP 90050-170
4. Institute Nacional de la Recherche Agronimique,
INRA, INRA, 2 place Viala 34060 MONTPELLIER CEDEX,
France
Peste des petits ruminants (PPR) is a viral disease of
small ruminants affecting mainly sheep and goats. Up
to 80-90% of the animals infected by PPR virus (PPRV)
may die. This virus is endemic mainly in Asia and Africa
being responsible for large economics deficits in these
countries. An efficient vaccine is available, but it does
not permit to differentiate the vaccinated animals from
those infected by the virus. Other important factor is
that this vaccine has a limited thermotolerance, thus
requiring a cold chain for field delivery. To surpass these
constraints, new generation vaccines and therapeutic
tools are being developed. An important problem to
develop these new reagents is the inexistence of a
proper small animal model to make the in vivo proof-ofconcept tests. Given the above, the main objective of this
study was to develop a transgenic mouse susceptible
for PPRV infection. Construction of a luciferase-marked
PPRV using reverse genetics tools was another aim of
this project. This marked virus will allow following the
dynamics of the infection by bioimaging while reducing
the number of animals necessary for that purpose. The
method used to the transgenic mouse development
consists in cloning the SLAM (signaling lymphocytic
activation molecule) goat receptor, specific to PPRV. The
cloned fragment is secondarily inserted in a retroviral
vector and then introduced into mice that are backcrossed to get a SLAMgoat +/+ mouse lineage. This
lineage is crossed with IFNAR -/- mouse to generate a
transgenic animal containing the PPRV receptor and
unable to mount an interferon response. Currently, the
transgenic and cloning process to the mouse model and
the marked PPRV generations are in course. Following
the evaluation of the PPRV infection dynamic, this
transgenic mouse model could be used to complement
all researches in progress, helping in the establishment
of new vaccines and therapeutics tools to combat the
PPR.
IV109 - Three Mutations In The Protein E Of
A Chimeric Yellow Fever Virus (Yfv-17d)
Expressing The Proteins Prm/E Of West Nile
Virus Confer Full Attenuation In Mice
Arenhart, S., Kanitz, F.A., Kowalsky, A.P., Gil, L.H.,
Weiblen, R., Flores, E.
1. Fundação Oswaldo Cruz - Pernambuco, Fiocruz, Av.
Professor Moraes Rego, s/n - Campus da UFPE, Recife, Brasil
2. Universidade Federal de Santa Maria, UFSM, Av
Roraima, 1000, CEP 97105-900, Santa Maria, RS, Brasil
West Nile virus (WNV) is an important emerging human
and animal pathogen and its potential introduction in
Brazil is a major concern, urging for the development
of diagnostic tests and vaccines. As WNV can only be
handled in laboratories BL-3, we used the infectious
clone (pBSC-YFV-17D) of the Yellow Fever virus (YFV)
strain 17-D to construct of a chimeric virus expressing
the membrane (prM) and envelope (E) (prM/E) proteins
of WNV. As to attenuate the chimeric virus (YFV17D/
WNV- prM/E) for potential use as vaccine, three
mutations were introduced in the E gene (codons Leu
→ Phe [position 319-321], Ala → Val [946-948] and Lys
→ Arg [1318-1320]). Both chimeras (with or without
the mutations) were evaluated in vitro and were shown
to retain the replicative efficiency of the parental virus
YFV-17D. As to ascertain their phenotype in vivo,
groups of six mice were inoculated intracerebraly with
104TCID50 of YFV-17D, YFV/WNV-prM/E or YFV/WNVprM/E-3M) and monitored for neurological disease. All
six mice (100%) inoculated with YFV-17D developed
neurological signs and died or were euthanized in
extremis between days 6 and 10 post-inoculation (pi).
Among mice inoculated with the chimeric YFV/WNVM/E, 5 out of 6 (83.3%) developed neurological signs
and died or were euthanized at days 6pi (2 animals) or
7pi (3). In contrast, none of the six animals inoculated
with the chimeric virus containing mutations in the
E protein (YFV/WNV-preM/E-3M) developed clinical
signs up to day 30 pi. These results demonstrate that the
substitution of preM/E protein of YFV by the homologous
proteins of WNV did not reduce virulence for mice;
yet the mutations introduced in the E protein lead to
significant attenuation of the chimeric virus. Thus, any
intent to use these chimeric viruses as vaccine should
necessarily consider the introduction of these mutations
for attenuation.
175
IV121 - Vaccination With A Pressure
Inactivated
Avian
Influenza
Virus
Protects Mice Against Infection With
Induction Of Humoral And Cellular
Immune Response And Preservation Of Ha
And Na Activity
Barroso, S.P.C., Nico, D., Vicente-Santos, A.C., Couceiro,
J.N.S.S., Nascimento, D., Bozza, F., Ferreira, D.F., PalatnikDe-Souza, C.B., Silva, J.L., Oliveira, A.C.
2. Instituto Oswaldo Cruz, FIOCRUZ
H3N8 is an avian influenza virus that was originally
isolated from birds, and later found in horses and dogs.
Here, we used 12 h of incubation under hydrostatic
pressure (HP) to achieve this virus inactivation without
damage to its hemagglutinin and neuraminidase
activities and study its protective capability in
vaccination against H3N8 infection. Balb/c mice were
treated by the intranasal route, with 3 doses of the
pressure-inactivated virus. Mice were challenged with
native H3N8 on fourth week, and monitored for: virusspecific antibodies in serum, nasal lavage and faeces,
CD4+ and CD8+ virus-specific T cells, cytokine ELISA,
clinical symptoms and inflammatory parameters. After
immunization and challenge we found an increase of
IgG1, IgG2a, and IgA antibodies. These antibodies found
in serum are neutralizing. The analysis of cytokine
production by CD4+ and CD8+ T cells showed a mixed
Th1/Th2 pattern after vaccination. Two weeks after the
challenge, we observed an increase in the production
of antibodies and IL-6, IFN gamma and TNF alpha.
The control group (saline) showed more clinical signs
of disease (lethargy, weight loss and huddling) than
vaccinated animals and more Evans blue leakage than
the vaccinated group. In the same way differential cell
counts in bronchoalveolar lavage showed more cells
in control group. HP-inactivated H3N8 virus vaccine
induced significant protection against the infection
by H3N8 influenza virus. Our work reaffirms the use
of HP as an interesting tool in the development of
viral vaccines at low cost and good immune response.
Support:CAPES,PRONEX,INBEB,CNPq,FAPERJ.
IV198 - Comparision Of Three Methods For
Purification Of Human Norovirus Virus
Like Particles
Oliveira, L.M., Nagata, T., Lamounier, T.A.C., Noronha,
E.F., Camargo, B.R., Monclaro, A.V.
1. Universidade de Brasília, UnB, Departamento de
Biologia Celular, Laboratório de Microscopia
2. Universidade de Brasília, UnB, Departamento de
Biologia Celular, Laboratório de Enzimologia, Brasília
Almost every two years a new Norovirus (NoV) strain
arises due to the changes in capsid protein (VP1) sequence
having a high antigenic variability, which results in a
new pandemic. This factor and the growth inability in
cultured cells made the serological diagnostic difficult.
In this study three methods for the VLP purification
were compared: Sucrose gradient ultracentrifugation,
cesium chloride (CsCl) gradient ultracentrifugation
and ion exchange chromatography. On the fourth day
post-inoculation of bacmid containing VP1 and VP2
genes of norovirus GII/4, the infected cell culture was
clarified by centrifugation with 3000xg for 5 minutes
at 4ᵒC. The VLPs in the supernatant were concentrated
by ultracentrifugation at 10,000xg for 1 hour at 4ᵒC and
the pellet was re-suspended in buffer. The samples were
then 1) loaded into a 10-60% discontinuous sucrose
gradient and ultracentrifugated at 100,000xg for 1 hour
at 4ᵒC followed by an additional discontinuous sucrose
gradient (35-60%). From the same VLPs suspension,
2) the purification of VLP by CsCl was performed at
a density of 1.36g/cm3 and was centrifuged for 24hrs
at 35,000 rpm. 3) Chromatographic purification was
done using a column packed with Q Sepharose XL
anion exchange resin. Our results showed that the ion
exchange purification was able to achieve high purity
and preserve the intact conformation of VLPs observed
by electron microscopy. The amount of VLPs purified
showed also differences among these treatments.
The optimum concentration of purified VLPs by CsCl
method was 5µg/ml in culture medium, though high
impurity. Similar results were obtained with sucrose
gradient. The purified VLPs were achieved 250µg/ml
when used ion exchange chromatography. In conclusion,
the purification method based on ion exchange column
showed the best purity and yield. Area: Human Virology
Financial Suport: CAPES
IV202 - Construction Of Yellow Fever
Virus 17d Chimeric Virus Expressing The
Structural Proteins Of Brazilian Dengue
Virus Serotype 4
Carvalho, A.G.O. , Bertani, G.R., Gil, L.H.V.G.
1. Centro de Pesquisas Aggeu Magalhães, CPqAM,
Av. Professor Moraes Rego, s/n - Campus da UFPE - Cidade
Universitária | Recife/PE
2. Universidade Federal de Pernambuco, UFPE, Av.
Prof. Moraes Rego, 1235 - Cidade Universitária, Recife - PE CEP: 50670-901
The genus Flavivirus is enveloped, single-stranded,
positive-sense RNA viruses and among its members
important human pathogens can be found, such as
dengue virus (DENV), West Nile virus (WNV) and
yellow fever virus (YFV). The viral genome consists of a
176
simple open reading frame (ORF), which encodes a large
polyprotein that is processed co- and post-translationally
by viral and host cell proteases into 10 different proteins:
three structural proteins (C, prM and E) and seven nonstructural (NS) proteins (NS1, NS2a, NS2b, NS3, NS4a,
NS4b and NS5). Dengue virus has four antigenically
distinct virus serotypes (DENV-1, -2, -3, -4) and there
is no specific treatment or vaccine accredited for this
virus. The DENV-4 was recently introduced in Brazil and
nowadays this serotype is responsible for more than half
of the cases of dengue in the country. Chimeric virus are
highly attenuated and can be used as vaccines and as
tools for the development of serological diagnostic tests.
The aim of this study was to construct chimera virus
using the infectious clone (pBSC-YFV-17D) from yellow
fever virus strain (17D) as vector, and replacing its
structural proteins (prM/E) by DENV-4 prM/E proteins.
The DENV-4 coding region was obtained by RT-PCR from
a brazilian isolated strain. The chimeric plasmids were
constructed by yeast-based homologous recombination.
The RNAs in vitro transcribed from the plasmids were
transfected into BHK-21 cells by electroporation and
incubated by 48, 72 and 96 hours. Rescued viruses were
confirmed by IFA and RT-PCR after three passages in cell
culture. Phenotypic characterization by viral replication
kinetics and plaque morphology is under way. The
chimeric virus constructed will be used to development
a chimeric vaccine specific for the DENV4 circulating in
our country.
IV246
Technological
Innovation
In
Rotavirus
Detection
Using
Immunoglobulin Y
Lanzarini, N.M., Vasconcelos, G.A.L.B.M., Guimarães,
J.R., Da Silva, A.S., Heinemann, M.B., Leite, J.P.G., Volotão,
E.M., Heneine, L.G.D., Pinto, M.A.
4365 - Pav. HPP - Laboratório de Desenvolv. Tecnológico em
Virologia
4365 - Pav. HPP - Laboratório de Virologia Comparada
Departamento de Medicina Veterinária Preventiva
4. Fundação Ezequiel Dias, Minas Gerais, FUNED,
Laboratório de Imunologia Aplicada
Introduction: The infection with rotavirus is responsible
for about 400,000 deaths annually and approximately
40% of hospitalizations for diarrhea in children under
five years worldwide. The Immunoglobulin Y (IgY) is
the major antibody presented in hens serum, being
transferred to the egg yolk by active transport. The
specific polyclonal antibody obtainment from egg yolk is
a non-invasive, large scale and cost-effective procedure,
in comparison with immunoglobulin G. The use of IgY
in latex agglutination tests is useful due simplicity, low
cost and rapid execution for detection of rotavirus in
fecal samples. Materials and Methods: In this study,
hens were immunized with group A human rotavirus
and divided in three immunization groups: the group
one - human rotavirus group A plus Incomplete Freund’s
Adjuvant (IFA) plus CPG-Oligodeoxynucleotide (CPGODN). The group two - one immunization with IFA plus
CPG-ODN and others two steps with rotavirus plus
IFA plus CPG-ODN. In the group three - the hens don’t
received immunogen, just IFA plus CPG-ODN. The yolk
was separated from the egg white, the IgY was purified
by polyethylene glycol 6,000, dosed at 562 nm by
bicinchoninic acid (BCA), characterized by SDS-PAGE
and specificity determined by Western Blotting. The
IgY was subjected to an additional purification using
chromatography ion exchange by a DEAE-Sepharose
column to remove additional interfering proteins.
Results: It was possible to obtain a IgY with 3 mg/mL.
The anti-rotavirus IgY was bound to carboxyl-latex beads
and tested in a rotavirus sample showing a positive
agglutination in a preliminary result. Conclusions: The
IgY bound efficiently to latex beads by covalent coupling
and due to the increased importance of IgY in research,
this antibody is a good method of choice that can be used
in immunoassays development. Financial support: IOC/
FIOCRUZ, FAPERJ
IV249 - Screening Serological Assay (Elisa)
For The Evaluation Of Htlv-1 Infection
Based On A Chimeric Prokariotic Protein
Santos, D.M.S., Carmo, A.P., Martins, M.L., Fonseca, F.G.,
Stancioli, E.F.B.
Campus da UFMG, Belo Horizonte, MG, Brazil, Caixa Postal
486 -31270-901
2. Fundação HEMOMINAS, HEMOMINAS, Fundação
HEMOMINAS, SETOR DE PESQUISA, Belo Horizonte, MG,
Brazil
3. Grupo Interdisciplinar de Pesquisa em HTLV, GIPH
Human T-lymphotropic virus (HTLV) was the first
retrovirus isolated from human and currently they
are classified into four types: 1, 2, 3 and 4, being the
HTLV-1 and HTLV-2 the types correlated with severe
inflammatory and neoplasic diseases in 5% of infected
individual. Both viruses can be transmitted by breast
feeding, sexual contact and blood transfusion. Routine
laboratory procedures are performed in order to evaluate
clinical samples and detect infected individuals by
using efficient and accurate serological tests and HTLV1/2 screening of blood units is important to prevent
177
transfusion transmitted infection, being mandatory
in Brazil and elsewhere. In this way, a recombinant
HTLV-1 chimeric protein was produced in a prokaryotic
system with diagnostic purposes. After production,
the recombinant protein was purified using an affinity
chromatography column and was tested by an in house
Enzyme Linked Immunosorbent Assay (ELISA) using
sera of infected and non-infected patients. Were tested
80 sera, including 40 from seronegative individuals (SN)
and 40 from HTLV-1 infected individuals (INF), being
20 presenting the mielopathy - HAM/TSP (HT) - and 20
sera from asymptomatic (AS) individuals. The results
showed that HTLV positive samples differ significantly
from those known as negative controls; only sera from
infected people reacted with the chimeric recombinant
protein (INF x SN; p<0.0001; “Unpaired t test”). HAM/
TSP and asymptomatic individuals recognized equally
the recombinant protein and when were compared to
SN both presented statistic differences (HT x SN and AS
x SN p<0.0001; Anova OneWay with tukey post-test).
These preliminary results suggest that sera from HTLV-1
infected individuals specifically recognized the protein
produced and then it can be a useful tool for routine
screening diagnostic tests.
IV252 - Detection Of Norovirus In Human
Stool Samples From Patients In Rio Grande
Do Sul, Brazil
Dalla Vecchia, A., Vetter, M.R., Soliman, M.C., Bortoluzzi,
M., Staggemeier, R., Giehl, I.C., Bianchi, E., Rigotto, C.,
Henzel, A., Spilki, F.R.
Universidade Feevale, FEEVALE, Rodovia RS 239,
n2755 - sala 205, CEP:93352-000, Novo Hamburgo/RS
Human Norovirus (HuNoVs) are responsible
for gastroenteritis worldwide and transmission
occurred through the fecal-oral route and by
ingestion of contaminated food and water. HuNoVs
belong to Caliciviridae family and are classified in
three genogroups: GI, GII and GIV. Genogroup GII is
responsible for the majority of diarrheal outbreaks. The
present study searched to identify, through molecular
assays, the presence of HuNoVs (GII) in stool samples.
Samples were obtained from one hospital in the city of
Esteio, Rio Grande do Sul, Brazil. A total of 147 stool
samples from patients of different ages were analyzed,
among them, 74 were collected in winter of 2011 and
73 in the summer of 2012. Nucleic acids were extracted
with a commercial kit (RTP DNA/RNA Virus Mini Kit),
according to the manufacturer’s instructions and
additional step (cDNA) was performed using the kit High
Capacity cDNA Reverse Transcription, and subsequently
diluted 10 fold to avoid inhibitors in PCR reactions. The
real time PCR (qPCR) was performed using primers
COG2: sense - CARGAR BCNATGTTYAGRTGGATGAG;
antisense
TCGACGCCATCTTCATTCACA,
using
plasmid DNA standards as positive control, for this
reaction the analytical sensitivity achieved was 102
genomic copies/uL. All samples were also analyzed by
conventional touchdown PCR using primers Norogen
2: sense - CCACAAAGACCA GAGATGT; antisense GGACCAATGAAGAGAGGGATA, resulting in an amplicon
of 368 base pairs (bp). All stool samples were negative
in both tests. Although different studies have recognized
that the NoV GII is the most prevalent and often affects
individuals of all ages around the world, in our study this
picture was not observed. Thus, our study suggest that
the NoV GII is not circulating in the analyzed samples and
a future monitoring is needed to evaluate the distribution
of this virus in our region. Financial support: FAPERGS,
CAPES, CNPQ.
IV294 - Human Antibody Response To Dengue
Virus Is Cross-Reactive To Different
Fragments Of Envelope Recombinant
Protein
Rocha, E.S.O., Souza, K.R., Gaspar, C.H.P., Ferreira,
T.A.R., Cursino, A.E., Marinho, P.E.S., Figueiredo, L.B.,
Oliveira, J.G., Ferreira, P.C.P., Kroon, E.G.
1. Laboratório de Vírus, Depto de Microbiologia da
UFMG, LABVIRUS UFMG, Av. Antônio Carlos, 6627 - Bloco
F4, Sala 258 - BH (MG) Brasil
2. Laboratory of Emerging Pathogens, FDA, NIH, USA
3. Laboratório de Imunol. Celular e Molecular,
FIOCRUZ, Brazil
The Dengue virus (DENV) envelope (E) protein is the
main target of neutralizing antibodies on the surface
of the virion and it is composed of three domains (EDI,
EDII, EDIII). Previous studies have determined that
antibodies targeting EDI/II are generally more crossreactive among serotypes, in contrast to EDIII which is
serotype-specific and highly neutralizing. In this study,
we aimed to assess antigenic determinants in different
fragments of E protein by using human DENV-immune
serum. Six recombinant fragments (E1-395, E1-81, E1193, E53-132, E53-395 and E298-395) comprising to
the three domains of DENV-3 E protein were expressed
in Escherichia coli system and purified by nickel affinity
chromatography. Out of 11 sera samples, 8 were obtained
from DENV-3 infected individuals, one from DENV-1 and
one from DENV-2. A serum sample from a non-infected
individual was used as negative control. The antibody
specificity of the sera panel was confirmed by plaque
reduction neutralization test. An IgG-ELISA based on
these six recombinant antigens was performed and
the titers show that E298-395 (EDIII fragment) crossreacts to all three DENV serotype-specific antibodies
178
and that E1-395 (80% C-terminally truncated DENV-3)
and E298-395 are similarly recognized by DENV-specific
antibodies. It is also suggested that a common epitope
to E1-81 and E53-132 is likely an important antigenic
determinant detected by specific antibodies since both
proteins resulted in similar OD values. In conclusion,
this study presents the different fragments of DENV
recombinant E proteins and the IgG-ELISA as valuable
tools for humoral response understanding in DENVinfected individuals. Financial support: CNPq, CAPES,
DECIT/MS, FAPEMIG, INCT-Dengue and PRONEXDengue
anti-HAdV (2 mg) produced in Balb / c was dialyzed and
concentrated with the coupling buffer NaHCO3 0.1 M pH
8.0 and added to gel. After addition of HAdV-2 sample,
proteins was eluted with NaCl 1M pH 8.3. Protein on
fractions were dosed at 280nm and analysed by SDSPAGE.
1. Universidade Federal De Sao Paulo, Unifesp, Rua
Pedro De Toledo, 781
2. Universidade De Sao Paulo, Usp, Rua Av. Lineu
Prestes, 1374
The rotavirus is considered one of the most important
causes of acute diarrhea in children, being responsible
to 111 million episodes of gastroenteritis in the world
and for 611 thousands of deaths for year, especially in
developing countries. The IgY antibodies production
against rotavirus is justified by several advantages
presented by this antibody such as easy achievement,
low cost, wide scale production and more appropriate
method about the bioethics aspect. The IgY is the
predominant immunoglobulin in the circulation of birds
and reptiles, and can be purified from egg yolk. In this
study we propose the purification and characterization
of IgY anti-rotavirus A group (RV-A) antibody made in
immunized hens. Hens were divided in three groups (I-III)
and immunized at intervals of one month with different
protocols: Group I – received three immunizations with
human and simian RV-A associated with incomplete
Freund adjuvant (IFA) and oligodesoxinucleotides that
have C-fosfatoguanosin (CpG-ODN); Group II – received
one immunization with IFA plus CPG-ODN in the first
month and two immunizations at intervals of one month
of group A rotavirus plus IFA plus CPG-ODN. Group III
– received three immunizations with IFA and CpG-ODN
(negative control). The study was approved in Ethics
Commission in Animals Tract-UNIFESO (nº0331/11).
The eggs were collected and the yolks purified by
precipitation in polyethylene glycol method (PEG). The
IgY was quantified by Lowry method and characterized
by the techniques of electrophoresis in polyacrylamide
gel with sodium dodecyl sulfate (SDS-PAGE) and
Western Blotting. A neutralization assay in vitro
was performed to evaluate the specificity of purified
IgY for rotavirus in MA-104 cell culture on different
concentrations. The characterization methods of IgY
demonstrated specificity to the rotavirus antigens and
efficacy in rotavirus neutralization in culture cells. The
IV343 - Production And Purification Of
Hadv-2 Hexon Protein By Ion Exchange And
Afinnity Cromatography.
Paulini , I.J., Silva, S., Thomaz, L., Bellei, N., Harsi, C.M.,
Granato, C.F.H.
Human adenovirus (HAdV) presents 52 serotypes which
can cause gastrointestinal, uro-genital, and neurological
system infections both in children and adults. The aim of
this study is to produce monoclonal antibodies against
HAdV-2 hexon protein which will be applied in a fast
diagnostic test. The first step of this project was to purify
HAdV-2 hexon protein. For this, 48 cell culture bottles of
300cm2 were seeded with HEK-293 cells and this cell
monolayer was infected with 0.1 M.O.I of HAdV-2. When
the cytopathic effect was evident (between 2-5 days), the
cells were harvested and centrifuged at 220 g for 10 min.
Then the supernatants were collected and the HAdV-2
precipitated by ultracentrifugation. The cell pellets were
pooled in 10 mM HEPES buffer at pH 7.4. The viruses
were released after three cycles of freezing and thawing.
Lysed cells suspensions were clarified using equal
volume of Vertrel XF, followed by vigorous vortexing.
Cells debris were removed by centrifugation at 2.619
g for 25min at 4°C. Viral particles and soluble proteins
in the supernatant were purified in CsCl gradients
prepared in a 10 mM HEPES buffer at pH 7.4. Purified
HAdV-2 complete particles were stored at -20°C. Soluble
proteins fraction of the gradient were analyses by SDSPAGE, Electronic Microscopy and hexon protein purified
by ion exchang columns/ultrafiltration. At first, the gel
column was equilibrated with phosphate buffer and
eluted at increasing concentrations of sodium chloride
in the buffer ranging from 0,02 M to 0,5M in steps of
0,02M. Aditionally, we perfomed purification by Affinity
Cromatography. CNBr sepharose 4B (1g) was washed
with 1 mM HCl pH 3.0 for activation. Polyclonal antibody
IV410 - Purification And Characterization
Of Immunoglobulin Y Specific For Human
Rotavirus Group A Produced In Hens
Immunized
Guimarães, J.R., Bentes, G.A., Silva, A.S., Lanzarini, N.M.,
Volotão, E.M., Pinto, M.A.
1. Fundação Oswaldo Cruz - Instituto Oswaldo Cruz,
Fiocruz-IOC, Avenida Brasil 4365 - Manguinhos, Rio de
Janeiro
2. Centro Universitário de Serra dos Órgãos, Unifeso
179
IgY anti-rotavirus was successfully produced, and their
use in immunodiagnostic and immunotherapy need to
be tested in the future.
IV442 - Baculovirus Surface Display Of
Domain Iii Of Envelope Protein (E) Of
Yellow Fever Virus
Chaves, L.C.S., Ribeiro, B.M.
University of Brasilia, UnB, Institute of Biological
sciences
The etiological agent of the yellow fever is the yellow
fever virus that belongs to the Flavivirus genus in the
Flaviviridae family. The envelope protein (E) of Flavivirus
is responsible for the entrance of the virus in the host
cell and is also the main target for the immune response.
The domain III of the E protein (ED3) interacts with cells
receptors and has the epitopes recognized by neutralizing
antibodies, being, therefore, the target of the immune
response. The diagnosis of the yellow fever is made
using immunoenzymatic tests that detect circulating IgM
during the viral infection (MAC-ELISA). For this test the
entire virus from infected mice brain is used as antigen.
The production of the antigen, containing only a part
of a functional protein, is not only more economically
viable but also safer than the virus produced in mice.
The “display” of heterologous proteins in the surface
of virus or cells is an important tool to the analysis of
these proteins and their interactions. Therefore, this
work has the objective to construct a recombinant
baculovirus containing the domain III of the protein
E of the yellow fever. The domain III of the protein E
(ED3) was chemically synthetized merging the essential
regions of the baculovirus GP64 protein envelope,
creating the expression cassette GP64ED3 6x his-tag.
This cassette was cloned into the vector pFASTBACACCI
that contains regions for specific site transposition into
the baculovirus genome using the Bac-to-Bac® system
(Invitrogen), creating the recombinant virus vGP64ED3.
The viral particles produced by this recombinant virus
were purified from the supernatant insect infected cells,
by centrifugation in a sucrose gradient. The purified
viral particles were analyzed for the presence of the ED3
using Western blot. The recombinant virus will be used
as antigen in the MAC-ELISA test, commonly used for the
detection of the presence of yellow fever antibodies in
the serum of patients.
IV451 - Production And Characterization
Of Monoclonal Antibodies To Recombinant
Envelope Proteins Of Dengue Virus.
Oliveira, P.C., Panisa, P.S., Ataide, A.C.Z., Silva, F.O.,
Caldas, S., Cecílio, A.B., Rocha, E.S.O., Souza, K.P.R.,
Kroon, E.G.
Presidente Antônio Carlos, 6627 / Belo Horizonte - MG
2. Fundação Ezequiel Dias, FUNED, Rua Conde
Pereira Carneiro, 80 / Belo Horizonte - MG
Dengue is a disease caused by Dengue virus that
belongs to the Flaviviridae family, with four distinct
serotypes DENV-1, 2, 3 and 4. It is associated with
several clinical manifestations, from asymptomatic to
severe cases leading to death. Thus, tools that allow
rapid detection are of extreme importance, because
in addition to patient care, also contribute to the
epidemiological survey, monitoring cases, pathological
studies, immunological and distribution profile of the
disease, which results in more relevant and objective
research. The present work aims to produce and
characterize monoclonal antibody anti-DENV, targeting
the development of biotechnological tools. Mice were
immunized with recombinant envelope (E) protein of
DENV serotype 1, 2, 3 and 4. They were euthanized and
the splenocytes obtained were fused to P3X63-Ag8.653
mielomic cells. The hybridomas were selected through
HAT/HT medium and evaluated for specificity by
immunoenzimatic assay. The ELISA positive hybridomas
were subjected to limiting dilution process for selection
of a single secretory cell. The fusion protocol of the
cells obtained after immunization of animals with the
recombinant E protein of each serotype produced 192
hybridoma cultures. Of these, 1,5%, 19.8%, 31.8% and
1.5%, were positive for DENV-1, 2, 3 and 4, respectively.
After the process of limiting dilution of some hybridomas
culture, positive clones were obtained only for DENV3, with a total of 129 producing clones. The cells were
expanded and characterizations by western blotting
showed specific binding of the antibody produced to the
band of 45kDa, corresponding to envelope protein. The
monoclonal antibodies obtained for DENV-3 encourages
us to invest in the production of these molecules for
application in the development of biotechnological
inputs, mainly because the technologies adopted here is
the result of imports, which raises the cost of diagnostic
kits used. Financial Support: FAPEMIG, FUNED.
IV535 - Application Of Mass Spectrometry
To Identify Contaminant Proteins In
Hepatitis B Vaccine
Botosso, V.F., Stuchlik, O., Prado, J.C.M., Gouvea M.N.,
Oliveira D.C.A., Tenório, E.C.N., Pohl, J.
1. Instituto Butantan, I.B., Av. Vital Brasil, 1500
2. Center for Disease Control and Prevention, CDC,
1600, Clifton Road
Instituto Butantan’s Recombinant Hepatitis B Vaccine
contains the purified Hepatitis B Surface Antigen
180
(HBsAg) obtained by culturing genetically engineered
Hansenula polymorpha yeast cells carrying the surface
antigen gene. The harvesting of cells is followed by
washing and disruption of the cells to release the
HBsAg, which is purified by several physico-chemical
steps to eliminate host cell-derived proteins. The final
product is submitted to microbiological, biological, and
physico-chemical tests, including the purity evaluation
by electrophoresis on SDS PAGE. The electrophoretic
profile is composed of three major bands, corresponding
to the HBsAg monomer (23 kDa), dimer (46 kDa) and
trimer (69 kDa), identified by Western Blotting with antiHBsAg Mabs. Other nonspecific bands could be verified,
but they should not exceed 5% of total protein, as
required by the WHO. In order to analyze and identify the
nonspecific components verified in one refused batch of
vaccine, the material was submitted to SDS PAGE, tryptic
digestion of protein bands, and electrospray ionization
(ESI) mass spectrometric analysis of the resulting
peptides, performed using a Bruker model maXis ESIQ-TOF instrument interfaced with an on-line nanospray
source (Bruker Daltonics) to perform LC-MS/MS using
a U3000 RSLCnano HPLC (Dionex). The collected data
was processed by DataAnalysis/Proteinscape software
(Bruker) that automatically submitted the peaklist
to MASCOT search program using NCBInr database.
Almost all the proteins identified in the “nonspecific”
bands were from the yeasts source, specially, from the
dehydrogenase complex, showing that our purification
process did not introduce protein contaminants from
other source than the host. The application of the mass
spectrometry technology to identify the contaminants
was very important since it promoted the knowledge of
the physico-chemical characteristics of the contaminant
proteins and consequently permitted us to optimize our
production process. Financial Support – FAPESP
IV556 - Camelid Nanobodies As A Tool To
Detect Hepatitis D Virus
Silva, M.P., Pereira, S.S., Botelho, L.F., Holanda, R.J.,
Salcedo, J.M.V., Stabeli, R.G., Vieira, D.S., Fernandes, C.F.
1. Fundação Oswaldo Cruz, Rondônia, FIOCRUZ/
RONDÔNIA, Rua da Beira, 7671, Km 3,5, BR 364
2. Centro de Pesquisa em Medicina Tropical, Rondônia,
CEPEM-RO, R: Guaporé, 215, Bairro Lagoa, Porto Velho -RO
Hepatitis D virus (HDV) is a defective single-strand
RNA virus circular enveloped that requires hepatitis B
surface antigen (HBsAg) of the hepatitis B virus (HBV)
for replication and transmission. The HDV produces
only the delta antigen (HDAg) as protein and can causes
infection in HBsAg-positive patients. With a worldwide
distribution, HDV highly prevalent in Northern Brazil
mainly in western Amazon region. Disease diagnosis
is based on serological tests or immunohistological
identification of HDAg in the liver. Currently, the AntiHDV kit used for detection of hepatitis Delta is imported
from Europe but this HDV infection is globally classified
among the neglected diseases, for this reason there is
a lack of interest for the production of this diagnostic
kit. The treatment for Hepatitis Delta is limited, mainly
based on peguilated interferon alfa. Besides conventional
antibodies, camelids produce immunoglobulins devoid
of light chains, in which the antigen binding site is formed
by the single domain referred to VHH or nanobody. Due
to peculiar characteristics, several studies propose the
use of nanobodies for laboratory diagnosis or viral
activity neutralization. This work aimed to construct
an immune VHH library to select clones capable to
recognize specifically HDAg using phage display
technology for production input of diagnostic kits.
Thus, a Lama glama was immunized with delta antigen
(HDAg) and the immune response monitored by ELISA.
Total RNA extraction was carried out using peripheral
blood lymphocytes to perform cDNA synthesis and VHH
fragments were amplified by RT-PCR. After digestion
with SfiI and NotI HF restriction enzymes, the amplicons
were inserted into pHEN1 phagemid to construct a
VHH library into E. coli TG1 strains, with a titer of
1,6x1012cfu/mL. VHHs were displayed fused to the
surface protein PIII of M13K07 helper phage to perform
the selection step using immunotubes previously
absorbed with HDAg. After identification of specific
clones, further experiments will be carried out aiming
the in vitro and in vivo characterization and validation of
Anti-HDAg nanobodies for production of diagnostic kits.
FINANCIAL SUPPORT: CNPQ
IV574 - Broad Spectrum Antiviral Activity
Of A Novel Protein From Lonomia Obliqua
Hemolymph
Carmo, A.C.V., Yamasaki, L.H.T., Giovanni, D.N.S.,
Figueiredo, C.A., Oliveira, M.I., Santos, F.C.P., Curti, S.P.,
Tonelotto, M., Rahal, P., Moraes, D., Mendonça, R.Z.
1. Universidade Estadual Paulista “Julio de Mesquita
Filho”, UNESP, Rua Cristovao Colombo, 2265 Jd. Nazareth,
Sao Jose do Rio Preto - SP, Brasil
2. Instituto Butantan, Instituto Butantan, Laboratorio
de Parasitologia e Entomologia, Sao Paulo-SP
3. Instituto Adolfo Lutz, IAL, Centro de Doencas
Transmitidas por Vetor, Centro de Virologia, Sao Paulo -SP
4. Faculdade Oswaldo Cruz, FOC, Sao Paulo-SP
The control of viruses is of great interest to the public
health area. Several studies have been conducted
that show the presence of pharmacologically active
substances in the hemolymph of insects. Recently we
181
have demonstrated the existence of a potent antiviral
in the hemolymph of Lonomia obliqua caterpillar. This
protein was able to reduce at 106 times the replication
of herpes virus and in 10,000 fold the rubella virus.
Assays using RT-PCR to determine viral RNA present in
no treated and rAVLO treated infected cells also showed
a reduction in the same scale. The analysis of this protein
by bioinformatics suggests that this protein is globular,
secreted with a signal peptide which is cleaved between
amino acids 16 and 17. The studies also allows us to
infer that this antiviral protein has the ability to bind to
MHC class I. It was found that there are several protein
binding sites on the weak and strong bases with various
HLA. The bioinformatic analysis also shows a strong
presence of α-helices in the N-terminal region and
allowed to classify the antiviral protein as α/β type of
structure, as we detected the presence of more than 30%
α-helix and 20 % of β-sheet found separately along the
protein chain. In the BLAST sequence analysis of cDNA
antiviral protein, no sequence similarity was found in
Genbank, suggesting that it is from a novel protein family.
It can be inferred by an analysis of this region that the
possible antigenicity region would be between the 70110 amino acids, showing high accessibility. This high
antigenic region on the surface, can be a possible region
to interaction with other proteins. Financial support:
FAPESP (08/57263-5), CAPES.
IV587 - Expression, Purification And
Evaluation Of The Immunogenicity Of Vp1
Protein Of Hepatitis A Virus
Da Silva Junior, H.C., De Azevedo, M.L.B., Galler, R.,
Medeiros, M.A.
Fundação Oswaldo Cruz, Fiocruz, Avenida Brasil,
4365, Manguinhos, Rio de Janeiro - RJ, Brasil
The hepatitis A virus (HAV) is the primary etiologic agent
of acute viral hepatitis and causes, annually, 1.4 million
new infections worldwide. Currently, effective vaccines
against HAV, based on inactivated and attenuated
viruses, are commercially available. However, the high
cost of production hinders the introduction of these
vaccines into the routine of developing countries.
In this context, the use of recombinant proteins of
HAV may represent an alternative model to existing
vaccines. The aim of this work was to express, purify
and evaluate immunogenicity of HAV VP1 protein. The
HAV VP1 gene, HM175 strain, was amplified and cloned
into pET-100/D-TOPO expression vector. The VP1
was expressed in BL-21 (DE3) Escherichia coli in the
form of inclusion bodies and purified by nickel affinity
chromatography. The purified protein was characterized
by SDS-PAGE and Western blotting techniques. To
evaluate immunogenicity, VP1 protein was adsorbed
on aluminum hydroxide and used to immunize BALB/c
mice by intramuscular route. The control group received
aluminum hydroxide without the protein. For the
comparison of groups, unpaired student’s t-test was used
and differences were considered significant when P was
<0.05. The VP1 protein could significantly elicit a specific
immunoglobulin G (IgG) response in mice compared to
control group. It is noteworthy that protocols used in
the present study were approved by Animal Care and
Use Committee of the Oswaldo Cruz Foundation. Our
findings showed that it was possible to obtain the HAV
VP1 protein from Escherichia coli expression system.
In addition, recombinant VP1 was able to induce the
production of specific antibodies in mice. These results
create prospects to evaluate the potential of recombinant
VP1 as prototype vaccine. Financial support: CAPES,
Instituto Oswaldo Cruz (FIOCRUZ) and Bio-Manguinhos
(FIOCRUZ).
IV621 - TRANSIENT EXPRESSION OF CHIMERIC
PROTEIN HBSAG/ROTAVIRUS-VP6 IN HUMAN
CELLS HEK-293 T: VALIDATION OF A SYSTEM FOR
CHIMERIC ANTIGEN PRODUCTION.
De Freitas, J.H.R., Jr. Mouta, S.S., Vieira, M.C.R., Pimenta,
M.M.A., Monteiro, G.C.T.S., Barbosa, V.G., Lavatori,
M.F.H., Gomes, S.A., Moraes, M.T.B.
Instituto Oswaldo Cruz-Fiocruz, IOC, Prédio Helio e
Peggy Pereira,Av.Brasil,4365,Manguinhos,Rio de Janeiro-RJ,
Brasil
HBsAg is the surface antigen of hepatitis B. It indicates
current infection with the hepatitis B virus (HBV).
HBsAg is a complex of three proteins called small (S)
(GP27 and P24), the middle protein (M) (GP36 and
GP33), and large protein (L) (GP42 and P39). All forms
are present in glycosylated or non-glycosylated. The
main commercial vaccines against HBV protein contains
only a small protein and has been successfully integrated
into the childhood vaccination schedule, contributing to
a 96% reduction in the incidence of acute hepatitis B in
children and adolescents worldwide. HBsAg particles
also called hybrid chimeras have been shown in different
experiments such as protein immunization very efficient
presentation of viral epitopes. Our study was initially
based on achieving the plasmid vector to express a
chimeric protein HBsAg/E2. The E2 protein corresponds
to 132 nucletídeos present in hypervariable region of the
HCV (HVR1). This region was inserted into the unique
restriction site in the gene for the small protein of HBsAg.
However, the detection of the epitope of HCV epitope
proved to be very difficult. Then in order to validate
the chimeric system, a second vector was constructed
containing an epitope of VP6 rotavirus protein which is
easily detectable. As a result, this second plasmid vector
182
was capable of expressing the protein of HBsAg epitope
fused to VP6. This may be evidenced using a commercial
ELISA detection and Western Blot using a polyclonal VP6
rotavirus antibody. Both the VP6 protein and HBsAg can
be detected. We hope that this system is versatile enough
to use in diagnosis and generation of bivalent vaccines,
and to detect the epitope E2/HCV hereafter we will use
the sera of patients with HCV infection.
Plant and Invertebrate Virology - PIV
184
Plant and Invertebrate Virology: PIV
PIV28 - Segregation Of Citrus Tristeza Virus
(Ctv) Isolates Based On Early Removal Of
The Inoculum Source
Giampani, J.S., Silva, C.C., Pissinati, A., Bersaneti, G.T.,
Tazima, Z.H., Leite Jr, R.P.
Instituto Agronômico do Paraná, IAPAR, Rod. Celso
Garcia Cid km 375, C.P. 301, CEP 86047-902, Londrina, PR,
Brasil
Citrus tristeza, caused by Citrus tristeza virus (CTV), is
an endemic disease in Brazil. The control of this disease
has been achieved by using tolerant rootstocks, as well
as by cross protection in citrus cultivars with certain
intolerance to the virus, such as ‘Pera’ sweet orange
(Citrus sinensis L. Osbeck). However, the breakdown
of the cross protection has been reported. Further, this
breakdown may be related to the segregation of the CTV
complex. In this work, we examined the segregation of
CTV isolates based on tissue grafting and early removal
of the inoculum source. Buds of different clones of ‘Pera’
sweet orange from the Citrus Active Germplasm Bank of
the Instituto Agronômico do Paraná - IAPAR were used
as inoculum source and virus free ‘Pera Bianchi’ sweet
orange was used as indicator. A bud of the inoculum
source was grafted on Rangpur lime (Citrus limonia
Osbeck) tree and a bud of the indicator ‘Pera Bianchi’
was grafted above them. The buds used as inoculum
were removed at 3, 5, 7, 10, 12 and 14 days after
grafting. However, the buds were kept in the citrus trees
used as positive control. CTV infection was confirmed
by RT-PCR and segregation of the viral complex was
examined by SSCP of the coat protein gene. Segregating
and positive control samples of the CTV were cloned
in the pCR®2.1-TOPO® vector and maintained in the
Escherichia coli strain DH10B for DNA sequencing. The
nucleotide sequences were analyzed by using the DNA
Baser Sequence Assembler software and Clustal W. The
initial CTV transmission was observed as early as 7 days
after bud inoculation. However, partial transmission
of the CTV complex was observed for a period ranging
from 7 to 12 days after inoculation. The sequences of the
segregant isolates, in which inoculum was removed up
to 12 days after grafting, reached 99% identity to each
other, whereas for the positive control sequences ranged
from 92 to 99%. These data confirm the segregation of the
viral complex when the inoculum source was removed
in early stages. The segregant isolate will be studied in
regard to the protective effect for cross protection in the
control of citrus tristeza. Financial support: Fundação
Araucária de Apoio ao Desenvolvimento Científico e
Tecnológico do Paraná.
PIV36 - Coat Protein Phylogenetic Analysis
Of Cowpea Aphid-Borne Mosaic Virus
Passion-Flower Isolates From Brazil.
Rodrigues, L.K., Da Silva, L.A., Garcez, R.M., Chaves, A.L.,
Duarte, L.M.L., Giampani, J.S., Colariccio, A., Harakava,
R., Eiras, M.
1. Instituto Biologico, IB, Avenida Conselheiro
Rodrigues Alves 1252
2. Instituto Agronômico do Paraná, IAPAR
Cowpea aphid-borne mosaic virus (CABMV) causes
woodiness fruit of passion-flower (Passiflora edulis),
the main viral disease of this crop in Brazil. In order
to evaluate the genetic variability of Brazilian passionflower CABMV isolates, leaves showing mosaic and
blister from passion-flower crops in the states of São
Paulo (municipalities of Adamantina, Alvinlândia,
Fernão, Garça and Jacupiranga), Paraná (São José da
Boa Vista) and Goiás (Planaltina) were submitted to
molecular analysis. After total RNA extraction and RTPCR, DNA fragments correspondent to part of NIb,
full-length of CP gene and 3’UTR were successfully
amplified, sequenced and deposited into the GenBank as
accession codes KC777401 to KC777407. Comparisons
with other complete CP nucleotide sequences were
done using BLASTn and multiple alignments were
done manually. Trees were constructed by maximum
parsimony (MP) and by maximum likelihood (ML),
TRN+G (0.5689) nucleotide substitution model, using
PAUP 4.0b10. Passionfruit woodiness virus sequence
was used as outgroup and bootstrap percentage values
were computed after 1,000 re-samplings. Phylogenetic
analysis showed four well defined clusters. CABMV
isolates from São Paulo, including those sequenced in
this work, formed a monophyletic group supported by
93% of bootstrapping. Other group was divided into
4 subgroups: Fabaceae isolates from Northeast and
Zimbabwe; passion-flower isolates from São Paulo,
Espírito Santo and Sergipe. The CABMV passion-flower
isolates from Goiás and Paraná clustered in a clade
with other Goiás isolate and Northeast CABMV passionflower isolates. Based on two different phylogenetic
analysis methods, we found a high genetic variability
among Brazilian CABMV passion-flower isolates.
Differently of previously reported, we did not observe
a consistent clustering based on geographical origin or
host adaptation. The origin of CABMV in Brazil remains
to be elucidated. Financial Support: FAPESP (Proc.
2011/11796-5) Fellows of *CAPES and **CNPq
PIV52 - Absolute Quantification Of
Grapevine Leafroll-Associated Virus 4
By Taqman Real Time Rt-Pcr In Infected
Grapevines
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV
185
Catarino, A.M., Fajardo, T.V.M., Pio-Ribeiro, G., Nickel,
O., Revers, L.F.
1. Embrapa Uva e Vinho , CNPUV, Rua Livramento,
515 - Bento Gonçalves, RS. CEP 95700-000
2. Universidade Federal Rural de Pernambuco, UFRPE,
Dept. de Agronomia-Av. Dom Manoel de Medeiros,s/n. Dois
Irmãos. Recife-PE
Grapevine viruses induce reduction of productivity and
quality of grapes. Grapevine leafroll-associated virus
4, GLRaV-4 (Closteroviridae, Ampelovirus) causes leaf
roll in grapevine. Absolute quantification determines
the absolute amount of a target (expressed as a copy
number or concentration). The objective of this study
was to generate a standard curve for GLRaV-4 absolute
quantification in infected grapevines. Reagents and
reaction set up for GLRaV-4 amplification were
previously described. To generate a standard curve, 5
or 6 different amounts (tenfold diluted) of the standard
were quantified by TaqMan real time RT-PCR. Reactions
were carried out in triplicates and standard curves
were generated by two independent experiments. For
quantification of RNA molecules as standard, a fragment
containing part of the GLRaV-4 genome (300 bp covering
94 bp hHSP70 DNA fragment amplified by real time
RT-PCR) was transcribed in vitro from a previously
obtained transcriptional recombinant vector. This clone
carries partial sequences of 14 viruses, fused in tandem,
including GLRaV-4. After in vitro transcription, plasmid
DNA template was removed with DNase and transcribed
RNA concentration was measured by spectrophotometry.
The use of RNA standard takes the variable efficiency
of the reverse transcription reaction into account. The
copy number of standard GLRaV-4 RNA molecules was
calculated using the formula: Y molecules/μl = (X g/μl
RNA / [transcript length in nucleotides x 340]) x 6.022 x
10^23 (Qiagen Handbook, 2011). After a standard curve
was generated, 76 infected grapevine samples were
evaluated to determine GLRaV-4 titre. The standard curve
(plot of CT value, threshold cycle, against log of amount
of standard) was generated: y = -1.509ln(x) + 41.202; in
which R2 = 0.9999, y = CT value and x = RNA molecules/
μl. The CT value of the target was compared with the
standard curve (used as a reference in all subsequent
reactions), allowing calculation of the GLRaV-4 amount
in the samples. The absolute amount of GLRaV-4
nucleic acid in analyzed samples was determined and
ranged from ca. 1000 to 150,000 copies of GLRaV-4/μl.
This result can improve virus diagnosis by accurately
quantifying virus titre variations in grapevines. Financial
support: Embrapa
PIV56 - Detection And Coat Protein Gene
Characterization Of Grapevine Virus B
Isolates From Different Grapevine Species
Catarino, A.M., Fajardo, T.V.M., Eiras, M., Pio-Ribeiro, G.,
Nickel, O.
1. Embrapa Uva e Vinho, CNPUV, Rua Livramento,
515 - Bento Gonçalves, RS. CEP 95700-000
2. Instituto Biológico de São Paulo, IB, Av. Conselheiro
Rodrigues Alves, 1252 - São Paulo, SP. CEP: 04014-002
Dept. de Agronomia-Av. Dom Manoel de Medeiros, s/n-Dois
Irmãos. Recife-PE
Corky bark, a component of the grapevine rugose
wood complex, caused by Grapevine virus B, GVB
(Betaflexiviridae, Vitivirus), induces decrease of
production, incomplete ripening of grapes and
progressive decline. Cultivars and rootstocks differ in
their susceptibility to the corky bark disease. Some
are symptomless carriers or exhibit mild symptoms,
while others suffer rapid decline. The objective of this
work was to characterize partially three isolates of GVB
collected from different grapevine species and Brazilian
geographical regions: GVB, the isolate named CS, was
collected from cv. Cabernet Sauvignon (Vitis vinifera)
exhibiting dark red spotted leaves and mild curling
down of leaf edges, maintained in Bento Goncalves, Rio
Grande do Sul State; the isolate IS-SVF was collected
from cv. Isabel (V. labrusca) showing bark swelling
and longitudinal cracking of mature canes in Sao
Vicente Ferrer, Pernambuco State, and the isolate CO
was collected from symptomless cv. BRS Cora (hybrid
grapevine) in Jales, Sao Paulo State. The symptoms could
not be associated with a single virus, since these plants
could be infected by two or more virus. Total RNA was
extracted from infected grapevines by capture on silica
and the complete coat protein (CP) gene of GVB was
RT-PCR-amplified, cloned into pGEM-T Easy vector and
sequenced (two clones/isolate). An expected fragment
of 594 nucleotides (bp) (coding for 197 deduced amino
acids) was amplified by RT-PCR, using specific primers
for GVB (6445v and 7038r), from the three different
infected grapevine sources. The obtained sequences
showed a low variability of coat protein genes among the
three GVB isolates. Nucleotide and amino acid identities
were higher than 99% among themselves. GVB GenBank
accession codes are KF040331 (CO), KF040332 (IS-SVF)
and KF040333 (CS). Different grapevine symptoms vary
according to combinations of cultivar or host species
with viral isolates, strains or species. In this work,
high homologous coat protein sequences of three GVB
isolates from symptomatic and symptomless grapevines
and from distant geographical regions are involved in a
186
very different range of symptoms. Despite the limited
extention of this viral variability study, in this case, it
could be indicative that GVB grapevine symptoms (or its
absence) are more related to grapevine genotypes than
coat protein nucleotide sequence. Financial support:
Embrapa
PIV98 - Molecular Characterization Of
Virus Isolated Collected In Commercial
Plantings Of Watermelon In The State Of
Tropical Várzea Tocantins
Tavares, A.T., Chaves, P.P.N., Tavares, M.T., Carvalho,
A.L.A., Gellen, L.F.A.
1. Universidade Federal do Tocantins, UFT, Rua
Badejós, L 7 Chácara 69/72 Zona Rural Cx Postal 66 CEP:
77402-970 Gurupi-TO
2. Universidade Federal de Lavras, UFLA, Caixa Postal
3037 Campus Universitário Cep: 37.200-000 Lavras – MG
With this work, aimed to verify through artificial
inoculation, the phenotypic response of plants pumpkin
cv. ‘Caserta’ to isolates of ZYMV and (ZYMV)+SqMV and
also check the phenotypic reaction in four genotypes
of melon from an isolated mixed (ZYMV+SqMV), both
coming from watermelon producing regions in the state
of Tocantins. The study was conducted in a greenhouse
with a screened proof aphid. The experimental design
was completely randomized with five plants per plot and
three replications. The inoculated plants were observed
for symptoms as at 28, 33 and 38 days after germination.
Pumpkin plants, inoculated with simple isolate, the
predominant symptoms exhibited were mosaic and
parallel veins. In mixed infections there were more
aggressive symptoms, progressing to narrowing and
leaf deformation, and bubbles, parallel ridges and spur,
compromising much of the leaf area of plants evaluated.
In melon genotypes, the symptoms observed were
more aggressive in Sunshine and Yellow. Genotypes in
Eldorado genotype was observed only mosaic and melon
Valenciano was not observed symptoms.
PIV100 - In Silico Analysis Of The
Occurrence Of Horizontal Gene Transfer
(Hgt) And Lateral Gene Transfer (Lgt) In
Invertebrate Iridescent Virus 6 (Iiv6)
Pereira, A.F., Assis, F.L., Bonjardim, C.A., Trindade, G.S.,
Ferreira, P.C.P., Kroon, E.G., Abrahão, J.S.
Universidade Federal De Minas Gerais, UFMG, Av.
Antonio Carlos, 6627 - Pampulha - Belo Horizonte - MG.
CEP: 31270-901
Invertebrate Iridescent Virus 6 (IIV6) belongs to
Iridovirus genus, Iridoviridae family, and was recently
grouped into the Nucleo-Cytoplasmic Large DNA Viruses
(NCLDV), comprised by others giant virus. The IIV6 is
morphologically complex and posses a large genome
(212,482 bp) cody to 468 ORF’s (Open Reading Frame).
The IIV6 infect a wide range of insect hosts, being
vertically transmitted, and leading to a high mortality
rate of the infected larvae. This fact has stimulated the
use of the IIV6 as biopesticides, being important in
agronomy and in economy. Despite its economic and
ecologic relevance, few studies have been conducted
to elucidate these issues, as well as to understanding
the evolution of IIV6 and their relationships with their
hosts and other NCLDV. The aim of this study was to
analyze the occurrence of horizontal (HGT) and lateral
(LGT) gene transfer in the IIV6 genome. For this, all
IIV6 genes (GenBank: NC_003038.1) were subjected to
similarity analysis in the NCBI protein database (BlastP
program) using pre-set parameters, considering hits
that met the following criteria: e-value ≥ 10-5, coverage
≥ 30% and similarity ≥ 10%. Results: 50 (10,7%) ORF’s
showed hits that met the criteria for initial screening.
After, phylogenetic trees were built using maximum
parsimony methods implemented by MEGA 5 program.
Among these genes, 13/50 indicated high probability of
involvement in HGT and LGT, especially genes of cellular
metabolism. Phylogenetic analysis has revealed that IIV6
has more than one source of HGT, especially invertebrates
and bacteria. The results show, in an unprecedented way,
the events of HGT and LGT have directly influenced the
evolution of IIV6 genome, similarly as described for
others NCLDV. The ability of “obtain” the genes from the
host and from ecologically sympatric organisms suggests
the versatility of iridovirus, influencing the evolution and
host range of the members of this viral family. Financial
support: FAPEMIG, CAPES, CNPq, MAPA, PRPq
PIV126 - Identification Of Melon Cultivars
Resistant To Mixed Infection With Viruses
Zymv And Sqmv
Silva, C.P., Silva, E.N., Dos Santos, G.R., Carline, G.J.V.,
Arruda, E.L.
Universidade Federal do Tocantins, UFT, Rua Badejós,
Lote 7, Chácaras 69/72, Zona Rural. Cx.postal 66. CEP:
77402-970
Although Brazil is considered as one of the biggest
producers of melon in South America, with 17% of the
total production over there; there is a need to seek new
technologies and knowledge which can increase the
quantity and quality of melon production in Brazil, in
order to supply the national and international market.
Diseases constitute one of the largest barriers for its
development, and viral diseases are among the most
important melon diseases, occurring with high incidence
and distinct severities; causing a drastic reduction in
187
the total production and product quality as well. The
occurrences of mixed infections, infections caused by
the viruses Zucchini yellow mosaic virus (ZYMV) and
Squash mosaic virus (SqMV), are very common in the
melon crop. The infected plant presents a severe yellow
mosaic, a large reduction in leaf blade and rickets; also
it can produce deformed fruits and leads to total loss
of production. The genetic resistance in some kind of
cultivars is the most effective way to control virus. The
aim of the study was to identify melon cultivars resistant
to mixed infections with (ZYMV) e (SqMV). The tests
were performed with 9 melon cultivars varieties by
subjecting them to the mixed infection of ZyMV+SqMV.
The experimental design was completely randomized,
containing 11 treatments with 3 repetitions and with 9
plants per replication. The symptoms of the virus were
analyzed visually using a scale of severity from zero to
five. Grade 0, no symptom; grade 1, severity too low, up
to 1% of the leaf with symptoms; grade 2, low severity,
from 1% to 5% of the leaf with symptom; grade 3, median
severity, from 5% to 25% of the leaf with symptom;
grade 4, high severity, from 25% to 50% of the leaf with
symptom; and grade 5, very high severity, over 50% of
the leaf with symptom. The melon cultivars: Sunshine,
Eldorado, Gaúcho Casca de Carvalho and Melão Amarelo
were susceptible to virus ZyMV+SqMV; however, the
Melão Amarelo and the Sunshine were the most affected
by the viruses; over 50% of their leaves got very high
severity, graded as 5. The cultivars Jangada, Valeciano,
Mossoró, Melão Rei, and the cultivar from Formoso do
Araguaia were highly resistant to the virus, with no
presence of symptoms.
PIV129 - A Infectious Clone Of Tomato Mild
Mosaic Virus
Godinho, M.T., Zerbini, F.M.
Universidade Federal de Viçosa, UFV, Av Ph Rolfs s/ N
Diseases caused by begomoviruses (genus Begomovirus,
family Geminiviridae) are serious problems in
economically important crops such as beans, cotton,
cassava and tomatoes, in many tropical and subtropical
regions of the world. Several studies have been
conducted seeking to molecularly characterize these
pathogens. However, it is also important to determine
their biological characteristics. Begomoviruses are
notoriously difficult to purify and most of them are
not sap-transmitted. Fortunately, their circular, ssDNA
genomes facilitates the construction of infectious clones
which can be used for artificial inoculation in host range
assays, and can be stored indefinitely at -80oC. This
work was carried out to construct an infectious clone
of Tomato mild mosaic virus (ToMlMV), a molecularly
characterized tomato-infecting begomovirus from Brazil.
Clones corresponding to one and a half copies of the
DNA-A and DNA-B, flanked by two origins of replication,
were constructed by stepwise restriction digestions to
generate “0.5mers”, monomers and “1.5mers”, which
were then transformed into E. coli. The clones were
used for inoculation of N. benthamiana by particle
bombardment. Infection was confirmed by rolling circle
amplification followed by RFLP. The infectious clone can
now be used as a tool for the biological characterization
of ToMlMV. Financial support: Fapemig e Capes
PIV141 - Effects Of Chemical Products
And Extracts From Medicinal Plants On
Infectivity Of Papaya Lethal Yellowing
Virus In Papaya
Lima, J.A.A.L.
Instituições
Papaya (Carica papaya) is an important tropical
fruit crop and production is increasing every year
in Northeastern Brazil. Papaya lethal yellowing is a
disease caused by Papaya lethal yellowing virus (PLYV)
that occurs only in Northeastern Brazil. The symptoms
are characterized by progressive leaf yellowing and
greenish circular spots on the fruits. The virus is very
stable and can be detected in dried roots and leaves
maintained in laboratory conditions for up to 120 days.
The present study had the objective to evaluate the
distribution and movement of PLYV in mechanically
inoculated plants. Serological studies with antiserum for
PLYV were performed using equal amount of tissue from
each part of infected papaya plants to demonstrate the
virus distribution in the plants and how long it takes to
infect systemically a mechanically inoculated plant. The
absorption readings in enzyme linked immunossorbent
assay (ELISA) for PLYV were very similar when equal
amount of each part of systemically infected plants
were tested demonstrating that the virus is uniformly
distributed in the young, intermediate and older leaves,
stem and roots. On the other hand, the presence of the
virus in inoculated plants was detected by indirect
ELISA in the inoculated leaves 72 h after inoculation,
and only seven and ten days later the virus was detected
in the stem and in the roots, respectively. Sixteen days
after inoculation the virus was detected in the younger
leaves but the plants were systemically infected only 20
to 25 days after inoculation. This is in agreement with
which has been proposed that virus moves from cell
to cell, multiply in most of them and after reaching the
phloem cells it is rapidly transported over long distance
within the plant. According to the obtained results, PLYV
started to replicate inside the inoculated cell as soon as
it is inoculated, but it took approximately 20 to 25 days
188
to infect systemically the entire plant. Financial Support:
CNPq and PRONEX/FCPC/FUNCAP.
PIV145 - Molecular And Biological
Characterization Of Six Cowpea Mild
Mottle Virus Isolates Infecting Soybean
In Brazil
Zanardo, L.G., Silva, F.N., Milanesi, D.F., Castillo-Urquiza,
G.P., Lima, A.T.M., Almeida, A.M.R., Zerbini, F.M.,
Carvalho, C.M.
1. Universidade Federal de Viçosa, UFV, Av. P.H. Rolfs,
s/n - Viçosa - MG
2. Empresa Brasileira de Pesquisa Agropecuária,
Embrapa Soja, Rod. Carlos João Strass - Distrito de Warta Londrina - PR
Cowpea mild mottle virus (CPMMV, family
Betaflexiviridae, genus Carlavirus) is a serious problem
in Brazilian soybean. The virus is associated with
soybean stem necrosis disease and has been found in
fields from different Brazilian states. Until now only one
complete genome of CPMMV has been determinated.
The aims of this study were to report the biological and
molecular characterization of six isolates of CPMMV.
Soybean plants with mosaic and stem necrosis were
collected in Bahia, Goias, Mato Grosso and Minas Gerais
states, Brazil. For host range studies the sap from
infected soybean leaves was mechanically inoculated
into 21 species/cultivars belonging to Amaranthacea,
Chenopodiaceae, Cucurbitaceae, Solanaceae and
Fabaceae. Symptoms were evaluated and indirect ELISA
was used to confirm infection. Complete genomes were
amplified from total RNA extracted of soybean plants cv.
CD206, followed by RT-PCR. The nucleotide sequences
obtained were assembled using DNA BASER v.3.5, and
the ORF’s were determined using ORF Finder. Pairwise
nt comparisons were analyzed in MEGA v.5.0 and
pairwise aa comparisons in DNAMAN v.7.0. Phylogenetic
trees were constructed using Bayesian Inference.
Potential recombinant sequences were performed using
RDP v.3.44. The viral isolates were able to infect Glycine
max (cvs. CD206 and Pintado), Phaseolus vulgaris
(cvs. Jalo and Manteigao), Vigna unguiculata, Nicotiana
benthamiana, N. debney, N. glutinosa, Chenopodium
quinoa and C. amaraticolor. Complete genomes of the
CPMMV isolates are 8,180-8,198 nt long, excluding the
3’-poly(A) tail, and have 67-68% nt sequence identity
with a Ghana CPMMV isolate. The replicase has only
60-61% nt identity with the Ghana isolate, and the coat
protein is highly conserved (79% nt identity and 9596% amino acid identity). The high CP identity and the
phylogeny supported the classification of the Brazilian
isolates as CPMMV. Biological and molecular differences
with the Ghana CPMMV isolate were found and indicated
that the six isolates represent a distinct CPMMV strain
denominated as CPMMV-BR. The recombination
occurred mainly in the polymerase gene, and may occur
less frequently in other regions of the CPMMV genome.
Funding: Fapemig, CNPq.
PIV147 - Movement And Distribution
Of Papaya Lethal Yellowing Virus In
Mechanically Inoculated Papaya
Anselmo, G.C., Lima, J.A.A., Nascimento, A.K.Q.
Universidade Federal do Ceará, Laboratório Virologia
Vegetal, UFC - LabVV, Depto Fitotecnia, Laboratório
Virologia Vegetal, Fortaleza, CE – 60.440.554
Papaya (Carica papaya) is an important tropical
fruit crop and production is increasing every year
in Northeastern Brazil. Papaya lethal yellowing is a
disease caused by Papaya lethal yellowing virus (PLYV)
that occurs only in Northeastern Brazil. The symptoms
are characterized by progressive leaf yellowing and
greenish circular spots on the fruits. The virus is very
stable and can be detected in dried roots and leaves
maintained in laboratory conditions for up to 120 days.
The present study had the objective to evaluate the
distribution and movement of PLYV in mechanically
inoculated plants. Serological studies with antiserum for
PLYV were performed using equal amount of tissue from
each part of infected papaya plants to demonstrate the
virus distribution in the plants and how long it takes to
infect systemically a mechanically inoculated plant. The
absorption readings in enzyme linked immunossorbent
assay (ELISA) for PLYV were very similar when equal
amount of each part of systemically infected plants
were tested demonstrating that the virus is uniformly
distributed in the young, intermediate and older leaves,
stem and roots. On the other hand, the presence of the
virus in inoculated plants was detected by indirect
ELISA in the inoculated leaves 72 h after inoculation,
and only seven and ten days later the virus was detected
in the stem and in the roots, respectively. Sixteen days
after inoculation the virus was detected in the younger
leaves but the plants were systemically infected only 25
to 30 days after inoculation. This is in agreement with
which has been proposed that virus moves from cell
to cell, multiply in most of them and after reaching the
phloem cells it is rapidly transported over long distance
within the plant. According to the obtained results, PLYV
started to replicate inside the inoculated cell as soon as
it is inoculated, but it took approximately 25 to 30 days
to infect systemically the entire plant. Financial Support:
CNPq and PRONEX/FCPC/FUNCAP.
189
PIV148 - Synergistic Interaction Between
Squash Mosaic Virus And Virus Species From
The Genus Potyvirus In Melon
Silva, F.R., Barbosa, G.S., Nascimento, A.K.Q., Lima, J.A.A.
Universidade Federal do Ceará, Laboratório Virologia
Vegetal, UFC - LabVV, Depto Fitotecnia, Laboratório
Virologia Vegetal, Fortaleza, CE – 60.440.554
The Northeastern Brazil has a great potential for
production of melon (Cucumis melo) and watermelon
(Citrullus lanatus), but virus infections can seriously
affect their yield. The most important virus species
found naturally infecting melon and watermelon in
Northeastern Brazil belong to the genus Potyvirus:
Papaya ringspot virus, type Watermelon (PRSV-W);
Watermelon mosaic virus (WMV) and Zucchini yellow
mosaic virus (ZYMV); and genus Comovirus: Squash
mosaic virus (SQMV). Considering the natural infection
of two or more viruses in the same plant, the present
research had the objective to evaluate the effects of mixed
infection of SQMV with species of the genus Potyvirus.
Groups of 12 plants were inoculated with the following
virus combinations: A- Plants inoculated with a mixture
of SQMV and PRSV-W; B- SQMV and WMV; C- SQMV and
ZYMV; D- Plants inoculated only with SQMV; E- Plants
inoculated only with PRSV-W; F- Plants inoculated only
with WMV and G- Plants inoculated only with ZYMV. The
study also included non-inoculated plants as control.
Synergistic effects were observed when SQMV was
mixed inoculated with either PRSV-W, WMV or ZYMV, but
all mixed inoculated plants started to present the typical
SQMV symptoms seven days after inoculation, and only
three days later they showed more severe symptoms
than those exhibited by the plants with single infections.
All mixed infected plants also presented delay of the
flowering period, reduction in size, reduction of number
of leaves, and fresh and dried weights when compared
with healthy and single infected plants. Nevertheless,
the interaction of SQMV with PRSV-W caused the
greatest reduction. All single and mixed infections were
confirmed by serology. These results demonstrated
that all control measures involving the development of
resistant genotypes should consider the effects of mixed
infections of virus in melon and watermelon. Financial
Support: CNPq and PRONEX/FCPC/FUNCAP.
PIV149 - Molecular Variability Of Two
Cowpea Mild Mottle Virus (Cpmmv) Strains
Infecting Soybean In Brazil
Zanardo, L.G., Silva, F.N., Milanesi, D.F., Lima, A.T.M.,
Castillo-Urquiza, G.P., Carvalho, S.L., Zerbini, F.M.,
Carvalho, C.M.
Universidade Federal de Viçosa, UFV, Av. P.H. Rolfs,
s/n - Viçosa - MG
Soybean stem necrosis disease is caused by CPMMV
(Family Betaflexiviridae, Genus Carlavirus). Symptoms
of viral infection in soybean plants are highly variable
and the viruses have been found in fields from several
producing Brazilian states. The aim of this study was to
determine the molecular variability of eighteen isolates
of CPMMV from fields of different Brazilian states
(Bahia, Goiás, Maranhão, Mato Grosso, Minas Gerais
and Pará) during the years of 2001-2010. Symptoms
were evaluated in soybean plants cv. CD206 and the
infection confirmed by indirect ELISA. Partial sequences
of genomes (ORF2-3’end) were amplified from total
RNA extracted of soybean cv. CD206, followed by RTPCR. The nt sequences obtained were assembled using
DNA BASER v.3.5 and the ORFs were determined using
ORF Finder. Pairwise nt comparisons were analyzed in
MEGA v.5.0 and pairwise aa comparisons in DNAMAN
v.7.0. Detection of potential recombinant sequences
was performed using RDP v.3.44. Phylogenetic trees
were constructed using Bayesian Inference for partial
genomes and for each ORF individually. Descriptors of
molecular variability were estimated using the DnaSP
software v.5.10 and site-specific selection analysis was
implemented in the Datamonkey server. The isolates
showed a variety of symptoms in soybean, ranging
from mild (crinkle/blistering of leaves, mosaic and vein
clearing) to severe (bud blight, dwarfism, leaf and stem
necrosis). Only one CPMMV isolate had a recombinant
portion among the eighteen evaluated. Pairwise
comparisons and phylogenetic analysis showed that
the isolates are distinct and form two distinct groups,
showing the existence of two strains, with molecular
variability between them. The phylogenetic tree did
not show clustering based on the year of collection or
geographical origin; some groupings were based on
symptoms. Selection analyses showed that all ORFs were
under purifying selection. Funding: Fapemig, CNPq.
PIV154 - Interfering Rna As A Strategy For
Silencing The Rep Gene Of Begomoviruses
Infecting Tomato (Solanum Lycopersicum)
In Brazil
Paula, N.T., Albuquerque, L.C., Aragão, F.J.L.
Universidade de Brasília, UNB, Campus Universitário
Darcy Ribeiro CEP: 70910-900
The Begomovirus (Family Geminiviridae) represents an
important group of pathogens that infect a wide range of
plant species and cause significant losses in agriculture.
These viruses are transmitted to dicotyledonous
plants by whitefly Bemisia tabacci, whose control
190
by insecticides is difficult and costly, making genetic
control a more promising management. In this study,
Nicothiana benthamiana was used as a model to obtain
plants with wide resistance to different begomoviruses
infecting tomato in Brazil, through the use of molecular
mechanism of interfering RNA (RNAi). A chimerical
sequence of 432 nucleotide within the rep gene
from two important Brazilian begomovirus species,
Tomato yellow vein streak virus (ToYVSV) and Tomato
chlorotic mottle virus (ToCMoV) was used to generate
an intron-hairpin construction. Following ligation
of the construct into binary vector pCAMBIA 3300,
Agrobacterium tumefaciens cells (strain EHA-105)
were transformed. The bar gene was used as selection
marker and regenerated plants tested for the presence
of PAT protein. A total of 21 N. benthamina plants were
selected. Currently, progenies arising therefrom are
being challenged with ToYVSV and ToCMoV and degree
of resistance are being evaluated.
PIV156 - PHENOTYPIC REACTION OF PUMPKIN
AND MELON PLANTS TO INFECTION OF ISOLATED
SINGLE AND MIXED ZYMV ZYMV+SQMV
Tavares, A.T., Tavares, M.T., Nunes, P.P., Gellen, L.F.A.,
Carvalho, A.L.A.
1. Universidade Federal do Tocantins, UFT, Rua
Badejós, L 7 Chácara 69/72 Zona Rural Cx Postal 66 CEP:
77402-970 Gurupi-TO
2. Universidade Federal de Lavras, UFLA, Caixa Postal
3037 Campus Universitário Cep: 37.200-000 Lavras – MG
With this work, aimed to verify through artificial
inoculation, the phenotypic response of plants pumpkin
cv. ‘Caserta’ to isolates of ZYMV and (ZYMV)+SqMV and
also check the phenotypic reaction in four genotypes
of melon from an isolated mixed (ZYMV+SqMV), both
coming from watermelon producing regions in the state
of Tocantins. The study was conducted in a greenhouse
with a screened proof aphid. The experimental design
was completely randomized with five plants per plot and
three replications. The inoculated plants were observed
for symptoms as at 28, 33 and 38 days after germination.
Pumpkin plants, inoculated with simple isolate, the
predominant symptoms exhibited were mosaic and
parallel veins. In mixed infections there were more
aggressive symptoms, progressing to narrowing and
leaf deformation, and bubbles, parallel ridges and spur,
compromising much of the leaf area of plants evaluated.
In melon genotypes, the symptoms observed were
more aggressive in Sunshine and Yellow. Genotypes in
Eldorado genotype was observed only mosaic and melon
Valenciano was not observed symptoms. Financial
support: CAPES, CNPq e UFT
PIV195 - Potato Virus Y And Pepper Mild
Mottle Virus Dual Infection In Capsicum
Baccatum ‘Aji Amarillo’
Chaves, A.L.R., Duarte, L.M.L., Eiras, M., Ramos, A.F.,
Colariccio, A., Harakava, R.
Instituto Biológico, IB, Av. Cons. Rodrigues Alves, 1252.
V. Mariana, SP. CEP 04014-002
Among peppers (Capsicum baccatum), the cultivar
‘Aji Amarillo’, native to the Andes, South America, is
considered the basis of Peruvian cuisine. In Brazil,
there are no cultivars that match ‘Aji Amarillo’. Plants
of pepper ‘Aji Amarillo’ from a commercial crop in
Piedade, State of São Paulo, showing leaf mosaic and
distortion of leaves and fruits, were examined in the
transmission electron microscope and subjected to
biological, serological and molecular tests. Viral particles
with two kinds of morphology, i.e. rigid helical rodshaped with 300 nm in length, and elongated flexuous
rod-shaped with approximately 700 nm in length,
were observed by sap negative staining. Viruses were
biologically isolated by sap mechanical inoculation in
Nicotiana glutinosa and Datura stramonium. Potato
virus Y (PVYO) was identified by DAS-ELISA and the
presumable Tobamovirus isolate was serologically
related to Pepper mild mottle virus (PMMoV) in PTAELISA. DNA fragments with 850 bp were successfully
amplified by RT-PCR with specific primers flanking the
coat protein (CP) ORF of the tobamovirus subgroup I.
The sequenced DNA products presented percentage of
nucleotide identity higher than 94% with homologous
sequences of PMMoV deposited in databases. The
deduced CP aminoacids sequence showed a methionine
instead of asparagine at 139 position, indicating that,
probably, this isolate is not capable to overcome L3
gene resistance. Phylogenetic analysis using maximum
likelihood criterion was performed using PAUP program
after nucleotide substitution model determination [HKY
+ G (=1.07)] and comparisons with PMMoV homologous
sequences from different geographical regions. PMMoV
Brazilian isolate (named PMMoV-Piedade) clustered in
the monophyletic group comprising European, Asian
and Brazilian isolates. It is suggested that PMMoVPiedade should have been introduced from Peru through
imported seeds, since it did not share the same common
ancestor of Brazilian isolates available in databases.
PIV231 - The Relative Contribution Of
Recombination And Mutation To The
Genetic Variability Of Begomovirus
Populations
Lima, A.T.M., Silva, J.C.F., Silva, F.N., Urquiza, G.P.C.,
Silva, F.F., Seah, Y.M., Pereira, H.M.B., Mizubuti, E.S.G.,
Duffy, S., Zerbini, F.M.
191
1. Universidade Federal de Viçosa, UFV, Viçosa, MG
36570-000, Brazil
2. The State University of New Jersey, Rutgers, New
Brunswick, NJ 08901, USA
Begomoviruses are single stranded DNA plant viruses
responsible for serious agricultural threats. Previous
studies have shown that begomovirus populations
exhibit a high within-host molecular variability and
may evolve as quickly as RNA viruses. Although the
recombination-prone nature of begomoviruses has been
exhaustively demonstrated, no work has attempted to
determine the relative contribution of recombination
and mutation to the standing molecular variability of
begomovirus populations. We estimated the molecular
variability levels of begomovirus datasets collected from
around the world and observed that they were similar
to some plant RNA virus populations, even though these
viruses replicate using the supposedly proof-reading DNA
polymerases from their hosts. An uneven distribution of
molecular variability levels across the length of the CP
and Rep genes due to recombination was readily evident
from our analyses, suggesting a significant contribution
of this evolutionary mechanism to the standing
molecular variability. We mapped all substitutions over
CP and Rep maximum likelihood trees and counted
the number of substitutions on branches which were
associated to recombination (ηr) and mutation (ημ), in
order to estimate their relative contribution (ηr/ημ). In
addition, we also estimated the per generation relative
rates of both evolutionary mechanisms (r/μ) as the ratio
between the population-scaled recombination (ρ = 2Ner)
and mutation rates (θ = 2Neμ), to express how frequently
these sequences are targeted by recombination relative
to mutation. We showed that the relative contribution
of recombination and mutation is not, necessarily, a
function of their relative rates. In addition, although a
large fraction of the molecular variability levels could
be assigned to recombination, it was always lower than
that due to mutation, indicating that the diversification
of begomovirus populations is predominantly driven
by mutational dynamics. Financial support: FAPEMIG,
INCTIPP
PIV241 - Tripartide Cucumber Mosaic Virus
Based Vector Development For Expression
Foreign Proteins In Plants
Souza, A.C., Inoue-Nagata, A.K., Chikara, M., Nagata, T.
1. Universidade de Brasília, Unb, Instituto de Biologia,
Campus Universitário Darcy Ribeiro - Asa Norte, 70910-900
Anápolis BR 060 Km 09 Gama - DF Caixa Postal 218 CEP
70351-970
3. Research Faculty of Agriculture, , Hokkaido
University, Sapporo, Hokkaido, Japan
Plants represent ideal system for production of
heterologous proteins. However, transgenic plant-based
protein production systems showed many disadvantages
as low protein production and long term development
required. Thus, the use of plant viruses as vehicles for
foreign protein production is the good alternative. Plant
virus-based protein production systems in binary vector
offer many advantages as the short developing time and
the higher yield. Cucumber mosaic virus (CMV) is one
of the viruses that has been used for protein production
in plants and has an extremely wide plant host range.
The tripartite CMV based vector was developed using
Agrobacterium tumefaciens system. Each cDNA of RNA
1, RNA 2 and RNA 3 genome segment was cloned into
binary vector pBI121 and transferred to Agrobacterium
GV 3101. Agro-infiltration of these three constructs
in Nicotiana benthamiana produced CMV systemic
infection with symptoms as wild type virus. In order
to develop CMV-based protein expression vector, the
cDNA of RNA 2 was modified by PCR using primers to
introduce additional restriction enzyme sites for easier
cloning. The modified RNA2 (cDNA) was cloned into pBI
121 and transferred to Agrobacterium GV 3101, the three
Agrobacterium constructs (RNA1, RNA3 and modified
RNA2) were co-infiltrated in Nicotiana benthamiana, and
after three days, infection was confirmed by symptom
development, though the symptom was attenuated
maybe due to the deletion of 2b gene in RNA2 which was
a PTGS supressor. The presence of CMV infection was
confirmed by Dot-Blot Immunobiding assay using antiCMV antibody. This result, confirm that the tripartite
CMV-based vector is a viable system. The capacity of
expression foreign proteins will be evaluated with GFP
expression.
PIV242 - Management Of Zucchini Lethal
Chlorosis Virus Disease In Cucurbita Pepo
Caserta Treated With Bougainvillea
Spectalis And Mirabilis Jalapa Leaf
Extracts
Duarte, L.M.L., Alexandre, M.A.V., Chaves, A.L.R.,
Azevedo Filho, J.A.
1. Instituto Biológico, IB, Av. Cons. Rodrigues Alves,
1252, São Paulo, SP
2. APTA- Pólo Leste Paulista, APTA, Estrada Nelson
Taufic Nacif, Km 03, CP-01, 13910-000 Monte Alegre do SulSP
Plant extracts containing inhibitors of viral infection
have been tested in some systems in which systemic
reaction was induced by viruses. The inhibitory action
192
of Bougainvillea spectabilis and Mirabilis jalapa foliar
extracts has been evaluated against Tomato spotted
wilt virus (Tospovirus) on tomato plants and Zucchini
yellow mosaic virus (Potyvirus) on Cucurbita pepo
‘Caserta’. The extracts were proven to be effective in
inhibiting infection by these viruses by up to 70% when
prepared at a concentration of 1/50 (W/V). In recent
years the incidence of lethal chlorosis disease caused by
the tospovirus Zucchini lethal chlorosis virus (ZLCV) is
increasing and worrying cucurbit crop producers due to
crop losses. Symptomatic plants are severely stunted and
die before they bloom. In order to evaluate the inhibitory
effect of B. spectabilis and M. jalapa on infection caused
by ZLCV the extracts were prepared by grinding leaves
in the proportion of 1g per 50mL of distilled water
and sprayed on C. pepo plants 24, 48, 72 and 96 hours
before inoculation (BI) with the virus. As well as TSWV x
tomato system, leaf extract from B. spectabilis showed to
be more efficient than that one from M. jalapa. A highest
inhibition percentage was observed when the extract
was applied until 24 (70%) and 48 (50%). Extract
applications carried out 72 and 96h BI did not induce any
inhibitory effect. It is noteworthy that the appearance of
mosaic symptoms in treated plants manifested 20 days
after virus inoculation (AI) as compared to control plants,
which presented mosaic and leaf deformation at the 7th
day AI. In addition, the inhibitor must have affected the
translocation of the virus in the plant, once some plants
showed symptoms on one leaf only, usually the 3dr or
4th above the cotyledon leaves. These results open a
new perspective on management of lethal chlorosis
disease, since the infection with ZLCV until early fruiting
prevents the production of zucchini marketable fruits.
PIV243 - MANAGEMENT OF ZUCCHINI LETHAL
CHLOROSIS VIRUS DISEASE IN CUCURBITA PEPO
CASERTA TREATED WITH BOUGAINVILLEA
SPECTALIS AND MIRABILIS JALAPA LEAF
EXTRACTS
Duarte, L.M.L., Alexandre, M.A.V., Chaves, A.L.R.,
Azevedo Filho, J.A.
1. Instituto Biológico, IB, Av. Cons. Rodrigues Alves,
1252, 04014-002, São Paulo, SP
2. APTA - Pólo Leste Paulista, APTA, Estrada Nelson
Taufic Nacif, Km 03, CP-01, 13910-000 Monte Alegre do SulSP
Plant extracts containing inhibitors of viral infection
have been tested in some systems in which systemic
reaction was induced by viruses. The inhibitory action
of Bougainvillea spectabilis and Mirabilis jalapa foliar
extracts has been evaluated against Tomato spotted
wilt virus (Tospovirus) on tomato plants and Zucchini
yellow mosaic virus (Potyvirus) on Cucurbita pepo
‘Caserta’. The extracts were proven to be effective in
inhibiting infection by these viruses by up to 70% when
prepared at a concentration of 1/50 (W/V). In recent
years the incidence of lethal chlorosis disease caused by
the tospovirus Zucchini lethal chlorosis virus (ZLCV) is
increasing and worrying cucurbit crop producers due to
crop losses. Symptomatic plants are severely stunted and
die before they bloom. In order to evaluate the inhibitory
effect of B. spectabilis and M. jalapa on infection caused
by ZLCV the extracts were prepared by grinding leaves
in the proportion of 1g per 50mL of distilled water
and sprayed on C. pepo plants 24, 48, 72 and 96 hours
before inoculation (BI) with the virus. As well as TSWV x
tomato system, leaf extract from B. spectabilis showed to
be more efficient than that one from M. jalapa. A highest
inhibition percentage was observed when the extract
was applied until 24 (70%) and 48 (50%). Extract
applications carried out 72 and 96h BI did not induce any
inhibitory effect. It is noteworthy that the appearance of
mosaic symptoms in treated plants manifested 20 days
after virus inoculation (AI) as compared to control plants,
which presented mosaic and leaf deformation at the 7th
day AI. In addition, the inhibitor must have affected the
translocation of the virus in the plant, once some plants
showed symptoms on one leaf only, usually the 3dr or
4th above the cotyledon leaves. These results open a
new perspective on management of lethal chlorosis
disease, since the infection with ZLCV until early fruiting
prevents the production of zucchini marketable fruits.
PIV259 - Dwv: Deforming Wing Virus Or Bees
Immunodeficiency Virus?
Golin, R.O., Cañedo, A.D., Oliveira, M.C.P.V., Costa, M.F.,
Barcellos, C.D.L.
Universidade Federal do Pampa, UNIPAMPA, Avenida
Antônio Trilha 1847
The bees are social insects and take part in the
pollination of various plants that provide food for man.
In Brazil the African influence of bees made them highly
and producing a swarm local, which increases the
production of honey in the country. Various diseases have
been undermining the apicultural production, mostly
caused by viruses. Viruses that infect bees are within
the order Picornavirales, these translate its genetic
information generating one or more polyprotein that
are later cleaved by a protease called 3 c. In the case of
virus DWV (Deforming Wing virus) it cleaves in specific
sites, AKPE, AVPE, AIPE and AFPE. The protease is the
function of the polyprotein cleavage, but also attacking
antiviral proteins of the host. In the present work we
have reviewed on proteome of the bee, the possible
targets of 3 c protease. Of more than 10000 proteins that
are part of the proteome of bees only 104 were target of
193
3 c protease. Among the targets identified were found
3 of 4 Apidaecinas described and the DICER protein.
The apidaecinas have antibiotic function for the bee, the
virus to infect the bee and cleave some apidaecinas will
inactivate your natural antibiotic, allowing the entry of
other pathogens in your body and, therefore generating
an incubator of these within the hives. On the other hand,
protein DICER, has among its functions the recognition
and degradation of double-stranded RNAs. According to
our hypothesis, the 3 c protease to cleave the DICER will
enable the body to recognize the virus DWV, allowing the
occurrence of new viral infections by other viruses RNA
and also infection with pathogenic microorganisms due
to lack of Apidaecinas. These data still need experimental
validation; however they are of great value because they
provide data that will allow the understanding the viral
infection mechanism of DWV and the development of
antiviral agents, contributing with the apiculture health
and increasing productivity of the apiaries. Financial
support: CNPq
PIV282 - Evaluation Via Biolistic Assays Of
The Spectrum Of Efficiency Of New Tomato
Resistance Sources Against Four Bipartite
Begomovirus Species
Machado, M.R., Mendonza, L.L., Pereira-Carvalho, R.C.,
Lacerda, A.L., Fonseca, M.E.N., Ribeiro, S.G., Boiteux, L.S.
1. Departamento de Fitopatologia, UnB, Dept.
Fitopatologia , Campus Universitário Darcy Ribeiro, Brasília
CEP 70910-900
Anápolis BR 060 Km 09 Gama - DF CEP 70351-970
CENARGEN, Parque Estação Biológica - PqEB - Av. W5
Norte (final) 70770-917 – Brasilia
In Brazil, a bipartite Begomovirus species complex
transmitted by Bemisia tabaci biotype B has been
reported infecting tomatoes. The amount of information
available about the phenotypic expression as well as
the spectrum of efficiency of distinct resistance sources
to Brazilian begomoviruses is still limited. So far, the
Ty-1 and Ty-3 loci are the most frequently employed
resistance factors. Five new accessions (‘LAM 100’,
‘LAM 156’, ‘LAI 132’, ‘H-24’ and ‘Ty-198’) without the
Ty-1 and Ty-3 loci were identified as promising sources
of resistance after preliminary field assays. Individual
plants of these five accessions as well as ‘Viradoro’
(susceptible control) and ‘TX-468-RG’ (resistant due to
the locus tcm-1) were evaluated in biolistic assays with
infective clones of four begomovirus: Tomato severe
rugose virus (ToSRV); Tomato rugose mosaic virus
(ToRMV); Tomato yellow vein streak virus (ToYVSV)
and Tomato chlorotic mottle virus (ToCMoV). Virus
accumulation was evaluated with Southern Blot assays
using a universal probe. ‘Viradoro’ displayed severe
symptoms and high virus DNA accumulation in all
assays. The line ‘H-24’ (source of Ty-2 locus from S.
habrochaites) displayed a susceptible reaction to ToSRV
and ToRMV. The accession ‘LAI 132’ displayed a peculiar
species-specific resistance to ToCMoV. The ‘TX-468-RG’
and the accessions ‘LAM 100’, ‘LAM 156’ and ‘Ty-198’
were resistant to all virus species, being recommended
for wide spectrum resistance breeding. Analyses with
a panel of molecular markers linked to all currently
characterized begomovirus resistance loci in tomato
(Ty-1, Ty-2, Ty-3, Ty-4 e Ty-5/ty-5) indicated that these
lines are sources of either new genes or alleles related
to begomovirus resistance. Financial support: Fundo
Embrapa/Monsanto, CNPq, INCT-Interações PlantaPraga, FapDF
PIV301 - New Begomoviruses Associated With
Malvaceous Weed In Brazil’s Northeast
Nascimento, L.D., Silva, S.J.C., Ferro, M.M.M., Assunção,
I.P., Zerbini, F.M., Lima, G.S.A.
1. Universidade Federal de Alagoas, UFAL, Centro de
Ciências Agrárias - CECA, BR 104 Norte, Km 85, CEP 57100000
Rua Dom Manoel de Medeiro, s/n, Dois Irmãos Recife - PE,
52171-900
3. Universidade Federal de Viçosa, UFV, Avenida P H
Rolfs, s/n - Campus Universitário, Viçosa - MG, 36570-000
Begomovirus (Family Geminiviridae) cause serious
problems on crops production of many tropical and
subtropical areas around the world, including Brazil.
The begomoviruses are transmitted by whiteflies, they
have circular single-stranded DNA and are frequently
associated with weeds, which can serve as natural
reservoirs of virus being able to cause epidemics on
crops plants. Therefore, this study aimed to characterize
the begomoviruses associated with weeds from
Malvaceae family in Brazil’s Northeast and to evaluate
their diversity and importance as source of new virus for
crops plants. Malvaceous weeds with typical symptoms
of begomoviruses infection were collected in Alagoas,
Pernambuco and Bahia state during the years 2010 to
2012. A total of 22 genomic components (13 DNA-A and
9 DNA-B) were amplified by RCA, after they were cloned
and sequenced. Analysis of the sequences indicated the
presence of 5 begomoviruses species, from which 3 were
new. The phylogenetic analysis indicated that the new
species were grouped with Brazilian begomoviruses.
Multiple evidences of recombination were detected.
194
No evidence for intra specific recombination events
was observed. The begomoviruses from Sida spp.
and tomato were identified as parents. These results
indicate that malvaceous’ weeds are major reservoirs
of begomoviruses and that events of recombination
apparently have contributed to the emergence of new
species on these hosts.
PIV351 - Identification Of Putative PlantPotyvirus Interactions Using Systems
Biology
Bruckner, F.P., Silva, J.C.F., Barros, A.P.O., Alfenas-Zerbini,
P.
Universidade Federal de Viçosa, UFV, Campus
universitário, Viçosa, MG
Plant viruses have small genomes of simple organization,
encoding 3 to 10 viral proteins. Successful infection
depends on cell manipulation by the virus, with complex
interactions occurring between viral and host factors.
To understand the processes of tomato infection by
the potyvirus Pepper yellow mosaic virus (PepYMV)
a subtractive library identified several genes as
differentially expressed during viral infection. Analyzing
three overexpressed genes, TCTP, Gal83 and DnaJ, we
identified that the silencing of them causes a decrease
in viral accumulation. However, the exact role of these
proteins during infection and their relationship with
viral proteins and other host-factors remain unknown.
To identify the connections between these proteins,
other plant proteins and viral proteins involved in
PepYMV infection, a network based on interactions
described for several pathosystems was build using
homologous proteins from A. thaliana. Previously
described plant-potyvirus interactions were compiled,
A. thaliana homologues were identified by WU-BLAST
in the TAIR database, and putative interactor proteins
were identified by STRING database online search. The
results show a large network of proteins with multiple
ways in which potyviruses might manipulate plant
cells. Two proteins identified in the library, DnaJ and
Hsp90, were connected to Hsp70 whose interaction
with NIb has been reported. Previously demonstrated
interactions between VPg and translation factors such
as eIF4E and PABP were also detected. Although direct
connection were not identified for TCTP and Gal83, in
silico analysis suggests that TCTP may interact with a
range of ribosomal proteins. Other proteins appear to be
directly or indirectly linked to HC-Pro, such as the 20S
proteasome, calnexin, and a calmodulin-related protein.
The in vivo occurrence and relevance of these and other
interactions remains to be analyzed.
PIV357 - Diversity Of Badnavirus Sequences
Infecting Yam (Dioscorea Cayanensis)In
Alagoas, Brazil
Guimarães, K.M.C., Silva, S.J.C., Melo, A.M., Assunção,
I.P., Lima, G.S.A.
Universidade Federal de Alagoas, UFAL, Centro de
Ciências Agrárias - CECA, BR 104 Norte, Km 85, CEP 57100000
Viruses of the genus Badnavirus (family Caulimoviridae)
are pararetroviruses, characterised by non-enveloped
bacilliform particles containing circular dsDNA genomes
of 7.0-7.6 kb. Badnaviruses are reported infecting a wide
range of economically important tropical crops such
as cacao, banana, rice, sugarcane, citrus, and yam. The
Brazilian Northeast accounts for 90% of the national
production of yams. This crop has great economic and
social importance in Alagoas, being the main activity of
family farming in the region. The sequence diversity was
analyzed in the reverse transcriptase (RT)/ribonuclease
H (RNaseH) coding region of 50 badnavirus isolates
infecting yam (Dioscorea cayanensis) in the counties of
Arapiraca, Chã Preta e Viçosa in Alagoas during 2012.
Total DNA was extracted from leaf tissue using Doyle &
Doyle protocol. To confirm the presence of badnaviruses,
PCR was carried out using the degenerate primer
set Badna-FP and Badna-RP, specific for Badnavirus
genera. PCR fragments obtained were sequenced.
Nucleotide sequences were subjected to a BLAST search
for preliminary species assignment based on the 80%
threshold level established by the Caulimoviridae Study
Group of the ICTV. Additional nucleotide pairwise
comparisons were performed with DNAMAN version 4.0.
Multiple alignments were done using MUSCLE program,
available in MEGA 5.1 package, and a phylogenetic tree
was performed with Maximum Likelihood method.
Bootstrap analysis of the 5.000 replications was carried
out to verify the significance of each tree branch. Pairwise
comparisons and phylogenetic analysis revealed the
presence of at least three species, including Dioscorea
bacilliform alata virus (DBALV), and two new probable
species represented by isolates CH412 e CH612,
which are more related with Dioscorea bacilliform
sansibarensis virus (DBSNV).
Begomoviruses Associated To Hyptis Sp.
And Physalis Sp.
Nascimento, L.D., Silva, S.J.C., Ferro, M.M.M., Oliveira,
M.H.C., Assunção, I.P., Lima, G.S.A.
Ciências Agrárias – CECA, BR 104 Norte, Km 85, CEP 57100000
195
Begomoviruses (family Geminiviridae) cause serious
diseases in several economically important crops and
are also associated with a wide range of weed plants.
Weeds can act as reservoirs or sources of new species
of begomoviruses which arise from recombination
events or pseudo-recombination because of its frequent
co-infection with more than one viral species. Here,
we report the detection of novel species associated
with the weeds Hyptis sp. (Lamiaceae) and Physalis sp.
(Solanaceae). A sample of Physalis sp. and two samples
of Hyptis sp. showing typical symptoms of viral infection
were collected in Rio Largo, state of Alagoas. Total DNA
was extracted from each sample and complete viral
genomes were amplified using the DNA polymerase from
phage phi29, cloned into plasmid vectors and completely
sequenced. Six clones were obtained (5 DNA-A and 1
DNA-B). Pairwise sequence comparisons indicated the
presence of three novel species whose proposed names
are: Hyptis rugose mosaic virus 1 (HyRMV1) and Hyptis
rugose mosaic virus 2 (HyRMV2), obtained from the
same Hyptis sp. sample; while Physalis yellow spot
virus (PhYSV), was found initially from Physalis sp. and
subsequently detected on another Hyptis sp. sample. In a
phylogenetic tree, the novel species clustered with other
Brazilian begomoviruses, indicating their indigenous
origin. Since HyRMV1 and HyRMV2 were found in coinfection, added to the fact of PhYSV infect both Hyptis
sp. and Physalis sp., we tested the hypothesis of these
species have arisen from recombination events. Strong
evidence of recombination was found among HyRMV1
and HyRMV2, identifying HyRMV1 as probable parental.
The Tomato rugose mosaic virus (ToRMV) was identified
as possible parental to the HyRMV1 and PhYSV species.
These results indicate that Physalis sp. and Hyptis sp.
are reservoirs of begomoviruses and that recombination
events have apparently contributed to the emergence of
new species of virus in these hosts.
PIV369 - Natural Infection Of Papaya
Ringspot Virus In The State Of Amazonas
Brioso, P.S.T., Souza, M.G., Pereira, J.C.R., Gasparotto, L.
1. Universidade Federal Rural do Rio de Janeiro, UFRRJ,
Caixa Postal 74585, Seropédica, RJ, 23897-970
2. EMBRAPA Amazônia Ocidental, EMBRAPA,
Rodovia AM-10, Km 29, Caixa Postal 319, Manaus, Amazonas
In crops of papaya (Carica papaya L.) cv. Sunrise Solo
in the state of Amazonas, was observed that 10-20% of
the plants presented symptoms of mosaic on leaves and
soaked lesions on stalk, causing loss of the production.
To identify the pathogen involved, leaves samples were
collected from these plants and analyzed by mechanical
inoculation (0.1 M phosphate buffer pH 7.5, containing
0.5 % of sodium sulfite and 0,1% of celite) on papaya
plants and by RT-PCR test with specific primers for
Papaya ringspot virus (PRSV). These leaves extracts
when inoculated mechanically in plants of papaya
reproduced the symptom of similar mosaic to the
observed one in papaya cv. Sunrise Solo. It was possible
to amplified specific fragment for the PRSV. Infection
for this virus was reported in the states of Bahia, Ceara,
Espirito Santo, Minas Gerais, Parana, Pernambuco, Rio
de Janeiro, Rio Grande do Sul, Roraima, Sao Paulo and
Distrito Federal. This is apparently the first report of this
virus on papaya in the Amazonas state. Control strategy
should be developed to reduce the economic losses
resulting from the action and dissemination of these
pathogen in this plant of high value to agribusiness in
the Amazonas state.
Begomovirus That Infect The Weed Gaya
Guerkeana
Tenorio, A.A.R., Vieira, M.C.B., Lima, J.S., Silva, S.J.C.,
Assunção, I.P., Lima, G.S.A.
Universidade Federal de Alagoas, UFAL, Campus Delza
Gitaí, BR 104 Norte, Km 85, CEP: 57100-000, Rio Largo-AL
Begomoviruses (family Geminiviridae) have a circular,
single-stranded DNA genome encapsidated in twinned
icosahedral particles that are transmitted in nature by
the whitefly Bemisia tabaci. During the last two decades
the begomovirus have emerged as one of the major plant
pathogens, mainly in tropical and subtropical regions
worldwide, causing severe economic losses. In Brazil,
the most severely affected crops are bean and tomato,
although there are reports of begomovirus infection in
others important crops such as soybean and pepper.
In addition to the cultivated plants, many wild species
and/or weeds have been reported as alternative hosts
for begomoviruses, in several countries, including
Brazil. The aim of this study was to realize the molecular
characterization of Begomovirus that infect the weed
species Gaya guerkeana in the northeast region of
Brazil. Leaf samples of G. guerkeana showing typical
symptoms of viral infection were collected in Caruaru,
Pernambuco during 2012. Total DNA was extracted from
each sample and complete viral genomes were amplified
by rolling circle amplification (RCA), cloned into plasmid
vectors and completely sequenced. The sequences were
used for comparison with other begomovirus and to
phylogenetic analysis. From the G. guerkeana samples
was obtained a DNA-A clone, which was more related to
Sida mottle Alagoas virus (SiMoAV JX871383), showing
85% of nucleotide identity, therefore, representing a
new viral species with the suggested name Gaya yellow
mosaic virus (GaYMV). This study is the first report of
196
the occurrence of a begomovirus infecting the species G.
guerkeana.
PIV383 - Genetic Diversity Of A Population
Of Tomato Chlorosis Virus, An Emerging
Crinivirus Infecting Tomato In Brazil
Albuquerque, L.C., Paula, N.T., Inoue-Nagata, A.K.,
Aragão, F.J.L.
Cenargen, Brasília, DF
2. Departamento de Biologia Celular, Universidade de
Brasília, UnB, Brasília, DF
3. Embrapa Hortaliças, CNPH, Brasília, DF
Tomato chlorosis virus (ToCV, genus Crinivirus, family
Closteroviridae) is an emerging threat to tomato crops
worldwide. ToCV has two single-stranded RNA molecules
(RNA1 and RNA2) of positive polarity. The 8.5 kb RNA1
codes for proteins likely involved in viral replication,
whereas the 8.2 kb RNA2 codes for viral movement and
encapsidation proteins. The presence of ToCV was first
confirmed in Brazil in tomato plants collected in 2006,
and it is now spread over the major tomato production
areas. The main aim of this study is to provide an analysis
of the ToCV population structure with information on
40 isolates obtained from various geographical areas
of Brazil. Here, the preliminary results obtained from
20 isolates of two areas with high ToCV incidence,
Goianápolis (GO) and Taquara (DF), are shown. The
sequence of cloned RT-PCR amplified products of fulllength RdRp and P22 (RNA1), and Hsp70h (RNA2)
genes was analyzed. Genetic distances were estimated
from sequence data using the PBL method. The ratio of
non-synonymous substitution per non-synonymous site
(dNS) over synonymous substitutions per synonymous
site (dS) was used as the indicator of protein selection
pressure. Nucleotide diversity was low (<0.4%) and the
proteins studied were under negative (RdRp and Hsp70h)
or neutral (p22) selection. Additionally, no evidence of
selection associated with geographical area adaptation
was found. However, the isolates were collected in areas
of relative close proximity, and it is expected that a
detailed study, including distant geographical areas and
a higher number of isolates, could be useful to estimate
the true genetic diversity of these viruses.
PIV386
Yam
Infection
(Dioscorea
Cayennensis) By Curtovirus In Brazil
Lima, J.S., Silva, S.J.C., Assunção, I.P., Lima, G.S.A.,
Zerbini, F.M.
1. Universidade Federal de Alagoas, UFAL, Centro de
Ciências Agrárias, UFAL, Rio Largo, AL, Brasil
2. Universidade Federal de Viçosa, UFV, Departamento
de Fitopatologia/BIOAGRO, UFV, Viçosa, MG, Brasil
Brazil is one of the biggest yams producer, with the main
crops located in the Northeast region, where the viruses
have been highlighted by the frequency which occur in
commercial plantations, mainly by vegetative propagation
by tuber-seeds, which results in virus accumulation and
perpetuation during successive cultivations. A simple
method of cloning based on rolling circle amplification
(RCA) of bacteriophage Phi29 polymerase was used in
this work to verify the occurrence of circular DNA virus
in cultures located in the Alagoas, Pernambuco and
Paraíba states. DNA was extracted from symptomatic
plants and used as template in RCA, the obtained DNA
was digested independently with selected restriction
endonucleases Kpn I. Among the samples drew attention
from one Viçosa-AL, which resulted a fragment of about
3.0 kb, which was cloned into pKS. The recombinant
plasmids were identified by restriction analysis and viral
inserts completely sequenced. The nucleotide sequences
obtained were submitted to a BLAST search for the
preliminary assignment of species based on criteria
established by the ICTV and were then aligned using
the Muscle module in the program Mega 5.0, with other
sequences deposited in Genbank. The clone obtained
was identified as belonging to the genus Curtovirus, with
2.930 nucleotides and 97% identity with a mild isolated
Beet curly top virus (AY134867). This was confirmed
by phylogenetic analysis that grouped the isolates in
the same branch. This is the first report of a Curtovirus
infecting yam in Brazil. Financial support: CAPES, CNPq
PIV389 - Genomic Analysis Of A Potato Virus Y
(Pvy) Isolate Evidence A New Intra-Specific
Variability In Brazil
Galvino-Costa, S.B.F., Figueira, A.R., Geraldino Duarte,
P.S., Karasev, A.V.
1. Universidade Federal de Lavras , UFLA, Campus
UFLA, Dept. de Fitopatologia (DFP), C.P.3037, CEP 37200000, Lavras-MG
2. University of Idaho , UI , AGRICULTURAL
BIOTECHNOLOGY BUILDING 422, room 105, P.O. Box
442339
A wide diversity of genotypes and serotypes of Potato
virus Y (PVY) had been frequently reported in Brazil.
Among the 32 isolates recently studied, all belonging
to the Virology Virus Collection of DFP/UFLA, the
unusual Y-BR isolate was selected to be completely
sequenced in order to investigate the unique RT-PCR
profile amplified during its molecular characterization.
This unexpected RT-PCR profile includes only one of
the two characteristic bands of PVYO and the PVYNA-N
197
band (267 and 328bp, respectively). Based on the clear
PVYO serological typing performed with monoclonal
antibodies, all the possibilities of contamination were
discarded. Several primers (36 in total), covering the
entire genome and generating overlapping fragments,
were used to obtain the whole genome sequence of
Y-BR. The complete genome contains 9.682 nucleotides,
excluding the poly-A tail. The specific primer annealing
regions, the amino acids sequence, and the recombinant
events for this genome had been analyzed. The coat
protein (CP) gene showed high similarity (99%) with
other PVYO CP sequences from GenBank, which explain
the O serotype reported previously. Six extra nucleotides
were identified in the Y-BR genome, located at the
positions 7131 to 7136 (5’TCGGAA3’) inside the NIb
gene. Due to those additional six nucleotides the Y-BR
protein sequence is two amino acids (S2321E2322)
longer than the regular proteins of all representative
PVY strains. The higher amino acids similarity of Y-BR
with the database was 97% with PVYO isolates while
the higher nucleotide similarity was 94% shared with
both PVYN and PVYO. This high similarity with PVYN
isolates and the presence of the PVYNA-N band suggest
that this isolate is not a regular PVYO type. No significant
modification in the primer annealing regions, which
could be correlated with the atypical amplifications, was
found. So far, preliminary results of the recombination
analysis suggest that Y-BR may be considered a new
genetic variant of PVY. Financial support: Capes, CNPq,
FAPEMIG
PIV392
Badnavirus
Incidence
In
Germoplasm Bank Of Sugarcane In MuriciAlagoas
Jordão, L.J., Santos, J.M.S., Lima, J.S., Assunção, I.P., Lima,
G.S.A.
Ciências Agrárias, UFAL, Rio Largo, AL, Brasil
Flowering and Crossing Station Serra do Ouro, located
in the municipality of Murici, Alagoas, has a collection
of more than 2,000 hits and is considered one of the
most important genebanks of sugarcane in the world.
This collection, linked to the Federal University of
Alagoas, forms the basis for the Genetic Improvement
Program of sugarcane, initiated in 1960 by then IAA
/ Planalsucar. However, despite its importance, no
survey on the incidence of Badnavirus was held in
collections, although preliminary observations found
plants showing chlorotic streaking, yellowing and
stunting. Thus an initial survey of the incidence of
Badnavirus was conducted by collecting 200 samples
from genotypes used in the crosses. The leaves DNA
extraction was performed according to the protocol
from Doyle & Doyle with modifications. The total DNA
was used as template for PCRs containing primers pair
BadnaFP and BadnaRP, which directs the amplification
of a fragment of about 580 nt domain RT / RNaseH ORF
3 of several Badnavirus genome described. A total of 75
samples (37.5%) were positive, among which some of
the genotypes used in the crosses. The PCR fragments
were sequenced and the sequences used for preliminary
identification by comparison with GenBank sequences,
as well as phylogenetic analysis. The results suggest
the presence of at least three species of Badnavirus,
and Sugarcane virus baciliform the most common. The
incidence of Badnavirus Station was considered high
and the possibility that the disease resulting in the loss
of more susceptible varieties is worrying, lacking actions
to stop the spread of these pathogens and replacement
of infected materials. financial support: CAPES, CNPq
PIV406 - The Role Of Chitinase And Cathepsin
Enzymes In Pathology Of Baculovirus
Lima, A.A., Ribeiro, B.M.
Universidade de Brasília, UnB, Instituto de Biologia,
Bloco K Laboratório de Virologia
Brazil stands out for being one of the largest exporters
of agricultural products in the world, therefore the use
of pesticides impacts on both the environment and
public health. An alternative to this practice is the use
of biological agents to control pests. An example is the
use of baculovirus Anticarsia gemmatalis multiple
nucleopolyhedrovirus (AgMNPV) in the control of
velvetbean caterpillar, A. gemmatalis, which is the
greatest global example of successfully using a virus as
a bio-insecticide. Baculoviruses are arthropod-specific
double-stranded DNA viruses. One of the interesting
features of the AgMNPV-2D isolateviral genome is the
absence of chitinase (chiA) and cathepsin (v-cath)
genes. This absence can be responsible for the lack of
liquefaction and larval melanization in A. gemmatalis
killed by AgMNPV-2D infection. This study intended to
analyze the effect of these proteins expression in insects
infected by recombinant AgMNPV containing these genes
derived from two baculovirus (Choristonera fumiferana
DEF multiple nucleopolyhedrovirus - CfDEFNPV e
Autographa californica multiple nucleopolyhedrovirus
- AcMNPV). The recombinant viruses containing the
genes v-cath and chiA from the baculovirus CfDefNPV
(vAgp2100Cf.chiA/v-cath) was able to promote the
liquefaction and melanization of A. gemmatalis larvae
bodies after their death, although the vAgp2100Ac.
chiA/v-cath virus prepared in this study, did not
present the same effect. Bioassays with third-instar
and neonate larvae of A. gemmatalis infected with the
vAgp2100Cf.chiA/v-cath recombinant virus showed
198
higher insecticidal activity. The LC50 of the recombinant
virus was from 3 (for neonate larvae) to 4 times (for 3rd
larval stage) lower than the LC50 of the wild-type virus.
The expression of v-cath and chiA genes during infection
of insect cells by the recombinant virus was analyzed by
qPCR, which detected both the presence and the increase
of gene transcripts from 6 h to 72 h p.i.
PIV413 - Molecular Analysis Of A Potyvirus
Polyprotein Cleavage Site For Coat Protein
Expression In Soybean
Geraldino Duarte, P.S., Figueira, A.R., Galvino-Costa,
S.B.F., Teixeira, J.V.L.
Universidade Federal de Lavras, UFLA, Campus
Universitário, C.P. 3037 CEP: 37200-000
The Soybean yellow shoot virus (SYSV) was first
detected in 1984 in an experimental area of EPAMIG
in Lavras, Minas Gerais. In preliminary studies it was
characterized as a Potyvirus infecting soybean, more
severe but with different biological, molecular and
serological characteristics of others Potyvirus already
described. Further sequence analysis showed that this
is an unknown potyvirus, never described before, and
the highest nucleotide identity (65%) was found with
Glycine virus Y, a potyvirus described in Australia. In
this work the C-terminal of the SYSV was analyzed to
identify the cleavage site of the coat protein (CP), aiming
the construction of a vector for coat protein expression
in soybean plants. This region was amplified by RT-PCR,
using the RNA extracted from partially purified virions
and universal primers designed in conserved nucleotide
region of nuclear inclusion b (NIb) and CP. The amino
acid (aa) sequence was deduced using ORFfinder and
GeneRunner program. The C-terminal proteolytic
cleavage domains of the sequence were analyzed
according to the family Potyviridae and specific primers
based on the cleavage sites detected were designed and
used to amplify the sequences to be cloned into vectors
to express the protein in soybean plants. Three regions
were identified as sites recognized by the NIa protease,
the first possible cleavage site detected was between
E/L generating a CP with 279 aa. Another possible site
would be Q/N, seven aa after the first site identified,
resulting in a 271 amino acid CP and the third site, Q/G,
was 7 aa after the second site detected and originates a
coat protein with 264 aa. These fragments cloned into
vector capable of systemic expression of foreign genes
in soybean will help a precise description of this virus
and the construction vector containing the CP of SYSV
that can be used in future studies of plant-virus protein
interaction. Financial support: CAPES, CNPq, FAPEMIG
PIV415 - Detection Of Coffee Ringspot Virus
(Corsv) In Western Bahia
Almeida, J.E.M., Figueira, A.R.
Universidade Federal de Lavras, UFLA, UFLA-Dept.
Fitopatologia, C.P.3037, 37200-000 Lavras MG
Brazilian commercial crops of coffee (Coffea arabica)
were inspected in December 2012, in the following
properties: Joá Farm, 900 ha planted with cv. IAC 144
(plots 2,3 and 4), and Agronol Farm, 1300 ha planted
with cv. IAC 144 (areas 9 and 17), located in Eduardo
Magalhães region; Farm of Uemura Group (3 plots, 01
and 02 with 25 ha each, planted with cv. Sachimor and
1 plot with 100 ha planted with cv. IAC 144) located
in São Desidério region. Both places are located in the
western region of the state of Bahia. On the Joá Farm
plants with symptoms were identified in plots 03 and
04, with incidences of 45.6% and 6.6%, respectively.
In plot 02, there were no plants with symptoms. The
characteristic symptoms of ringspot disease were seem
in leaves and fruits, and an intense defoliation from the
inside of the plants, showing a hollow at the center of the
cup and a low bloom of the coffee tree were detected in
all properties except for the Agronol Farm, where CoRSV
was absent. On the Uemura Group Farm, the incidence
of ringspot in plot 03 was 8%, and in the other plots
the disease was not found. It was observed that the
symptoms were prevalent in part of the plant facing the
sun, indicating a higher multiplication of CoRSV in this
area. The symptoms observed in plants mechanically
inoculated with the extract of infected coffee leaves were
necrotic local lesions on the plants of A. deflexus and C.
ambrosioides, and chlorotic local lesions plus systemic
infection in plants of C. quinoa confirming the infection
by CoRSV. Despite the fact that ringspot disease has
already been reported in Minas Gerais and São Paulo
state, this is the first report of its occurrence in Western
Bahia. This demonstrates that the CoRSV has great
ability to spread by its vector, and may be present in all
coffee fields where the temperature is suitable for viral
multiplication. Financial support: Capes, CNPq, FAPEMIG
PIV417 - Efficient Detection Of Squash
Mosaic Virus In Infected Squash Seeds
Almeida, J.E.M., Figueira, A.R., Alencar, N.E., Pompeu,
D.C., Lucas, M.A.
Universidade Federal de Lavras, UFLA, UFLA-Dept.
Fitopatologia, C.P.3037, 37200-000 Lavras MG
The choice of technique for the detection of viruses in
pumpkin seeds, and its practical application, is greatly
important to support phytosanitary surveillance in
Brazil. The objective of this work was verifying the
efficiency of different techniques to detect Squash mosaic
199
virus (SqMV) in seeds, using several procedures. Four
methods were compared for SqMV detection in squash
seeds: biological, DAS-ELISA, IC-RT-PCR and RT-PCR.
The testes were done with different tissue extracts: non
germinated seeds: the whole ground seeds, the tegument
and cotyledon; seeds germinated in boxes or paper towel
at 26ºC with 16h light: the primary leaves analyzed in
combined samples and separately. In the biological tests,
the primary leaves of seedlings growing in greenhouse
were tested by DAS-ELISA. Each biological test was
performed with 1000 seeds with three replicates. The
obtained antigens were used for DAS-ELISA, PCR and ICPCR. When the extracts of nom germinated seeds were
employed as antigen all the DAS-ELISA and also the IC-RTPCR tests were positive, either when the whole seeds or
the tegument and cotyledon were analyzed, showing that
SqMV particles were present in 100% of the tissues from
seeds produced by infected squash plants. The RT-PCR
tests had no the same efficiency showed by IC-RT-PCR
tests. In primary leaves, coming from seeds germinated
in boxes or paper towel, using composite samples with
10 seeds in each sample, neither DAS-ELISA nor IC-RTPCR detected the virus. However, when each seedling
was sampled separated, the DAS-ELISA detected the
virus in 1,33% and IC-RT-PCR in 15% of primary leaves.
Therefore, IC-PCR test was more efficient and faster
than DAS-ELISA to detect SqMV incidence in germinated
squash seeds and was able to predict the transmissibility
of SqMV from seeds to plant. DAS-ELISA and IC-PCR was
highly efficient to detect SqMV in the whole seeds, but it
does not represent the virus transmissibility from seeds
to plants. Finantial Support: CNPq, Capes e Fapemig
PIV420 - First Report Of Lettuce Mottle
Virus (Lemov) In South Of Minas Gerais
Lucas, M.A., Figueira, A.R., Santos, B.A., Alencar, N.E.,
Teixeira, J.V.L., Almeida, J.E.M.
Universidade Federal de Lavras, UFLA, Campus
Universitário, Lavras - MG, Brasil
Among the viral diseases detected in Brazilian lettuce
crops, the two main viruses able to cause relevant
losses are Lettuce mosaic virus (LMV), belonging to
the genus Potyvirus, and Lettuce mottle virus (LeMoV),
a Sequivirus species. The LeMoV induces mottling in
lettuce plants and was first detected in Brazil in 1982,
in the Federal District, causing symptoms quite similar
to those induced by LMV. Therefore, it is difficult to
distinguish between these two viruses based only in
the symptoms. In addition, mixed infections of LMV and
LeMoV cannot be discarded. In this work was analyzed
one virus isolate from lettuce, collected in the region of
Tres Pontas, located in the south of Minas Gerais State
- Brazil. Leaves showing typical symptoms of virus
infection were analyzed by DAS-ELISA, using polyclonal
antibodies specific for the LMV, by inoculation assays in
diagnostic species: lettuce (Lactua sativa L.) cv. Regina,
Chenopodium quinoa, C. amaranticolor Gomphena
globosa and Zinnia elegans and by RT-PCR using specific
primers for LeMoV and LMV. The results of DAS-ELISA
and RT-PCR were negative for LMV, discarding an
infection by this virus. In the mechanical inoculation in
diagnostic species, both viruses did not induce symptoms
in Zinnia elegans, however the virus was recovered from
this plant by mechanical inoculation of the plant extract
in lettuce cv. Regina, which is typical of LeMoV. Finally,
the presence of LeMoV infection was confirmed by RTPCR using primers specific for this virus. Probably, such
as happened in other places where LeMoV have been
detected, its infection is being confused with a break of
resistance to LMV in lettuce cultivars. Based on these
results, the occurrence of LeMoV in south Minas Gerais
was registered for the first time, indicating the need for
additional measures of control in commercial fields of
lettuce, aiming to prevent the introduction and spread
of this virus in field. Financial support: CAPES, CNPq e
FAPEMIG
PIV422 - Evaluation Of Internal Damages
Of Zucchini Seeds Infected With Squash
Mosaic Virus Using X-Ray
Alencar, N.E., Figueira, A.R., Lucas, M.A., Galvino-Costa,
S.B.F., Santos, H.O.
Universidade Federal de Lavras, UFLA, Departamento
de Fitopatologia, Caixa Postal 3037, CEP 37200-000, Lavras
MG
Oleraceous species such as zucchini (Cucurbita pepo cv
Caserta) usually present seeds with empty and damage
structures due to problems correlated with the seed
malformation in addition to the occurrence of infection
by pathogens. These damages in this type of seeds are
not commonly detected due to its tissue density, which
prevents the visualization of internal structures. The
objective of this work was to verify the potential use
of the X-ray in the evaluation of internal seed damages
produced by zucchini plants infected with Squash mosaic
virus (SqMV)as an auxiliary tool for the seed selection
which will be subsequently used in the evaluation of
seed transmissibility rate of this virus. Four lots with
hundred seeds each, produced by infected and healthy
plants, were submitted to X-ray analysis using Faxtron
HP MX-20 with 22kv intensity and exposure time of
15 seconds. The analysis of the X-ray images allowed
the separation of the seeds into three categories: filled,
empty and damaged seeds. Among seeds produced by
infected plants 58.33% were empty, 12.5% were filled
and 29.1% were damaged. In the seeds from the healthy
200
plants only 1% was empty, 84% were filled and 15%
were damaged, showing that the virus infection strongly
influences the seed quality produced. These seeds are
being tested to determine its viability in comparison with
the seeds produced by healthy plants and, in addition,
the SqMV seed transmissibility rate, when the seed is
viable, for each category is also being done. The X-ray
analysis was considered a useful tool for evaluation of
the quality of seeds produced by SqMV infected plants.
Financial Support: CNPq, CAPES, FAPEMIG.
PIV441 - Broad Resistance To Brazilian
Bipartite Begomoviruses Confered By The
Locus Ty-1 In Tomato Lam 144r Line
Mendoza, L.L., Ribeiro, S.G., Resende, R.O., Boiteux, L.S.
Pereira-Carvalho, R.C.
1. Departamento de Fitopatologia, Universidade de
Brasília, UnB, Brasília, DF, Brazil
The tomato crop has a high economic and social
importance in Brazil. The cultivation throughout the year
favors the appearance of various diseases, especially
diseases caused by begomoviruses. The best option of
the control these diseases is the use of resistant cultivars.
Breeding programs seek sources that have broad,
durable and stable resistance. In this work, to study
the breadth of genetic resistance conferred by the gene
Ty-1 in the LAM 144R line, plants were inoculated by
biolistics with viral DNA of four begomoviruses: Tomato
chlorotic mottle virus (ToCMoV), Tomato rugose mosaic
virus (ToRMV), Tomato severe rugose virus (ToSRV) and
Tomato yellow vein streak virus (ToYVSV). As control,
we used plants of the susceptible near isogenic line LAM
144S. Assessment of symptoms were done at 21 and
40 days post inoculation (dpi) and viral accumulation
was evaluated at 30 (dpi) by Southern blot. For the four
begomoviruses tested, LAM 144R plants showed very
mild symptoms in comparison to LAM 144S and low or
sometimes no viral accumulation was observed. These
results demonstrate that LAM144R can be considered
promising for the use in breeding programs. Financial
support: CNPq, Fap-DF, Rede EstRESCe, INCT-Interacoes
Planta-Praga, CAPES
PIV444 - Restriction Of Tomato Chlorotic
Mottle Virus (Tocmov) Long-Distance
Movement In Tomato Lam 144r Line
Containing The Ty-1 Resistance Locus
Mendoza, L.L., Ribeiro, S.G., Resende, R.O., Boiteux, L.S.
Pereira-Carvalho, R.C.
1. Embrapa Recursos Genéticos e Biotecnologia, , Pq
Estação Biológica, Brasilia, DF, Brazil
2. Departamento de Fitopatologia, Universidade de
4. Embrapa Hortaliças, , Brasília, DF, Brazil
Tomato (Solanum lycopersicum) is an important
vegetable crop in Brazil. Due to the diversity of bipartite
begomovirus species infecting tomato in the country,
Embrapa Hortalicas has an active breeding program
aiming the development of tomato genotypes resistant
to these viruses. Near-isogenic lines (NILs) differing
for the presence of the begomovirus resistance locus
Ty-1 were recently obtained and named LAM 144R
(resistant) and LAM 144S (susceptible). Since resistance
can be the result of the interference with pivotal stages
of the virus cycle such as replication, cell to cell or
long distance movement, the aim of this research was
to compare the replication rate of ToCMoV in the two
NILs. Plant leaves were infiltrated with Agrobacterium
tumefaciens harboring the DNA-A of ToCMoV cloned in
a binary vector. Samples were collected 0, 2, 6 and 10
days post infiltration (dpi) and the viral DNA load was
quantified by quantitative polymerase chain reaction
(qPCR) using primers for the coat protein gene. Data
was analyzed by Kruskal-Wallis nonparametric test.
There was no significant difference in the viral load in
the samples collected 0, 2 and 6 dpi between LAM 144R
and LAM 144S. However, at 10dpi, the viral titer was
significantly lower in LAM144R plants, compared with
LAM144S, showing at least twice as low virus molecules.
This result suggests that the resistance conferred by the
locus Ty-1 may be related to the impairment of virus
replication.
PIV452 - Establishment Of A Unit Of
Reference In Diagnosis Of Quarantine And
Non Quarantine Regulated Plant Viruses
Pompeu, D.C., Figueira, A.R., Sotero, A.J., Geraldino
Duarte, P.S., Galbino-Costa, S.B.F., Fernandes, J.R.C.
Universidade Federal de Lavras, UFLA, Departamento
de Fitopatologia, Campus Universitário, UFLA, Lavra-MG
The growth of the Brazilian domestic and foreign trades
and the large flux of goods exchange between different
states and countries increase the risk of pests and diseases
introduction in disease free regions. Therefore, there is
a great demand for reliable laboratories and diagnostic
techniques to certify the sanity of plant propagation
material in Brazil. This study aimed to create a bank of
positive control for PCR and RT-PCR diagnostic tests, by
cloning genomic fragments containing the coat protein,
201
of quarantine and non-quarantine regulated virus, into
plasmids, without risk of contamination or pathogen
introduction in the country. The genetic material of the
quarantine viruses was obtained with the collaboration
of researchers from many parts of the world, amplified
by RT-PCR and / or PCR, using primers designed based
on the coat protein sequences from GenBank, and cloned.
The plasmids were sequenced to confirm the identity of
the genomic fragments and then new inner primers were
designed to be used in RT-PCR/PCR diagnostic tests.
After checking the efficiency of the plasmids containing
the viruses fragments, they were multiplied and stored
at -80°C. A bank containing 39 positive controls for
quarantine virus, 2 viroid, and 12 viruses not quarantine
regulated was created. This material will be multiplied
periodically to maintain the viability, in order to use the
plasmids as a positive control in routine diagnostic tests
of imported plant propagation material, from countries
where quarantine virus for Brazil have been reported.
The positive controls will be available for every official
laboratory of MAPA, being an important support for
the Official Plant Protection Service in the inspection
of imported plant material. Financial support: CAPES,
CNPq, FAPEMIG
PIV470 - Unique Sequence Characteristics
Of Rna 2 Genome Segment Of New Pepper
Ringspot Virus, Tobraviruses Isolated In
Brazil
Batista, A.R.S., Nicolini, C., Rodrigues, K.B., Vasques,
R.M., Macedo, M.A., Inoue-Nagata, A.K., Nagata, T.
1. Universidade de Brasília, UnB, Campus Universitário
Darcy Ribeiro - Asa Norte- Departamento de Biologia Celular
Darcy Ribeiro - Asa Norte - Departamento de Fitopatologia
Two new isolates of pepper ringspot virus (PepRSV)
(Tobravirus) were corrected and the sequence of
complete RNA 2 segment and 3’ UTR of RNA 1 of both
isolates were determined. Although the sequences of
coat protein genes of these two and the isolate corrected
in 1970’s were highly conserved, the both UTRs
were distinct. The original CAM isolate showed twice
impaired repeat sequences (AA’BB’) in 5’ UTR, however,
new isolates did not possess the repeat sequence (AB).
The 3’ end of CAM isolate (the stretch of 459nt) had been
reported as a recombination between RNA 1, while new
isolates possessed only 279 nts stretch almost identical
to 3’ end of RNA 1 of their isolates. In addition, the RNA 2
sequences of these isolates showed inserted sequences,
resulting in longer RNA 2 sequences compared to CAM
isolate. This is the first report showing the diversity
of RNA 2 sequence of PepRSV, a tobravirus naturally
occurring only in Brazil.
PIV513 - A New Strategy For Heterologous
Expression Of Coat Protein From Garlic
Virus D (Garv-D) In Insect Cells Using A
Modified Baculovirus Vector To Easy
Purification
Andrade, M.S., Ardisson-Araújo, D.M.P., Resende, R.O.,
Ribeiro, B.M.
Universidade de Brasília, UnB, UnB Campus Darcy
Ribeiro - IB - Bloco K, Brasília, DF, CEP 70910-900
Garlic virus D (GarV-D) infects Allium sativum causing
“garlic mosaic disease” which reduces the overall
crop production. The GarV-D belongs to the genus
Allexiviruses with a single-stranded RNA genome,
positive sense, encoding six open reading frames (ORF).
One of those is the coat protein ORF that codifies a
protein that surrounds the viral genome and forms a
filamentous capsid. In previous work we expressed the
Garlic virus D coat protein fused with the main occlusion
body protein (polyhedrin) of Autographa californica
multiple nucleopolyhedrovirus (AcMNPV) in the amino
terminal portion, but we did not successfully purified
the recombinant protein. This work aims a new strategy
to express and purify the GarV-D coat protein (CP) for
antibody production to be used for detection of garlicinfected plants. For this propose, we reconstructed
a recombinant baculovirus derived from AcMNPV
using the commercially available Bac-to-bac system
(Invitrogen). This recombinant virus has the Garlic virus
D coat protein gene (GarV-Dcp) inserted into its genome
as a fused gene with polyhedrin gene of AcMNPV, a
his-tag, both under the command of pSym and pXIV
promoter. Furthermore, has another copy of polyhedrin
gene under the command of its own promoter .The
recombinant virus was used to infect insect cells and
the expression of the recombinant protein was analyzed
by SDS-PAGE and Western-blot using a commercially
available anti-his antibody. We successfully constructed
the recombinant virus containing the fused gene and
when used to infect insect cells, a protein band of the
expected size was detected by SDS-PAGE and westernblot. The recombinant protein is now being produced
in a large scale in insect larvae for the production of
polyclonal antiserum in rabbits. This antiserum will then
be tested for its potential to detect this important plant
pathogen. Financial support: CNPq, FAPDF
PIV514 - Minimum Approach To Construct The
Infectious Cdna Clone Of A Tobamovirus In
Binary Vector
Junqueira, B.R.T., Nicolini, C., Lucinda, N., Nagata, T.
Universidade de Brasília, UnB, Lab. Microscopia e
Virologia, IB Bloco-K, Brasília, DF
202
Pepper mild mottle virus (PMMoV) is a tobamovirus,
which consists of a monopartite single-stranded
RNA genome in positive polarity. The RNA genome is
surrounded by coat proteins forming rod-shaped rigid
particles. The genome is capped at 5 terminus and it has
a tRNA-like structure at 3 terminus and it possesses four
open reading frames (ORFs). Aiming to study the virushost interactions and the functions of viral proteins the
development of infectious clone was attempted. To obtain
cDNA of full-length PMMoV genome, polymerase chain
reaction (PCR) was performed to amplify the PMMoV
genome from a cDNA previously cloned in pCR4TOPO
vector. The cDNA of full-length genome of ~6.3 kb was
successfully amplified by PCR. The binary vector used
to join the whole genome was pCAMBIA 0390. PCR was
performed to amplify the binary vector, which length
was 7.0 kb. Overlap extension PCR was performed to join
the two fragments and the expected length was 13.3kb.
The resulted plasmid was electroporated in E. coli
STBL4 strain. The profile of the clones was confirmed
by restriction enzyme profile, PCR and DNA sequencing.
Aiming the transient expression, the selected clones
were elestroporated in Agrobacterium tumefaciens
GV3101 strain. Nicotiana benthamiana plants were
agroinfiltrated and maintained in green house for up to
ten days. The virus recovery was confirmed by symptom
observation and Dot immunobinding assay (Dot-ELISA).
N. benthamiana plants showed severe mottle and top
distortion symptoms in five clones out of seven selected
by restriction enzyme profile, which were very similar to
symptoms caused by wild type virus. The positive signals
in Dot-ELISA observed in plants with recovered virus
were as strong as in plants with wild type virus. This
study showed an effective and simple protocol based on
overlap extension PCR to construct an infectious clone of
tobamovirus.
PIV519 - Heterologous Expression And
Functional Analysis Of Non-Structural
Proteins (Nss) Codified By Two Tospovirus
Species
Vasconcelos, A.F., Oliveira, A.S., Lima, R.N., Resende, R.O.
Universidade de Brasília, UnB, Dept. de Biologia
Celular, Instituto de Biologia
Tospovirus is the only genus of plant viruses within family
Bunyaviridae. Its members present a tripartite RNA
genome classified, according to their sizes, in S (small),
M (medium) and L (large) RNAs. The S segment encodes
a non-structural protein (NSs) involved in RNA-silencing
suppression, as already demonstrated for Tomato Spotted
Wilt Virus (TSWV). The RNA silencing is a conserved
mechanism in plants and other organisms associated
to gene regulation and defense against viral infections.
Bean Necrotic Mosaic Virus (BeNMV) is a new tospovirus
found in Brazil naturally infecting Phaseolus vulgaris L.,
representing a new evolutionary lineage of tospoviruses
circulating in the American continent. The objective of
this work is to verify whether the NSs protein of BeNMV
also acts as a RNA silencing suppressor, even though the
level of amino acid identity between BeNMV and TSWV
is quite low (18.4%). To evaluate a possible differential
RNA silencing suppressor mechanism in an apparently
resistant host (N. benthamiana) and in a susceptible one
to BeNMV (D. stramonium), RT-PCRs were performed
to obtain the NSs genes of both BeNMV and TSWV The
amplicons were cloned into pGEM-T easy, subcloned
intopENTR-2B vector and translocated (recombination
by LR clonase) to pDEST-17 (expression vector in E. coli)
and PK2 (binary vector). Escherichia coli BL 21 was used
to express the NSs fused to 6xHis tag. The expression was
confirmed by SDS-PAGE and Western Blot. The proteins
were purified on chromatography column of nickel
and used to immunized mice for polyclonal antibodies
production. The genes will be used for agroinoculation
by the binary vectors via Agrobacterium tumefaciens
for further analysis of protein localization and function
by UV and Northern Blot. Financial support: UnB, CNPq,
Capes, FAP-DF, RedeEstRESCe, INCT Praga-Hospedeiro
PIV529 - Wild Ipomoea Spp. Are Alternative
Hosts For Begomoviruses In Brasil And
Nigeria
Rossato, M., Melo, F.L., Ogunwenmo, K.O., Aragão, F.J.L.,
Resende, R.O.
1. Embrapa Hortaliças, CNPH, Brasília, DF, Brazil
2. Universidade de Brasília, UnB, Brasília, DF, Brazil
Cenargen, Brasília, DF, Brazil
4. Babcock University, Babcock University, Ilishan,
Nigéria
In recent years, several begomovirus species have been
identified in sweet potato (Ipomoea batatas) in Brazil
and other countries. It is also known that wild Ipomoea
spp. can be infected naturally and experimentally by
begomoviruses, indicating that these plants can be
inoculum sources of begomoviruses for the cultivated
sweet potato. However, wild Ipomoea spp. have not yet
been identified as natural begomovirus hosts in South
America or Africa. The objective of this study was to
identify all possible Ipomoea-infecting begomoviruses in
Ipomoea spp. plants collected in Brazil and Nigeria using
next generation sequencing. Rolling circle amplification
(RCA) reaction products from 14 Ipomoea spp. samples
collected in Brazil (from the States of Ceará, Pernambuco
and the Distrito Federal) as well as 9 samples collected
in Nigeria were polled separately by country origin and
203
sequenced using the Roche 454 GS FLX platform. The
two libraries, IPOBRA and IPONIG, were sequenced in
1/8 th of a plate. IPOBRA resulted on 44,433 reads with
an average length of 653 bases, and IPONIG had a total
number of 75,318 reads with an average length of 708
bases. Sequence assembly and analysis were performed
with the program Geneious6.0. Blast searches with the
contigs obtained revealed identity with several sweet
potato-infecting begomoviruses: Sweet potato leaf curl
virus, Sweet potato mosaic associated virus, Sweet
potato golden vein associated virus, Ipomoea yellow vein
virus. It is worthy to note that, the diversity of viruses
identified in the samples was much higher in Nigeria than
in Brazil. Further identification of the virus(es) present
in each sample will be performed by amplifying viruses
by inverse PCR using back-to-back specific primers for
each virus followed by molecular analysis. Financial
support: Embrapa, CNPq, Fap-DF, Rede EstRESCe, INCTInteracoes Planta-Praga, CAPES
PIV539 - Study Of The Interactions
Between The Movement Protein And The
Nucleocapisid Protein Of Groundnut
Ringspot Virus (Grsv) In Nicotiana
Benthamiana
Using
Bimolecular
Fluorescence Complementation
Silva, M.C.B., Lima, R.N., Resende, R.O.
Universidade de Brasília, UnB, Campus Universitario
Darcy Ribeiro, S/N, Asa Norte, Brasilia, DF 70910-900
Groundnut ringspot virus (GRSV) is classified in the genus
Tospovirus. Tospovirus is the only genus that infects
plants in the family Bunyaviridae. The virus species
within the genus are responsible for several economic
impacts in a wide range of crops mainly in tomatoes, sweet
peppers and onions. GRSV has three RNA segments that
are called L (large), M (medium ), and S ( small). The L
segment codes the viral polymerase in negative polarity.
The M segment codes the movement protein (NSm) and
the glycoproteins precursor and the S segment codes
the RNA-silencing suppressor protein (NSs) and the
nucleocapsid protein (N), both in an ambisense coding
strategy. The understanding of the interactions among
the proteins of GRSV and host proteins can contribute
significantly to elucidate the biological functions of
these proteins during the process of viral infection,
replication and viral transmission. This project aimed
the constructions of vectors for transient expression
pSAT of the proteins NSm and N of GRSV fused with the
fluorescent protein EYFP, which were used to study the
localization and the interaction of these proteins in plant
cells. The technique used to analyze these interactions
was the Bimolecular Fluorescent Complementation
(BiFIC) that consists in separate the fluorescent protein
EYFP in two fragments, C-terminus and N-terminus.
Each fragment was fused to one of the proteins studied
(NSm and N). The genes of N and NSm were amplified by
RT-PCR and then were inserted in pSAT vectors which
were transformed in A. tumefaciens (CV3101) and
agroinfiltrated in N. benthamiana leaves. After 36 hours
of the agroinfiltration the micrographs were taken. The
results showed the interactions between proteins N-N,
NSm-NSm and N-NSm, which demonstrated that these
vectors can be used to study interactions between
proteins in planta during tospovirus infection. The
interactions between the nucleoprotein were observed
in the cytoplasm forming small yellow spots. The N-NSm
and NSm-NSm interactions weres observed throughout
the cytoplasm, specifically at cell periphery. Financial
support: CNPq, FAP-DF, Rede Centro Oeste de Pesquisa
PIV555 - Analysis Of The Interaction Of
Movement Protein (Nsm) Of Tospovirus
With Host Proteins
Paula, D.F., Silva, M.C.B., Lima, R.N., Leastro, M.O.,
Resende, R.O.
Universidade de Brasília, UnB, Campus Universitario
Darcy Ribeiro, S/N, Asa Norte, Brasilia, DF 70910-900
Plant viruses have evolved various mechanisms for
virus movement inside the host. These mechanisms may
be grouped into two general strategies: the genome is
transported as (1) a nucleoprotein complex, and (2) as
encapsulated nucleic acids forming a viral particle. The
genus Tospovirus belongs to the Bunyaviridae family.
All members of this genus have a genome organized as
three single stranded RNA segments named S, M and L
RNA for small, medium and large RNA, respectively. A
viral movement protein NSm has an important role for
the spread of viral infection in the plant, and there are
few studies that show the molecular interactions of this
protein both in plant and in vitro. A study by Soellick
et. al., (2000) suggests an interaction between the viral
protein NSm with the DnaJ protein, present in plants
such as A. thaliana and N. tabacum. The interaction
of NSm with DnaJ could involved the binding of viral
structures to the elements of the plant machinery
directing the intercellular transport of the virus through
plasmodesmata. This project aim to investigate the
association of DnaJ protein and NSm protein through
Complementary Bimolecular Fluorescence technique
(BiFC) and demonstrate how this interaction can benefit
the viral cell to cell movement. We amplified the DnaJ
from N. tabacum and NSm from Groundnut ringspot virus
(GRSV) genes and inserted in BiFC vectors developed
by Martin et.al (2009). N. benthamiana leaves were
agroinfiltrated with A. tumefaciens (GV3101) extracts
for transient expression of these proteins fused to C and
204
N terminus of yellow fluorescent protein (YFP). After 36
hours post agroinfiltration, by the BiFC technique, we
confirmed the interaction between these two proteins.
The merged micrographs showed cytoplasmatic
aggregates next to plasmodesmata wich can support,
in vivo, the evidence previously proposed for these two
proteins. Financial support: UnB, CNPq, Capes, FAP-DF,
Rede EstRESCe.
PIV558 - Genome Sequence And Organization
Of A Baculovirus Isolated From Lonomia
Obliqua (Lepidoptera: Saturniidae).
Aragão-Silva, C.W., Ribeiro, B.M., Melo, F.L., ArdissonAraújo, D.M.P., Wolff, J.L.C.
Darcy Ribeiro, Brasília - CEP 70910-900
2. Universidade Presbiteriana Mackenzie, CCBS, Rua
da Consolação, 896 - Pr. 38 Consolação 01302-907 - Sao
Paulo, SP - Brasil
Lonomia obliqua (Lepidoptera: Saturniidae) is a
poisonous larvae of medical importance due to the
severity of accidents occurred in Brazil caused by the
contact with the human skin. The possibility of controlling
the population of these larvae is being evaluated by
using pathogens such as a single nucleopolyhedrovirus
isolated from L. obliqua (LoobMNPV). In this work
we have sequenced the genome of LoobMNPV using
the pyrosequencing technique (454 Life Sciences
Technology). The genome is approximately 120.000 bp,
with a 30.9% GC content, containing seven homologous
regions (HRs). The genome comprises 169 putative
open reading frames, out of which 31 are unique genes,
4 came from organisms from other kingdom, and
134 genes are correspondingly encountered in other
baculovirus. Phylogenetic analysis using the polyhedrin
gene suggests that LoobMNPV is basal to group I from
Alphabaculovirus, and it is related to ThorNPV, BmNPV,
and AnfaNPV, in agreement with previous studies.
Interestingly, the referred genome does not have two
common baculovirus genes that are responsible for the
host liquefaction: the cathepsin and chitinase genes.
The elucidation of the complete genome of LoobMNPV
will benefit studies related to the biological control of L.
oblique, as well as support further studies on baculovirus
evolution.
PIV560 - Effect Of The Multiplicity
Of Infection On Protein Expression
Based On The Polyhedrin Promoter Of
The Anticarsia Gemmatalis Multiple
Nucleopolyhedrovirus (Agmnpv)
Morgado, F.S., Silva, L.A., Ribeiro, B.M.
Universidade de Brasília, UnB, Lab. Microscopia
Eletrônica e Virologia - Instituto de Ciências Biológicas
The baculovirus expression vector system is a widely
used set of tools that comprise a genetically modified
baculovirus containing the gene of interest under the
control of a strong promoter and insect cell lines grown
in vitro that are susceptible to the virus. This allows
the expression of relevant proteins in an eukaryotic
environment. The amount and quality of the expressed
proteins is dependent of a series of factors, such as
the time of protein extraction, the multiplicity of virus
per cell (MOI) and the density of cells at the time of
infection. The baculovirus AgMNPV is best known as
the bioinsecticide used to control the soy bean eating
larvae Anticarsia gemmatalis, but it may also be used as
an expression vector. We constructed, by homologous
recombination, a recombinant AgMNPV containing the
FLUC gene, encoding the chemiluminescent protein
Luciferase, under the control of the AgMNPV polyhedrin
gene promoter, this virus was named vAgPOLHFLUC.
This was used to infect the Trichoplusia ni derived insect
cell line BTI-Tn5B1-4, and by using a special technique, it
was possible to track the production of Luciferase in real
time and so quantify total protein production along the
infection. By varying the MOI at the time of infection the
optimal conditions for protein expression was estimated.
Optimal protein expression was achieved by infecting
at MOI 10, the peak expression was reached at 54
hours post infection. Below MOI 1 there was an intense
delay on timing and amount of protein production, for
instance, a MOI of 0.1 yield only half total FLUC activity,
in relation to MOI 10, at 140 hours post infection.
Above MOI 10 there was little difference in timing and
amount of FLUC expression, showing a faster but lower
expression relative to MOI 10. This work shows that by
manipulating the multiplicity of infection parameter it
is possible to optimize the efficiency of the baculovirus
vector systems in terms of a greater amount of protein
expression in a faster time.
PIV566 - Quantitative Real-Time Rt-Pcr For
Chrysanthemum Stunt Viroid Detection
Gobatto, D., Chaves, A.L.R., Harakava, R., Eiras, M.,
Instituto Biológico - São Paulo, IB, Av. Conselheiro
Rodrigues Alves, 1252 - Vila Mariana - SP
The stunting disease induced by Chrysanthemum
stunt viroid (CSVd) has become a serious problem in
chrysanthemum production systems worldwide. CSVd
incites colour-break and retards flowering, however in
many situations the plants are symptomless, facilitating
its spread in the field. Our work aimed to develop a
sensitive diagnostic system based on quantitative RT-
205
PCR (RT-qPCR). Young leaves from chrysanthemum
infected by an isolate of CSVd were ground with liquid
nitrogen, homogenized in water-saturated phenol and
extraction buffer, followed by alcohol precipitation. The
purified RNAs (approximately 100 ng) were transferred
to a microtube in presence of 1 µL (50 pmoles/µL) of
antisense primer [CSVd-I(c)]. After incubation for 3 min
at 95oC, it was added 2.5 µl of reverse transcriptase
buffer (Roche), 0.5 µl dNTPs (10 mM), 200 units (1 µL) of
reverse transcriptase (Roche), being the mix incubated
for 60 min at 37oC. The analyses were performed
using the 7500 Fast Real Time PCR System (Applied
Biosystems). The reaction was carried out adding 2 µl
of each cDNA sample, 5.2 µl of sterile deionized water,
7.5 µl Universal FastStart SYBR Green Master (ROX) (2X
concentrate) (Roche) and 0.3 µl of each primer [CSVdII(s) and CSVd-I(c)] (10 µM). Serial dilutions of 1:10
up to 1:100,000 of the cDNA were prepared to check
detection threshold of the RT-qPCR, and to calculate the
amplification efficiency. The specificity was confirmed by
the dissociation curves for each reaction. The efficiency
of amplification was 102%, which means that there was
a duplication of the amount of DNA copies in each cycle.
Amplification was observed even for the highest dilution
of cDNA (1:100,000), confirming the high sensitivity of
this technique for CSVd detection. Financial support:
FAPESP (2011/02721-1) and CNPq (471796/2011-5).
PIV573 - Novel Plant Viruses Infecting
Sweetpotato In Brazil
Fernandes, F.R., De Souza, J.M., Silva, K.F.O.
1. Embrapa Vegetables, CNPH, Rod. Brasília/Anápolis
BR 060 Km 09 Caixa Postal 218 CEP 70351-970. Brasília, DF
2. Catholic University of Brasilia, UCB, QS 07 Lote 01
EPCT, Águas Claras CEP: 71966-700 .Taguatinga, DF
Virus diseases are important constraints for sweetpotato
(Ipomoea batatas (L.) Lam.) production. Knowledge
on the distribution, economic impact, and control of
sweetpotato viruses is still limited (Clark et al., 2012).
In many cases, infection of sweetpotato by two or
more different virus species causes greater damage
than does infection by each of the viruses separately.
Identification of virus species that occur in Brazil is of
great importance for the design of crop management
strategies and for indexing arrays of sweet potato virusfree production programs. A total of 153 samples from
different regions (144 samples from Federal District, five
from Sergipe, three from Rio Grande do Sul and one from
Minas Gerais) and genotypes were tested. Scions from
sweetpotato plants were grafted onto Ipomoea setosa, a
nearly universal indicator plant for sweetpotato viruses,
and leaves were tested by NCM-ELISA for ten viruses
infecting sweet potato: Sweet potato feathery mottle
virus (SPFMV), Sweet potato latent virus (SPLV), Sweet
potato mild speckling virus (SPMSV), Sweet potato virus
G (SPVG), Sweet potato mild mottle virus (SPMMV), Sweet
potato chlorotic fleck virus (SPCFV), Sweet potato C-6
virus (C-6), Sweet potato chlorotic stunt virus (SPCSV),
Sweet potato collusive virus (SPCV) e Cucumber mosaic
virus (CMV). Eight antisera were obtained from the
International Potato Center (Lima, Peru) and the other
two (for SPFMV and CMV) were produced in Embrapa
Vegetables. Single and mixed infections were identified
in samples submitted for analysis. Infected plants were
observed for only one kind of virus (4.6%), two (7.2%),
three (4.6%), four (5.2%), five (11.8%), six (11.1%),
seven (9.1%), eight (15%), nive (13.7%) and ten species
of viruses (17.7%), that is, most plants of sweet potato
are infected by virus complex (composed of different
combinations of viruses). The following percentages of
infection were found: SPFMV, 77.8; SPLV, 28.1; SPMSV,
75.2; SPVG, 62.1; SPMMV, 80.4; SPCFV, 64.1; C-6, 54.2;
SPCSV, 61.4; SPCV, 84.3 and CMV, 75.8. The data obtained
indicated a high virus incidence and represent the first
report of detection of SPVG, SPMMV, Sweet potato C-6
virus, SPCV and CMV in sweetpotato genotypes growing
in Brazil.
PIV578 - Begomovirus Species Diversity In
Tomato Crops And Weeds In Ecuador
Paz-Carrasco, L., Xavier, C.A.D., Lima, A.T.M., CastilloUrquiza, G.P., Ramos-Sobrinho, R., Vivas-Vivas, L.,
Zerbini, F.M.
1. Dep. Fitopatologia/BIOAGRO, Universidade Federal
de Viçosa, Bioagro/UFV, Avenida Peter Henry Rolfs, s/n.
Campus Universitário, 36570-000,Viçosa, MG
2. Instituto Nacional Autónomo de Investigaciones
Agropecuarias, INIAP, Km 26 Vía Durán-Tambo, al Oeste de
Guayaquil, Cantón Yaguachi, Guayas, Ecuador
Whitefly-transmitted geminiviruses (begomoviruses)
are responsible for serious agricultural threats in Latin
America. In Ecuador, despite reports of significant
infestations of Bemisia tabaci in the late 1990’s, only very
recently has a begomovirus, Tomato leaf deformation
virus (ToLDeV), been reported in tomato. ToLDeV had
previously been reported in neighboring Peru, and
was shown to be the first monopartite begomovirus
originated in the Americas. In the years 2010 and 2011,
leaf tissue from individual tomato plants were collected
in the provinces of Chimborazo, Galapagos, Guayas,
Loja, Manabí and Santa Elena. Weed samples were also
collected in Guayas and Manabí. A total of 71 full-length
clones were obtained from 44 begomovirus-positive
tomato samples collected in Guayas, Manabí, Santa
Elena and Loja. Pairwise nt identities of 67 of these
complete genomes were >94% with ToLDeV isolates
206
from Peru. One sample collected in Manabí showed a
triple infection. One clone from this sampled displayed
98% nt identity with ToLDeV, a second clone displayed
92% nt identity with Rhynchosia golden mosaic Yucatan
virus (RhGMYuV), and a third clone displayed 93% nt
identity with the second clone from this same sample.
Recombination analysis indicated a strongly supported
recombination event in this third component, with
RhGMYuV as the major parent and ToLDeV from Santa
Elena as the minor parent. Furthermore, from two
different samples from Manabí, one clone was obtain with
92% nt identity with RhGMYuV, and one corresponded
to a new begomovirus species with a maximum nt
identity of 81% with Tomato golden leaf distortion virus
(ToGLDV). Begomovirus clones were also obtained from
six samples of Rhynchosia sp. collected in Guayas and
Manabí. All six DNA-A components showed >91% nt
identity with RhGMYuV. Together, these results indicate
a low species diversity of begomovirus in tomato in
Ecuador. Financial support: FAPEMIG, INIAP, CAPES
PIV603 - Complete Genome Sequence Of A
Field Isolate Of Pseudoplusia Includens
Single Nucleopolyhedrovirus
Craveiro, S.R., Mello, F.L., Ribeiro, Z.M.A., Ribeiro, B.M.,
Báo, S.N., Castro, M.E.B.
1. Programa de Pós-graduação em Biologia Molecular,
UnB, Brasília, DF, Brasil
2. Universidade de Brasília , UnB, Brasília, DF, Brasil
Cenargen, Brasília, DF, Brasil
Pseudoplusia includens single nucleopolyhedrovirus is
a baculovirus pathogenic for P. includens caterpillars,
a pest that causes considerable economic losses. The
natural occurrence of P. includens larvae killed by virus
emerged as prospect for use of this virus in soybean pest
control in the country. Seven PsinSNPV (IA to IG) isolates
obtained from Pseudoplusia includens larvae in soybean
and cotton crops in Brazil and Guatemala have been
compared and characterized by high degree of genetic
variability. In this study, the complete genomic sequence
of one of these isolates (PsinSNPV-IE) was described and
partially analyzed. DNA samples were sequenced using
Technology Next Generation (NGS) with the equipment
454 GS FLX automated sequencer (Roche) and 34,988
reads were obtained from pyrosequencing and used for
genome assembly. The compilation and analysis of data
were performed using Geneious v.6.1 and CLC Genomics
Workbenck (CLC bio) programs. For each read, the
regions corresponding to the adapters and regions with
0.1% error probability were trimmed. The contigs were
assembled and the PsinSNPV-IE genome sequence was
obtained with approximately 140 kbp and sequence
coverage greater than 20x. The genome of Chrysodeixis
chalcites (Chch) NPV, closely related virus to PsinSNPV,
was used as reference for identification of open reading
frames (ORFs) of the PsinSNPV genome. The ORFs were
confirmed using BLASTX and genomic mapping of
PsinSNPV-IE was performed. This virus has a genomic
sequence distinct from other baculoviruses sequenced
so far and has a high ability to multiply and infect in its
host, which makes of PsinSNPV an excellent target for
studies of genes related to pathogenicity and for future
development of biopesticides for the control of the P.
includens pest.
PIV622 - Genetic Variability Of The
Begomoviruses Euphorbia Yelllow Mosaic
Virus And Macroptilium Yelllow Vein
Virus In Their Respective Natural Hosts,
Euphorbia Heterophylla An Macroptilium
Lathyroides
Lemos, P.P.F., Ramos-Sobrinho, R., Lima, A.T.M., Xavier,
C.A.D., Zerbini, F.M.
BIOAGRO - Universidade Federal de Viçosa, BIOAGRO
- UFV, BIOAGRO, Universidade Federal de Viçosa, CEP
36570-000, Viçosa - MG
Begomoviruses
(genus
Begomovirus,
family
Geminiviridae) comprise a group of replant viruses of
great economic importance causing serious economic
losses in tropical and subtropical crops. It is believed
that the emergence of begomoviruses in Brazil occurred
through horizontal transfer of viruses previously
restricted to non cultivated plants by the B biotype
of Bemisia tabaci. Little is known about the genetic
variability of weed begomoviruses present in the field.
The study of this variability is important to understand
how viruses evolve in order to adopt strategies for the
development of crop cultivars with durable resistance, or
weed control practices. In this study we investigated the
genetic variability of two weed begomoviruses, Euphorbia
yellow mosaic virus (EuYMV) and Macroptilium yellow
vein virus (MaYVV) that infect Euphorbia heterophylla
and Macroptilium lathyroides, respectively. Our results,
based on 19 sequences of EuYMV and 18 of MaYVV, cloned
from samples collected in 2011 and 2012, support the
hypothesis that the genetic structure of begomoviruses
can be modulated by their hosts by common processes
of selection, mutation and recombination. We observed
distinct degrees of genetic variability between the two
viruses. EuYMV presented a higher diversity, similar
to other weed-infecting begomoviruses, while MaYVV
presented a low variability. The nucleotide diversity
of EuYMV (0.00819) was ~4 fold higher than MaYVV’s
(0.00197). The mutation frequency of EuYMV (2.5x103) was higher than MaYVV (4.2x10-4). This difference
207
can be supported by the higher diversity of all genes of
EuYMV compared to MaYVV. The diversity of the ORF’s
of EuYMV was higher for the CP (~3 fold), Rep (~7 fold),
Trap (~46 fold), Ren (~4 fold), AC4 (~8 fold). The higher
diversity of EuYMV can be explained mostly by the Trap.
The lower diversity observed for MaYVV could be due
to its recent emergence compared to EuYMV, reported
since the 1950s in Brazil.
PIV646 - High Infection Rate Of WhiteflyTransmitted Tomato Chlorotic Virus
(Tocv) In Potato In Brazil
Lima, M.F., Barriolli, C.
1. Embrapa Hortaliças, CNPH, C.P. 23 70359-970
Brasília-DF
2. Universidade Paulista, UNIP, Taguatinga-DF
In the last four years whitefly (Bemisia tabaci L.) biotype
B has been detected on high population levels in the main
Brazilian potato growing areas, especially, Northeast,
Midwest and Southeast regions, where whiteflytransmitted geminivirus has already been detected.
In 2012-2013, potato plants exhibiting symptoms of
chlorosis and undulate margins on apical leaves, that also
exhibited margins slightly rolled upward were observed
in commercial potato fields, at Cristalina County, State
of Goiás and Brasilia, Federal District, Brazil. Incidence
of symptoms on 45-50-day-old potato plants was
nearly 15% and symptoms always occurred associated
with high populations of whiteflies. The objective of
this work was to perform diagnosis on plants showing
the symptoms previously described and estimate the
infection rate of the causal agent. Fifty one symptomatic
potato plants were sampled from three potato growing
areas and subjected to analysis including dot-blot
analysis using polyclonal antibodies against Potato virus
Y (PVY), Potato virus X (PVX), Potato virus S (PVS) and,
Potato leafroll virus (PLRV). Also, preparations of total
RNA were used in Polymerase chain reaction (PCR) using
detection primers MA380/MA381 for Tomato chlorosis
virus (ToCV; genus Crinivirus; family Closteroviridae),
which amplifies a fragment of ca. 436 bp. In addition,
samples were also subjected to total DNA extraction
and geminivirus detection with universal primers
pALv1978/pARc496. A very small number of PVY, PVS,
PVX and PLRV infected plants was recorded. However,
33 (64.7%) out of 51 samples tested positive for ToCV
primers, amplifying a DNA fragment of the expected
size. No geminivirus positive samples were detected.
This high infection rate of ToCV in the sampled potato
fields indicate the importance of the virus to potato
cultivation and, in addition, also indicate the urgent need
of efficient control measures for ToCV and its vector, as
well. Financial support: Embrapa
PIV647 - Stuffing Cucumber (Cylanthera
Pedata): A New Host Of Papaya Ringspot
Virus (Prsv-W) And Cucumber Mosaic Virus
(Cmv)
Lima, M.F., Madeira, N., Barriolli, C.
1. Embrapa Hortaliças, CNPH, C.P. 23 70359-970,
Brasília, DF
2. Embrapa Hortaliças, CNPH, C.P. 23 70359-970,
Brasília, DF
3. Universidade Paulista, UNIP, Brasília-DF
Stuffing cucumber is a species of cucurbit that produce
edible fruits, consumed in some regions of Brazil. In 2012
it has been described as a host of geminivirus. During
2013, stuffing cucumber plants (Cyclanthera pedata
L. Schrad.) showing symptoms of leaf malformation,
with reduction of leaf blade and, mosaic, blistering,
and plant stunting, with almost 90% of infection rate,
were observed on a planting in the experimental field at
Embrapa Vegetables, Brasília-DF, Brazil. The objective of
this work was to identify the cause of those symptoms
on stuffing cucumber plants and, determine the rate
of infection. Fourteen plants were sampled and leaf
extracts were prepared and tested by dot-blot analysis
using polyclonal antisera against the most important
viruses that infect cucurbit species: Papaya ringspot
virus-type W (PRSV-W), Zucchini yellow mosaic virus
(ZYMV), Watermelon mosaic virus-2 (WMV-2), Zucchini
lethal chlorosis virus (ZLCV), and Cucumber mosaic virus
(CMV). In addition, all samples were also rub-inoculated
onto the following indicator hosts, using phosphate buffer
solution pH 7.0: Nicotiana benthamiana, N. tabacum
(TNN), N. rustica, Physalis spp., Solanum lycopersicon
(cv. Santa Clara), Cucurbita pepo (cv. Caserta), Nicandra
physaloides, Datura stramonium, Chenopodium muralha,
C. amaranthicolor and, C. quinoa. Serological results
on sampled plants revealed they were infected with
PRSV-W at an infection rate of 85% and also with CMV
at infection rate of 30%. Symptoms on indicator plants
were observed at about 10-15 days after inoculation
on C. pepo, N. physaloides, S. lycopersicon, N. rustica,
N. tabacum (TNN), and D. stramonium. Symptomatic
indicator plants tested positive in dot-blot test for
PRSV-W (12 isolates) and/or CMV (4 isolates), indicating
that indeed stuffing cucumber plants were infected with
PRSV-W and/or CMV. These data indicate the importance
of this species of cucurbit on epidemiology of diseases
caused by PRSV-W and CMV. This is the first report of
PRSV-W and CMV infecting stuffing cucumber in Brazil.
Financial support: Embrapa
Veterinary Virology - VV
209
Veterinary Virology: VV
VV2 - Serological And Molecular Evidence
Of Vaccinia Virus In Argentina
Franco, L., Pereira, A.F., Costa, G.B., Alves, P.A., Oliveira,
D.B., Trindade, G.S., Gonzalez, E.T., Panei, C.J., Galosi,
C.M., Abrahão, J.S., Kroon, E.G.
VV23 - Hobi-Like Virus: Clinical Signs, CrossReactivity And Detection By Diagnostic
Tests Used For Bovine Viral Diarrhea Virus
Bauermann, F.V., Ridpath, J.F., Flores, E.F., Weiblen, R.,
Harmon, A.
Antônio Carlos, 6627 Bloco F4, Sala 258
2. Universidad Nacional de La Plata, UNLP, La Plata
1900, Buenos Aires, Argentina
3. National Research Council , CCT-CONICET, La
Plata 1900, Buenos Aires, Argentina
4. Scientific Research Commission of Buenos Aires
Province , CIC-PBA, , La Plata 1900, Buenos Aires, Argentina
Roraima, 1000- Santa Maria,RS
2. National Animal Disease center - NADC/USDA,
NADC/USDA, Ames, Iowa
3. Novartis Animal Health, Novartis, Larchwood, IA
Bovine vaccinia (BV) is a viral disease that affecting dairy
cattle and milkers, being classified as an occupational
zoonosis. This disease has as etiologic agent the Vaccinia
virus (VACV), which belongs to the Poxviridae family,
Orthopoxvirus genus. Infected dairy cattle usually
present ulcerative lesions on their teats and udders.
Rural works, when infected, presented lesions on their
hands, lymphadenopathy, high fever and prostration,
among other symptoms. Therefore, BV has a great
economic impact, compromising the milk industry and
public health services. In the last 14 years, outbreaks the
BV have been detected and/or described across Brazil.
Despite BV impacts in Brazil, there is no data regarding
VACV circulation in Argentina. We investigated for the
presence of OPV-neutralizing antibodies and VACV
DNA in 100 sera samples from different Argentinian
provinces (50 from dairy cattle/50 from beef cattle). Of
50 dairy cattle samples, neutralizing antibodies against
OPV were detected in 4 sera (2%); of these, 3 (1.5%) had
titers of 100 NU/ml, and 1 (0.5%) had a titer of >200
NU/ml. Of the 50 beef cattle, 8 (4%) had antibodies to
OPV; of these, 2 (1%) had titers of 100 NU/ml, 2 (1%)
had titers of 200 NU/ml, 3 (1.5%) had titers of 400 NU/
ml, and 1 (0.5%) had a titer of >800 NU/ml. Five of 100
serum samples were positive in PCR assays: 3 beef and
2 dairy cattle sera samples. The hemaglutinin gene (HA)
PCR product of a PCR positive bovine sample was directly
sequenced in both orientations using the M13 universal
primers. The alignment of the obtained HA sequence
revealed that the Argentinian sample is highly similar
to the homologous gene from other VACV. Although no
exanthematous VACV outbreaks have been described in
bovines in Argentina, our results suggest that dairy and
beef herds may be exposed to VACV in areas surrounding
the Brazilian border and therefore may be at risk for
VACV infection.
Hobi-like or atypical pestiviruses comprise a newly
recognized group of pestiviruses whose origin,
epidemiology and pathogenesis are begining to be
understood. This study aimed at comparing the clinical
presentation, antigenic cross reactivity between HoBi
like viruses and bovine viral diarrhea viruses (BVDV)
and detection tests for these viruses. For this, colostrum
deprived calves were infected with a HoBi like virus
or with field BVDV isolates of different virulences. The
clinical presentation following acute infection of cattle
with a HoBi-like virus was very similar to field strains of
noncytopathic BVDV and included low grade pyrexia and
reduction in circulating lymphocytes. We also compared
the detection of pestiviruses BVDV, border disease
virus, bungowannah virus and pronghorn virus using a
commercial ELISA for BVDV Erns protein and by RT-PCR
using panpestivirus primers. Detection of a HoBi-like
virus using the ELISA kit was statistically similar to that
of BVDV1 and BVDV2. In contrast, RT-PCR tests using
the panpestivirus primers had lower sensitivity for the
detection of HoBi-like strains compared to detection of
four recognized species of pestivirus. Two commercial
ELISA kits designed to detect antibodies against BVDV,
missed 22.2% and 77.7% of serum samples containing
low to moderate levels of HoBi virus neutralizing
antibodies. Finally, cross reactivity of serum antibodies
produced by animals vaccinated against BVDV to HoBi
like viruses was examined. Sera of cows vaccinated using
killed or modified live vaccine containing both BVDV1
and BVDV2 antigens had low neutralizing activity against
two HoBi-like viruses, indicating that these vaccines
would provide limited protection against infection with
a HoBi-like virus. These results indicate that Hobi-like
virus produce clinical signs similar to BVDV and indicate
that suggest that new diagnostics tests and/or reagents
are needed to properly identify these new viruses.
Financial support: CRADA ARS-Novartis Animal Health
VV24 - Mapping The Sites Of Latency And
Reactivation By Bovine Herpesvirus 5
(Bohv-5) And By A Thymidine Kinase-Deleted
Bohv-5 In Lambs
September 2013 Volume 18 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV
210
Cadore, G.C., Weiss, M., Anziliero, D., Brum, M.C.S.,
Weiblen, R., Flores, E.F.
1. Universidade Federal de Santa Maria, UFSM, Av.
Roraima, 1000, Santa Maria/RS
2. Universidade Federal do Pampa, UNIPAMPA, BR
472, km 592, Caixa Postal 118. Uruguaiana/RS
Bovine herpesviruses types 1 (BoHV-1) and 5 (BoHV-5)
are very closely related pathogens of cattle, associated
with respiratory/genital and neurological disease,
respectively. Nonetheless, cases of encephalitis caused
BoHV-1 have been occasionally reported. Envelope
glycoprotein D of BoHV-1 (gD1) and BoHV-5 (gD5) are
involved in attachment, penetration and cell fusion, and
also seem to participate in viral neuropathogenesis. In
addition, gD gene is well conserved and, as such, may be
used for phylogenetic analysis. Thus, a phylogenetic study
was performed to investigate genetic divergences at the
3’region of gD gene of respiratory/genital BoHV-1 (n=7),
neurological BoHV-5 (n=7) and neurological BoHV-1
(n=7) isolates, and whether these differences would be
associated with the respective clinical presentations. The
isolates/strains were initially differentiated as BoHV1 or BoHV-5 by a differential PCR, then, a nucleotide
(nt) region of the gD 3’ was sequenced and analyzed;
and the amino-acid (aa) sequence was deduced. The
phylogenetic reconstruction based on nt and aa allowed
the clear differentiation of BoHV-1 (n=14) and BoHV-5
(n=7) in different clusters. The seven BoHV-1 isolates
from neurological disease grouped within BoHV-1
branch. A consistent alignment of 310 nt revealed a high
conserved region within each type and a least conserved
between 3’ of gD1 and 3’ of gD5. The nt and aa similarity
levels were on average 98.3% among gD1; 97.8% and
95.8% among gD5 and 73.7% and 64.1% between
both viral types. Thus, the phylogenetic and identity
similarity levels allowed differentiation/classification
of BoHV-1 and BoHV-5 types. However, no conclusion of
a possible involvement of gD 3’ nucleotide sequence in
determination of the neurovirulent phenotype could be
drawn. Financial support: CNPq
VV25 - Glicoprotein D-Based Phylogeny
Of Typical And Neurological Bovine
Herpesviruses Types 1 And 5
Traesel, C.K., Sá e Silva, M., Weiss, M., Weiblen, R., Flores,
E.F.,
2. Southeast Poultry Research Laboratory, USDA/ARS,
934 College Station Road, Athens, GA, USA
Bovine herpesviruses types 1 (BoHV-1) and 5 (BoHV-5)
are very closely related pathogens of cattle, associated
with respiratory/genital and neurological disease,
respectively. Nonetheless, cases of encephalitis caused
BoHV-1 have been occasionally reported. Envelope
glycoprotein D of BoHV-1 (gD1) and BoHV-5 (gD5) are
involved in attachment, penetration and cell fusion, and
also seem to participate in viral neuropathogenesis. In
addition, gD gene is well conserved and, as such, may be
used for phylogenetic analysis. Thus, a phylogenetic study
was performed to investigate genetic divergences at the
3’ region of gD gene of respiratory/genital BoHV-1 (n=7),
neurological BoHV-5 (n=7) and neurological BoHV-1
(n=7) isolates, and whether these differences would be
associated with the respective clinical presentations. The
isolates/strains were initially differentiated as BoHV1 or BoHV-5 by a differential PCR, then, a nucleotide
(nt) region of the gD 3’ was sequenced and analyzed;
and the amino-acid (aa) sequence was deduced. The
phylogenetic reconstruction based on nt and aa allowed
the clear differentiation of BoHV-1 (n=14) and BoHV-5
(n=7) in different clusters. The seven BoHV-1 isolates
from neurological disease grouped within BoHV-1
branch. A consistent alignment of 310 nt revealed a high
conserved region within each type and a least conserved
between 3’ of gD1 and 3’ of gD5. The nt and aa similarity
levels were on average 98.3% among gD1; 97.8% and
95.8% among gD5 and 73.7% and 64.1% between
both viral types. Thus, the phylogenetic and identity
similarity levels allowed differentiation/classification
of BoHV-1 and BoHV-5 types. However, no conclusion of
a possible involvement of gD 3’ nucleotide sequence in
determination of the neurovirulent phenotype could be
drawn. Financial support: CNPq
VV26 - Evaluation Of Diagnostic Tests To
Detect Calves Persistently Infected With
Hobi-Like Pestiviruses
Bauermann, F.V., Falkenberg, S.M., Decano, N., Weiblen,
R., Flores, E.F., Ridpath, J.F.
2. National Animal Disease Center, NADC/USDA,
Aimes, Iowa
3. University of Bari, University of Bari, Valenzano,
Italy
The emergence of a new group of pestiviruses, the HoBilike viruses, presents potential problems for diagnosis
due to the similarities in clinical presentation, genetic
and antigenic similarity with bovine viral diarrhea
virus (BVDV). Because BVDV persistently infected (PI)
calves are the major reservoirs and source of virus
dissemination in nature, they constitute the main
211
targets of BVDV detection efforts in the U.S. and other
countries undertaking control and/or eradication
measures. Thus, calves persistently infected with HoBilike virus (HoBi PI) were generated by experimental
infection of seven pregnant heifers with HoBi-like
viruses. One heifer aborted at 8 months of gestation;
two calves died shortly after birth and four surviving
calves appeared clinically normal. HoBi like virus was
isolated from the aborted fetus and two calves that died.
Based on multiple tests performed on samples collected
more than 2 weeks apart, the surviving calves were
persistently infected with HoBi-like viruses. Ear notches
were collected from HoBi PI calves at day of birth (DOB)
and then weekly for one month. Samples were tested
by ELISA, immunohistochemistry (IHC), and RT-PCR
using panpestiviruses and HoBi-like specific primers.
IHC detected 100% of samples at all time points,
ELISA missed one animal at DOB. About 80% of RTPCR reactions using panpestivirus primers and 15% of
reactions using HoBi-like virus specific primers resulted
in false negatives. These results indicate the need for
improving the methods/tests for detection of calves
persistently infected with this new group of pestiviruses.
Financial support: CRADA ARS-Novartis Animal Health
VV31 - Pseudocowpox And Papular
Stomatitis In Cattle In The Rondonia State,
Brazil
Cargnelutti, J.F., Santos, B.S., Lebre, S.N., Sodré, D.N.A.,
Silva, R.M., Weiblen, R., Flores, E.F.
Roraima, 1000, Santa Maria, Rio Grande do Sul
2. Agência de Defesa Sanitária Agrosilvopastoril do
Estado de R, IDARON, Rondônia
Cases of vesicular disease, initially suspected of footand-mouth disease or vesicular stomatitis were reported
in cattle in Nova Brasilandia do Oeste county located
at central-southern region of Rondonia state (Brazil),
between October and November of 2012. The described
outbreaks occurred in 13 neighbor herds affecting 25 of
482 animals, mainly calves (< six months-old). Samples
from nine herds were submitted to laboratory diagnostic.
The animals developed papulo-vesicular lesions, mainly
in the oral cavity, but also in the muzzle and skin, with a
clinical course of approximately 7 to 10 days. Samples
collected from lesions were submitted initially to
diagnosis of foot-and-mouth disease, resulting negative.
Tissue fragments of lesions and swabs were submitted
to diagnosis of other agents of vesicular disease:
parapoxvirus, vaccinia virus, and bovine herpesvirus
type 2, by virus isolation and PCR. Samples obtained
from animals of four herds were positive to B2L gene
of parapoxvirus by PCR. Nucleotide sequencing and
phylogenetic analysis of the amplicons indicated 9799% of similarity with pseudocowpox virus in samples
from three herds; samples from another herd presented
the same similarity with bovine papular stomatitis
virus. Samples from others herds were negative for all
viruses. These results show the circulation of bovine
parapoxviruses in Rondonia state, and indicate the need
for fast and reliable diagnosis to avoid the consequences
of restrictive measures related to foot-and-mouth
disease, and to control and prevent these viral infections
as well. Financial Support: CNPq
VV42 - Surface Plasmon Resonance
Immunosensor For The Diagnosis Of Canine
Distemper Virus Infection
Basso, C.R., Pedrosa, V.A., Araújo Jr., J.P.
Universidade Estadual Paulista, UNESP, Rubião Junior,
Botucatu-SP
The canine distemper virus known as CDV, affects
carnivorous order animals and it is responsible for
one of the canine diseases more difficult to diagnose.
The technique of Surface Plasmon Resonance (SPR) is
presented as an analytical tool that can detect both the
presence of the antigen as the antibody, and determine
the values of the adsorption and desorption kinetics of
this process. For this study were used twenty positives
samples of canine urine and eight negatives from
animals treated at the Clinic of Infectious Diseases
Animals Veterinary Hospital (FMVZ-UNESP)-Botucatu.
The SPR signal response increased in proportion to the
concentration of CDV. The CDV binding signals were
linearly related to the concentration in the range of
1.1 to 1160.0 ng mL-1 with Δθ = 7.8 + 4.28x, R2=0.98,
combined with a low relative error of 4.8%. The
detection limit was calculated using this high sensitivity
domain, which is typically used for the determination of
LOD in SPR experiments. This LOD was calculated using
3 times the noise on the SPR sensorgram combined
with the slope of the highly sensitive region, and the
detection limit for CDV was 0.1 ng L-1 and the analytical
frequency can be estimated to be 240 samples per
day. The saturated CDV binding at 1.1 ng mL-1 (6.7
millidegrees) corresponds to a binding capacity of 0.05
ng/mm−2. This result is comparable to previous efforts
to diagnose CDV by conventional methods including
electron microscopy, virus isolation, latex agglutination,
hemaglutination and ELISA. However, these methods
require multistep detection schemes. In contrast, this
proposed methodology requires less than 2 hours for
a complete diagnosis, including the modification step.
The advantage of the proposed method over some
existing ones resides in its simplicity, low consumption
of reagents, higher sample frequency and the possibility
212
of automation. The method has been satisfactorily
applied to the measurement of CDV concentrations
in urine samples. Financial support: FAPESP- process
2012/15666-1
VV46 - Equine Infectious Anemia: Risk
Factors Detected In A Prevalence Study Of
Working Equids In Minas Gerais
Almeida, V.M.A., Gonçalves, V.S.P., Haddad, J.P.A.,
Martins, M.F., Dias, R.A., Leite, R.C., Reis, J.K.P.
Antônio Carlos, 6.627, Belo Horizonte, MG, CEP: 31.270-901
2. Instituto Mineiro de Agropecuária
3. Universidade de Brasília
4. Universidade de São Paulo
Risk factors for the occurrence of equine infectious
anemia (EIA) were studied in 6,540 animals from 1,940
randomly sampled farms in 853 municipalities of Minas
Gerais after administering a questionnaire to farmers
during a seroepidemiological survey from September
2003 to March 2004. Stratified analyses indicated that
mules are 1.94 times more likely to acquire EIA than
horses, that horses of undefined breeds animals are
8.24 times more likely to develop EIA than purebred
animals, and that animals aged from 61 to 120 months
are 2.90 times more likely to develop the disease than
animals aged 13 to 24 months. The final multiple logistic
regression model indicated that vaccination and the use
of the same horse harness on more than one animal are
risk factors for EIA. The disease appears to be related to
transit, as the out-of-state origin of animals and their use
in breeding, which are indirect indicators of the greater
movement of animals, were associated with increased
disease risk. Financial support: FAPEMIG,CNPq

Virus Reviews and Research - Sociedade Brasileira de Virologia

Transcrição

Documentos relacionados

Surfing CASE: GSAF 2005.02.04 DATE: Friday February 4, 2005

O026: Countrywide prevalence study of healthcare

color and genomic ancestry of brazilians studied with

The Ascidiidae (Ascidiacea: Tunicata) of Coastal Brazil

brazil - berkanatravel.com.br

What You Really Need to Know about Importing into the United

ISSUE INTRODUCTION We are proud to announce to the scholar

plant communities of hennequin point, king george island, antarctica

項目詳細信息 Detalhes de Projeto

Visa Form