Pseudomonas syringae
Transcrição
Pseudomonas syringae
National Institute for Agrarian and Veterinary Research (INIAV) (www.iniav.pt) National Reference Laboratory for Plant Health ILab Main activities 1.00 UW175 UW070 UW167 UW9 P3 332 R633 LB1 NCPPB3987 Ant307 BS025 PD1939 BR855 UW224 BR629 UW344 CPBF833 UW298 CPBF915 UW505 PD1100 JT516 CPBF568 CPBF785 PD 1941 CPBF850 CPBF894 CPBF933 CPBF836 BR113 CPBF914 BS048 UW365 UW51 WP306 BS024 UW448 MAFF301556 UW152 CPBF923 PD441 CPBF869 UW296 CPBF917 CPBF793 CPBF759 UW72 AW UW134 ICMP7963 K60 CFBP2047 ICMP9600 CPBF1192 CPBF674 BS095 UW469 DAR64836 CFBP715 CFBP712 BR574 CFBP2958 Research on quarantine and quality phytopathogenic bacteria of national and regional interest (phenetic diversity, diagnosis and epidemiology) Support to national phtyossanitary authority (definition of national control plans for quarantine bacteria, sampling procedures and diagnostics) Analysis of Q-bacteria (Ralstonia solanacearum, Clavibacter michiganensis subsp. sepedonicus, Erwinia amylovora, Pseudomonas syringae pv. actinidiae, Xylella fastidiosa; Huanlonbing) Scientific and technical suport to official national/regional laboratories (diagnostic procedures, training) Dissemination of knowledge to stakeholders and regional inpectors (lectures and technical courses) Support to community (Plant Clinics) 1.00 0.99 2 Phyl bhr c Bacterial canker of kiwi caused by Pseudomonas syringae pv. actinidiae in Portugal – Disease Importance and pathogen characterization Leonor Cruz1,3, Joana Cruz1,3, Camila Fernandes1,4, Gisela Chicau2, Rogério Tenreiro3 1 Instituto Nacional de Investigação Agrária e Veterinária, UEIS-SAFSV – Laboratório de Fitobacteriologia, Quinta do Marquês, Oeiras; 2 DRAPN –Divisão de Apoio ao Sector Agroalimentar, Senhora da Hora, Porto; 3Universidade de Lisboa, Faculdade de Ciências, Centro de Biodiversidade Genómica 22/04/2013 Integrativa e Funcional (BioFiG); 4Universidade do Porto, Faculdades de Ciências, Campo Alegre, Porto. [email protected] EAP Meeting - Copenhagen 23 October 2015 Symptoms Leaves Branches 4 Symptoms Flowers Main risk factors in the area Presence of high levels of inoculum High number of orchards Presence of very susceptible cultivars (A. chinensis) Temperature >15ºC during blooming Presence of polinators High HR 5 Bacterial canker of kiwi Major and minor hosts Actinidia chinensis (summer kiwi, chinese kiwi) Actinidia deliciosa (kiwi, Chinese gooseberry) Actinidia arguta Actinidia kolomikta Bacteria Proteobacteria Gama-Proteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas sp. Classified in to 4 biovars based on phenotipic and genomic characteristics 6 Portuguese situation Reynaud (2011) EPPO PRA Portugal Balestra et al. 2010d: disease incidence as high as 30% was noted in 2010 and incidence has increased up to 80% in 2011 (Renzi et al., 2011). ano 2010 2011 2012 2013 nº total 10 175 71 293 pos 6 15 30 140 % 60% 9% 42% 48% Portuguese Control Plan P. syringae pv. actinidiae Progression of P. syringae pv. actinidiae infections in Latina (Vanneste et al. 2011b). (circulo = 1km) 7 Incidence 03/2010 – First identification (Santa Maria da Feira), in plant material imported sent by Direcção Regional de Agricultura do Norte (DRAPN) 2010-2012 Orchards neg pos TOTAL 44 Hayward 16 Bo Erica 4 Ciften 2 Summer kiwi 1 Tumori P1 3 p.e. D1 0 nd 18 Soreli 0 Belen 0 Tsechelidis 0 8 Nurseries freq. rel neg pos 42 48,84 156 20 55,56 45 0 0,00 15 2 50,00 0 2 66,67 0 2 40,00 38 0 0,00 7 16 47,06 7 0 0,00 25 0 0,00 12 0 0,00 4 freq. Rel 6 3,70 1 2,17 0 0,00 0 0,00 0 0,00 2 5,00 3 30,00 0 0,00 0 0,00 0 0,00 0 0,00 Portuguese situation 9 Sampling Kiwi area in north Portugal – 1500ha Comission Decision n.º 2012/756/EU Definition of portuguese contaminated and disease free areas Definition of a sampling strategy National Control Plan surveillance of orchards, nurseries and garden centres Training courses for farmers and inspectors Research 10 IDiagnosis Samples from orchards, nurseries and imported propagation materials aprox. 1000 (2010-2013) 84 selected isolates from North and Center regions Diagnosis - internal method based on OEPP PM7/120(1) Extraction from leaves, branches, fruits and roots Isolation on KMB Conventional PCR Scortichini et al., 2002 or Rees-Gerge et al., 2010 PAV 1 GGCGACGATCCGTAACTGGTCTGAGA 760 bp P 22 TTCCCGAAGGCACTCCTCTATCTCTAAAG Gallelli et al., 2011 KN-F (5’ – CACGATACATGGGCTTATGC – 3’) 492 bp KN-R (5’ – CTTTTCATCCACACACTCCG – 3’) AvrDdpx-F (5’ – TTTCGGTGGTAACGTTGGCA – 3’) 230 bp AvrDdpx-R (5’ – TTCCGCTAGGTGAAAAATGGG – 3’) 11 IIdentification PCR Scor 760 bp PCR Gal 492 bp 230 bp 12 PCR Gal Biovar symptoms esculin coronatin phaseolotoxin PCR Scor 1 ramos/folhas - - + + 2 2 ramos/folhas - + - + 2 3 ramos/folhas - - - + 2 4 folhas + - - + 1 (bands) L1 – 1Kb plus L2 – Psa 1365 L3 – Psa 1366 L4 – Psa 1367 L5 – Psa 1368 L6 – Psa 1369 L7 – Psa 1370 L8 – Psa 1371 L9 – Psa 1372 L10 – 1Kb plus L11 – Psa 1373 L12 – Psa 1374 L13 – Psa 1375 L14 – Psa 1416 L15 – Psa 1377 L16 – Psa 1393 L17 – Psa 1395 L18 – Psa 1396 L19– 1Kb plus IGenomic characterization 13 Bv1 Bv2 Bv3 (Cunty et al., 2015 Bv4 IGenomic characterization 70 69 72 69 70 83 64 67 71 75 76 96 58 2012 Year of 2013 2013 2013 Geographical Origin V Arouca 2013 Box Oliveira da Bairro 2013 2013 1376 Cantanhede 2013 Ponte de Lima 1450 Águeda 2013 CPB 1447 Póvoa do Lanhoso 2013 2013 1449 Amares 2013 Ponte de Lima 1434 Amares 2013 1431 1438 Amares 2013 1432 1440 Póvoa do Lanhoso 2013 2013 1439 Amares 2013 Póvoa do Lanhoso 1435 Felgueiras 2013 1433 1437 Felgueiras 2013 2013 1417 Felgueiras 2013 2013 1421 Felgueiras 2013 Fafe 1418 Felgueiras 2013 1430 1419 Celorico de Bastos 2013 2013 1420 Celorico de Bastos 2013 Vagos 1422 Felgueiras 2013 Penafiel 1423 Felgueiras 2013 1452 1412 Felgueiras 2013 2013 1415 Felgueiras 2013 Penafiel 1411 Guimarães 2013 1427 1414 Guimarães 2013 1425 1397 Vila Verde 2013 2013 1398 Vila Verde 2013 Vila Verde 1407 Braga 2013 1428 1410 Vila Verde 2013 2013 1406 Maia 2013 2013 1408 Gondomar 2013 Vila Verde 1399 Maia 2013 1429 1402 Gondomar 2012 2013 1400 Braga 2012 Cantanhede 1401 Felgueiras 2012 Oliveira da Bairro 1405 Rio Tinto 2012 1445 1413 Anadia 2012 1446 1362 Maia 2012 2013 1364 Oliveira do Bairro 2012 Anadia 1368 Santa Maria da Feira 2012 1444 1370 Castelo de Paiva 2012 2013 1367 Castelo de Paiva Amarante 1366 Oliveira do Bairro 2013 1441 1365 2012 Celorico de Bastos 1369 Arouca 2012 1424 1374 Felgueiras 2012 95 1416 Castelo de Paiva 72 100 58 51 75 87 72 94 1372 77 75 80 74 96 91 67 60 59 88 2012 Maia 2013 Arouca Arouca 2013 1377 1375 Barcelos 2012 1373 1395 Valongo 2011 2011 1393 Castelo de Paiva 1325 2011 1327 2011 2011 2011 2010 1326 1305 2011 1322 1329 2011 2012 1330 1442 1360 1359 Braga Anadia Amarante Amarante Vila Meã 2013 2012 2013 2013 2013 2012 2012 2011 1443 Amarante 1331 1356 1332 Lousada 1328 Santa Maria da Feira 1371 59 59 55 70 59 80 68 92 77 71 64 61 91 85 62 68 68 1436 Guimarães Presence of strains from “biovar 4” box_todas (82 entries) 74 85 1357 492 bp 230 bp Lack of the specific band for the 84 strains of P. syringae pv. actinidiae tested C+ - Pst (CFBP 2212) PCR Gal Coronatin production (Cfl) (Bereswill et al., 1994) MW 1305 1322 1325 1326 1327 C- Pst Box 86 1396 14 Box A1R Lows et al. (1994) IDiagnosis Decision scheme 1 . Sample preparation Orchard sub-samples of male and female plants 2 – Screening tests Isolation on KMB and conventional PCR (Scortichini et al 2002; Rees-George et al., 2010) 3 – Identification of colonies by Galleli et al. (2011) 4 – Confirmation by Real - time PCR (Gallelli et al., 2013) (EUPHRESCO II – PSADID) 15 IResearch EUPHRESCO II - European Phytossanitary Research Coordination II Partner Country Development and harmonization of methods for diagnosis, detection and identification of Pseudomonas syringae pv. actinidiae (2013-2015) Resultados previstos: Implementation of new tools for the diagnosis of Psa in symptomatic a asymptomatic plant material Validation of a sampling protocol Epidemiological knowledge of Pseudomonas syringae pv. actinidiae in distinct areas of Europe 16 I Phylogenetic Characterization Italy 1st Focus – 1992 2nd Focus – 2008 Estirpes com características fisiológicas (produção de faseolotoxina e coronatina) e genómicas distintas (genes constitutivos e de virulência) Biovares 1, 2 e 3 Portugal 1st Identification – 2010 Identification of the bacterium in orchards with more than 10 years Sequenciação de 1 isolado Português obtido em 2010 87 Biovar 4 CFBP2212 Pseudomonas syringae pv. tomato 0.002 17 ICMP 19073 Biovar 2; Korea; 1998 CPBF 1428; Portugal; 2013 CFBP 7811 Biovar 3; New Zealand; 2010 CFBP 7287; Biovar 3; Italy; 2008 CFBP 4909; Biovar 1; Japan; 1984 NCPPB 3871; Biovar 1; Italy; 1992 CFBP 8052; Biovar 3; France; 2012 CPBF 1439; Portugal; 2013 CPBF 1367; Portugal; 2012 CPBF 1447; Portugal; 2013 CPBF 1364; Portugal; 2012 CPBF 1433; Portugal; 2013 CPBF 1411; Portugal; 2013 CPBF 1400; Portugal; 2013 CPBF 1329; Portugal; 2011 CPBF 1366; Portugal; 2012 ICMP 19439; Biovar 3; Chile; 2010 ICMP 19455; Biovar 3; Chile; 2010 CPBF 1371; Portugal; 2012 98 CPBF 1406; Portugal; 2013 CPBF 1444; Portugal; 2013 CPBF 1442; Portugal; 2013 ICMP 19457; Biovar 3; Chile; 2010 ICMP 19456; Biovar 3; Chile; 2010 CRA-FRU 10.22; Biovar 3; Italy; 2008 ICMP 19076; Biovar 3; New Zealand; 2011 ICMP 19072; Biovar 2; Korea; 1997 ICMP 18743; Biovar 3; Italy; 2010 ICMP 9855; Biovar 1; Japan; 1984 ICMP 18744; Biovar 3; Italy; 2010 ICMP 18745; Biovar 3; Italy; 2010 ICMP 19071; Biovar 2; Korea; 1997 ICMP 19068; Biovar 1; Japan; 1988 ICMP 19070; Biovar 1; Japan; 1987 ICMP 19069; Biovar 1; Japan; 1984 CPBF 1414; Portugal; 2013 CPBF 1372; Portugal; 2012 CPBF 1422; Portugal; 2013 CPBF 1421; Portugal; 2013 CPBF 1326; Portugal; 2011 ICMP 19440; Biovar 4; Australia; 2011 ICMP 19441; Biovar 4; Australia; 2011 ICMP 18882; Biovar 4; New Zealand; 2010 ICMP 19486; Biovar 4; Australia; 1990 CFBP 7905; Biovar 4; New Zealand; 2010 CFBP 8043; Biovar 4; France; 2011 CFBP 8045; Biovar 4; Australia; 1990 CFBP 8046; Biovar 4; Australia 2011 rpoD Neighbor-Joining phylogenetic tree using MEGA5 of 19 selected Portuguese isolates and 30 selected g worldwide strains according to Parkinson et al. (2011). Bootstrap test (1000 replicates) are shown next to the branches. Evolutionary distances were computed using the Jukes-Cantor method. Pst type strain IConclusions Between 2010 and 2013 more than 100 isolates of Pseudomonas syringae pv. actinidiae were collected from orchards nurseries and imported propagation materials. The use of two conventional PCR protocols allowed identifying all known biovars of Pseudomonas syringae pv. actinidiae. The use of primers directed to genes responsible for the production of the toxins coronatin (Cfl) and/or phaseolotoxin (argK) allow to exclude the presence of biovar 2 among Portuguese strains. BOX PCR fingrprinting profiles were characteristic of biovar 3 for most of the strains tested The phylogenetic tree generated by rpoD confirms the association of the selected strains as belonging to biovar 3. The lack of avrD1 amplification indicates the presence of a small population of biovar 4 strains alocated recently to Pseudomonas syringae pv. actinidifoliorum. 18 Obrigada! Instituto Nacional de Investigação Agrária e Veterinária, I.P. Av. da República, Quinta do Marquês, 2780-157 Oeiras, Portugal Tel: (+ 351) 21 440 35 00 - Fax: (+ 351) 21 440 36 66 www.iniav.pt
Documentos relacionados
nec 80.573
BANESPA - C/ APLICACAO BANCO NOSSA CAIXA S/A - C/ IPVA B. BRASIL S/A - C/ FPM B. BRASIL S/A - C/ ITR B. BRASIL S/A - C/ FUNDO ESPECIAL B. BRASIL S/A - C/ CFERM B. BRASIL S/A - C/ REPASSE ICMS B. NO...
Leia mais