Diapositivo 1 - Universidade de Évora

Сomentários

Transcrição

Diapositivo 1 - Universidade de Évora
Dia da Propriedade
Industrial
Bases de Dados de
Biotecnologia
Vanessa Fatal
Examinadora de Patentes
Universidade de Évora | 21.09.2010
BASES DE DADOS GRATUITAS:
http://www.ncbi.nlm.nih.gov/Database/
http://www.ebi.ac.uk/Tools/fasta/index.html
http://chem.sis.nlm.nih.gov/chemidplus/
NCBI – National Center for Biotechnology Information
Depósito de sequências
Bases de Dados de
literatura biomédica
Pesquisa de sequências e
estruturas; homologias
NCBI - Bases de Dados
PubMed → MeSH TERMS (Medical Subject Headings)
MeSH TERMS
http://www.ncbi.nlm.nih.gov/mesh?itool=sidebar
MeSH TERMS
Os termos MeSH permitem alargar o
âmbito da pesquisa ao estado da
arte, através de uma hierarquia de
categorização.
BLAST (pesquisa de sequências e homologia)
http://blast.ncbi.nlm.nih.gov/Blast.cgi
BLAST
Introduzir a sequência a
pesquisar
agttaccttcgcatcgatcaactaaccaactcagcctcagaatgatgaagttcatgtgca
Iniciar a pesquisa
BLAST
BLAST
Referências
bibliográficas
BLAST
Sequência a
pesquisar
Resultado
Percentagem
de identidade
BLAST
GenBank (base da dados de sequências genéticas)
http://www.ncbi.nlm.nih.gov/Genbank/
PubChem (pesquisa de compostos e estruturas químicas)
http://pubchem.ncbi.nlm.nih.gov/
PubChem
PubChem
PubChem
EMBL- EBI
http://www.ebi.ac.uk/Databases/
EMBL- EBI
agttaccttcgcatcgatcaactaaccaactcagcctcagaatgatgaagttcatgtgca
EMBL- EBI
BLAST ou FASTA (pesquisa de sequências e homologia)
BLAST
BLAST
BLAST
BLAST
ChemIDplus
http://chem.sis.nlm.nih.gov/chemidplus/
ChemIDplus
ChemIDplus
BASES DE DADOS COM SUBSCRIÇÃO:
http://www.stn-international.de/stn_content.html?&L=class%3Dl
http://www.cas.org/expertise/cascontent/index.html
STN
9 Pesquisa por estrutura, CAS, sequência ou função em bases de dados científicas e de patentes
9 Pesquisa de sequências homólogas em bases de dados científicas e de patentes
CAS – Chemical Abstracts Service
http://www.cas.org/expertise/cascontent/index.html
EPOQUENET
EPOQUENET
OBRIGADA PELA
VOSSA ATENÇÃO!
INPI
INSTITUTO NACIONAL DA PROPRIEDADE INDUSTRIAL
Campo das Cebolas 1149-035 Lisboa
Linha de informações: 808 200 689 / Site: www.inpi.pt
Tel: (+351) 218 818 100 / Fax: (+351) 218 869 859
OS MEUS CONTACTOS
DEPARTAMENTO DE PATENTES E MODELOS DE
UTILIDADE
Vanessa Fatal
[email protected]

Documentos relacionados

clique aqui

clique aqui http://www.ncbi.nlm.nih.gov/pmc/ Base de dados com resumos e textos completos em ciências biomédicas PUBMED http://www.ncbi.nlm.nih.gov/pubmed/ Base de dados com resumos em ciências biomédicas

Leia mais