Gabriela Carvalho Fernandes Identificação de mulheres em risco

Сomentários

Transcrição

Gabriela Carvalho Fernandes Identificação de mulheres em risco
Gabriela Carvalho Fernandes
Identificação de mulheres em risco para câncer de mama hereditário por mutação nos
genes BRCA1 e BRCA2: contribuição dos dados patológicos, história familiar e
modificadores genéticos do risco de câncer.
Barretos, SP
2015
Gabriela Carvalho Fernandes
Identificação de mulheres em risco para câncer de mama hereditário por mutação nos
genes BRCA1 e BRCA2: contribuição dos dados patológicos, história familiar e
modificadores genéticos do risco de câncer.
Dissertação apresentada ao Programa de
Pós-Graduação da Fundação PIO XII –
Hospital de Câncer de Barretos para
obtenção do Título de Mestre em Ciências
da Saúde.
Área de Concentração: Oncologia
Orientador: Profa. Dra. Edenir Inêz Palmero
Barretos, SP
2015
F363i
Fernandes, Gabriela Carvalho
Identificação de mulheres em risco para câncer de mama hereditário por
mutação nos genes BRCA1 e BRCA2: contribuição dos dados patológicos,
história familiar e modificadores genéticos do risco de câncer. / Gabriela
Carvalho Fernandes. - Barretos, SP 2015.
173 f. : il.
Orientadora: Edenir Inêz Palmero.
Dissertação (Mestrado em Ciências da Saúde) – Fundação Pio XII – Hospital
de Câncer de Barretos, 2014.
1. Neoplasias da Mama. 2. Neoplasias da mama/triplo negativo. 3.
Hereditariedade. 4. Mutação. 5. Genes BRCA1. 6. Genes BRCA2. I.
Autor. II. Palmero, Edenir Inês
CDD 616.994 49
Dedicatória
Dedico este trabalho a três pessoas especiais e muito importantes em minha vida, meus pais
Fernandes Antonio Silva e Silvana Carvalho da Silva, e meu noivo Evandro Gonçalves Silva,
pela paciência e também por me ajudarem de todas as maneiras possíveis durante essa
caminhada. Que fique registrado o meu profundo agradecimento e admiração por essas
pessoas maravilhosas que fazem parte da minha vida. Dedico também esse trabalho a uma
quarta pessoa não menos amada, mesmo que não esteja entre nós sempre foi a maior
incentivadora do meu sucesso que fique aqui registrado meu eterno carinho e admiração a
minha avó Terezinha Gonçalves Carvalho que sempre esteve ao meu lado, agradeço a
paciência, as orações, o amor e o carinho que me dedicou em cada dia de sua vida.
Agradecimentos
Agradeço a Deus por sempre iluminar o meu caminho, me ajudando enfrentar cada
batalha, me proporcionando força e determinação nesta etapa tão importante de minha
vida, permitindo a realização deste objetivo tão almejado.
A minha orientadora Prof. Dra. Edenir Inêz Palmero, pela oportunidade e
credibilidade em mim depositada, e também pela dedicação e incansável empenho para o
desenvolvimento desse trabalho, agradeço também os ensinamentos e a amizade que me
dedica.
Aos meus pais Fernandes Antonio da Silva e Silvana Carvalho da Silva, maiores
incentivadores e grandes torcedores do meu sucesso, pelo que investiram em mim, pela
confiança, incentivo durante essa jornada, pelo amor, carinho, paciência, atenção e por
estarem ao meu lado em todos os momentos de alegria e dificuldades vividas nesse período.
Ao meu noivo, Evandro Gonçalves Silva, um agradecimento especial, pela paciência,
compreensão, amor, carinho, companheirismo, incentivo e por nunca deixar-me desanimar.
Aos meus irmãos Anderson Fernandes da Silva, Vinicius Carvalho Fernandes e Luis
Felipe Carvalho Silva, pelo companheirismo, incentivo, união e por toda amizade que me
dedicam.
Ao meu primo Julio Cesar de Souza, por todo apoio e incentivo.
Aos grandes amigos do Centro de Diagnóstico Molecular André, Juliana, Flavia, Thaís,
Adriane, Cristina, Aline e Deise, pelas palavras de incentivo, pelo companheirismo, carinho,
cumplicidade e amizade que me dedicam.
A grande amiga de todas as horas Allini Mafra por todos os socorros prestados fora
de hora com a análise estatística do projeto.
Ao amigo Cleyton Zanardo de Oliveira pelo suporte e auxílio nas análises estatísticas
e pela amizade.
Ao NAP (Núcleo de Apoio ao Pesquisador) por todo suporte prestado.
Ao departamento de Oncogenética pelas informações fornecidas.
Ao departamento de mastologia, em especial ao Dr. Rodrigo Michelli pela
imensurável colaboração na inclusão de pacientes.
As amigas do mestrado Allini Mafra, Camila Crovador, Paula Aguilar, Larissa Kuil,
pelos almoços de sexta e por proporcionarem momentos divertidos e agradáveis mesmo
quando estávamos com a ‘’corda no pescoço’’.
Aos pacientes agradeço pela participação voluntária.
Ao departamento de Pós Graduação (Brenda e Silvana) pela paciência e
esclarecimento de dúvidas.
Aos assessores da banca de acompanhamento Dr. Victor Evangelista e Dr. Rene
Aloisio Vieira pela dedicação e sugestões.
A todos meus amigos e familiares, não menos importantes que de alguma forma
fazem ou fizeram parte da minha vida e me auxiliaram ao longo desse dois longos anos.
“Deus não nos fez perfeitos e não escolhe os capacitados, capacita os escolhidos.”
ALBERT EINSTEIN
Sumário
1. INTRODUÇÃO
18
1.1 Câncer de Mama – Aspectos Gerais
18
1.2 Câncer de Mama – Fatores de Risco
19
1.3 Câncer de Mama Hereditário – Aspectos Gerais
19
1.4 Câncer de Mama Hereditário no Brasil
20
1.5 Câncer de Mama Hereditário – Principais Síndromes de Predisposição Hereditária
1.5.1 Síndrome de Predisposição Hereditária ao Câncer de Mama e Ovário
1.5.1.1 Aspectos Clínicos
1.5.1.2 Aspectos Moleculares
1.5.1.3 Diagnóstico Molecular
1.5.2 Síndrome de Li-Fraumeni
1.5.2.1 Síndrome de Li Fraumeni – Aspectos Moleculares
1.5.3 Síndrome de Cowden
1.5.4 Síndrome de Prediposição Hereditária ao câncer de Mama e câncer Colorretal
1.5.5 Ataxia-Telangiectasia
1.5.6 Síndrome de Peutz-Jeghers
1.5.7 Câncer Gástrico Difuso Hereditário
24
24
25
27
29
30
31
32
33
34
34
35
1.6 Câncer de Mama Hereditário – Identificação das famílias em risco
35
1.6.1 Identificação das famílias em risco – Modelos epidemiológicos para identificação das
famílias em risco
36
1.6.2 Identificação das famílias em risco – Presença de mutações germinativas em genes
de predisposição e/ou suscetibilidade ao câncer
39
1.6.3 Identificação das famílias em risco - História Familiar
39
1.6.4 Identificação das famílias em risco – Contribuição das características histopatológicas
do tumor
40
1.6.5 Identificação das famílias em risco - Polimorfismos: Modificadores Genéticos do
Risco de Câncer
42
2. JUSTIFICATIVA
45
3. OBJETIVOS
46
3.1. Objetivo Geral
46
3.2. Objetivos Específicos
46
4. MATERIAL E MÉTODOS
47
4.1 Delineamento do Estudo
47
4.2 Critérios de inclusão
47
4.3 Critérios de exclusão
48
4.4 Casuística
48
4.5 Metodologia
4.5.1 Coleta de dados clínicos e de história familiar
4.5.2. Análises Imunohistoquímicas e moleculares
50
50
50
4.6
Armazenamento dos Dados e Análise Estatística
54
4.7
Aspectos Éticos
55
4.8
Uso das Informações e Publicações
55
5. RESULTADOS
56
5.1 Caracterização Geral da Amostra
56
5.2 Caracterização do Perfil Histopatológico e Imunohistoquímico das amostras utilizadas 62
5.3 Frequência dos polimorfismos rs2981582 (gene FGFR2), rs3803662 (região contendo
TNRC9), rs889312 (região contendo MAP3K1), rs3817198 (gene LSP1) e rs13281615
70
5.4 Associação entre os polimorfismos rs3803662, rs2981582, rs13281615, rs889312 e
rs3817198 com o perfil histopatológico e imunohistoquímico do tumor e com a história
familiar de câncer
72
5.5 Identificação de indivíduos não-testados para mutações germinativas em BRCA1/2 que
poderiam se beneficiar do teste pela combinação de seus dados histopatológicos e dos
diferentes polimorfismos analisados
96
6. DISCUSSÃO
6.1.1 Grupo amostral
6.1.2 Características dos tumores
6.1.3 História pessoal e familiar de câncer
6.1.4 Polimorfismos
6.1.5 Características que influenciam na presença de mutações germinativas em
BRCA1/BRCA2
101
101
102
106
109
111
7 . CONCLUSÃO
115
8. REFERÊNCIAS BIBLIOGRÁFICAS
118
9.ANEXOS
128
Lista de figuras
Figura 1: Representação esquemática dos genes BRCA1 e BRCA2, dos seus exons 28
codificantes, proteínas e domínios funcionais.
LISTA DE TABELAS
Tabela 1: Classificação molecular.
52
Tabela 2: Detalhamento das reações de PCR realizadas.
53
Tabela 3: Caracterização geral da amostra e fatores de risco.
57
Tabela 4: Características anatomopatológicas relacionadas ao câncer de mama geral
e por grupo.
58
Tabela 5: Características da história pessoal e familiar de câncer geral e por grupo.
60
Tabela 6: Probabilidade de mutação dos tumores de mama (por grupo).
62
Tabela 7: Características imunohistoquímicas dos tumores de mama (por grupo).
63
Tabela 8: Suptipo molecular dos tumores de mama (por grupo).
64
Tabela 9: História familiar de câncer conforme subtipo molecular.
65
Tabela 10 : Relação entre Triplo Negatividade e história familiar de câncer.
66
Tabela 11 : História familiar de câncer conforme status do receptor hormonal para as
mulheres TN, por grupo.
67
Tabela 12: Características imunohistoquímicas e subtipo molecular conforme gene
mutado.
69
Tabela 13: Frequência dos polimorfismos rs3803662 no gene TNRC9, rs2981582 no
gene FGFR2, rs13281615, rs889312 no gene MAP3K1 e rs3817198 no gene LSP1, por
grupo.
71
Tabela 14 : Correlação entre frequência dos genótipos do polimorfismo rs3803662 no
gene TNRC9 e Receptores Hormonais (geral).
72
Tabela 15: Correlação entre frequência dos genótipos do polimorfismo rs3803662 no
gene TNRC9 e Receptores Hormonais (por grupo).
73
Tabela 16: Correlação entre frequência dos genótipos do polimorfismo rs2981582 no
gene FGFR2 e Receptores Hormonais (geral).
74
Tabela 17: Correlação entre frequência dos genótipos do polimorfismo rs2981582 no
gene FGFR2 e Receptores Hormonais (por grupo).
75
Tabela 18: Correlação entre frequência dos genótipos do polimorfismo rs13281615 e
Receptores Hormonais (geral).
76
Tabela 19: Correlação entre frequência dos genótipos do polimorfismo rs13281615 e
Receptores Hormonais (por grupo).
77
Tabela 20: Correlação entre frequência dos genótipos do polimorfismo rs889312 no
gene MAP3K1 e Receptores Hormonais (geral).
78
Tabela 21: Correlação entre frequência dos genótipos do polimorfismo rs889312 no
gene MAP3K1 e Receptores Hormonais (por grupo).
79
Tabela 22: Correlação entre frequência dos genótipos do polimorfismo rs3817198 no
gene LSP1 e Receptores Hormonais (geral).
80
Tabela 23: Correlação entre frequência dos genótipos do polimorfismo rs3817198 no
gene LSP1 e Receptores Hormonais (por grupo).
81
Tabela 24: Correlação entre frequência do polimorfismo rs3803662 no gene TNRC9
e a história familiar de câncer (por grupo).
84
Tabela 25: Correlação entre frequência do polimorfismo rs2981582 no gene FGFR2 e
a história familiar de câncer (por grupo).
86
Tabela 26: Correlação entre frequência do polimorfismo rs13281615 e a história
familiar de câncer (por grupo).
88
Tabela 27: Correlação entre frequência do polimorfismo rs889312 no gene MAP3K1
e a história familiar de câncer (por grupo).
90
Tabela 28: Correlação entre frequência do polimorfismo rs3817198 no gene LSP1 e a
história familiar de câncer (por grupo).
92
Tabela 29: Características de história familiar do grupo 1 versus os grupos 2, 3 e 4.
96
Tabela 30: Características histopatológicas e imunohistoquímicas do grupo 1 versus
os grupos 2, 3 e 4.
97
LISTA DE ABREVIATURAS
RCV
Risco Cumulativo Vital
RE
Receptor de Estrógeno
RP
Receptor de Progesterona
CK
Citoqueratina
SNP
Polimorfismo de Nucleotídeo Simples
TN
Triplo Negativo
INC
Inconclusivo
RR
Risco Relativo
CM
Câncer de Mama
AG
Aconselhamento Genético
NCCN Rede Nacional de Câncer
ASCO Sociedade Americana de Oncologia Clinica
VUS
Variante de Significado Clínico Desconhecido
HBOC Câncer de Mama e Ovário Hereditários
aCGH Hibrização Genômica Comparativa
MLPA Multiplex Ligation-dependent Probe Amplification
SLF
Síndrome de Li-Fraumeni
SLFL
Síndrome de Li-Fraumeni Like
FISH
Hibridização in Situ Fluorescente
HER
Fator de Crescimento Epidermal
Resumo
Justificativa: Do total de casos de câncer de mama cerca de 5-10% são causados por
mutações germinativas em genes de predisposição ao câncer. A história familiar de câncer
bem como as características histopatológicas dos tumores BRCA- associados são indicadores
importantes de risco para o câncer de mama hereditário e podem auxiliar na identificação
de indivíduos em risco. Somado a isso, trabalhos recentes identificaram polimorfismos
associados à história familiar de câncer e/ou ao tipo histológico do tumor, que conferem um
aumento na suscetibilidade ao câncer. Objetivo: Dessa forma, o presente projeto teve como
objetivo principal analisar a capacidade preditiva dessas três variantes (história familiar de
câncer, características histopatológicas do tumor e presença de polimorfismos
modificadores do risco de câncer) na identificação de mulheres com câncer de mama
hereditário em quatro grupos de mulheres, todas elas afetadas por câncer de mama.
Materiais e Métodos: As mulheres foram divididas em quatro grupos, i) mulheres com
mutação germinativa deletéria nos genes BRCA1 ou BRCA2; ii) mulheres com Variante de
Significado Clínico Desconhecido (VUS) nos genes BRCA1 e/ou BRCA2; iii) mulheres sem
mutação germinativa e VUS identificada nos genes BRCA1 e BRCA2 e, iv) mulheres com
câncer de mama esporádico e que não foram submetidas a teste genético de BRCA1/BRCA2.
Resultados: Foram incluídas no estudo 287 mulheres: 51 no grupo 1, 53 no grupo 2, 100 no
grupo 3 e 83 mulheres no grupo 4. Observamos que 51,2% das mulheres do grupo 4
possuíam idade superior a 50 anos no momento do diagnóstico (idade média 51,65)
enquanto que nos grupos 1, 2 e 3 a idade média ao diagnóstico era 41,8, 34,9 e 38,3 anos,
respectivamente. A análise imunohistoquímica mostrou que 57 mulheres eram triplonegativas (receptor de estrógeno, progesterona e HER2 negativos), sendo 24 delas do grupo
1. Dentre as 24 triplo negativas do grupo 1, 22 eram mutadas no gene BRCA1. Em relação
aos polimorfismos analisados, encontramos associação entre o SNP rs3803662 (no gene
TNRC9) e história familiar de câncer. Também verificamos associação entre o polimorfismo
rs889312 (gene MAP3K1) e presença de câncer de mama bilateral. Com relação ao SNP
rs3817198 (no gene LSP1), uma associação entre a presença do alelo T e aumento no
número de casos de câncer foi observada. Conclusão: Cabe salientar a importância de que
outros fatores, além do número de casos de câncer e da idade ao diagnóstico, sejam levados
em consideração para a identificação das famílias em risco. Além disso, dada a frequência
aumentada da triplo negatividade apenas nos casos BRCA1 mutados sugere-se que os
tumores BRCA1 e BRCA2 mutados apresentam comportamentos distintos (BRCA2 é mais
similar aos tumores esporádicos, com idades mais tardia ao diagnóstico e menor frequência
de triplo negatividade), que devem ser levados em consideração ao identificar as famílias em
risco para câncer hereditário, bem como ao definir a melhor estratégia para a realização do
teste genético para BRCA1 e BRCA2.
Palavras chaves: Câncer de mama, hereditariedade, câncer de mama triplo negativo,
mutação, BRCA1, BRCA2 .
Abstract
Background: Approximately 5-10% of all breast cancer cases are caused by germline
mutations in cancer predisposing genes. Family history of cancer and histopathological
characteristics of BRCA-associated tumors are important indicators of risk for hereditary
breast cancer, and may help in the identification of at-risk individuals. Besides, recent
studies have identified polymorphisms associated with family history of cancer and/or
histological type of tumor. These polimorphisms confer an increased susceptibility to cancer.
Objective: Thus, this project aimed to assess the predictive ability of these three variables
(family history of cancer, histopathological characteristics of the tumor and presence of
specific polimorphisms) in the identification of women with hereditary breast cancer in four
groups (all of them constituted by women with personal history of breast cancer): Material
and Methods: The women were divided into four groups, i) women with deleterious
germline mutation in BRCA1 or BRCA2 genes; ii) women with a variant of unknown
significance (VUS) in BRCA1 and/or BRCA2 genes; iii) women without germline mutation and
VUS identified in the BRCA1 and BRCA2 genes, and iv) women with sporadic breast cancer
who have not undergone genetic testing of BRCA1 / BRCA2. Results: Were included in the
study, 287 women were included: 51 in group 1, 53 in group 2, 100 in group 3 and 83 in the
“control” group. We observe that 51,2% of women in group 4 were older than 50 years at
diagnosis (mean age 51.65 years) while in groups 1, 2 and 3 the mean age at diagnosis was
41.8, 34.9 and 38.3 years, respectively. The immunohistochemical analysis showed that 57
women were triple-negative (estrogen, progesterone and HER2 receptors negative), being
24 from group 1. From these 24 women, 22 were mutated for BRCA1 gene. Regarding the
polymorphisms, an association was found between the SNP rs3803662 (in TNRC9 gene) and
a family history of cancer. We also verified an association between rs889312 polymorphism
(gene MAP3K1) and the presence of bilateral breast cancer. Regarding the SNP rs3817198
(LSP1 gene), an association between the T allele and an increased number of cancer cases
was observed. Conclusions: We should reinforce that, beside the number of cases and age at
diagnosis, other factors should be taken into account for the identification of families at-risk.
In addition, given the increased frequency of triple negativity in BRCA1 mutated cases, we
suggested that BRCA1 and BRCA2-mutated tumors behaves differently (BRCA2 is more
similar to sporadic tumors with later age at diagnosis and lower frequency of triple negative
tumors) which must be taken into consideration when identifying families at risk for
hereditary cancer, as well as to define the best strategy for genetic testing for BRCA1 and
BRCA2.
Key words: Breast cancer, heredity, triple negative breast cancer, mutation, BRCA1, BRCA2.
1. Introdução
1.1 Câncer de Mama – Aspectos Gerais
O câncer é considerado um problema de saúde pública há muito tempo em países
desenvolvidos. No entanto, aumento na incidência de câncer tem sido também observado
em países de baixa renda, especialmente na América Latina1.
Devido ao seu prognóstico relativamente bom (dados europeus apontam uma taxa
de sobrevivência de 91% no primeiro ano pós-diagnóstico e de 65% nos 5 anos
subsequentes), o câncer de mama (CM) é hoje o mais prevalente no mundo. Existem,
atualmente, em torno de 3,7 milhões de mulheres “sobreviventes” nos primeiros 5 anos
após o diagnóstico. Este é um número significativo se comparado a outros tumores, como
por exemplo, o câncer de pulmão, que registra 1,3 milhões de “sobreviventes” (homens e
mulheres) após 5 anos do diagnóstico2,3.
No entanto, no Brasil, as neoplasias da mama são a principal causa de mortalidade
por câncer entre mulheres. Conforme o Instituto Nacional de Câncer (INCA), o número de
novos casos de câncer de mama esperados em 2014 é de 57.120, com um risco estimado de
56 casos a cada 100 mil mulheres. Na região Sudeste do Brasil ocorre maior incidência entre
as mulheres com uma taxa estimada de 69 casos novos a cada 100 mil4.
Do total de casos de câncer de mama diagnosticados a cada ano, estima-se que 5%
a 10% sejam hereditários, ou seja, causados por uma alteração genética herdada que
confere a seu portador um risco de câncer significativamente maior que o da população em
geral. Os rápidos avanços em técnicas de biologia molecular nas últimas décadas resultaram
na identificação de genes que, quando alterados, aumentam significativamente o risco de
desenvolver câncer de mama, câncer de ovário e outros tumores, dentre os quais destacamse os genes supressores tumorais BRCA1 e BRCA25,6.
18
1.2 Câncer de Mama – Fatores de Risco
O Câncer de mama é uma doença multifatorial. Dentre os fatores de risco associados
encontram-se densidade da mama aumentada, história de menarca precoce (idade da
primeira menstruação) ou menopausa tardia (após os 50 anos de idade), obesidade após a
menopausa, uso de contraceptivos orais ou reposição de hormônios orais (estrogênio e
progesterona) no período pós-menopausa, nuliparidade e primeira gravidez após os 30 anos
de idade4.
Fatores genéticos também estão associados ao maior risco de desenvolvimento de
câncer de mama. Segundo o Instituto Nacional de Câncer (INCA) mulheres que apresentam
mutação germinativa nos genes BRCA1 e BRCA2 têm 85% de chance de desenvolver câncer
de mama antes dos 70 anos de idade4. Além disso, estudos apontam que o Risco Relativo
(RR) para desenvolvimento de câncer de mama para quem tem 1 familiar de primeiro grau
com câncer é de 1,25 (0,83-1,87) e de 4,79 (0,77-29,78) para quem tem 2 ou mais familiares
de primeiro grau afetados. Para aquelas pessoas com familiares de primeiro e segundo graus
com câncer, o risco varia de 4,44 (1,49-13,17) para quem tem 2 familiares a 6,14 (1,75-21,56)
para quem tem 4 familiares de primeiro ou segundo graus com CM 7.
Visando a redução do risco de câncer de mama algumas estratégias de manutenção
da saúde podem ser utilizadas, tais como realização de atividade física, diminuição da
ingestão de álcool, alimentação regular e a prática regular (conforme sexo e faixa etária) das
diferentes estratégias de detecção precoce preconizadas, tais como mamografia, exame
clínico da mama, auto-exame das mamas7.
1.3 Câncer de Mama Hereditário – Aspectos Gerais
Atualmente estima-se que 5-10% do total de casos de câncer de mama sejam
hereditários. O câncer de mama hereditário acontece no contexto de uma síndrome de
predisposição hereditária ao câncer, condição em que os indivíduos herdam um risco
aumentado para o desenvolvimento de uma ou mais neoplasias. Diversos genes já foram
descobertos e associados a um aumento no risco de desenvolvimento de câncer de mama,
19
sendo a grande maioria deles genes supressores tumorais, como por exemplo os genes
BRCA1 e BRCA25,6.
As famílias com câncer hereditário, de uma forma geral, apresentam uma ou mais
das seguintes características: i) Dois ou mais familiares diagnosticados com câncer; ii) Um
membro da família diagnosticado com câncer antes dos 50 anos de idade; iii) Vários
membros da familia afetados pelo mesmo tipo de câncer; iv) Um familiar afetado por mais
de um tipo de câncer e v) Um ou mais membros da família afetados com um câncer raro8,9.
Uma vez identificadas, essas famílias devem ser encaminhadas a programas especializados
em Genética e Câncer e uma ou mais sessões de aconselhamento genético devem ser
realizadas9. O aconselhamento genético (AG) é um processo de comunicação da
possibilidade de ocorrência de uma doença genética e, no caso do AG para câncer, é
direcionado a indivíduos e famílias com suspeita de desenvolvimento de alguma síndrome
de predisposição hereditária ao câncer. O processo de aconselhamento genético é iniciado
com a identificação de indivíduos em risco para uma síndrome de predisposição hereditária
ao câncer e posterior detalhamento da história familiar através da construção e análise do
heredograma envolvendo o máximo possível de gerações e indivíduos da família em
questão. Além da construção e avaliação detalhada do heredograma, são feitas estimativas
de risco e cálculos da probabilidade de mutação, abordagens essas fundamentais para o
manejo correto do paciente e de seus familiares9. Sempre que possível a suspeita clínica
deve ser confirmada através do teste genético9 .
1.4 Câncer de Mama Hereditário no Brasil
Embora na última década alguns serviços de Genética e Câncer tenham sido criados
no Brasil, ainda existem poucos serviços especializados em oncogenética, sendo que a
maioria deles está localizada nos hospitais universitários de algumas capitais brasileiras,
principalmente nas regiões Sul e Sudeste do Brasil10. Apesar do relativo aumento no
atendimento de oncogenética, o número atual de serviços públicos especializados que são
oferecidos à população está muito abaixo das necessidades do país11,12.
20
Trabalho realizado por Horovitz13 em 2003 mostrou que testes genéticos diagnósticos
estavam disponíveis em apenas 47 dos 66 serviços de Genética e Câncer (públicos)
existentes no Brasil. Dentre os testes oferecidos, 83% oferecem citogenética convencional,
55% citogenética de alta resolução, 36% possuem testes para erros inatos do metabolismo, e
32% realizam triagem pré natal. Apenas cerca de 50% desses laboratórios oferecem técnicas
de biologia molecular para determinados grupos de doenças incluindo retardo mental,
síndromes dismórficas, câncer hereditário, infertilidade, etc.
Conforme destacado por Penchaszadeh14 e colaboradores as principais dificuldades
relacionadas a criação e estabelecimento de centros especializados em oncogenética
residem no fato que as doenças genéticas ainda não são consideradas prioridades. Além
disso ainda existem cuidados a serem tomados em outras áreas da saúde; os serviços
genéticos são caros e voltados principalmente para doenças raras e a população não tem
consciência dos riscos e das possibilidades de prevenção.
Apesar dessas dificuldades os serviços de genética no Brasil vêm crescendo ao longo
do tempo10. Em 2014 foi implementada, pelo Ministério da Saúde, a Política para doenças
raras, que embora não contemple os tumores hereditários, pode ser um primeiro passo para
o reconhecimento da importância das doenças genéticas. Dentro do contexto da nova
portaria, um contexto de atendimento multidisciplinar foi estabelecido, no qual o médico
geneticista apresenta papel fundamental. Paralelamente ao crescimento (mesmo que lento)
dos serviços de genética, ou como uma consequência deles, estudos envolvendo famílias em
risco para câncer de mama hereditário têm surgido, conforme pode ser visto,
resumidamente, no texto abaixo 15.
Estudo realizado por Dufloth e colaboradores, avaliou a presença de mutação nos
genes BRCA1 e BRCA2 em 31 mulheres brasileiras com câncer de mama e história familiar
positiva. Dos casos testados 4 foram positivos, sendo uma mutação no gene BRCA1 e três
em BRCA2. Dessa forma a prevalência de mutação nos genes BRCA1 e BRCA2 encontrada
pelo estudo foi de 13% 16.
A prevalência de mutações em BRCA1 e BRCA2 em pacientes brasileiras com câncer
de mama também foi avaliada em estudo realizado por Gomes17 e colaboradores. Foram
incluídas no estudo 402 mulheres com câncer de mama. Do total de mulheres testadas, 9
(2,3%) eram portadoras de mutação (6 em BRCA1 e 3 em BRCA2). A mutação mais
21
frequentemente encontrada foi a mutação fundadora 5382insC no gene BRCA1 (atualmente
conhecida como c.5266dupC). O estudo sugere que um teste genético rápido e barato pode
ser desenvolvido para o rastreamento dessas mutações fundadoras que são relevantes na
população brasileira17.
Em estudo realizado em 2009 por Palmero e colaboradores18, foi avaliada a
prevalência de câncer de mama hereditário/familial e qual seria a aceitação de um programa
de avaliação de risco de câncer genético (GRCA). O trabalho teve início a partir de uma
coorte criada em 2004 em Porto Alegre chamada de Núcleo Mama – Porto Alegre (NMPOA)
composta por 9.218 mulheres com câncer de mama. Mulheres do NMPOA que foram
identificadas com alguma história familiar positiva de câncer foram encaminhadas para o
GRCA. Das 9.218 mulheres inscritas no NMPOA 1.286 relataram história familiar positiva de
câncer, e destas, 902 mulheres aceitaram ser encaminhadas para o NMPOA. Das 902
mulheres avaliadas, 214 mulheres possuíam história familiar sugestiva de predisposição
hereditária ao câncer de mama, destas 183 tinham critério para síndrome de Li-fraumeni. A
prevalência geral do fenótipo de câncer de mama hereditário foi de 6,2% (IC 95%) 18.
A prevalência da mutação fundadora c.5266dupC (gene BRCA1) foi descrita em
trabalho recente realizado por Ewald e colaboradores19 em 137 indivíduos brasileiros em
risco para síndrome de predisposição ao câncer de mama e ovário hereditários (Hereditary
Breast and Ovarian Cancer - HBOC). O estudo avaliou a prevalência de 3 mutações
fundadoras em uma população não Judaica com critérios bem definidos para HBOC. A
freqüência da mutação c.5266dupC foi de 5,2%. No entanto, quando selecionados apenas os
casos com câncer de mama bilateral, a frequência aumentou para 12,1%. As outras duas
mutações avaliadas (c.68_69del no gene BRCA1) e (c.5946del no gene BRCA2) não foram
encontradas nesse grupo amostral. Com isso o estudo conclui que a triagem para as 3
mutações fundadoras não é justificável na nossa população, mas que a avaliação da
presença da mutação c.5266dupC no gene BRCA1 deve ser levada em conta em pacientes de
alto risco devido a sua alta prevalência19.
A frequência de mutações nos genes BRCA1, BRCA2 e TP53 em mulheres jovens foi
investigada por Carraro e colaboradores20. Em estudo publicado pelos referidos autores
foram analisadas 54 mulheres com câncer de mama diagnosticado em idade inferior a 35
anos. Além do status mutacional foram analisadas as características do tumor, tais como
22
positividade/negatividade para os receptores hormonais, estrógeno, progesterona e HER2.
Mutações germinativas foram encontradas em 12 dos 54 pacientes (22%), sendo 7 mutados
em BRCA1, 4 em BRCA2 e 1 mutado em TP53. 31,4% dos pacientes testados apresentavam
história familiar positiva de câncer e, desses, 43,7% eram portadores de mutação
germinativa patogênica (37,5% em BRCA1 e 6,2% em BRCA2). O estudo demonstrou ainda
que 50% dos pacientes com receptores hormonais negativos eram portadores de mutação
em BRCA1, percentual esse que aumentava para 83% quando apenas os casos com história
familiar positiva eram considerados20.
Mais recentemente o câncer de mama e ovário hereditários foram avaliados quanto
a presença de mutações pontuais e variações no número de cópias em pacientes brasileiras
por Silva e colaboradores21. Foram avaliadas por sequenciamento e MLPA 120 pacientes com
critérios clínicos para HBOC quanto a presença de mutações germinativas nos genes,
BRCA1/BRCA2, TP53, CHEK2 1100delC. Na sequência os pacientes foram analisados quanto a
variações no número de cópias em 14 genes de suscetibilidade ao câncer de mama (PTEN,
ATM, NBN, RAD50, RAD51, BRIP1, PALB2, MLH1, MSH2, MSH6, TP53, CDKN2A, CDH1 e
CTNNB1) através de Hibrização Genômica Comparativa (aCGH). A taxa de detecção de
mutações foi de 26%. Dos 31 casos positivos, 20 eram mutados no gene BRCA1, incluindo 2
casos com variação no número de cópias, e 7 tiveram mutação identificada no gene BRCA2.
Além disso, 3 pacientes apresentavam a mutação p. Arg337His no gene TP53, e um paciente
apresentava a mutação c.1100delC em CHEK2. Os resultados do estudo mostraram uma alta
frequência de mutações em BRCA1/BRCA2, notadamente no gene BRCA1 (64,5%). Além
disso, a mutação em TP53 (Arg337His) sugere que todos os pacientes com câncer de mama
com critérios para HBOC e negativos para BRCA1/BRCA2 devem ser testados para a mutação
p.Arg337His no gene TP5321.
A prevalência da mutação p.Arg337His no gene TP53 também foi descrita em famílias
brasileiras com câncer de mama hereditário em trabalho realizado por Cury22 e
colaboradores. O estudo determinou a prevalência dessa mutação em uma população com
câncer de mama e com critério para HBOC e também em uma população saudável
(controle). Do total de casos com câncer de mama a mutação estava presente em dois casos,
e ausente em todos os controles. O trabalho sugere que o rastreamento genético para
pacientes brasileiros que preencham critério para Síndrome de Predisposição ao Câncer de
23
Mama e Ovário Hereditários e com história familiar de tumores relacionados a Síndrome de
Li-fraumeni deve iniciar pela análise da mutação p.Arg337His no gene TP5322.
Embora ainda não se tenha um claro panorama da frequência e prevalência de
mutações germinativas deletérias em toda a população Brasileira, os estudos que vem sendo
realizados e publicados nos últimos anos demonstram uma clara preocupação em modificar
esse cenário de falta de conhecimento acerca da nossa população21.
1.5 Câncer de Mama Hereditário – Principais Síndromes de Predisposição Hereditária
1.5.1 Síndrome de Predisposição Hereditária ao Câncer de Mama e Ovário
A Síndrome de Predisposição ao Câncer de Mama e Ovário Hereditários (HBOC) é
causada, principalmente, por alterações genéticas nos genes supressores tumorais BRCA1 e
BRCA25,6.
Embora existam uma série de estudos investigando o papel de outros genes na
predisposição hereditária ao câncer de mama e de ovário, não há, até o presente momento,
outros genes associados a essa síndrome que confiram um risco de câncer significativamente
aumentado como o causado pela presença de mutações nos genes BRCA1 e BRCA2 23–25.
Acredita-se que o gene BRCA1 seja responsável por cerca de 50% de todos os casos
de câncer de mama hereditário. No entanto, esse percentual depende de uma série de
fatores, como por exemplo dos tipos de tumores presentes nas famílias avaliadas26.
Portadoras de mutação germinativa no gene BRCA1 têm um risco cumulativo vital (RCV) de
desenvolver câncer de mama de 44% a 68% até os 70 anos de idade. Além disso, o RCV para
câncer de ovário nessas pacientes também é significativamente maior, e pode chegar até
60% aos 70 anos de idade26,27. Outros tumores que parecem ser mais frequentes em
portadores (as) de mutações em BRCA1 incluem o câncer de tuba uterina, o câncer de
próstata e tumor de Wilms28. Além disso, diversos estudos relatam um risco aumentado para
câncer de mama masculino associado a mutações germinativas em BRCA1, embora
represente uma associação menos frequente do que a relatada para câncer de mama
masculino e mutações germinativas no gene BRCA229,30.
24
O gene BRCA2, quando alterado, aumenta o risco de desenvolvimento de múltiplos
tumores. BRCA2 é responsável por cerca de 30% a 40% de todos os casos de câncer de
mama hereditários. O RCV para câncer de mama em mulheres portadoras de mutações
germinativas nesse gene é similar ao risco de portadoras de mutações germinativas em
BRCA1 (44% a 68% até os 70 anos de idade)28,31 enquanto que o risco para câncer de ovário
é de 15% a 30%32,33. Embora menor que o RCV para câncer de ovário associado a mutações
germinativas em BRCA1, este risco ainda é 10 vezes maior que o da população em geral34.
Homens com mutações germinativas em BRCA2 têm um RCV significativamente maior que o
da população de desenvolver câncer de mama, cerca de 6% até os 70 anos de idade, o que
representa um aumento de 80-100 vezes o risco para a população em geral33. Além de
câncer de mama e ovário, há um aumento do RCV para diversos outros tumores: tumores de
vias biliares, bexiga, esôfago, pâncreas, próstata, estômago, sistema hematopoiético,
cavidade oral e faringe, e melanoma35,36.
1.5.1.1 Aspectos Clínicos
Segundo a Sociedade Americana de Oncologia Clínica (ASCO), famílias que
apresentem um ou mais dos critérios listados abaixo são classificadas clinicamente como
portadoras da Síndrome de Predisposição Hereditária ao Câncer de Mama e Ovário e
deverão ser acompanhadas de forma adequada. Os critérios propostos pela ASCO são: 37
 Três ou mais casos de câncer de mama e um caso de câncer de ovário em qualquer
idade ou;
 Mais de três casos de câncer de mama em idade menor ou igual a 50 anos ou;
 Pares de irmãs (ou mãe e filha) com uma das seguintes combinações de tumores
diagnosticados em idade inferior a 50 anos:
- dois casos de câncer de mama ou;
- dois casos de câncer de ovário ou;
- um caso de câncer de mama mais um caso de câncer de ovário.
Além dos critérios preconizados pela ASCO, existem os critérios propostos pela NCCN
(National Comprehensive Cancer Network38, que são mais abrangentes que os propostos
pela ASCO e incluem:
25
 Família com mutação detectada em BRCA1 e BRCA2;
 História pessoal de câncer de mama associada a um ou mais dos seguintes critérios:
- diagnóstico antes dos 45 anos;
- diagnóstico antes dos 50 anos com:

segundo tumor primário;

1 ou mais familiares com câncer de mama em qualquer idade.
- diagnóstico antes dos 60 anos com:

câncer de mama triplo negativo.
- diagnóstico em qualquer idade com:

1 ou mais familiares com câncer de mama antes dos 50 anos;

2 ou mais familiares com câncer de mama em qualquer idade;

1 ou mais familiares com câncer de ovário epitelial;

2 ou mais familiares com câncer de pâncreas e/ou câncer de próstata em
qualquer idade;

1 caso de câncer de mama masculino;

ascendência étnica associada a uma alta frequência de mutações deletérias.

História pessoal de câncer de ovário do tipo epitelial.

História pessoal de câncer de mama masculino.

História pessoal de câncer de pâncreas ou próstata em qualquer idade com 2
ou mais familiares com câncer de mama e/ou ovário e/ou pâncreas ou próstata em
qualquer idade.
Com relação às estratégias de redução de risco, sabe-se que a mastectomia bilateral
profilatica é a intervenção com maior redução de risco de câncer de mama, principalmente
em mulheres com mutações em BRCA1 e BRCA239,40. Além disso a oforectomia bilateral
profilática também tem um valor significativo para a redução do risco de câncer de ovário
em mulheres mutadas, podendo reduzir em até 90% o risco de câncer de ovário e em 50% o
risco para câncer de mama41.
26
1.5.1.2 Aspectos Moleculares
O gene BRCA1 é um gene supressor tumoral localizado no cromossomo 17, composto
por 22 exons codificantes e codifica para uma proteína de 1863 aminoácidos (Figura1). A
proteína brca1 apresenta em sua estrutura uma região amino-terminal, conhecida como
dedo-de-zinco (‘’Zinc-finger’’) que é caracterizada por uma sequência de aminoácidos com
três cisteínas, uma histidina e quatro cisteínas em proximidade42,43, além de uma
variabilidade no processamento decorrente da heterogeneidade das junções intron-exon da
região 5’ do gene. Além do motivo dedo-de-zinco na região N-terminal, econtram-se, ao
longo do exon 11 dois domínios de localização nuclear. A proteína brca1 apresenta também
uma região de interação com rad51 e, na região carboxi-terminal da proteína, ocorre uma
concentração de aminoácidos de carga negativa que formam dois domínios BRCT, envolvidos
na manutenção da estabilidade da proteína brca143–47.
O supressor tumoral BRCA2 localiza-se no cromossomo 13 e é composto de 26 exons
codificantes que codificam a proteína brca2, a qual apresenta 3418 aminoácidos ao longo de
sua extensão (Figura 1). Essa proteína possui, oito repetições de 30-80 aminoácidos (domínio
BRC) no exon 11 como característica marcante, repetições essas que estão relacionadas com
a interação com a proteína rad51, a qual atua nos processos de reparo e recombinação. A
proteína brca2 apresenta, além desses domínios, uma região de ativação transcricional e
uma região adicional de interação com rad5148. A proteína brca2 juntamente com rad51,
está envolvida na manutenção da estabilidade genômica através de seu papel nos processos
de reparo de quebra das duas fitas de DNA por recombinação homóloga 49.
27
Figura 1 - Representação esquemática dos genes BRCA1 e BRCA2, dos seus exons
codificantes, proteínas e domínios funcionais.
Fonte: Palmero EI50
De uma forma geral a função de ambos os supressores tumorais (BRCA1 e BRCA2)
está relacionada a aspectos do metabolismo celular, tais como controle do ciclo celular,
reparo de danos ao DNA e regulação da expressão gênica. Alterações na função da proteína,
na transcrição e também no reparo do DNA são notadas quando mutações patogênicas são
encontradas nesses genes, podendo levar a uma instabilidade genômica, a qual está
diretamente relacionada ao desenvolvimento do câncer. Mutações nos genes BRCA1/BRCA2
conferem um risco aumento de desenvolvimento de câncer, e o acúmulo de alterações
causadas pela inativação desses genes define o destino celular, podendo levar à apoptose,
reparo dos danos sofridos ou proliferação celular descontrolada51.
Muitas similaridades são observadas entre os genes BRCA1/BRCA2: ambos codificam
proteínas extensas, possuem um primeiro exon não codificante e um central (exon 11) que
compreende mais de 60% da região codificadora. Além disso, os dois genes possuem um
28
padrão similar de regulação do ciclo celular e, uma grande heterogeneidade genética, onde a
presença de mutações germinativas ao longo de toda a extensão de ambos leva ao mesmo
fenótipo: uma predisposição aumentada para o câncer de mama e ovário. Os efeitos da
especificidade tecidual dos genes BRCA1/BRCA2 são vistos principalmente em órgãos como
mama, ovário, útero e próstata pois são órgãos hormônio-responsivos52,53.
1.5.1.3 Diagnóstico Molecular
A pesquisa de mutações germinativas em BRCA1 e BRCA2 é considerada como
laboriosa, de alta complexidade e cara. Essa dificuldade deve-se, principalmente, ao
tamanho do gene e extensa heterogeneidade molecular que a doença apresenta. Com
raríssimas excessões (ex. população de judeus Ashkenazi), os genes BRCA1 e BRCA2 não
possuem hotspots, de forma que toda a extensão de ambos os genes deve ser analisada.
Mais de 4.000 alterações pontuais e grandes rearranjos gênicos já foram descritos em ambos
os genes 54.
O padrão ouro para a detecção de mutações germinativas é o sequenciamento
bidirecional convencional (Sanger) de toda a região codificadora dos genes BRCA1 e BRCA2.
Recentemente foram desenvolvidas plataformas de nova geração para realização de
sequenciamento conhecido como NGS – Next Generation Sequencing. As plataformas NGS
são capazes de gerar informação sobre milhões de pares de bases em uma única corrida,
auxiliando de forma considerável na realização do teste genético25,55.
Com o surgimento da tecnologia associada aos sequenciadores de nova geração
(NGS), novas estratégias para o teste genético e diagnóstico molecular estão surgindo, as
quais vêm demonstrando algumas vantagens em relação à eletroforese capilar
(sequenciamento Sanger), como, por exemplo, a capacidade de gerar, com a mesma
sensibilidade e especificidade oferecidas pelo sequenciamento convencional (Sanger), vários
Megabases de informação em uma única corrida, bem como a capacidade de testar vários
pacientes em um único experimento e num curto espaço de tempo (uma semana a 10 dias).
A capacidade de multiplexar o experimento, ou seja, analisar vários genes e pacientes em
29
uma mesma “corrida” diminui o custo de realização do teste e amplia o número de
pacientes que podem ser analisados por experimento54,56–58.
De maneira complementar, realiza-se a busca por grandes rearranjos gênicos
(deleções e/ou duplicações), sendo que a principal metodologia utilizada para essa
finalidade é o MLPA (Multiplex Ligation-dependent Probe Amplification). A técnica de MPLA
é um método sensível que visa a quantificação relativa do número de moléculas
hibridizadas, a técnica descrita por Schouten59 em 2002 e posteriormente comercializada
pela empresa MRC-Holland60 (http://www.mlpa.com) é capaz de detectar quantitativamente
deleções e duplicações. A técnica é constituída de quatro fases: Denaturação, hibridização,
ligação e amplificação, onde um par de primers universais é ligado a uma sonda sequencia
específica, os quais irão amplificar de forma proporcional à quantidade de DNA presente na
amostra que está sendo analisada. Os dados gerados são comparados com de amostras
normais e, na sequencia, resultados acerca da quantidade de cada exon do gene em análise
são liberados.
1.5.2 Síndrome de Li-Fraumeni
A Síndrome de Li-Fraumeni (SLF) é uma síndrome autossômica dominante, rara, de
predisposição hereditária a vários tipos de câncer, especialmente sarcomas, câncer de
mama, tumores do sistema nervoso central e tumores adrenocorticais em idade jovem. É
uma síndrome caracterizada pela sua alta penetrância, na qual os afetados têm um risco de
cerca de 50% de desenvolver algum tipo de câncer até os 40 anos de idade comparado a 1%
na população em geral e, até os 60 anos esse risco chega a 90%61–63. A incidência dessa
síndrome é maior em mulheres devido à alta frequência de câncer de mama. A síndrome é
causada por mutações germinativas no gene supressor tumoral TP53, considerado o
“guardião do genoma” pelo seu papel central no processo de reparo de danos ao DNA, na
regulação do ciclo celular e na apoptose64,65. Indivíduos portadores de mutações no gene
TP53 tendem a desenvolver tumores em idades extremamente jovens e, além disso, os
portadores apresentam alto risco de ocorrência de múltiplos tumores primários. Visando
abranger famílias com espectro tumoral similar ao das famílias com SLF, mas que não
30
preenchiam os critérios clínicos inicialmente estabelecidos, foram propostos critérios
adicionais, denominados como Síndrome de Li Fraumeni like (LFL). Dentre esses critérios
cabe destacar os propostos por Birch, Eeles e, mais recentemente os critérios de
Chompret66–69.
1.5.2.1 Síndrome de Li Fraumeni – Aspectos Moleculares
O gene TP53 está localizado no braço curto do cromossomo 17 e é composto de
11 exons, sendo o primeiro não-codificante. A proteína p53 apresenta cinco domínios
estruturais e funcionais: a) um domínio de transativação N-terminal (região correspondente
aos aminoácidos 1 a 62); b) um domínio regulatório, rico em prolinas (aminoácidos 63 a 97);
c) um domínio central, de ligação sequência-específica ao DNA (aminoácidos 102 a 292),
domínio esse no qual estão localizadas mais de 90% das mutações somáticas e germinativas
“clássicas” já descritas no gene TP53; d) um domínio de oligomerização (aminoácidos 323 a
356), onde está localizada a mutação fundadora Brasileira p.Arg337His, e um domínio Cterminal envolvido na regulação da ligação ao DNA (aminoácidos 363 a 393) 70–73. Embora a
grande maioria das mutações já descritas no gene TP53 localizem-se entre os exons 5 a 8
(região correpondente ao domínio de ligação ao DNA), recentemente, diversos estudos têm
descrito mutações em outras regiões do gene, como por exemplo no domínio de
oligomerização (tetramerização), as quais também estão associadas ao desenvolvimento
tumoral. No Brasil, uma mutação particular no exon 10 do gene TP53 (situado na região
correspondente ao domínio de oligomerização da proteína), mais precisamente no códon
337 (c.1010G>A, p.Arg337His) vêm sendo descrita em várias famílias aparentemente nãorelacionadas. A mutação foi primeiramente identificada em crianças com carcinoma
adrenocortical da região de Curitiba, Paraná72. Conforme relatado por Ribeiro72 e
colaboradores, não havia qualquer relato de outros tipos de câncer nas 35 famílias das
crianças identificadas com a mutação p.Arg337His, sugerindo dessa forma que essa mutação
fosse tumor-específica, isto é, estivesse relacionada exclusivamente com um aumento no
risco de câncer adrenocortical, sem aumento de risco para outros tumores relacionados a
SLF/LFL72–74.
31
Posteriormente, em estudo realizado por Achatz75 e colaboradores, 45 famílias
brasileiras (das regiões Sul e Sudeste do Brasil) com critérios clínicos para LFL foram testadas
para a presença de mutações germinativas no gene TP53 e, destas, 6 (13,3%) apresentavam
a mutação descrita por Ribeiro. No entanto, diferentemente das famílias analisadas pelo
grupo de Curitiba, nas famílias descritas por Achatz o espectro tumoral referido era variado,
com famílias com e sem a presença de tumores adrenocorticais75.
Posteriormente, estudo realizado por Palmero74 e colaboradores indicou que a frequência
populacional da mutação p.Arg337His na região Sul do Brasil é de 0,3%. Os pesquisadores
analisaram a frequência da mutação em um grupo de 750 mulheres assintomáticas, com
idade entre 40 e 69 anos, que realizavam rastreamento mamográfico e a mesma foi
detectada em 2 das 750 participantes (frequência alélica de 0,0015). Esse dado de
frequência populacional foi corroborado por uma estimativa recente feita em recémnascidos do estado do Paraná, região Sul do Brasil, que também aponta para uma frequência
populacional da mutação p.Arg337His de 0,3% 71.
Considerando a elevada frequência dessa mutação nas regiões Sul e Sudeste do Brasil, a
presença de um efeito fundador foi investigada por vários pesquisadores. Trabalho realizado
por Garritano76 e colaboradores utilizando um painel de 29 Tag SNPs demonstrou que todos
os portadores da mutação p.Arg337His analisados possuíam o mesmo haplótipo, e que a
mutação estava segregando no mesmo alelo. Ainda, conforme os autores, a probabilidade
de que esta mutação tenha surgido de forma independente em todos os casos analisados é
de 3,1x10-9 comprovando desta forma a presença do efeito fundador e provendo um raro
exemplo de persistência de uma mutação deletéria em uma população miscigenada como a
Brasileira76.
1.5.3 Síndrome de Cowden
A síndrome de Cowden é uma doença genética de herança autossômica dominante,
causada por mutações no gene PTEN. O gene PTEN é um supressor tumoral constituído por
9 exons, está localizado no braço longo do cromossomo 10 e codifica para uma tirosina
fosfatase que atua na manutenção do controle de proliferação celular 77.
32
Aproximadamente 30% das mulheres portadoras de mutação no gene PTEN
desenvolvem câncer de mama (risco cumulativo vital de 25 a 50% na segunda década de
vida). Outros tumores frequentemente diagnosticados em mulheres com mutação nesse
gene são: adenocarcinoma de endométrio e carcinomas de tireóide. Além disso há uma
maior predisposição para doenças malignas da tireóide e para lesões cutâneas tais como
triquilemonas, fibromas, papilomas e queratoses. Cerca de 99% dos indivíduos portadores
de mutações germinativas no gene PTEN apresentam alguma manifestação até a terceira
década de vida77,78.
1.5.4 Síndrome de Prediposição Hereditária ao câncer de Mama e câncer Colorretal
A síndrome de predisposição hereditária aos cânceres de mama e cólon foi descrita
por Meijers-Heijboer79 e colaboradores em 2003, e se caracteriza pela presença de uma
deleção de base única no gene CHEK2 na posição 1100delC. Famílias com essa alteração
apresentam uma predisposição aumentada para o desenvolvimento de câncer de mama e
câncer colorretal e essa famílias não apresentam mutações nos genes relacionados a
síndrome de Lynch ou em BRCA1/BRCA279. Estudos descrevem que mulheres portadoras da
mutação CHEK2 1100 delC tem risco duas vezes maior de desenvolver um segundo câncer de
mama e menor tempo de sobrevida livre de recorrência. Além disso a presença dessa
mutação está associada a um risco três a cinco vezes maior para o desenvolvimento de
câncer de mama 79–81.
O gene CHEK2 é um gene supressor de tumor de baixa penetrância composto de 15
éxons localizado no braço longo do cromossomo 22. O CHEK2 codifica uma proteína quinase
envolvida no controle dos pontos de checagem do ciclo celular. A deleção da Citosina na
posição 1100 no exon 10 do gene CHEK2 resulta na introdução de um codon de parada na
posição 380 e consequente perda da atividade quinase da proteína 79–81.
33
1.5.5 Ataxia-Telangiectasia
A Ataxia-Telangiectasia é um doença com padrão de herança autossômico recessivo
caracterizada por ataxia cerebelar na infância associada à coreoatetose, disartria,
anormalidades no movimento ocular, deterioração neurológica progressiva, telangiectasias
faciais e conjuntivais, imunodeficiência e hiperpigmentação da mácula. A síndrome está
associada a mutações no gene ATM. Indivíduos portadores de mutação no gene ATM têm
uma extrema sensibilidade à radiação ionizante, e um consequente aumento no risco de
desenvolvimento de múltiplos tumores, principalmente leucemias e linfomas (80% dos
casos). Outros tumores descritos em associação com a síndrome incluem câncer de mama,
melanoma,
meduloblastoma,
glioma,
meningioma,
carcinoma
basocelular,
hepatocarcinoma, disgerminoma de ovário e leiomioma uterino. Homens adultos, têm um
aumento de 70% no risco de câncer gástrico. Apesar de ser uma síndrome autossômica
recessiva, mulheres heterozigotas apresentam risco significativamente aumentado para
câncer de mama em relação às homozigotas para o aleno normal82,83.
O gene ATM está localizado no braço longo do cromossomo 11, possui 63 exons e
está envolvido principalmente na resposta celular a danos ao DNA83.
1.5.6 Síndrome de Peutz-Jeghers
A Síndrome de Peutz-Jeghers é caracterizada pela associação de pólipos
gastrointestinais e a presença de pigmentação mucocutânea. Os pólipos hamartomatosos
são mais comuns no intestino delgado, mas também podem ocorrer no estômago e intestino
grosso. A hiperpigmentação mucocutânea apresenta-se como máculas azuladas a castanho
escuro em torno da boca, mucosa oral, olhos, dedos e região perianal 84.
A síndrome é transmitida com padrão de herança autossômico dominante e está
associada a mutações germinativas no gene STK11 (LKB1). Portadores de mutações têm um
risco cumulativo vital aumentado para câncer colorretal, gástrico, pancreático, mamário e
ovariano. Os homens podem ocasionalmente desenvolver tumor de células de Sertoli
calcificante, associado a ginecomastia. O diagnóstico é baseado nos achados clínicos.
34
Naqueles com fenótipo clássico, o resultado molecular é positivo para mutações no gene
STK11 em 100% dos casos. Nos casos sem história familiar, mutações são encontradas em
até 90% dos casos84.
O gene STK11 é um supressor tumoral constituído por 10 exons, localizado no braço
curto do cromossomo 19. Codifica uma proteína quinase envolvida em interações entre
proteínas e na apoptose85.
1.5.7 Câncer Gástrico Difuso Hereditário
A síndrome de câncer gástrico difuso hereditário é uma síndrome com padrão de
herança autossômica dominante e está associada a presença de mutações germinativas no
gene CDH1, o qual codifica a molécula de adesão celular E-caderina. Mutações neste gene
têm sido descritas em 30%-50% das famílias com a síndrome. Os critérios para o diagnóstico
clínico foram estabelecidos pelo International Gastric Cancer Consortium. Em indivíduos
afetados, a maioria dos diagnósticos de câncer gástrico é feita antes dos 40 anos de idade. O
risco cumulativo vital de desenvolver esse tumor é de 67% em homens e 83% em mulheres.
Mulheres afetadas têm um risco cumulativo vital de 40% de desenvolver carcinoma lobular
de mama86,87.
O gene CDH1 é um gene supressor tumoral localizado no braço longo do
cromossomo 16 e apresenta 16 exons. A proteína por ele codificada (e-caderina) é uma
glicoproteína de adesão célula-célula que é cálcio-dependente, composta de cinco
repetições caderina extracelulares, uma região transmembrana e uma cauda citoplasmática
altamente conservada. A perda de função desse gene está relacionada com aumento da
proliferação e invasão celular e metástase88.
1.6 Câncer de Mama Hereditário – Identificação das famílias em risco
A possibilidade de identificar famílias de risco elevado para o desenvolvimento de
câncer torna possível o emprego de uma abordagem preventiva e de detecção precoce do
35
câncer. Os indivíduos considerados de alto risco devem ser encaminhados para o
aconselhamento genético, onde a hipótese diagnóstica pode ser confirmada bem como
informações sobre a doença, sua forma de herança, estratégias de redução de risco e as
chances de recorrência para outros familiares podem ser transmitidas e discutidas.
A identificação de indivíduos/famílias em risco para câncer hereditário é importante
por várias razões. Primeiro, porque indivíduos afetados apresentam RCV muito superior ao
da população para vários tipos de câncer. Segundo, porque outros familiares de um
indivíduo afetado podem estar em risco para o câncer hereditário. Terceiro, porque medidas
de
rastreamento
intensivo
e
intervenções
preventivas
(cirurgias
profiláticas
e
quimioprofilaxia) se mostram eficazes em reduzir significativamente o risco de câncer em
portadores de mutação. 89–91. No caso da predisposição hereditária ao câncer de mama, que
é uma doença de início na vida adulta, o diagnóstico pré-sintomático de um indivíduo
afetado tem um enorme potencial para redução do risco de câncer. Por outro lado, a
identificação precisa de um indivíduo não-afetado em uma família de risco permite
tranquilizar o indivíduo e elimina os gastos e complicações de rastreamento e intervenções
preventivas desnecessárias92,93.
1.6.1 Identificação das famílias em risco – Modelos epidemiológicos para identificação das
famílias em risco
Alguns modelos estatísticos foram criados para estimar o risco de câncer de mama
ao longo da vida e também auxiliar na decisão de medidas de rastreamento e prevenção
primária para pacientes assintomáticos. Para a maioria dos modelos a história familiar de
câncer é o fator mais importante no cálculo desse risco. Alguns modelos levam em
consideração fatores de risco pessoal associados, como Índice de Massa Corporal (IMC),
idade da menarca e menopausa, uso de terapias de reposição hormonal, etnia e patologias
mamárias prévias.
O modelo de GAIL94 é um dos modelos criados para estimar o risco atual (em 5
anos) e o risco cumulativo vital (até 90 anos de idade) de desenvolver câncer de mama,
considerando para isso o número de familiares de primeiro grau diagnosticados com câncer
36
de mama, além de fatores como idade atual da mulher, idade na primeira menstruação,
idade ao nascimento do primeiro filho, realização de biópsias prévias, etnia, história prévia
de carcinomal ductal ou lobular in situ. A exemplo de outros modelos, o modelo de Gail
também apresenta suas limitações, já que considera apenas os casos de câncer de mama em
primeiro grau, enquanto outros tipos de câncer e grau de parentesco são negligenciados.
Além disso a idade ao diagnóstico não é levada em consideração para o cálculo do risco de
desenvolvimento do câncer de mama94,95.
Outro modelo muito utilizado para estimar o risco de desenvolvimento de câncer
de mama ao longo da vida é o modelo de CLAUS96, criado para estimar o risco cumulativo
em diversas faixas etárias, considerando a idade ao diagnóstico e o número de familiares de
primeiro e segundo grau afetados com câncer de mama. O modelo de CLAUS considera de
uma forma mais completa a história familiar, porém, não inclui em sua estimativa de risco a
presença de câncer de mama bilateral, ovário e câncer de mama masculino96.
Além dos modelos para estimativa de risco de desenvolvimento de câncer ao longo
da vida, existe uma série de modelos desenvolvidos para estimativa da probabilidade de
mutação em genes de predisposição hereditária. No caso dos genes BRCA1 e BRCA2, vários
modelos para estimativa da probabilidade de mutação encontram-se disponíveis na
literatura e auxiliam na indicação do teste molecular para confirmação da suspeita clínica.
Dentre os diversos modelos existentes cabe destacar o modelo desenvolvido pela
Universidade da Pensilvânia, chamado de “modelo de Couch” seguido do “Couch
modificado”97,98, o modelo desenvolvido por Shattuck-Eidens ou “Myriad I”
99
, e o “Myriad
II”, que é uma extensão do previamente utilizado Myriad I100 . Além disso, existem ainda os
modelos “BRCAPRO”100,101, o “escore de Manchester” desenvolvido por Evans e
colaboradores102–104 e o BOADICEA, proposto por Antoniou e colaboradores105,106. Além da
diversidade de modelos existentes, há também uma grande diversidade no ponto de corte
utilizado pelos diversos centros que realizam os testes genéticos para os genes BRCA1 e
BRCA2, sendo que alguns centros estabelecem como ponto de corte uma probabilidade
mínima de 10% enquanto outros usam um limiar mínimo de 20% como ponto de corte para
selecionar os indivíduos que serão submetidos ao teste genético107,108.
Cada um dos modelos epidemiológicos acima listados apresenta suas vantagens e
limitações determinadas pelo método, tamanho e tipo da população utilizada para criar o
37
modelo. Dentre as limitações encontradas, está o fato de alguns modelos desconsiderarem a
presença de câncer de mama bilateral, ou ainda a presença na família de casos de câncer de
próstata ou pâncreas (no caso das tabelas de prevalência de mutação Myriad, por exemplo),
previamente associados na literatura a mutações em genes BRCA. Essas informações por
outro lado, são incorporadas no cálculo de probabilidade do modelo de Couch modificado
(Penn II). Uma ressalva importante a ser considerada é que também não há nenhum estudo
de validação destes modelos em mulheres brasileira. Para que estes modelos sejam
realmente considerados aplicáveis à nossa população, a qual é altamente miscigenada,
estudos maiores, com avaliação clínica e molecular completa de famílias com critérios
clínicos para a Síndrome de Predisposição Hereditária ao Câncer de Mama e Ovário terão
que ser conduzidos.
Uma dificuldade adicional na estimativa da probabilidade de mutação é a estrutura
familiar limitada de muitos pacientes, com muitos familiares já falecidos há vários anos,
número reduzido de mulheres em algumas gerações e a baixa penetrância dessas alterações
em homens. Estudo realizado por Weitzel109 e colaboradores definiu como tendo estrutura
limitada aquelas famílias com menos de duas mulheres aparentadas em primeiro ou
segundo graus com idade superior a 45 anos em ambas as linhagens, materna e paterna, de
um caso índice. O estudo relatado por Weitzel e colaboradores incluiu análise dos genes
BRCA1 e BRCA2 em 261 mulheres com câncer de mama antes dos 50 anos de idade e sem
história familiar (primeiro e segundo graus) de câncer. Destas, 50% pertenciam a famílias
com estrutura limitada. Alterações germinativas em BRCA1 ou BRCA2 foram detectadas em
13,7% das pacientes provenientes de famílias com estrutura limitada e em 5,2% daquelas
com estrutura adequada. Após comparação da probabilidade de mutação obtida a partir de
diferentes modelos disponíveis na literatura com a taxa de mutações detectada pelo
sequenciamento dos genes, os autores verificaram a insensibilidade dos diferentes modelos
à presença de uma estrutura familiar limitada109.
Outra limitação que concerne à grande maioria dos modelos atualmente disponíveis
para a estimativa da probabilidade de mutação nos genes BRCA refere-se ao fato de que as
características histopatológicas dos tumores BRCA-associados não são levadas em
consideração (o modelo de Manchester foi apenas recentemente revisado para a
38
incorporação dos dados histopatológicos no escore final que fornece a estimativa da
probabilidade de mutação).
1.6.2 Identificação das famílias em risco – Presença de mutações germinativas em genes de
predisposição e/ou suscetibilidade ao câncer
Existem, atualmente mais de 30 loci gênicos associados à suscetibilidade ao câncer de
mama. Dentre esses, conforme mencionado previamente, destacam-se os genes supressores
tumorais BRCA1 e BRCA2, os quais conferem aos portadores de alterações germinativas, um
risco extremamente elevado para o desenvolvimento de câncer de mama e ovário 20,21,25,110.
Além dos genes BRCA1/BRCA2, outros genes tais como TP53, PTEN, STK11 e CDH1 estão
associados a um alto risco de desenvolvimento de câncer de mama, provavelmente pelo fato
de que, nas síndromes em que estão envolvidos, o tumor de mama faz parte do espectro
tumoral. Além dos genes associados a um risco elevado de desenvolvimento de câncer de
mama, existe um grupo associado a um risco moderado, estando esses genes envolvidos
principalmente em vias de reparo de danos ao DNA, tais como ATM, CHEK2, BRIP1, PALB2,
NBS1, RAD51C. Algumas dessas variantes são bastante comuns, com frequências alélicas de
até 1%. E, por último, existem cerca de 20 genes de baixo risco (RR entre 1,1 e 1,3), cuja
frequência do menor alelo pode ser de até 5%, e que coletivamente ocasionam um pequeno
aumento na suscetibilidade ao câncer de mama111,112.
1.6.3 Identificação das famílias em risco - História Familiar
A história familiar de câncer de mama e ovário aumento o risco para estes tipos de
câncer. Mulheres com pelo menos um familiar de primeiro grau com câncer de mama tem
um risco de 2 a 4 vezes de desenvolver câncer de mama. Fatores como aumento no número
de familiares afetados e idade jovem ao diagnóstico aumentam o risco 113.
A identificação de pacientes com risco aumentado começa pela obtenção da histrória
familiar detalhada e precisa, auxliando assim, a determinar o risco 113. Pacientes com
39
aumento no risco de câncer de mama por causa da história familiar devem ser informados e
instruídos quanto aos planos de sobrevida. Idealmente, mulheres com história familiar de
câncer de mama e ovário devem ser referidas para aconselhamento genético e se julgadas
apropriadas, deve-se oferecer o teste genético114.
O teste genético muitas vezes começa por uma pessoa afetada, se a mutação é
identificada em uma pessoa afetada, o teste genético para uma mutação específica pode ser
oferecido para outras pessoas da família (baseado em um padrão autossômico dominante os
filhos de um portador terá 50% de chance de portar a mesma mutação)9.
1.6.4 Identificação das famílias em risco – Contribuição das características histopatológicas
do tumor
Além da história familiar, características histopatológicas dos tumores estão
intrinsecamente relacionadas com o câncer de mama hereditário. Indivíduos com mutações
germinativas no gene BRCA1 apresentam um excesso de carcinomas mamários ductais do
tipo medular. Em trabalho realizado por Meyer e colaboradores115 o carcinoma do tipo
medular foi avaliado quanto às suas características mamográficas e ultrasonográficas, e os
autores afirmam que, embora o carcinoma medular apresente marcadores biológicos
compatíveis com alta agressividade ele apresenta um prognóstico intermediário e apesar de
raro na população geral, é encontrado com relativa freqüência em pacientes de alto rsico 115.
Além disso, estudo realizado por Young e colaboradores destacou que mulheres com câncer
de mama triplo-negativo (com negatividade para os receptores hormonais estrógeno (ER) e
progesterona (PR), bem como ausência de amplificação do gene HER2) e diagnosticadas em
idade precoce são candidatas a realização do teste genético para BRCA1, mesmo que não
apresentem história familiar de câncer de mama ou ovário116.
De forma similar ao proposto por Young, diversos estudos apontam para um excesso
de tumores triplo-negativos dentre os pacientes com mutações germinativas no gene
BRCA1117,118. Além disso, tumores associados a BRCA1 expressam normalmente um ou mais
dos marcadores “basais” como citoqueratina 5/6 (CK5/6), 14 (CK14), EGFR, SMA, P-caderina,
caveolina 1. Outro marcador associado à presença de mutações germinativas em BRCA1 é o
40
Ki67, que é um marcador de proliferação celular. Estudos sugerem que a presença de um
Ki67 com expressão superior a 25% é um indicativo da presença de mutações germinativas
em BRCA1119.
Através da utilização única e exclusiva de dados histomorfológicos para classificar
tumores, Liderau120 e colaboradores, bem como Chang121 e colaboradores, utilizando como
amostra indivíduos da população em geral com câncer de mama jovem, independentemente
da história familiar, identificaram mutações germinativas em BRCA1 em 29,6% e 25%
respectivamente. No entanto quando dados da história familiar de câncer foram
incorporados aos modelos, a taxa de detecção de mutações aumentou para 53%.
Outro estudo interessante, realizado por Farshid122 e colaboradores demonstrou que,
utilizando apenas dados histopatológicos, independente da informação clínica ou da história
familiar de câncer, conseguiu-se identificar os tumores associados a mutações germinativas
em BRCA1 com uma sensibilidade de 92% e uma especificidade de 86%. Dessa forma podese concluir que as características morfológicas, a tripla negatividade para os receptores
hormonais, assim como um tumor do tipo “basal-like”(estrógeno negativo, progesterona
negativo, HER-2 negativo, receptor de citoqueratina 5/6 e/ou CK14 positivo e/ou EGFR
positivo) são altamente preditivos para a presença de mutações germinativas em BRCA1.
Em consonância com o acima exposto, estudos apontam que, para o caso hipotético
de uma mulher de 30 anos de idade, a probabilidade de possuir uma mutação germinativa
no gene BRCA1 aumenta em 10 vezes se a paciente for triplo-negativa e, além disso,
apresentar positividade para os marcadores CK5/6 e CK14104. Sendo assim, a incorporação
de dados referentes à patologia do tumor do probando ou de membros da família pode
resultar num aumento da capacidade de distinguir entre indivíduos portadores de mutações
germinativas em BRCA1, BRCA2 daqueles com câncer de mama esporádico ou que ocorrem
por alteração em um supostamente existente gene BRCAX, auxiliando dessa forma na
identificação de indivíduos que melhor se beneficiariam do teste genético de predisposição
ao câncer.
Tendo como referência os receptores hormonais ER, PR, HER2, Ki67 e as
citoqueratinas 5/6, 14 ou ainda EGRF, o câncer de mama vêm sendo classificado em cinco
subtipos distintos: 1) luminal A (ER positivo e/ou PR positivo, HER-2 negativo e Ki-67 <14%),
2) luminal B- her-2 negativo (ER positivo e/ou PR positivo, HER-2 negativo e Ki-67 >14%),
41
luminal B- her-2 positivo (ER positivo e/ou PR positivo, HER-2 positivo e qualquer resultado
de Ki-67), 3) HER-2 ou “HER-2 super expresso” (ER negativo, PR negativo, HER-2 positivo), 4)
basal-like (ER negativo, PR negativo, HER-2 negativo, receptor de citoqueratina 5/6 positiva
e/ou CK14 positivo e/ou EGFR positivo)123.
Diferenças clínicas também são observadas entre os diferentes subtipos moleculares
e tem sido descritas na literatura. Em estudo realizado por Carey124 e colaboradores foi
analisada a sobrevida em cinco anos para pacientes apresentando os diferentes subtipos
moleculares e, a taxa de sobrevida das mulheres do subtipo luminal A foi de 65-94%, para as
luminal B 83-92%, para os casos com superexpressão de HER-2 a taxa de sobrevida foi de 3971%, e por fim o subtipo basal-like teve taxa de sobrevida de 51-93%. Adicionalmente,
aquelas com câncer de mama do tipo ‘’normal’’ tiveram uma sobrevida entre 44-91%124.
Cabe destacar que aproximadamente 70% dos tumores triplo-negativos são do subtipo
basal-like dentre as mulheres portadoras de mutação em BRCA125.
1.6.5 Identificação das famílias em risco - Polimorfismos: Modificadores Genéticos do
Risco de Câncer
Outro fator de risco importante e que merece ser abordado refere-se à presença de
modificadores genéticos do risco de câncer, tais como polimorfismos, os quais quando
associados a um determinado padrão morfológico podem levar a um aumento no risco de
desenvolvimento do câncer de mama. Dados provenientes de um estudo de associação
realizado por Easton126 e colaboradores envolvendo genotipagem em larga escala em 4.398
casos (mulheres com câncer de mama) e 4.316 controles, seguido de uma etapa de
validação que envolveu 21.860 casos e 22.578 controles identificou polimorfismos de base
única (SNPs) em 5 “loci” associados com risco de desenvolvimento de câncer de mama: 1)
rs2981582 no gene FGFR2, o qual codifica para um receptor de tirosina quinase que atua no
desenvolvimento da glândula mamária; 2) rs3803662 localizado numa região contendo
TNRC9 (também conhecido como TOX3); 3) rs889312 localizado numa região contendo
MAP3K1 além de dois genes hipotéticos, o MGC33648 e o MIER3; 4) rs3817198 no gene
LSP1; e, 5) o SNP rs13281615 o qual está situado em uma região que não contém nenhum
42
gene conhecido (8q24), mas na qual já foram detectadas variantes associadas a risco
aumentado para câncer de próstata e câncer colorretal. Os autores puderam correlacionar a
presença de variantes nas regiões supramencionadas a características histopatológicas como
positividade ou negatividade para os receptores hormonais estrógeno e progesterona, grau
de desenvolvimento do tumor, presença de nódulos, tamanho, histologia e estágio ao
diagnóstico. Dentre os 5 SNPs acima referidos, 3 (rs2981582 em FGFR2, rs3803662 em
TNRC9 e rs889312 em MAP3K1) foram significativamente associados a risco aumentado de
câncer de mama em indivíduos receptores de estrógeno. Mulheres homozigotas para o SNP
rs3803662 e tumores estrógeno-negativos apresentavam um risco 1,28 (95%CI = 1.13–1.45)
vezes maior de desenvolver câncer de mama do que mulheres homozigotas para o alelo
“selvagem” presente em 53% dos controles)126,127.
Além disso, trabalho publicado por Gorodnova128 e colaboradores demonstrou
evidência de associação entre os polimorfismos rs2981582 (P=0.02), rs3803662 (P=0.03) e
rs13281615 (P=0.05) e presença de história familiar positiva de câncer de mama, sendo os
alelos variantes mais frequentemente encontrado em mulheres com familiares de primeiro
grau afetados por câncer quando comparados com mulheres com história pessoal de câncer
de mama, porém com ausência de história familiar para câncer. Outro fato interessante
ressaltado pelo mesmo grupo de pesquisadores foi a associação detectada entre a presença
do SNP rs2981582 e frequência de câncer de mama bilateral. As associações encontradas
são de magnitude similar às já descritas para variantes nos genes CHEK2 e ATM.
Mais recentemente uma revisão de literatura envolvendo esses mesmos
polimorfismos foi desenvolvida por Fanale129 e colaboradores, onde, após avaliação de
estudos de associação envolvendo todo o genoma (GWAS) em câncer de mama observaram
que alguns polimorfismos (SNPs) em cinco genes estavam associados ao desenvolvimento de
câncer de mama: TNRC9, FGFR2, MAP3K1, H19 e LSP1. O SNP mais fortemente associado ao
câncer de mama (rs29811582) está localizado no gene FGFR2, que está amplificado ou super
expresso em 5-10% dos casos de câncer de mama. O SNP rs3803662 no gene TNRC9 mostra
uma associação mais forte com câncer de mama, e parece estar correlacionado com a
presença de metástases ósseas. O SNP rs889312 no gene MAP3K1 mostrou uma associação
com o risco aumento de câncer de mama somente em portadores de mutação no gene
BRCA2, não estando associada com um risco aumentado em portadores de mutação em
43
BRCA1. O SNP rs3817198 em LSP1 foi associado com aumento do risco de desenvolvimento
de câncer de mama em portadores de mutação em BRCA2. O estudo destaca, por fim, a
importância da identificação dos polimorfismos e da sua associação com a doença, bem
como o papel que podem desempenhar para uma melhor compreensão do mecanismo
biológico do câncer de mama, o que pode contribuir para uma melhora na prevenção,
detecção e tratamento precoce da doença129.
Tendo em mente os fatores acima expostos, pretendemos, no presente estudo,
avaliar o impacto de uma história familiar positiva para câncer, de fatores
imunohistoquímicos e histopatológicos, bem como a presença de modificadores genéticos do
risco de câncer na identificação de indivíduos com predisposição hereditária ao câncer de
mama por mutações germinativas nos genes BRCA1 e/ou BRCA2.
44
2. Justificativa
Considerando a alta incidência e prevalência do câncer de mama no Brasil, o fato de
que em torno de 10% desses tumores são causados por alterações germinativas em genes de
predisposição hereditária ao câncer e, a importância de identificar esses indivíduos em risco
pelo potencial de prevenção existente, justifica-se a realização do teste genético para a
identificação de mutações germinativas nos genes BRCA1/BRCA2. No entanto, considerando a
complexidade dos genes envolvidos e o alto custo para a realização do teste genético, assim
como o possível impacto psicológico decorrente do teste, o mesmo não pode ser oferecido
sem distinção a todos os indivíduos com história pessoal de câncer de mama ou de ovário.
Dessa forma, o presente estudo pretende realizar uma ampla caracterização de um grupo
amostral em risco para e/ou com câncer de mama hereditário de forma a compreender o
impacto da história familiar de câncer, das características histopatológicas do tumor assim
como de modificadores genéticos do risco de câncer na identificação de pacientes com câncer
de mama hereditário. Acreditamos que o somatório de fatores relacionados à história familiar
de câncer, padrão histopatológico dos tumores e presença de modificadores genéticos do
risco de câncer (polimorfismos) permitirão uma pré-seleção mais acurada de indivíduos que
melhor se beneficiarão do teste genético de predisposição ao câncer.
45
3. Objetivos
3.1. Objetivo Geral
Verificar a presença de história familiar positiva de câncer, características
histopatológicas e imunohistoquímicas dos tumores mamários, bem como a presença de
polimorfismos modificadores do risco de câncer de mama e sua associação com a presença
de mutação germinativa nos genes BRCA1 ou BRCA2 em mulheres com câncer de mama
hereditário.
3.2. Objetivos Específicos
I) Caracterizar um grupo de mulheres com câncer de mama hereditário e/ou em
risco para câncer de mama hereditário quanto a fatores de risco para câncer de mama
(história pessoal e familiar de câncer, exposição hormonal) e quanto a probabilidade de
mutação nos genes BRCA1 e BRCA2);
II) Caracterizar o perfil histopatológico e imunohistoquímico (quanto aos receptores
de Estrógeno, Progesterona, HER2, citoqueratina 5/6, citoqueratina 14 e Ki67) em amostras
tumorais emblocadas em parafina, de mulheres com e sem mutação nos genes BRCA1 e
BRCA2;
III) Avaliar a frequência dos polimorfismos rs2981582 no gene FGFR2; rs3803662
localizado numa região contendo TNRC9; rs889312 localizado numa região contendo
MAP3K1; rs3817198 no gene LSP1; e, rs13281615 em mulheres com câncer de mama com e
sem mutação nos genes BRCA1 e BRCA2;
IV) Correlacionar a frequência dos diferentes polimorfismos com o perfil
histopatológico e imunohistoquímico do tumor e com a história familiar de câncer;
V) Estimar o número de indivíduos não-testados para mutações germinativas em
BRCA1/BRCA2 que poderiam se beneficiar do teste pela combinação de seus dados
histopatológicos e da história familiar de câncer.
46
4. Material e Métodos
4.1 Delineamento do Estudo
Parte
I:
Estudo
de
coorte
retrospectivo
de
análise
de
marcadores
imunohistoquímicos em material biológico já existente (blocos de parafina armazenados
junto ao Setor de Anatomia Patológica do Hospital de Câncer de Barretos). Os materiais
biológicos selecionados conforme critérios de inclusão foram alocados aos grupos de
pesquisa, conforme descrito abaixo (item 4.4 Casuística).
Parte II: Estudo de coorte retrospectivo da frequência de polimorfismos genéticos
em material biológico já existente (DNA extraído de sangue periférico e analisado para a
presença de mutações pontuais e rearranjos nos genes BRCA1 e BRCA2 junto ao Centro de
Diagnóstico Molecular do Hospital de Câncer de Barretos). Os materiais biológicos
selecionados conforme critérios de inclusão foram alocados aos grupos de pesquisa,
conforme descrito abaixo (item 4.4 Casuística).
Ainda na parte II do presente estudo, no que concerne às mulheres alocadas ao
Grupo 4 (mulheres com história pessoal de câncer de mama porém que não apresentam
critérios para teste genético), a coleta de material biológico foi feita de forma prospectiva,
após o preenchimento do Termo de Consentimento Livre e Esclarecido (TCLE) para a coleta
de sangue e participação no estudo (Ver anexo 1).
4.2 Critérios de inclusão
 História pessoal de câncer de mama;
 Ter realizado sessão de aconselhamento genético (grupos 1, 2 e 3) para realização de
teste genético para os genes BRCA1/BRCA2 e assinado TCLE específico do
departamento (anexo 2);
 Presença de câncer de mama supostamente esporádico (grupo 4);
47
 Voluntariedade em participar do estudo (manifestada através do preenchimento do
TCLE, grupos 1, 2, 3 e 4);
 Probabilidade de mutação nos genes BRCA1/BRCA2 (estimada pela tabela de
prevalência de mutação Myriad) <5% (grupo 4);
 Ausência de história pessoal e familiar de câncer de ovário (grupo 4);
 Ausência de história pessoal e familiar de câncer de mama <40 anos (grupo 4).
4.3 Critérios de exclusão
 Pacientes que não possuem bloco de parafina na Instituição ou cujo bloco de
parafina não apresente tecido tumoral, ou ainda aqueles cuja utilização do materail
biológico remanescente possa comprometer futuros testes/retestes diagnósticos;
 Pacientes portadoras de mutação germinativa, mas com história pessoal de câncer
de ovário.
4.4 Casuística
Tratam-se de grupos amostrais de conveniência, nos quais o material biológico
(material tumoral emblocado parafina e DNA extraído a partir de sangue periférico) era
proveniente de mulheres com as seguintes características:
Grupo 1: 51 mulheres com história pessoal e familiar de câncer de mama com
mutação germinativa patogênica identificada nos genes BRCA1 e/ou BRCA2;
Grupo 2: 53 mulheres com história pessoal e familiar de câncer de mama com
presença de Variante de Significado Clínico Desconhecido (VUS) identificada nos genes
BRCA1 e/ou BRCA2;
48
Grupo 3: 100 mulheres com história pessoal e familiar de câncer de mama sem
mutação patogênica e/ou de significado clínico desconhecido identificada nos genes BRCA1
e/ou BRCA2;
Grupo 4: 83 mulheres com história pessoal de câncer de mama, não selecionadas
pela história familiar de câncer e que não realizaram o teste genético para análise de
mutações nos genes BRCA1 e/ou BRCA2.
As mulheres pertencentes aos grupos 1, 2 e 3 foram selecionadas junto ao
Departamento de Oncogenética do HCB e enviadas para realização de teste genético
(sequenciamento gênico e MLPA) para os genes BRCA1/BRCA2 devido a uma história pessoal
e/ou familiar sugestiva de síndrome de predisposição hereditária ao câncer de mama e
ovário (HBOC). As mulheres do grupo 4 foram selecionadas junto ao Departamento de
Mastologia como um grupo com câncer de mama supostamente esporádico.
Observação 1: Os critérios utilizados pelo Departamento de Oncogenética do HCB para
indicação do teste genético para BRCA1/BRCA2 são: a) História pessoal de câncer de mama
antes dos 40 anos de idade; b) História pessoal de câncer de ovário em qualquer idade, com
história familiar positiva de câncer; c) Critérios clínicos estabelecidos pela Sociedade
Americana de Oncologia Clínica (ASCO); d) Probabilidade de mutação nos genes
BRCA1/BRCA2 (estimada pelas Tabelas de prevalência de Myriad) superior a 30%.
Observação 2: Para a classificação das variantes germinativas identificadas e subsequente
classificação das pacientes como pertencentes ao grupo 1 ou 2, foram utilizados os seguintes
bancos de dados: BIC (Breast Cancer Information Core), HGMD (Human Genome Mutation
Database), e LOVD IARC (Leiden Open Variation Database). No caso de inconsistências entre
os 3 bancos de dados, as informações constantes no LOVD IARC foram priorizadas, seguidas
daquelas disponíveis no HGMD e, apenas nos casos em que ambos os bancos não
contiverem as informações necessárias foram utilizadas as informações disponíveis no banco
de dados BIC.
Observação 3: Todas as mulheres incluídas no estudo estão (ou estavam) em atendimento
junto ao Hospital de Câncer de Barretos, local onde foi realizado o recrutamento das
mesmas bem como a coleta do material biológico (sangue) que foi utilizado no presente
trabalho (no caso do grupo 4 esse recrutamento e coleta foram realizados de maneira
prospectiva).
49
4.5 Metodologia
4.5.1 Coleta de dados clínicos e de história familiar
A coleta de dados clínicos foi realizada através de revisão de prontuário médico
geral. Os dados referentes à história familiar foram obtidos através de revisão do prontuário
do Departamento de Oncogenética. Todos os dados foram coletados em ficha de coleta
específica para o estudo (anexo 3).
4.5.2. Análises Imunohistoquímicas e moleculares
a)
Imunohistoquímica
Inicialmente, as lâminas foram desparafinizadas por incubação em xilol 58°C
durante 10 min; seguido de dois banhos de xilol à temperatura ambiente, um banho em
solução de álcool e xilol na proporção de 1:1, um banho em álcool absoluto e banhos
sequenciais em álcool 95%, 90%, 80%, 70% e 50% e em água corrente para hidratação dos
cortes histológicos. Após estes processos foi feita a recuperação antigênica pelo calor, com
banho de imersão das lâminas em solução tampão Citrato de Sódio 10 mM, pH 6,0, seguido
de resfriamento à temperatura ambiente. A seguir, ocorreu o bloqueio da peroxidase com
Peróxido de Hidrogênio (H2O2) 3%, durante 15 minutos, seguido de lavagem das lâminas
com água destilada e tampão Tris-HCl (50 mM, pH 9,5). A seguir, os cortes histológicos foram
lavados em salina tamponada com fosfatos (PBS 10 mM pH 7,4) durante 30 min à
temperatura ambiente, seguido de bloqueio com solução contendo 20 mM tampão fosfato
de sódio, pH 7,4; 0,45M NaCl; 0,3% Triton X-100 e 5% de leite em pó desnatado, por 4 h, à
temperatura ambiente. Posteriormente, foram lavados em água corrente e incubados com o
anticorpo primário (diluído em albumina bovino, conforme o anticorpo e o título), em
câmara úmida a 4°C overnight na geladeira. No dia seguinte, os cortes foram lavados em
água destilada e incubados com o anticorpo secundário biotinilado (Kit LSAB anti-mouse,
rabbit ou goat) por 30 minutos em temperatura ambiente. Para a revelação das reações,
seguiu-se uma lavagem em solução de PBS, seguida de incubação dos cortes com
50
estreptavidina conjugada por 30 minutos em temperatura ambiente, com posterior lavagem
em solução de PBS seguida de aplicação da DAB líquida (DAKO). Seguiu-se com nova
lavagem em água corrente e com a contracoloração com Hematoxilina de Harris; imersão
das lâminas em água amoniacal (solução de hidróxido de amônio a 0,2%) seguida de nova
lavagem em água corrente e desidratação dos cortes em álcool absoluto, finalizando-se com
imersão das lâminas em Xilol e montagem das lamínulas com Entellan (Merck).
Foram utilizados os seguintes anticorpos:
1) Anticorpo monoclonal contra ERα (clone SP1, Neomarkers (Lab Vision),
Fremont, CA, USA, 1:50);
2) Anticorpo monoclonal contra PgR (clone PgR 636, Dako, Glostrup,
Denmark, 1:50);
3) Anticorpo policlonal contra HER2 (HercepTest™ antibody, Dako,
1:500);
4) Anticorpo monoclonal contra Ki67 (clone MIB-1, Dako, 1:50);
5) Anticorpo
monoclonal contra
CK5/6
(clone D4/16B4, Zymed
(Invitrogen), Carlsbad, CA, USA, 1:25);
6) Anticorpo monoclonal contra CK14 (1:40, clone LL002, Newcastle
(Tyne), Novocastra, reino Unido).
Observação: A confirmação da qualidade e do diagnóstico anátomo-patológico de
todas as amostras foi realizada por um patologista (CSN) do Departamento de Anatomia
Patológica deste Hospital. Em todos os casos foram utilizadas lâminas cujo percentual de
células tumorais correspondia a pelo menos 60% do total de células.
Classificação: Para as análises das reações imunohistoquímicas realizadas, foram
consideradas as seguintes classificações: Para os receptores de estrógeno (ER), progesterona
(PR), citoqueratina 5/6 (CK56), citoqueratina 14 (CK14) foram consideradas duas categorias
(negativo e positivo). Para o marcador de proliferação celular Ki67, os índices de proliferação
celular foram agrupados em duas categorias <=14% e >14%. Para o receptor de HER2, além
das categorias positivo e negativo, foi considerada uma terceira categoria, denominada
inconclusiva, e para esses casos foi realizada análise de HER-2 por FISH (Hibridização in Situ
51
Fluorescente) utilizando Zytovision Zytolight SPEC Her-2/CEN17 Dual Color Probe (conforme
detalhado abaixo).
Tabela 1: Classificação molecular
Luminal A
ER e/ou PR positivos, HER2 negativo e ki-67 <14%
Luminal B1 - HER2 negativo
ER e/ou PR positivos, HER2 negativo ki-67 >14%
Luminal B2 - HER2 positivo
ER e/ou PR positivos, HER2 positivo, independente do resultado
de ki-67
ER e PR negativos e HER2 positivo
HER2 super expresso
Basal-like
ER/PR/HER2 negativos e uma das citoqueratinas CK5/6 e CK14
positiva
Fonte: Goldhirsch WC 123.
b)
FISH
A reação de FISH utiliza recursos moleculares para analisar os cromossomos. Para
essa metodologia foram utilizadas lâminas de 5µm, com região tumoral previamente
marcada, seguida de fixação em estufa a 60°C e posterior desparafinização a 80°C. Após
etapa de preparação da lâmina seguiu-se o protocolo de Hibridização in Situ Fluorescente
para tumores sólidos, que consta de uma primeira etapa de pré hibridização, seguida de
hibridização e por fim a pós hibridização. Ao término da reação é realizada a análise
utilizando o microscópio Nikon ECLIPSE 50i no software Apllied Spectral Imaging FISH View
versão 7.0.
c)
Extração de DNA genômico e análise de polimorfismos por sequenciamento
bi-direcional
Os DNAs genômicos extraídos (utilizando o Kit QIAamp Blood DNA Mini-Kit, Qiagen)
e quantificados (NanoDrop) foram analisados quanto à presença dos polimorfismos
rs2981582 no gene FGFR2; rs3803662 localizado numa região contendo TNRC9 (também
conhecido como TOX3); rs889312 localizado numa região contendo MAP3K1; rs3817198 no
gene LSP1; e, rs13281615. Para a análise dos polimorfismos em questão, os fragmentos
contendo as regiões de interesse foram amplificados através da reação em cadeia da
52
polimerase (PCR), na seguinte condição: Denaturação inicial (94°C – 3’), denaturação,
anelamento e extensão (94°C – 1’45’’ / temp. de anelamento (conforme tabela2) – 1’ / 72°C
- 1’) por 35 vezes, e extensão final 72°C – 10’. Todos os fragmentos foram amplificados com
a utilização da enzima Hot Star Taq (Qiagen). Após amplificação seguiu-se purificação dos
produtos com a utilização da enzima ExoSap (USD products) e sequenciamento bi-direcional
utilizando o Kit BigDye terminator v3.1 (Applied Biosystems, USA). A eletroforese foi
realizada no sequenciador automatizado modelo 3500 (Applied Biosystems,USA).
Tabela 2: Detalhamento das reações de PCR realizadas.
Polimorfismo
rs3817198 - LSP1
Primer Forward
Primer Reverse
Tamanho
Temperatura
Fragmento
annealing
(Pb)
(°C)
gcctggagccctgttgcagg
tgctagccctgtggtggcca
259
70
gctgttgagccaagtagacccac
acctggccaagcctacacttcc
400
65
rs889312 – MAP3K1
gggcctgggtccttagcattcc
tgccctgaagtgagtagggctgt
430
65
rs2981582 – FGFR2
caccccacgacagagatgtgt
cgccggtgtcacagctttggaa
367
60
rs3803662 – TNRC9
ccttcagcaggaggggcccc
ccaaagcaccaactatgaga
238
60
rs13281615
d) Análise de mutações germinativas nos genes BRCA1 e BRCA2
Embora não faça parte do presente trabalho de uma forma direta (essa análise
molecular é realizada pelo Centro de Diagnóstico Molecular do HCB), a investigação de
mutações e rearranjos nos genes BRCA1/BRCA2 (que nos permitiu a classificação do grupo
amostral em grupos) foi feita da seguinte forma:
Investigação de mutações pontuais e pequenos rearranjos foram realizadas através de
amplificação por PCR Multiplex de todos os exons codificantes dos genes BRCA1 (NCBI;
NM_007294.3) e BRCA2 (NCBI; NM_000059.3) e suas respectivas regiões intrônicas
flanqueadoras imediatamente adjacentes, seguido de sequenciamento bi-direcional,
53
utilizando duas plataformas (sequenciador ABI 3500 XL) e sequenciador de nova geração
(Ion Torrent PGM, Applied Biosystems).
A investigação de grandes rearranjos foi realizada através da técnica de MLPA
(Multiplex Ligation-dependent Probe Amplification). Para o gene BRCA1 foi utilizado o kit
Salsa MLPA P002 Probemix, sendo que todas as alterações encontradas foram confirmadas
pelo kit Salsa MLPA P087 Probemix. Em relação ao BRCA2 o kit utilizado foi o Salsa MLPA
P045 Probemix e o kit utilizado para confirmação seria o kit Salsa MLPA P077 Probemix
(http://www.mlpa.com), no caso de algum rearranjo em BRCA2 ter sido identificado.
4.6 Armazenamento dos Dados e Análise Estatística
Trata-se de uma amostra de conveniência, onde foram incluídas todas as mulheres
com diagnóstico de câncer de mama testadas para BRCA1 e BRCA2 previamente no Centro
de Diagnóstico Molecular, e, conforme o resultado do teste, as mulheres foram alocadas em
um dos grupos do estudo.
Para armazenamento dos dados e análise estatística foi utilizado o programa SPSS
v.21.0 for Windows (Chicago, IL). As variáveis categóricas foram descritas por frequências
absolutas e frequências relativas percentuais. As correlações foram feitas pelo método do
qui-quadrado e método exato de fishser. O nível de significância considerado em todos os
testes foi de 5%.
Com o intuito de se realizar uma análise de regressão logística múltipla a amostra
foi divida em dois grupos (mutados e não mutados) que compôs a resposta do modelo.
Realizamos então uma análise univariada através do teste Qui-quadrado ou Exato de Fisher
para selecionar as variáveis que foram analisadas conjuntamente, considerando para isso
um nível de significância de 0,2, com o intuito de ter mais chance de selecionar as variáveis
que pudessem ser significativas para o estudo. A análise múltipla foi realizada inicialmente
com todas as variáveis selecionadas na análise univariada e as consideradas não
significativas nessa etapa foram retiradas, uma por vez, do modelo, até obtermos um
resultado onde todas as variáveis foram consideradas significativas a um nível de
significância de 0,05.
54
4.7 Aspectos Éticos
O projeto foi aprovado pelo Comitê de Ética em Pesquisa com número 423/2010.
Todas as pacientes incluídas no estudo preencheram o Termo de Consentimento Livre e
Esclarecido antes da sua inclusão no mesmo (Anexos 1 e 2). Os dados contidos nas fichas de
coleta somente poderão ser utilizados/acessados pelos pesquisadores do estudo e comissão
de ética da Instituição em que se realiza o estudo. O registro dos dados e análise dos
mesmos é de responsabilidade dos investigadores principais e foi realizado exclusivamente
pelos mesmos.
4.8 Uso das Informações e Publicações
Os investigadores do estudo têm absoluta responsabilidade pelos dados obtidos e
os resultados não serão publicados ou fornecidos a terceiros, sem o consentimento por
escrito de todos os investigadores.
55
5. Resultados
5.1 Caracterização Geral da Amostra
No presente estudo foram incluídas 287 mulheres com história pessoal de câncer de
mama, sendo 51 no grupo 1 (30 com história positiva de câncer e presença de mutação
germinativa no gene BRCA1 e 21 com história pessoal e familiar de câncer e mutação no
gene BRCA2), 53 no grupo 2 (com história positiva de câncer, com presença de Variante de
Significado Clínico Desconhecido nos genes BRCA1 e/ou BRCA2), 100 no grupo 3 (com
história positiva de câncer sem mutação germinativa patogênica nos genes BRCA1 e BRCA2).
E, no grupo 4, foram incluídas 83 mulheres com diagnóstico de câncer de mama
(supostamente esporádico) não selecionadas pela história familiar de câncer.
A maioria das mulheres participantes do estudo era procedente do estado de São
Paulo (64,8%). As mulheres em sua maioria eram casadas (64,8%), e não fumantes (80,1%).
Com relação aos fatores de risco (hormonais) para câncer de mama, observamos que 23,6%
das mulheres estavam na menopausa no momento do diagnóstico e 79,4% apresentavam
gestação prévia. Outros dados de caracterização da amostra e dos fatores de risco
associados ao câncer de mama encontram-se detalhados na Tabela 3.
Os dados anátomopatológicos das amostras consideradas no estudo encontram-se
sumarizados na Tabela 4.
56
Tabela 3: Caracterização geral da amostra e fatores de risco.
Variável
Total N (%)
Procedência
São Paulo
184 (64,8)
Outros
100 (35,2)
Estado Civil
Solteira
54 (19,2)
Casada
182 (64,8)
Divorciada
31 (11,0)
Viúva
14 (5,0)
Escolaridade
Analfabeto
3 (1,1)
Esino fundamental incompleto
14 (5,1)
Esino fundamental completo
40 (14,4)
Ensino médio incompleto
54 (19,5)
Ensino médio completo
90 (32,5)
Superior completo
76 (27,4)
Sexo
Feminino
287 (100,0)
Masculino
0 (0,0)
Idade da menarca
7 a 11 anos
58 (23,8)
12 a 13 anos
114 (46,7)
>14
72 (29,5)
Idade ao nascimento do promeiro filho
<=20
71 (38,6)
>20 e <=24
52 (28,3)
>24 e <=29
38 (20,7)
>29
23 (12,4)
Fumante
Sim
27 (10,4)
Não
205 (80,2)
Ex-fumante
24 (9,4)
Etilista
Sim
5 (2,0)
Não
249 (98,0)
Menopausa ao diagnóstico
Sim
51 (23,6)
Não
165 (76,4)
Gestação prévia
Sim
201 (79,4)
Não
52 (20,6)
57
Tabela 3 (Cont.): Caracterização geral da amostra e fatores de risco.
Variável
Total N (%)
Uso de Anticoncepcional Oral
Sim
128 (54,0)
Não
109 (46,0)
Uso de Terapia de Reposição Hormonal
Sim
27 (11,8)
Não
202 (70,4)
Tabela 4: Características anatomopatológicas relacionadas ao câncer de mama (geral e por
grupo).
Variável
Grupo 1
N (%)
Grupo 2
N (%)
Grupo 3
N (%)
Grupo 4
N (%)
Total N (%)
Grau histológico
P valor *
0,010
Grau I
1 (2,6)
4 (8,5)
10 (11,9)
6 (8,2)
21 (8,6)
Grau II
21 (53,8)
29 (61,7)
39 (46,4)
49 (67,1)
138 (56,8)
Grau III
17 (43,6)
14 (29,8)
35 (41,7)
18 (24,7)
84 (34,6)
Estadio
T patológico
0,040
T1
14 (28,6)
18 (34,6)
33 (37,1)
29 (39,2)
94 (35,6)
T2
16 (32,7)
15 (28,8)
31 (34,8)
28 (37,8)
90 (34,1)
T3
9 (18,4)
11 (21,2)
15 (16,9)
9 (12,2)
44 (16,7)
T4
10 (20,4)
8 (15,4)
10 (11,2)
8 (10,8)
36 (13,6)
N patológico
0,493
N0
26 (52,0)
25 (48,1)
49 (54,4)
48 (65,8)
148 (55,58)
N1
17 (34,0)
22 (42,3)
26 (28,9)
16 (21,9)
81 (30,6)
N2
4 (8,0)
3 (5,8)
11 (12,2)
6 (8,2)
24 (9,1)
N3
3 (6,0)
2 (3,8)
4 (4,4)
3 (4,1)
12 (4,5)
Metástase
0,105
M0
45 (91,8)
52 (100,0)
86 (95,6)
72 (98,6)
255 (96,6)
M1
4 (8,2)
0 (0,0)
4 (4,4)
1 (1,4)
9 (3,4)
*Qi-quadrado
Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
Quando essa mesma análise é realizada considerando o grupo 1 (com mutação) de
forma separada de acordo com o gene mutado, notamos uma pequena diferença no grau
histológico, onde 56,5% das mulheres mutadas em BRCA1 tinham grau histológico 3 vs 25%
58
das mutadas em BRCA2 (p=0,03). As demais variáveis também foram analisadas da mesma
forma porém nenhuma diferença foi notada.
A maioria dos tumores diagnosticados eram do tipo ductal 236 casos (91,8%),
seguido de carcinoma lobular (10 casos, 3,9%) e carcinoma medular (4 casos, 1,6%). Quando
realizamos uma análise detalhada das mulheres com carcinoma medular observamos que
dentre as 4 mulheres com esse diagnóstico, 2 pertenciam ao grupo 1 (com presença de
mutação germinativa), sendo que uma delas apresentava mutação no gene BRCA1 e outra
no gene BRCA2, 1 mulher no grupo 2 (com VUS - Variante Significado Clínico Desconhecido
no gene BRCA1), e por fim, observamos 1 mulher com esse mesmo diagnóstico no grupo 4.
Em relação a idade ao diagnóstico, no grupo 1 a média de idade foi de 41,88 anos
(desvio padrão 10,5 e mediana de 42 anos, variando de 23 a 67 anos), no grupo 2 a média foi
34,91 anos (desvio padrão: 10 e mediana 32 anos, variando de 16 a 63 anos), no grupo 3 a
média de idade foi 38,37 anos (desvio de 10,8 e mediana de 38, intervalo de 20 a 73 anos)
enquanto no grupo 4 a média de idade ao diagnóstico foi 51,65 anos (desvio padrão de 9,9 e
mediana de 51 anos, intervalo de 32 a 74 anos). Informações adicionais sobre a história
pessoal assim como a familiar de câncer (gerais e por grupo) foram obtidos a partir da
análise dos heredogramas e encontram-se detalhadas na Tabela 5.
59
Tabela 5: Características da história pessoal e familiar de câncer (geral e por grupo).
Variável
Grupo 1
N (%)
Grupo 2
N (%)
Grupo 3
N (%)
Grupo 4
N (%)
Total N
(%)
Idade ao diagnóstico
P valor*
<0,001
≤30
8 (15,7)
24 (44,4)
30 (30,3)
0 (0,0)
62 (21,7)
>30 e ≤50
34 (66,7)
25 (46,3)
56 (56,6)
40 (48,8)
155 (54,2)
>50
9 (17,6)
5 (9,3)
13 (13,1)
42 (51,2)
69 (24,1)
Presença de outros tipos de câncer
0,005
Sim
20 (40,8)
16 (30,2)
28 (29,5)
11 (13,4)
75 (26,9)
Não
29 (59,2)
37 (69,8)
67 (70,5)
71 (86,6)
204 (73,1)
Número de gerações afetadas
**(ver
rodapé)
1
9 (17,6)
11 (20,4)
16 (16,2)
45 (62,5)
81 (29,3)
2
20 (39,2)
25 (46,3)
50 (50,5)
24 (33,3)
119 (43,1)
3
19 (37,3)
18 (33,3)
30 (30,3)
3 (4,2)
70 (25,4)
4
3 (5,9)
0 (0,0)
3 (3,0)
0 (0,0)
6 (2,2)
Presença de câncer de mama bilateral (na
família)
<0,001
Não
41 (80,4)
49 (90,7)
95 (95,0)
71 (100,0)
256 (92,8)
Sim
10 (19,6)
5 (9,3)
5 (5,0)
0 (0,0)
20 (7,2)
Presença de câncer de mama masculino (na
família)
0,071
Não
51 (100,0)
52 (96,3)
100 (100,0)
71 (100,0)
274 (99,3)
Sim
0 (0,0)
2 (3,7)
0 (0,0)
0 (0,0)
2 (0,7)
Presença de câncer de de ovário (na família)
<0,001
Não
38 (74,5)
50 (92,6)
89 (89,0)
71 (100,0)
248 (89,9)
Sim
13 (25,5)
4 (7,4)
11 (11,0)
0 (0,0)
28 (10,1)
Número de casos de câncer (na família)
<0,001
≤3
8 (15,7)
18 (33,3)
40 (40,0)
54 (75,0)
120 (43,3)
>3
43 (84,3)
36 (66,7)
60 (60,0)
18 (25,0)
157
(56,47)
Número de casos de câncer de mama (na
família)
<0,001
≤3
23 (45,1)
44 (81,5)
77 (77,8)
72 (100,0)
216 (78,3)
>3
28 (54,9)
10 (18,5)
22 (22,2)
0 (0,0)
60 (21,7)
Número de óbitos por câncer (na família)
<0,001
≤3
32 (62,7)
43 (79,6)
90 (90,9)
69 (97,2)
234 (85,1)
>3
19 (37,3)
11 (20,4)
9 (9,1)
2 (2,8)
41 (14,9)
60
Tabela 5 (Cont.): Características da história pessoal e familiar de câncer (geral e por grupo).
Variável
Grupo 1
N (%)
Grupo 2
N (%)
Grupo 3
N (%)
Grupo 4
N (%)
Total N
(%)
Número de óbitos por câncer de mama (na
família)
P valor*
0,004
≤3
46 (90,2)
51 (94,4)
98 (99,0)
71 (100,0)
266 (96,7)
>3
5 (9,8)
3 (5,6)
1 (1,0)
0 (0,0)
9 (3,3)
**Dado o número amostral muito baixo em alguns dos grupos, não foi possível realizar o teste estatístico.
*Qi-quadrado / Exato de Fisher
Nota: Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
Ainda como parte da caracterização geral da amostra, utilizamos diferentes modelos
de estimativa de probabilidade de mutação (nos genes BRCA1/BRCA2). A Tabela 6 mostra
um detalhamento, por grupo, das probabilidades obtidas com a utilização dos modelos de
Myriad (tabelas de prevalência de mutação disponibilizada pelos Laboratórios Myriad),
modelo de Penn II e escore de Manchester. Para os modelos de Myriad e Penn II, as
probabilidades foram agrupadas da seguinte forma: até 10% (probabilidade considerada
baixa), entre 10% e 30% (probabilidade moderada) e acima de 30% (probabilidade alta). Para
o escore de Manchester (que atribui pontos e não percentual) a subdivisão foi: até 10
(probabilidade considerada baixa), entre 10 e 30 pontos (probabilidade moderada) e acima
de 17 pontos (probabilidade alta). Dentre as mulheres do grupo 1 notamos que 82,4%
tinham probabilidade moderada (>10% e <=30%), essa mesma tendência não é vista nos
demais grupos, 44,4%, 49,0% e 0% grupos 2, 3 e 4 respectivamente. O mesmo é notado para
os demais modelos de cálculo de probabilidade.
61
Tabela 6: Probabilidade de mutação dos tumores de mama (por grupo).
Probabilidade de mutação
Grupo 1
N (%)
Grupo 2
N (%)
Grupo 3
N (%)
Grupo 4
N (%)
Myriad
P valor*
<0,001
<=10%
>10% e <=30%
>30%
5 (9,8)
30 (55,6)
49 (49,0)
71 (100,0)
42 (82,4)
24 (44,4)
49 (49,0)
0 (0,0)
4 (7,8)
0 (0,0)
2 (2,0)
0 (0,0)
PEN II-BRCA1
<0,001
<=10%
30 (58,8)
40 (74,1)
74 (74,0)
71 (100,0)
>10% e <=30%
18 (35,3)
13 (24,1)
25 (25,0)
0 (0,0)
3 (5,9)
1 (1,9)
1 (1,0)
0 (0,0)
>30%
PEN II-BRCA2
<=10%
0,001
46 (90,2)
41 (75,9)
88 (88,0)
70 (98,6)
>10% e <=30%
5 (9,8)
13 (24,1)
12 (12,0)
1 (1,4)
>30%
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
Manchester-BRCA1
<0,001
<=10
23 (45,1)
42 (77,8)
79 (79,0)
71 (86,6)
>10 e <=17
18 (35,3)
11 (20,4)
17 (17,0)
0 (0,0)
>17
10 (19,6)
1 (1,8)
4 (4,0)
0 (0,0)
Manchester-BRCA2
<0,001
<=10
24 (47,1)
44 (81,5)
80 (80,0)
71 (100,0)
>10 e <=17
22 (43,1)
9 (16,7)
18 (18,0)
0 (0,0)
5 (9,8)
1 (1,9)
2 (2,0)
0 (0,0)
>17
*Qi-quadrado
Nota: Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
5.2 Caracterização do Perfil Histopatológico e Imunohistoquímico das amostras utilizadas
Como mencionado anteriormente o tipo histológico mais frequente identificado foi o
ductal invasivo. Quanto ao padrão imunohistoquímico, não foi possível fazermos a
caracterização de toda a amostra para todos os marcadores em questão, dada a má
qualidade ou má conservação de alguns blocos, bem como devido ao fato que, para vários
espécimes não havia material tumoral remanescente no bloco de parafina. Dados
anatomopatológicos relacionados aos tumores encontram-se na Tabela 4 acima. Os
resultados das análises imunohistoquímicas dos tumores estão descritos na Tabela 7.
62
Tabela 7: Características imunohistoquímicas dos tumores de mama (por grupo).
Variável
Grupo 1
N (%)
Grupo 2
N (%)
Grupo 3
N (%)
Grupo 4
N (%)
Receptor Estrógeno
P valor*
<0,001
Negativo
28 (58,3)
19 (35,8)
32 (34,8)
19 (23,2)
Positivo
20 (41,7)
34 (64,2)
60 (65,2)
63 (76,8)
Receptor Progesterona
0,020
Negativo
28 (58,3)
18 (34,0)
44 (46,8)
33 (40,2)
Positivo
20 (41,7)
35 (66,0)
50 (53,2)
49 (59,8)
Receptor ErbB (HER2)
0,012
Negativo
42 (89,4)
37 (72,5)
59 (64,8)
63 (76,8)
Positivo
4 (8,5)
14 (27,5)
30 (33,0)
19 (23,2)
Inconclusivo**
1 (2,1)
0 (0,0)
2 (2,2)
0 (0,0)
Triplo Negativas
<0,001
Sim
24 (51,1)
7 (13,2)
18 (19,6)
8 (9,8)
Não
23 (48,9)
46 (86,8)
74 (80,4)
74 (90,2)
CK5/6
0,002
Negativo
17 (60,7)
24 (92,3)
40 (74,1)
58 (90,6)
Positivo
11 (39,3)
2 (7,7)
14 (25,9)
6 (9,4)
CK14
0,016
Negativo
22 (71,0)
28 (90,3)
43 (75,4)
59 (81,9)
Positivo
9 (29,0)
3 (9,7)
13 (22,8)
13 (18,1)
Ki67
<0,001
<=14%
3 (8,1)
3 (7,7)
12 (16,0)
23 (31,9)
>14%
34 (91,9)
36 (92,3)
63 (84,0)
49 (68,10)
**Amostras cuja análise por FISH não foi realizada dada ausência de tumor no bloco de parafina.
*Qi quadrado / Exato de Fisher
Valores em negrito indicam valores com significancia estatística (p<0,05).
Como pode ser observado na tabela 7 , existe uma diferença importante no perfil dos
quatro grupos. No grupo constituído pelas mulheres com mutações germinativas nos genes
BRCA1 e BRCA2 há um predomínio de negatividade para os receptores hormonais
ER/PR/HER2, quando comparado às mulheres dos três outros grupos do estudo. Além disso
uma maior positividade para os marcadores CK56 e CK14 pôde ser observada no grupo 1
quando comparado aos demais grupos.
Para as mulheres nas quais os resultados de citoqueratina puderam ser obtidos,
realizamos uma classificação conforme o subtipo molecular do tumor, considerando os
seguintes grupos: Luminal A, Luminal B (HER2 negativo), Luminal B (HER2 positivo), HER2
63
super-expresso e basal-like. A classificação adotada para essa subdivisão encontra-se
descrita na Tabela 1, seção da metodologia item 4.5.2 – a. A tabela 8 apresenta os resultados
dessa análise por grupo amostral.
Tabela 8: Suptipo molecular dos tumores de mama (por grupo).
Variável
Grupo 1
Grupo 2
Grupo 3
Grupo 4
N (%)
N (%)
N (%)
N (%)
Subtipo Molecular
Luminal A
P valor
**
1 (3,3)
1 (2,6)
8 (11,0)
19 (26,0)
Luminal B (Her2 negativo)
16 (53,3)
22 (57,9)
25 (34,2)
31 (42,5)
Luminal B (Her2 positivo)
4 (13,3)
9 (23,7)
19 (26,0)
12 (16,4)
HER2 super expresso
0 (0,0)
5 (13,2)
11 (15,1)
7 (9,6)
Basal like
9 (30,0)
1 (2,6)
10 (13,7)
4 (5,5)
**Dado o número amostral muito baixo em alguns dos grupos, não foi possível realizar o teste estatístico.
Ainda em relação ao subtipo molecular, pudemos observar que o subtipo
predominante em todos os grupos foi o Luminal B sem expressão de HER2. Nos grupos 2 e 3,
o segundo subtipo molecular predominante também foi Luminal B, porém com expressão de
HER2. Nos casos de câncer de mama supostamente esporádicos, o segundo subtipo mais
frequente foi o Luminal A. Por outro lado, um número considerável (30%) de famílias do
grupo 1 (com mutação germinativa nos genes BRCA1/BRCA2) foram classificadas como
sendo basal-like. Dessa forma, estratificamos ainda mais o grupo de mulheres mutadas que
foram classificadas como basal-like e vimos que 88,8% destas mulheres eram portadoras de
mutação germinativa no gene BRCA1 e apenas uma mulher (11,2%) apresentava mutação no
gene BRCA2.
Realizamos, na sequência, uma correlação entre dados da história familiar de câncer
e o subtipo molecular dos tumores. Os resultados dessa correlação estão representados na
Tabela 9.
64
Tabela 9: História familiar de câncer conforme subtipo molecular.
Variável
Luminal A
N (%)
Luminal
HER2 –
Luminal
N (%)
N (%)
HER2 +
Her-2 expresso
N (%)
Basal like
N (%)
Número de casos de
câncer
P valor*
0,106
<=3
16 (59,3)
40 (43,5)
20 (47,6)
9 (42,9)
7 (30,4)
>3
11 (40,7)
52 (56,5)
22 (52,4)
12 (57,1)
16 (69,6)
Presenca cancer mama
bilateral
0,020
Sim
0 (0,0)
6 (6,5)
4 (9,5)
2 (9,5)
4 (17,4)
Não
26 (100,0)
86 (93,5)
38 (90,5)
19 (90,5)
19 (82,6)
Presença cancer mama
masculino
0,599
Sim
0(0,0)
1 (1,1)
1 (2,4)
0 (0,0)
0 (0,0)
Não
26 (100,0)
91 (98,9)
41 (97,6)
21 (100,0)
23 (100,0)
Número de gerações com
câncer
**
1
11 (40,7)
27 (29,3)
15(36,6)
6 (28,6)
4 (17,4)
2
13 (48,1)
42 (45,7)
17 (41,5)
9 (42,9)
10 (43,5)
3
3 (11,1)
21 (22,8)
8 (19,5)
5 (23,8)
9 (39,1)
4
0 (0,0)
2 (2,2)
1 (2,4)
1 (4,8)
0 (0,0)
Número de casos cancer
de mama
0,022
<=3
25 (92,6)
73 (79,3)
37 (88,1)
17 (81,0)
16 (69,6)
>3
2 (7,4)
19 (20,7)
5 (11,9)
4 (19,0)
7 (30,4)
Idade ao diagnóstico
<=30 anos
0,005
2 (6,9)
20 (21,3)
11 (25,0)
7 (30,4)
10 (41,7)
>30 e <=50 anos
16 (55,2)
46 (48,9)
26 (59,1)
12 (52,2)
10 (41,7)
>50 anos
11 (37,9)
28 (29,8)
7 (15,9)
4 (17,4)
4 (16,7)
**Dado o número amostral muito baixo em alguns dos grupos, não foi possível realizar o teste estatístico.
*Qi-quadrado / Exato de Fisher
Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
Quando os dados de subtipo molecular são comparados às informações de história
familiar de câncer, observamos que no subtipo basal-like há uma tendência (embora não
estatisticamente significativa) para número de casos de câncer maior que 3, e presença de
câncer de mama bilateral na família e diagnóstico mais precoce do câncer de mama (mais de
40% dos casos diagnosticados em idade inferior a 30 anos), em contraste com os dados dos
65
casos classificados como luminal A, onde há menor número de casos de câncer em geral e
também número de casos de câncer de mama e nenhum caso de câcer de mama bilateral.
Considerando a provável importância da triplo negatividade dentre as mulheres com
mutação germinativa nos genes BRCA1/BRCA2, analisamos a relação entre a triplo
negatividade e a história familiar de câncer, de forma geral (Tabela 10) e também com as
amostras estratificadas por grupo (Tabela 11).
Tabela 10: Relação entre Triplo Negatividade e história familiar de câncer (geral).
Variável
TN Não
TN Sim
N (%)
N (%)
Número de casos de câncer
P valor*
0,016
<=3
100 (47,8)
18 (32,7)
>3
109 (52,2)
37 (67,3)
Presenca câncer mama bilateral
0,123
Sim
14 (6,7)
6 (10,9)
Não
194 (93,3)
49 (89,1)
Presença câncer mama masculino
0,625
Sim
2 (1,0)
0 (0,0)
Não
206 (99,0)
55 (100,0)
Número de gerações com câncer
0,016
1
67 (32,2)
13 (23,6)
2
92 (44,2)
23 (41,8)
3
45 (21,6)
17 (30,9)
4
4 (1,9)
2 (3,6)
Número de casos câncer de mama
0,003
<=3
174 (83,3)
36 (65,5)
>3
35 (16,7)
19 (34,5)
Idade ao diagnóstico
0,052
<=30 anos
45 (20,7)
15 (26,3)
>30 e <=50 anos
116 (53,5)
30 (52,6)
>50 anos
56 (25,8)
12 (21,1)
TN= Triplo Negativas
*Qi-quadrado
Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
66
Tabela 11: História familiar de câncer conforme status do receptor hormonal para as
mulheres TN (por grupo).
Variável
TN não
N (%)
TN sim
N (%)
P valor*
Número de casos de câncer
Grupo 1
0,019
<=3
7 (30,4)
1 (4,2)
>3
16 (69,6)
23 (95,8)
<=3
15 (32,6)
3 (42,9)
>3
31 (67,4)
4 (51,7)
<=3
29 (39,2)
9 (50,0)
>3
45 (60,8)
9 (50,0)
Grupo 2
0,277
Grupo 3
0,148
Grupo 4
0,364
<=3
49 (74,2)
5 (83,3)
>3
17 (25,8)
1 (16,7)
Presença câncer mama bilateral
Grupo 1
0,230
Sim
4 (17,4)
6 (25,0)
Não
19 (82,6)
18 (75,0)
Grupo 2
0,478
Sim
5 (10,9)
0 (0,0)
Não
41 (89,1)
7 (100,0)
Grupo 3
0,328
Sim
5 (6,8)
0 (0,0)
Não
69 (93,2)
18 (100,0)
Grupo 4
**
Sim
0 (0,0)
Não
65 (100,0)
0 (0,0)
6 (100,0)
Número de gerações com câncer
Grupo 1
0,057
1
6 (26,1)
2 (8,3)
2
10 (43,5)
10 (41,7)
3
5 (21,7)
11 (45,8)
4
2 (8,7)
1 (4,2)
Grupo 2
0,188
1
9 (19,6)
2 (28,6)
2
21 (45,7)
3 (42,8)
3
16 (34,8)
2 (28,6)
4
0 (0,0)
0 (0,0)
1
12 (16,4)
4 (22,2)
2
38 (52,1)
9 (50,0)
3
21 (28,8)
4 (22,2)
4
2 (2,7)
1 (5,6)
Grupo 3
0,132
67
Tabela 11 (cont.): História familiar de câncer conforme status do receptor hormonal para as
mulheres TN (por grupo).
Variável
TN não
N (%)
TN sim
N (%)
P valor*
Número de gerações com câncer
Grupo 4
0,188
1
40 (60,6)
5 (83,3)
2
23 (34,8)
1 (16,7)
3
3 (4,5)
0 (0,0)
4
0 (0,0)
0 (0,0)
<=3
13 (56,5)
9 (37,5)
>3
10 (43,5)
15 (62,5)
Número de casos câncer de mama
Grupo 1
0,101
Grupo 2
0,254
<=3
39 (84,8)
5 (71,4)
>3
7 (15,2)
2 (28,6)
Grupo 3
0,133
<=3
56 (75,4)
16 (88,9)
>3
18 (24,3)
2 (11,1)
Grupo 4
**
<=3
66 (100,0)
6 (100,0)
>3
0 (0,0)
0 (0,0)
Idade ao diagnóstico
Grupo 1
<=30 anos
0,061
1 (4,3)
5 (20,8)
>30 e <=50 anos
17 (73,9)
15 (66,7)
>50 anos
5 (21,7)
3 (12,5)
Grupo 2
0,226
<=30 anos
21 (45,7)
3 (42,9)
>30 e <=50 anos
21 (45,7)
3 (42,9)
4 (8,7)
1 (14,3)
>50 anos
Grupo 3
0,128
<=30 anos
23 (31,1)
7 (38,9)
>30 e <=50 anos
40 (54,1)
9 (50,0)
>50 anos
11 (14,9)
2 (11,1)
Grupo 4
<=30 anos
0,115
0 (0,0)
0 (0,0)
>30 e <=50 anos
38 (51,4)
2 (25,0)
>50 anos
36 (48,6)
6 (75,0)
TN= Triplo Negativas
**Não foi possível realizar a análise comparativa no grupo 4.
* Qi-quadrado / Exato de Fisher
Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
68
Foi observada uma diferença na história familiar (número de casos com câncer)
quando comparamos as mulheres triplo negativas com as não triplo negativas. Quando as
mulheres foram agrupadas (grupos 1 a 4 conforme status mutacional de BRCA1/BRCA2),
pudemos observar que a diferença deve-se ao grupo 1, no qual 95,8% das mulheres triplo
negativas possuem mais de 3 casos de câncer na família. No que se refere a idade ao
diagnóstico, não estratificadas por grupo, nenhuma diferença foi identificada quando
comparadas as mulheres triplo negativas e não triplo negativas. Adicionalmente, pudemos
observar que, embora não tenha tido significância estatística as mulheres triplo negativas do
grupo 1 apresentam mais casos de câncer de mama e um percentual considerável de casos
com idade inferior a 30 anos de idade (20,8%) dos casos.
Dado que o padrão de positividade/negatvividade dos receptores hormonais do
grupo 1 diferiu bastante daquele observado nos demais grupos, optamos por subdividir o
grupo 1 conforme o gene mutado (BRCA1 ou BRCA2) para analisar o padrão de expressão
desses marcadores nesses dois subgrupos de pacientes (tabela 12).
Tabela 12: Características imunohistoquímicas e subtipo molecular conforme gene mutado.
MUTADA BRCA1
MUTADA BRCA2
N (%)
N (%)
Triplo Negativas
22 (91,6)
2 (8,4)
24 (100,0)
CK5/6 Positivo
8 (72,7)
3 (27,3)
11 (100,0)
CK14 Positivo
8 (88,8)()
1 (11,2)
9 (100,0)
Ki-67 >14%
17 (50,0)
17 (50,0)
34 (100,0)
Luminal A
1 (100,0)
0 (0,0)
1 (100,0)
Luminal B – her2 negativo
4 (25,0)
12 (75,0)
16 (100,0)
Luminal B – her2 positivo
0 (0,0)
4 (100,0)
4 (100,0)
HER2 super expresso
0 (0,0)
0 (0,0)
0 (0,0)
Basal-like
8 (88,8)
1 (11,2)
9 (100,0)
Variável
Total N (%)
Subtipo molecular
Quando o grupo 1 (com mutação germinativa) foi estratificado em mutadas BRCA1 e
mutadas BRCA2 observamos que 91,6% das mulheres triplo negativas eram mutadas no
gene BRCA1 e apenas 8,4% no gene BRCA2. Adicionalmente, pudemos observar a diferença
do índice de positividade (elevada) para as citoqueratinas 5/6 e 14 para as mulheres
69
mutadas em BRCA1 versus as mulheres mutadas em BRCA2. Em relação ao subtipo
molecular, a maioria das mutadas em BRCA1 foram classificadas como basal-like, enquanto
que nas mutadas em BRCA2 o subtipo predominate foi o luminal B.
5.3 Frequência dos polimorfismos rs2981582 (gene FGFR2), rs3803662 (região contendo
TNRC9), rs889312 (região contendo MAP3K1), rs3817198 (gene LSP1) e rs13281615
Foram considerados no presente estudo os seguintes polimorfismos: rs2981582 no
gene FGFR2, rs3803662 no gene TNRC9, rs13281615, rs889312 no gene MAP3K1 e
rs3817198 no gene LSP1
A Tabela 13 apresenta a frequência genotípica dos 5 polimorfismos avaliados, bem como a
sua distribuição nos diferentes grupos do presente estudo.
70
Tabela 13: Frequência dos polimorfismos rs3803662 (TNRC9), rs2981582 (FGFR2),
rs13281615, rs889312 (MAP3K1) e rs3817198 (LSP1) por grupo.
Variável
Grupo 1
N (%)
Grupo 2
N (%)
Grupo 3
N (%)
Grupo 4
N (%)
rs3803662 (TNRC9)
P valor*
0,027
AA
5 (9,8)
12 (22,6)
17 (17,3)
16 (19,5)
AG
27 (52,9)
24 (45,3)
47 (48,0)
37 (45,1)
GG
19 (37,3)
17 (32,1)
34 (34,7)
29 (35,4)
rs2981582 (FGFR2)
0,031
AA
14 (27,5)
9 (16,7)
26 (26,3)
19 (23,2)
AG
22 (43,1)
33 (61,1)
49 (49,5)
43 (52,4)
GG
15 (29,4)
12 (22,2)
24 (24,2)
20 (24,4)
rs13281615
0,029
AA
14 (27,5)
11 (20,4)
27 (27,0)
23 (28,0)
AG
24 (47,1)
26 (48,1)
48 (48,0)
37 (45,1)
GG
13 (25,5)
17 (31,5)
25 (25,0)
22 (26,8)
rs889312 (MAP3K1)
0,029
CC
8 (15,7)
8 (14,8)
11 (11,0)
8 (9,8)
CA
21 (41,2)
20 (37,0)
55 (55,0)
36 (43,9)
AA
22 (43,1)
26 (48,1)
34 (34,0)
38 (46,3)
rs3817198 (LSP1)
0,023
TT
26 (51,0)
28 (51,9)
44 (44,4)
38 (46,3)
TC
22 (43,1)
24 (44,4)
43 (43,4)
38 (46,3)
CC
3 (5,9)
2 (3,7)
12 (12,1)
6 (7,3)
*Qi-quadrado
Nota: Nota: Valores em negrito indicam valores com significancia estatística (p<0,05).
Conforme pode ser observado na tabela acima, o genótipo heterozigoto do SNP
rs3803662 foi mais frequente nos 4 grupos. No grupo 1 pudemos observar uma menor
frequência do homozigoto AA quando comparados aos outros 3 grupos. Em relação ao
polimorfismo rs2981582 no gene FGFR2 observamos uma maior prevalência de
heterozigotos nos quatro grupos analisados, tendência essa também observada no SNP
rs13281615. Ainda em relação ao polimorfismo rs13281615 cabe ressaltar uma maior
frequência do genótipo GG (31,5%) no grupo 2 quando comparado aos outros 3 grupos. Já
em relação ao polimorfismo rs889312 no gene MAP3K1 observamos que grande parte das
71
mulheres dos grupos 1, 2 e 3 (43,1%, 48,1% e 46,3) apresentavam homozigose para o alelo
A, enquanto no grupo 3 a maioria das mulheres apresentavam o genótipo heterozigoto CA
(55%). Por último o polimorfismo rs3817198 no gene LSP1 mostrou a presença do alelo T em
homozigose em mais de 50% das mulheres dos grupos 1 e 2. Já para os grupos 3 e 4 a
presença do alelo T em homozigose esteve presente em 44,4% e 46,3% respectivamente,
sendo que no grupo 3 (WT) houve uma freqüência relativamente aumentada do genótipo
CC.
5.4 Associação entre os polimorfismos rs3803662, rs2981582, rs13281615, rs889312 e
rs3817198 com o perfil histopatológico e imunohistoquímico do tumor e com a história
familiar de câncer
Primeiramente verificamos se havia ou não associação entre os polimorfismos
analisados com o perfil imunohistoquímico dos tumores considerados. Os dados das
correlações com o status dos receptores hormonais (ER/PR e HER2) estão detalhados nas
tabelas 14 a 23.
Tabela 14: Correlação entre frequência dos genótipos do polimorfismo rs3803662 no gene
TNRC9 e Receptores Hormonais (geral).
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
Negativo
16 (16,3)
42 (42,9)
40 (40,8)
98 (100,0)
Positivo
33 (18,9)
84 (48,3)
57 (32,8)
174 (100,0)
Negativo
25 (20,5)
51 (41,8)
46 (37,7)
122 (100,0)
Positivo
24 (15,8)
78 (51,3)
50 (32,9)
152 (100,0)
Negativo
32 (16,0)
98 (49,3)
69 (34,7)
199 (100,0)
Positivo
14 (21,2)
26 (39,4)
26 (39,4)
66 (100,0)
0 (0,0)
0 (0,0)
3 (100,0)
Receptores Hormonais
Estrógeno
0,035
Progesterona
0,068
Her-2
Inconclusivo
P valor*
0,037
3 (100,0)
*Qi-quadrado
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
72
Tabela 15: Correlação entre frequência dos genótipos do polimorfismo rs3803662 no gene
TNRC9 e Receptores Hormonais (por grupo).
Receptores Hormonais
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
P valor*
Estrógeno
Grupo 1
0,127
Negativo
3 (10,7)
12 (42,9)
13 (46,4)
28 (100,0)
Positivo
2 (10,0)
12 (60,0)
6 (30,0)
20 (100,0)
Grupo 2
0,138
Negativo
3 (15,8)
10 (52,6)
6 (31,6)
19 (100,0)
Positivo
9 (27,3)
13 (39,4)
11 (33,3)
33 (100,0)
Grupo 3
0,114
Negativo
7 (21,8)
11 (34,3)
14 (43,9)
32 (100,0)
Positivo
9 (15,5)
31 (53,4)
18 (31,1)
58 (100,0)
Grupo 4
0,131
Negativo
3 (15,8)
9 (47,3)
7 (36,9)
19 (100,0)
Positivo
13 (20,6)
28 (44,4)
22 (35,0)
63 (100,0)
Negativo
3 (10,8)
13 (46,4)
12 (42,8)
28 (100,0)
Positivo
2 (10,0)
11 (55,0)
7 (35,0)
20 (100,0)
Negativo
3 (16,6)
8 (44,5)
7 (38,9)
18 (100,0)
Positivo
9 (26,5)
15 (44,1)
10 (29,4)
34 (100,0)
Negativo
10 (23,3)
17 (39,5)
16 (37,2)
43 (100,0)
Positivo
6 (12,2)
28 (57,1)
15 (30,7)
49 (100,0)
Negativo
9 (27,3)
13 (39,4)
11 (33,3)
33 (100,0)
Positivo
7 (14,3)
24 (49,0)
18 (36,7)
49 (100,0)
Progesterona
Grupo 1
0,165
Grupo 2
0,106
Grupo 3
0,113
Grupo 4
0,075
Her-2
Grupo 1
0,191
Negativo
4 (9,6)
22 (52,4)
16 (38,0)
42 (100,0)
Positivo
0 (0,0)
1 (25,0)
3 (75,0)
4 (100,0)
Inconclusivo
1 (0,0)
0 (0,0)
(0,0)
1 (100,0)
Negativo
8 (21,7)
17 (45,9)
12 (32,4)
37 (100,0)
Positivo
4 (30,7)
5 (38,6)
4 (30,7)
13 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
11 (19,4)
27 (47,3)
19 (33,3)
57 (100,0)
Positivo
3 (10,0)
15 (50,0)
12 (40,0)
30 (100,0)
Inconclusivo
2 (100,0)
0 (0,0)
0 (0,0)
2 (100,0)
Grupo 2
0,153
Grupo 3
Negativo
0,109
Grupo 4
0,079
Negativo
9 (14,3)
32 (50,8)
22 (34,9)
63 (100,0)
Positivo
7 (36,9)
5 (26,2)
7 (36,9)
19 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
*Qi-quadrado / exato de Fisher
Nota: Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
73
Tabela 16: Correlação entre frequência dos genótipos do polimorfismo rs2981582 no gene
FGFR2 e Receptores Hormonais (geral).
Receptores Hormonais
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
Estrógeno
P valor*
0,020
Negativo
20 (20,7)
47 (48,4)
30 (30,9)
97 (100,0)
Positivo
45 (25,4)
94 (53,2)
38 (21,4)
177 (100,0)
Progesterona
0,014
Negativo
22 (18,0)
66 (54,0)
34 (28,0)
122 (100,0)
Positivo
43 (28,0)
76 (49,3)
35 (22,7)
154 (100,0)
Her-2
0,025
Negativo
46 (22,9)
100 (49,7)
55 (27,4)
201 (100,0)
Positivo
18 (27,3)
36 (54,5)
12 (18,2)
66 (100,0)
Inconclusivo
1 (33,4)
2 (66,6)
0 (0,0)
3 (100,0)
*Qi-quadrado
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
74
Tabela 17: Correlação entre frequência dos genótipos do polimorfismo rs2981582 no gene
FGFR2 e Receptores Hormonais (por grupo).
Receptores Hormonais
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
P valor*
Estrógeno
Grupo 1
0,114
Negativo
7 (25,0)
12 (42,9)
9 (32,1)
28 (100,0)
Positivo
7 (35,0)
8 (40,0)
5 (25,0)
20 (100,0)
Grupo 2
0,038
Negativo
0 (0,0)
14 (73,7)
5 (26,3)
19 (100,0)
Positivo
9 (26,5)
18 (52,9)
7 (20,6)
34 (100,0)
Grupo 3
0,073
Negativo
8 (25,8)
12 (38,7)
11 (35,5)
31 (100,0)
Positivo
15 (25,0)
34 (56,6)
11 (18,3)
60 (100,0)
Grupo 4
0,149
Negativo
5 (26,3)
9 (20,9)
5 (25,0)
19 (100,0)
Positivo
14 (73,7)
34 (79,2)
15 (75,0)
63 (100,0)
Negativo
6 (21,4)
13 (46,4)
9 (32,2)
28 (100,0)
Positivo
8 (40,0)
7 (35,0)
5 (25,0)
20 (100,0)
Negativo
1 (5,6)
15 (83,3)
2 (11,1)
18 (100,0)
Positivo
8 (22,9)
17 (48,5)
10 (28,6)
35 (100,0)
Negativo
9 (20,9)
19 (44,2)
15 (34,9)
43 (100,0)
Positivo
14 (28,0)
28 (56,0)
8 (16,0)
50 (100,0)
Negativo
6 (18,2)
19 (57,6)
8 (24,2)
33 (100,0)
Positivo
13 (26,5)
24 (48,9)
12 (24,6)
49 (100,0)
Progesterona
Grupo 1
0,080
Grupo 2
0,180
Grupo 3
0,025
Grupo 4
0,113
Her-2
Grupo 1
0,082
Negativo
11 (26,2)
19 (45,2)
12 (28,6)
42 (100,0)
Positivo
2 (50,0)
1 (25,0)
1 (25,0)
4 (100,0)
Inconclusivo
1 (100,0)
0 (0,0)
0 (0,0)
1 (100,0)
Negativo
6 (16,2)
21 (56,7)
10 (27,1)
37 (100,0)
Positivo
3 (21,4)
9 (64,3)
2 (14,3)
14 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
Negativo
16 (27,2)
25 (42,3)
18 (30,5)
59 (100,0)
Positivo
7 (24,1)
18 (62,0)
4 (13,9)
29 (100,0)
Inconclusivo
0 (0,0)
2 (100,0)
0 (0,0)
2 (100,0)
Grupo 2
0,131
Grupo 3
0,085
Grupo 4
0,134
Negativo
13 (20,7)
35 (55,5)
15 (23,8)
63 (100,0)
Positivo
6 (31,6)
8 (42,1)
5 (26,3)
19 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
*Qi-quadrado / exato de Fisher
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
75
Tabela 18: Correlação entre frequência dos genótipos do polimorfismo rs13281615 e
Receptores Hormonais (geral).
Receptores Hormonais
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
Estrógeno
P valor*
0,056
Negativo
26 (26,5)
42 (42,8)
30 (30,7)
98 (100,0)
Positivo
47 (26,5)
86 (48,7)
44 (24,8)
177 (100,0)
Progesterona
0,056
Negativo
36 (29,3)
54 (43,9)
33 (26,8)
123 (100,0)
Positivo
38 (24,7)
74 (48,0)
42 (27,3)
154 (100,0)
Her-2
0,056
Negativo
52 (25,9)
93 (46,2)
56 (27,9)
201 (100,0)
Positivo
17 (25,4)
32 (47,7)
18 (26,9)
67 (100,0)
Inconclusivo
2 (66,6)
1 (33,4)
0 (0,0)
3 (100,0)
*Qi-quadrado
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
76
Tabela 19: Correlação entre frequência dos genótipos do polimorfismo rs13281615 e
Receptores Hormonais (por grupo).
Receptores Hormonais
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
P valor*
Estrógeno
Grupo 1
0,151
Negativo
7 (25,0)
15 (53,6)
6 (21,4)
28 (100,0)
Positivo
7 (35,0)
6 (30,0)
7 (35,0)
20 (100,0)
Grupo 2
0,121
Negativo
4 (21,0)
7 (36,8)
8 (42,2)
19 (100,0)
Positivo
7 (20,6)
18 (52,9)
9 (26,5)
34 (100,0)
Grupo 3
0,100
Negativo
9 (28,1)
13 (40,6)
10 (31,3)
32 (100,0)
Positivo
16 (26,7)
32 (53,3)
12 (20)
60 (100,0)
Grupo 4
0,138
Negativo
6 (31,6)
7 (36,8)
6 (31,6)
19 (100,0)
Positivo
17 (27,0)
30 (47,6)
16 (25,4)
63 (100,0)
Negativo
7 (25,0)
16 (57,1)
5 (17,9)
28 (100,0)
Positivo
7 (35,0)
5 (25,0)
8 (40,0)
20 (100,0)
Negativo
4 (22,2)
7 (38,9)
7 (38,9)
18 (100,0)
Positivo
7 (20,0)
18 (51,4)
10 (28,6)
35 (100,0)
Negativo
15 (34,1)
17 (38,6)
12 (27,3)
44 (100,0)
Positivo
11 (22,0)
28 (56,0)
11 (22,0)
50 (100,0)
Negativo
10 (30,3)
14 (42,4)
9 (27,3)
33 (100,0)
Positivo
13 (26,5)
23 (47,0)
13 (26,5)
49 (100,0)
Progesterona
Grupo 1
0,132
Grupo 2
0,148
Grupo 3
0,102
Grupo 4
0,118
Her-2
Grupo 1
0,169
Negativo
11 (26,2)
19 (45,2)
12 (28,6)
42 (100,0)
Positivo
2 (50,0)
1 (25,0)
1 (25,0)
4 (100,0)
Inconclusivo
0 (0,0)
1 (100,0)
0 (0,0)
1 (100,0)
Negativo
7 (19,0)
20 (54,0)
10 (27,0)
37 (100,0)
Positivo
3 (21,4)
4 (28,6)
7 (50,0)
14 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
14 (23,7)
29 (49,1)
16 (27,2)
59 (100,0)
Positivo
9 (30,0)
15 (50,0)
6 (20,0)
30 (100,0)
Inconclusivo
2 (100,0)
0 (0,0)
0 (0,0)
2 (100,0)
Grupo 2
0,117
Grupo 3
Negativo
0,030
Grupo 4
0,127
Negativo
20 (31,7)
25 (39,7)
18 (28,6)
63 (100,0)
Positivo
3 (15,8)
12 (63,1)
4 (21,1)
19 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
*Qi-quadrado / exato de Fisher
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
77
Tabela 20: Correlação entre frequência dos genótipos do polimorfismo rs889312 no gene
MAP3K1 e Receptores Hormonais (geral).
Receptores Hormonais
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
Estrógeno
P valor*
0,073
Negativo
13 (13,3)
44 (44,9)
41 (41,8)
98 (100,0)
Positivo
22 (12,4)
81 (45,8)
74 (40,6)
177 (100,0)
Progesterona
0,066
Negativo
12 (9,7)
61 (49,5)
50 (43,1)
123 (100,0)
Positivo
23 (14,9)
65 (42,2)
66 (42,9)
154 (100,0)
Negativo
27 (13,4)
90 (44,7)
84 (41,9)
201 (100,0)
Positivo
7 (10,5)
32 (47,7)
28 (41,8)
67 (100,0)
Inconclusivo
0 (0,0)
1 (33,3)
2 (66,7)
3 (100,0)
Her-2
0,062
*Qi-quadrado
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
78
Tabela 21: Correlação entre frequência dos genótipos do polimorfismo rs889312 no gene
MAP3K1 e Receptores Hormonais (por grupo).
Receptores Hormonais
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
P valor*
Estrógeno
Grupo 1
0,141
Negativo
5 (17,8)
11 (39,2)
12 (43,0)
28 (100,0)
Positivo
3 (15,0)
7 (35,0)
10 (50,0)
20 (100,0)
Grupo 2
0,152
Negativo
3 (15,8)
6 (31,6)
10 (52,6)
19 (100,0)
Positivo
5 (14,7)
13 (38,2)
16 (47,1)
34 (100,0)
Grupo 3
0,136
Negativo
4 (12,5)
18 (56,2)
10 (31,3)
32 (100,0)
Positivo
7 (11,7)
34 (56,7)
19 (31,6)
60 (100,0)
Grupo 4
Negativo
1 (5,2)
9 (47,4)
9 (47,4)
19 (100,0)
Positivo
7 (11,1)
27 (42,9)
29 (46,0)
63 (100,0)
Negativo
4 (14,3)
11 (39,3)
13 (46,4)
28 (100,0)
Positivo
4 (20,0)
7 (35,0)
9 (45,0)
20 (100,0)
Negativo
2 (11,1)
6 (33,3)
10 (55,6)
18 (100,0)
Positivo
6 (17,1)
13 (37,1)
16 (45,8)
35 (100,0)
Negativo
4 (9,1)
28 (63,6)
12 (27,3)
44 (100,0)
Positivo
7 (14,0)
25 (50,0)
18 (36,0)
50 (100,0)
Negativo
2 (6,0)
16 (48,5)
15 (45,5)
33 (100,0)
Positivo
6 (12,2)
20 (40,9)
23 (46,9)
49 (100,0)
0,147
Progesterona
Grupo 1
0,147
Grupo 2
0,122
Grupo 3
0,124
Grupo 4
0,130
Her-2
Grupo 1
0,173
Negativo
8 (19,0)
15 (35,7)
19 (45,3)
42 (100,0)
Positivo
0 (0,0)
3 (75,0)
1 (25,0)
4 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
1 (100,0)
1 (100,0)
Negativo
7 (18,9)
13 (35,1)
17 (46,0)
37 (100,0)
Positivo
0 (0,0)
5 (35,7)
9 (64,3)
14 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
Negativo
6 (10,1)
33 (55,9)
20 (34,0)
59 (100,0)
Positivo
5 (16,6)
17 (56,7)
8 (26,7)
30 (100,0)
Inconclusivo
0 (0,0)
1 (50,0)
1 (50,0)
2 (100,0)
Grupo 2
0,046
Grupo 3
0,107
Grupo 4
0,147
Negativo
6 (9,5)
29 (46,0)
28 (44,5)
63 (100,0)
Positivo
2 (10,5)
7 (36,9)
10 (52,6)
19 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
*Qi-quadrado / exato de Fisher
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
79
Tabela 22: Correlação entre frequência dos genótipos do polimorfismo rs3817198 no gene
LSP1 e Receptores Hormonais (geral).
TT
N (%)
TC
N (%)
CC
N (%)
Total
N (%)
Negativo
51 (52,6)
40 (41,2)
6 (6,2)
97 (100,0)
Positivo
80 (45,2)
83 (46,9)
14 (7,9)
177 (100,0)
Receptores Hormonais
Estrógeno
0,042
Progesterona
0,077
Negativo
61 (50,0)
50 (41,0)
11 (9,0)
122 (100,0)
Positivo
71 (46,1)
74 (48,1)
9 (5,8)
154 (100,0)
Negativo
98 (48,8)
89 (44,3)
14 (6,9)
201 (100,0)
Positivo
39 (51,4)
31 (40,7)
6 (7,9)
76 (100,0)
0 (0,0)
3 (100)
0 (0,0)
3 (100,0)
HER-2
Inconclusivo
P valor*
0,042
*Qi-quadrado
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
80
Tabela 23: Correlação entre frequência dos genótipos do polimorfismo rs3817198 no gene
LSP1 e Receptores Hormonais (por grupo).
Receptores Hormonais
TT
N (%)
TC
N (%)
CC
N (%)
P valor*
Estrógeno
Grupo 1
0,109
Negativo
13 (46,4)
12 (42,9)
3 (10,7)
28 (100,0)
Positivo
11 (55,0)
9 (45,0)
0 (0,0)
20 (100,0)
Negativo
10 (52,6)
8 (42,1)
1 (5,3)
19 (100,0)
Positivo
18 (53,0)
15 (44,1)
1 (2,9)
34 (100,0)
Negativo
19 (61,3)
11 (35,5)
1 (3,2)
31 (100,0)
Positivo
22 (36,6)
30 (50,0)
8 (13,4)
60 (100,0)
Grupo 2
0,193
Grupo 3
0,007
Grupo 4
0,162
Negativo
9 (47,3)
9 (47,3)
1 (5,4)
19 (100,0)
Positivo
29 (46,0)
29 (46,0)
5 (8,0)
63 (100,0)
Negativo
14 (50,0)
12 (42,8)
2 (7,2)
28 (100,0)
Positivo
10 (50,0)
9 (45,0)
1 (5,0)
20 (100,0)
Progesterona
Grupo 1
0,186
Grupo 2
0,171
Negativo
10 (55,5)
8 (44,5)
0 (0,0)
18 (100,0)
Positivo
18 (51,4)
15 (42,8)
2 (5,8)
35 (100,0)
Negativo
25 (58,1)
14 (32,6)
4 (9,3)
43 (100,0)
Positivo
13 (28,2)
28 (60,9)
5 (10,9)
46 (100,0)
Negativo
12 (36,3)
16 (48,5)
5 (15,2)
33 (100,0)
Positivo
26 (53,1)
22 (44,9)
1 (2,0)
49 (100,0)
Negativo
22 (52,4)
18 (42,9)
2 (4,7)
42 (100,0)
Positivo
1 (25,0)
2 (50,0)
1 (25,0)
4 (100,0)
Inconclusivo
0 (0,0)
1 (100)
0 (0,0)
1 (100,0)
Negativo
20 (54,0)
15 (40,6)
2 (5,4)
37 (100,0)
Positivo
6 (42,9)
8 (57,1)
0 (0,0)
14 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
Grupo 3
0,024
Grupo 4
0,015
Her-2
Grupo 1
0,075
Grupo 2
0,201
Grupo 3
0,119
Negativo
26 (44,1)
26 (44,1)
7 (11,8)
59 (100,0)
Positivo
14 (48,3)
13 (44,8)
2 (6,9)
29 (100,0)
0 (0,0)
2 (100,0)
0 (0,0)
2 (100,0)
Negativo
30 (47,6)
30 (47,6)
3 (4,8)
63 (100,0)
Positivo
8 (42,1)
8 (42,1)
3 (15,8)
19 (100,0)
Inconclusivo
0 (0,0)
0 (0,0)
0 (0,0)
0 (0,0)
Inconclusivo
Grupo 4
0,098
*Qi-quadrado / exato de Fisher
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
81
Quando realizamos análise dos diferentes polimorfismos com os receptores
hormonais notamos uma frequência aumentada de heterozigose nos indivíduos com
receptor de estrógeno positivo. No caso do SNP rs3803662 no gene TNRC9, um percentual
considerável dos indivíduos cujo receptor hormonal era negativo apresentava homozigose
para o alelo G. Em relação ao Her-2 a associação foi com a negatividade, sendo que 79,9%
desses casos estavam em heterozigose. Quando a mesma análise é realizada com o SNP
rs2981582 no gene FGFR2, notamos a presença do genótipo hetrozigoto AG em 53,2% dos
casos com receptor de estrógeno positivo. Adicionalmente tanto para estrógeno quanto
para progesterona, notamos um aumento na frequência do alelo A nos casos cujo receptor
ER ou PR eram positivos.
O SNP rs3817198 no gene LSP1 apresentou associação com receptor de estrógeno,
estando o alelo T (em homozigose) mais freqüente nos casos cujo receptor de estrógeno era
negativo e a combinação de ambos os alelos (heterozigose) ocorreu com mais freqüência
nos casos ER positivos. Em relação aos SNPs rs13281615 e rs889312, não encontramos
associação da freqüência dos mesmos com os receptores hormonais considerados.
Quando a análise dos polimorfismos com os receptores hormonais é realizada de
forma separada entre os grupos estudados notamos algumas associações. Em relação ao
SNP rs2981582 no gene FGFR2 notamos associação do grupo 2 com o receptor de estrógeno,
onde a presença de homozigotos AA não foi observada e, heterozigose AG estava presente
em 73,7% dos casos estrógeno negativos. Adicionalmente quando essa mesma análise é
realizada para o SNP rs13281615 observamos uma associação com a negatividade de her-2
no grupo 3, sendo que 49,1%, eram heterozigotos AG. Já para o SNP rs889312 no gene
MAP3K1 a associação com her-2 negativo é vista no grupo 2, 46,0%, dos casos negativos
tinha a presença em homozigose do alelo A. E por fim o SNP rs3817198 no gene LSP1
mostrou associação com receptor de estrógeno no grupo 3, onde 50,0% dos casos estrógeno
positivo eram heterozigotos (TC). Por fim, no caso do SNP rs3803662 no gene TNRC9, a
frequência aumentada do alelo G em homozigose fica mais evidente nos grupos 1 e 3, onde
a maioria dos casos cujo receptor de estrógeno é negativo apresentam genótipo GG;
Na sequência, realizamos uma correlação entre os polimorfismos com as
características da história familiar classicamente associadas à presença de síndromes de
82
predisposição hereditária ao câncer de mama (como idade ao diagnóstico, número de
gerações afetadas, número de casos de câncer, número de casos de câncer de mama,
presença de câncer de mama bilateral, câncer de ovário).
Uma análise dos genótipos versus os receptores hormonais foi realizada
considerando separadamente os indivíduos mutados em BRCA1 com aqueles com mutação
identificada no gene BRCA2, porém nenhuma associação foi observada nessa análise (dados
não mostrados).
A análise da história familiar de câncer com os diferentes polimorfimos estudados
encontra-se detalhada nas tabelas 24 a 28.
83
Tabela 24: Correlação entre frequência do polimorfismo rs3803662 no gene TNRC9 e a
história familiar de câncer (por grupo).
História familiar
Número de casos de câncer
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Presenca câncer mama bilateral
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Presença câncer ovário
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Número de gerações com câncer
Grupo 1
1
2
3
4
Grupo 2
1
2
3
4
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (25,0)
3 (7,0)
2 (25,0)
25 (58,1)
4 (50,0)
15 (34,9)
8 (100,0)
43 (100,0)
6 (33,3)
6 (17,1)
5 (27,7)
19 (54,3)
7 (38,9)
10 (28,6)
18 (100,0)
35 (100,0)
5 (12,8)
12 (20,3)
18 (46,2)
29 (49,2)
16 (41,0)
18 (30,5)
39 (100,0)
59 (100,0)
11 (20,4)
3 (16,6)
24 (44,4)
10 (55,6)
19 (35,2)
5 (27,8)
54 (100,0)
18 (100,0)
P valor*
0,235
0,149
0,055
0,147
0,198
1 (10,0)
4 (9,8)
6 (60,0)
21 (51,2)
3 (30,0)
16 (39,0)
10 (100,0)
41 (100,0)
2 (40,0)
10 (20,8)
1 (20,0)
23 (48,0)
2 (40,0)
15 (31,2)
5 (100,0)
48 (100,0))
1 (20,0)
16 (17,2)
2 (40,0)
45 (48,4)
2 (40,0)
32 (34,4)
5 (100,0)
93 (100,0)
0 (0,0)
13 (18,3)
0 (0,0)
34 (47,9)
0 (0,0)
24 (33,8)
0 (0,0)
71 (100,0)
0 (0,0)
5 (13,2)
7 (53,8)
20 (52,6)
6 (46,2)
13 (34,2)
13 (100,0)
38 (100,0)
1 (25,0)
11 (22,5)
3 (75,5)
21 (42,9)
0 (0,0)
17 (34,6)
4 (100,0)
49 (100,0)
3 (27,3)
14 (16,1)
5 (45,4)
42 (48,3)
3 (27,3)
31 (35,6)
11 (100,0)
87 (100,0)
0 (0,0)
13 (18,3)
0 (0,0)
34 (47,9)
0 (0,0)
24 (33,8)
0 (0,0)
71 (100,0)
1 (11,1)
4 (20,0)
0 (0,0)
0 (0,0)
3 (33,3)
8 (40,0)
13 (68,4)
3 (100,0)
5 (55,6)
8 (40,0)
6 (31,6)
0 (0,0)
9 (100,0)
20 (100,0)
19 (100,0)
3 (100,0)
5 (45,5)
4 (16,0)
3 (17,7)
0 (0,0)
4 (36,4)
12 (48,0)
8 (47,0)
0 (0,0)
2 (18,1)
9 (36,0)
6 (35,3)
0 (0,0)
11 (100,0)
25 (100,0)
17 (100,0)
0 (0,0)
0,234
0,253
**
0,098
0,175
0,122
**
0,086
0,039
84
Tabela 24 (Cont.): Correlação entre frequência do polimorfismo rs3803662 no gene TNRC9 e
a história familiar de câncer (por grupo).
História familiar
Número de gerações com câncer
Grupo 3
1
2
3
4
Grupo 4
1
2
3
4
Número de casos cancer de mama
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Idade ao diagnóstico
Grupo 1
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 2
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 3
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 4
<=30 anos
>30 e <=50 anos
>50 anos
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (12,5)
9 (18,0)
5 (17,9)
1 (33,3)
8 (50,0)
24 (48,0)
14 (50,0)
1 (33,3)
6 (37,5)
17 (34,0)
9 (32,1)
1 (33,4)
16 (100,0)
50 (100,0)
28 (100,0)
3 (100,0)
10 (22,2)
3 (12,5)
1 (33,3)
0 (0,0)
18 (40,0)
15 (62,5)
1 (33,3)
0 (0,0)
17 (37,8)
6 (25,0)
1 (33,4)
0 (0,0)
45 (100,0)
24 (100,0)
3 (100,0)
0 (0,0)
3 (13,0)
2 (7,1)
8 (34,8)
19 (67,9)
12 (52,2)
7 (25,0)
23 (100,0)
28 (100,0)
11 (25,6)
1 (10,0)
18 (41,9)
6 (60,0)
14 (32,5)
3 (30,0)
43 (100,0)
10 (100,0)
11 (14,5)
6 (28,6)
37 (48,7)
9 (42,8)
28 (36,8)
6 (28,6)
76 (100,0)
21 (100,0)
14 (19,4)
0 (0,0)
34 (47,2)
0 (0,0)
24 (33,4)
0 (0,0)
72 (100,0)
0 (0,0)
0 (0,0)
4 (11,8)
1 (11,1)
4 (50,0)
16 (47,0)
7 (77,8)
4 (50,0)
14 (41,2)
1 (11,1)
8 (100,0)
34 (100,0)
9 (100,0)
4 (16,7)
7 (29,2)
1 (20,0)
14 (58,3)
10 (41,6)
0 (0,0)
6 (25,0)
7 (29,2)
4 (80,0)
24 (100,0)
24 (100,0)
5 (100,0)
3 (10,0)
9 (16,6)
4 (30,8)
12 (40,0)
28 (51,9)
7 (53,9)
15 (50,0)
17 (31,5)
2 (15,3)
30 (100,0)
54 (100,0)
13 (100,0)
0 (0,0)
10 (25,0)
6 (14,3)
0 (0,0)
12 (30,0)
25 (59,5)
0 (0,0)
18 (45,0)
11 (26,2)
0 (0,0)
40 (100,0)
42 (100,0)
P valor*
0,066
0,107
0,089
0,167
0,061
**
0,041
0,083
0,004
0,106
*Qi-quadrado / exato de Fisher
**Não foi possível realizar a análise comparativa no grupo 4 para as variáveis presença de câncer de mama bilateral,
presença de câncer de ovário e idade ao dignóstico.
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
85
Tabela 25: Correlação entre frequência do polimorfismo rs2981582 no gene FGFR2 e a
história familiar de câncer (por grupo).
História familiar
Número de casos de câncer
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Presenca câncer mama bilateral
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Presença câncer ovário
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Número de gerações com câncer
Grupo 1
1
2
3
4
Grupo 2
1
2
3
4
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (25,0)
12 (27,9)
1 (12,5)
21 (48,8)
5 (62,5)
10 (23,3)
8 (100,0)
43 (100,0)
4 (22,2)
5 (13,9)
10 (55,6)
23 (63,9)
4 (22,2)
8 (22,2)
18 (100,0)
36 (100,0)
11 (27,5)
15 (25,4)
17 (42,5)
32 (54,2)
12 (30,0)
12 (20,4)
40 (100,0)
59 (100,0)
15 (27,7)
2 (11,1)
25 (46,3)
13 (72,2)
14 (26,0)
3 (16,7)
54 (100,0)
18 (100,0)
P valor*
0,074
0,164
0,100
0,144
0,111
3 (30,0)
11 (26,8)
6 (60,0)
16 (39,0)
1 (10,0)
14 (34,2)
10 (100,0)
41 (100,0)
0 (0,0)
9 (18,3)
4 (80,0)
29 (59,2)
1 (20,0)
11 (22,5)
5 (100,0)
49 (100,0)
1 (20,0)
25 (26,6)
3 (60,0)
46 (48,9)
1 (20,0)
23 (24,5)
5 (100,0)
94 (100,0)
0 (0,0)
17 (24,0)
0 (0,0)
38 (53,5)
0 (0,0)
16 (22,5)
0 (0,0)
71 (100,0)
2 (15,4)
12 (31,6)
7 (53,9)
15 (39,5)
4 (30,7)
11 (28,9)
13 (100,0)
38 (100,0)
0 (0,0)
9 (18,0)
3 (75,0)
30 (60,0)
1 (25,0)
11 (22,0)
4 (100,0)
50 (100,0)
0 (0,0)
26 (29,2)
8 (80,0)
41 (46,1)
2 (20,0)
22 (24,7)
10 (100,0)
89 (100,0)
0 (0,0)
17 (24,0)
0 (0,0)
38 (53,5)
0 (0,0)
16 (22,5)
0 (0,0)
71 (100,0)
2 (22,2)
8 (40,0)
2 (10,5)
2 (66,7)
3 (33,3)
6 (30,0)
13 (68,4)
0 (0,0)
4 (44,5)
6 (30,0)
4 (21,1)
1 (33,3)
9 (100,0)
20 (100,0)
19 (100,0)
3 (100,0)
1 (9,1)
6 (24,0)
2 (11,1)
0 (0,0)
6 (54,5)
15 (60,0)
12 (66,6)
0 (0,0)
4 (36,4)
4 (16,0)
4 (22,3)
0 (0,0)
11 (100,0)
25 (100,0)
18 (100,0)
0 (0,0)
0,257
0,249
**
0,129
0,269
0,111
**
0,077
0,109
86
Tabela 25 (Cont.): Correlação entre frequência do polimorfismo rs2981582 no gene FGFR2 e
a história familiar de câncer (por grupo).
História familiar
Número de gerações com câncer
Grupo 3
1
2
3
4
Grupo 4
1
2
3
4
Número de casos câncer de mama
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Idade ao diagnóstico
Grupo 1
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 2
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 3
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 4
<=30 anos
>30 e <=50 anos
>50 anos
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
3 (18,7)
14 (8,4)
8 (27,6)
1 (33,3)
7 (43,8)
23 (13,7)
17 (58,6)
1 (33,3)
6 (37,5)
13 (77,9)
4 (13,8)
1 (33,4)
16 (100,0)
50 (100,0)
29 (100,0)
3 (100,0)
14 (31,1)
3 (12,5)
0 (0,0)
0 (0,0)
22 (48,9)
14 (58,3)
2 (66,3)
0 (0,0)
9 (20,0)
7 (29,2)
1 (33,4)
0 (0,0)
45 (100,0)
24 (100,0)
3 (100,0)
0 (0,0)
6 (26,1)
8 (28,6)
7 (30,4)
15 (53,6)
10 (43,5)
5 (17,8)
23 (100,0)
28 (100,0)
9 (20,5)
0 (0,0)
25 (56,8)
8 (66,6)
10 (22,7)
4 (33,4)
44 (100,0)
10 (100,0)
18 (23,7)
7 (31,8)
38 (50,0)
11 (50,0)
20 (26,3)
4 (18,2)
76 (100,0)
22 (100,0)
17 (23,6)
0 (0,0)
38 (52,8)
0 (0,0)
17 (23,6)
0 (0,0)
72 (100,0)
0 (0,0)
2 (25,0)
10 (29,4)
2 (22,2)
4 (50,0)
13 (38,2)
5 (55,6)
2 (25,0)
11 (32,4)
2 (22,2)
8 (100,0)
34 (100,0)
9 (100,0)
6 (25,0)
3 (12,0)
0 (0,0)
12 (50,0)
18 (72,0)
3 (60,0)
6 (25,0)
4 (16,0)
2 (40,0)
24 (100,0)
25 (100,0)
5 (100,0)
10 (33,3)
13 (23,2)
3 (25,0)
12 (40,0)
31 (55,4)
6 (50,0)
8 (26,7)
12 (21,4)
3 (25,0)
30 (100,0)
56 (100,0)
12 (100,0)
0 (0,0)
10 (25,0)
9 (21,4)
0 (0,0)
19 (47,5)
24 (57,1)
0 (0,0)
11 (27,5)
9 (21,5)
0 (0,0)
40 (100,0)
42 (100,0)
P valor*
0,035
0,025
0,063
0,162
0,087
**
0,125
0,080
0,085
0,125
* Qi-quadrado / exato de Fisher
**Não foi possível realizar a análise comparativa no grupo 4 para as variáveis presença de câncer de mama bilateral,
presença de câncer de ovário e número de casos de câncer de mama.
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
87
Tabela 26: Correlação entre frequência do polimorfismo rs13281615 e a história familiar de
câncer (por grupo).
História familiar
Número de casos de câncer
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Presenca câncer mama bilateral
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Presença câncer ovário
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Número de gerações com câncer
Grupo 1
1
2
3
4
Grupo 2
1
2
3
4
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (25,0)
12 (27,9)
6 (75,0)
18 (41,8)
0 (0,0)
13 (33,3)
8 (100,0)
43 (100,0)
7 (41,2)
4 (11,1)
8 (47,0)
17 (47,2)
2 (11,8)
15 (41,7)
18 (100,0)
36 (100,0)
12 (30,0)
15 (25,0)
22 (55,0)
26 (43,3)
6 (15,0)
19 (31,7)
40 (100,0)
60 (100,0)
15 (27,8)
3 (16,6)
27 (50,0)
8 (44,4)
12 (22,2)
7 (38,8)
54 (100,0)
18 (100,0)
P valor*
0,133
0,003
0,039
0,056
0,008
1 (10,0)
13 (31,7)
3 (30,0)
21 (51,2)
6 (60,0)
7 (17,1)
41 (100,0)
10 (100,0)
0 (0,0)
11 (22,5)
1 (20,0)
25 (51,0)
4 (80,0)
13 (26,5)
5 (100,0)
49 (100,0)
2 (40,0)
25 (26,3)
1 (20,0)
47 (49,5)
2 (40,0)
23 (24,2)
95 (100,0)
5 (100,0)
0 (0,0)
18 (25,3)
0 (0,0)
34 (47,9)
0 (0,0)
19 (26,8)
0 (0,0)
71 (100,0)
5 (38,5)
9 (23,7)
6 (46,1)
18 (47,3)
2 (15,4)
11 (29,0)
13 (100,0)
38 (100,0)
1 (25,0)
10 (20,0)
3 (75,0)
23 (46,0)
0 (0,0)
17 (34,0)
4 (100,0)
50 (100,0)
5 (45,4)
22 (24,7)
3 (27,3)
45 (50,6)
3 (27,3)
22 (24,7)
11 (100,0)
89 (100,0)
0 (0,0)
18 (25,3)
0 (0,0)
34 (47,9)
0 (0,0)
19 (26,8)
0 (0,0)
71 (100,0)
2 (22,2)
3 (15,0)
9 (47,4)
0 (0,0)
4 (44,5)
14 (70,0)
5 (26,3)
1 (33,3)
3 (33,3)
3 (15,0)
5 (26,3)
2 (66,7)
9 (100,0)
20 (100,0))
19 (100,0)
3 (100,0)
6 (54,6)
3 (12,0)
2 (1,2)
0 (0,0)
4 (36,3)
14 (56,0)
8 (44,4)
0 (0,0)
1 (9,1)
8 (32,0)
8 (44,4)
0 (0,0)
11 (100,0)
25 (100,0)
18 (100,0)
0 (0,0)
0,020
0,245
**
0,086
0,167
0,130
**
0,090
0,003
88
Tabela 26 (Cont.): Correlação entre frequência do polimorfismo rs13281615 e a história
familiar de câncer (por grupo).
História familiar
Número de gerações com câncer
Grupo 3
1
2
3
4
Grupo 4
1
2
3
4
Número de casos câncer de mama
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Idade ao diagnóstico
Grupo 1
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 2
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 3
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 4
<=30 anos
>30 e <=50 anos
>50 anos
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
6 (37,5)
16 (32,0)
5 (16,6)
0 (0,0)
8 (50,0)
23 (46,0)
14 (46,7)
2 (66,7)
2 (12,5)
11 (22,0)
11 (36,7)
1 (33,3)
16 (100,0)
50 (100,0)
30 (100,0)
3 (100,0)
13 (28,9)
4 (16,6)
1 (33,3)
0 (0,0)
24 (53,3)
10 (41,7)
1 (33,3)
0 (0,0)
8 (17,8)
10 (41,7)
1 (33,4)
0 (0,0)
45 (100,0)
24 (100,0)
3 (100,0)
0 (0,0)
5 (21,7)
9 (32,1)
14 (60,9)
10 (35,8)
4 (17,4)
9 (32,1)
23 (100,0)
28 (100,0)
10 (22,7)
1 (10,0)
21 (47,7)
5 (50,0)
13 (29,6)
4 (40,0)
44 (100,0)
10 (100,0)
22 (28,6)
5 (22,7)
35 (45,4)
12 (54,6)
20 (26,0)
5 (22,7)
77 (100,0)
22 (100,0)
18 (25,0)
0 (0,0)
35 (48,6)
0 (0,0)
19 (26,4)
0 (0,0)
72 (100,0)
0 (0,0)
4 (50,0)
7 (20,5)
3 (33,3)
4 (50,0)
18 (53,0)
2 (22,2)
0 (0,0)
9 (26,5)
4 (44,5)
8 (100,0)
34 (100,0)
9 (100,0)
8 (33,3)
2 (8,0)
1 (20,0)
8 (33,3)
15 (60,0)
3 (60,0)
8 (33,4)
8 (32,0)
1 (20,0)
24 (100,0)
25 (100,0)
5 (100,0)
11 (36,6)
13 (23,2)
3 (23,1)
13 (43,4)
27 (48,2)
8 (61,5)
6 (20,0)
16 (28,6)
2 (15,4)
30 (100,0)
56 (100,0)
13 (100,0)
0 (0,0)
13 (32,5)
10 (23,8)
0 (0,0)
19 (47,5)
18 (42,9)
0 (0,0)
8 (20,0)
14 (33,3)
0 (0,0)
40 (100,0)
42 (100,0)
P valor*
0,005
0,033
0,148
0,130
0,130
**
0,034
0,097
0,065
0,049
* Qi-quadrado / exato de Fisher
**Não foi possível realizar a análise comparativa no grupo 4 para as variáveis presença de câncer de mama bilateral,
presença de câncer de ovário e número de casos de câncer de mama.
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
89
Tabela 27: Correlação entre frequência do polimorfismo rs889312 no gene MAP3K1 e a
história familiar de câncer (por grupo).
História familiar
Número de casos de câncer
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Presença câncer mama bilateral
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Presença câncer ovário
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Número de gerações com câncer
Grupo 1
1
2
3
4
Grupo 2
1
2
3
4
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
2 (25,0)
6 (14,0)
2 (25,0)
19 (44,1)
4 (50,0)
18 (41,9)
8 (100,0)
43 (100,0)
4 (22,2)
4 (11,1)
7 (38,9)
13 (36,1)
7 (38,9)
19 (52,8)
18 (100,0)
36 (100,0)
5 (12,5)
6 (10,0)
19 (47,5)
36 (60,0)
16 (40,0)
18 (30,0)
40 (100,0)
60 (100,0)
3 (5,6)
3 (16,6)
24 (44,4)
9 (50,0)
27 (50,0)
6 (33,4)
54 (100,0)
18 (100,0)
P valor*
0,205
0,077
0,109
0,048
0,079
2 (20,0)
6 (14,6)
6 (60,0)
15 (36,6)
2 (20,0)
20 (48,8)
10 (100,0)
41 (100,0)
2 (40,0)
6 (12,2)
3 (60,0)
17 (34,7)
0 (0,0)
26 (53,1)
5 (100,0)
49 (100,0)
1 (20,0)
10 (10,5)
3 (60,0)
52 (54,7)
1 (20,0)
33 (34,8)
5 (100,0)
95 (100,0)
0 (0,0)
6 (8,2)
0 (0,0)
33 (45,2)
0 (0,0)
34 (46,6)
0 (0,0)
71 (100,0)
1 (7,6)
7 (18,4)
6 (46,2)
15 (39,5)
6 (46,2)
16 (42,1)
13 (100,0)
38 (100,0)
0 (0,0)
8 (16,0)
1 (25,0)
19 (38,0)
3 (75,0)
23 (46,0)
4 (100,0)
50 (100,0)
1 (9,0)
10 (11,2)
5 (45,5)
50 (56,2)
5 (45,5)
29 (32,6)
11 (100,0)
89 (100,0)
0 (0,0)
6 (8,4)
0 (0,0)
33 (46,5)
0 (0,0)
32 (45,1)
0 (0,0)
71 (100,0)
0 (0,0)
5 (25,0)
3 (15,8)
0 (0,0)
6 (66,7)
4 (20,0)
9 (47,3)
2 (66,4)
3 (33,3)
11 (55,0)
7 (36,9)
1 (33,3)
9 (100,0)
20 (100,0)
19 (100,0)
3 (100,0)
0,019
0,199
**
0,147
0,164
0,156
**
0,088
0,081
3 (27,3)
3 (12,0)
2 (11,1)
0 (0,0)
3 (27,3)
10 (40,0)
7 (38,9)
0 (0,0)
5 (45,4)
12 (48,0)
9 (50,0)
0 (0,0)
11 (100,0)
25 (100,0)
18 (100,0)
0 (0,0)
90
Tabela 27 (Cont.): Correlação entre frequência do polimorfismo rs889312 no gene MAP3K1
e a história familiar de câncer (por grupo).
História familiar
Número de gerações com câncer
Grupo 3
1
2
3
4
Grupo 4
1
2
3
4
Número de casos câncer de mama
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Idade ao diagnóstico
Grupo 1
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 2
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 3
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 4
<=30 anos
>30 e <=50 anos
>50 anos
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
1 (6,3)
6 (12,0)
4 (13,3)
0 (0,0)
9 (56,2)
22 (44,0)
20 (66,7)
3 (100,0)
6 (37,5)
22 (44,0)
6 (20,0)
0 (0,0)
16 (100,0)
50 (100,0)
30 (100,0)
3 (100,0)
3 (6,7)
2 (8,3)
1 (33,3)
0 (0,0)
18 (40,0)
14 (58,4)
1 (33,3)
0 (0,0)
24 (53,3)
8 (33,3)
1 (33,4)
0 (0,0)
45 (100,0)
24 (100,0)
3 (100,0)
5 (21,8)
3 (10,7)
9 (39,1)
12 (42,8)
9 (39,1)
13 (46,5)
23 (100,0)
28 (100,0)
7 (15,9)
1 (10,0)
17 (38,6)
3 (30,0)
20 (45,5)
6 (60,0)
44 (100,0)
10 (100,0)
9 (11,7)
2 (9,1)
40 (51,9)
15 (68,2)
28 (36,4)
5 (22,7)
77 (100,0)
22 (100,0)
6 (8,4)
0 (0,0)
33 (45,8)
0 (0,0)
33 (45,8)
0 (0,0)
72 (100,0)
0 (0,0)
1 (12,5)
6 (17,6)
1 (11,1)
3 (37,5)
13 (38,2)
5 (55,5)
4 (50,0)
15 (44,2)
3 (33,4)
8 (100,0)
34 (100,0)
9 (100,0)
3 (12,5)
3 (12,0)
2 (40,0)
7 (29,1)
11 (44,0)
2 (40,0)
14 (58,4)
11 (44,0)
1 (20,0)
24 (100,0)
25 (100,0)
5 (100,0)
5 (16,7)
4 (7,1)
2 (15,4)
13 (43,3)
34 (60,8)
8 (61,5)
12 (40,0)
18 (32,1)
3 (23,1)
30 (100,0)
56 (100,0)
13 (100,0)
0 (0,0)
1 (2,5)
7 (16,7)
0 (0,0)
15 (37,5)
21 (50,0)
0 (0,0)
24 (60,0)
14 (33,3)
0 (0,0)
40 (100,0)
42 (100,0)
P valor*
0,023
0,031
0,103
0,146
0,116
**
0,121
0,030
0,085
0,002
* Qi-quadrado / exato de Fisher
**Não foi possível realizar a análise comparativa no grupo 4 para as variáveis presença de câncer de mama bilateral,
presença de câncer de ovário e número de casos de câncer de mama.
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
91
Tabela 28: Correlação entre frequência do polimorfismo rs3817198 no gene LSP1 e a história
familiar de câncer (por grupo).
História familiar
Número de casos de câncer
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Presenca câncer mama bilateral
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Presença câncer ovário
Grupo 1
Sim
Não
Grupo 2
Sim
Não
Grupo 3
Sim
Não
Grupo 4
Sim
Não
Número de gerações com câncer
Grupo 1
1
2
3
4
Grupo 2
1
2
3
4
TT
N (%)
TC
N (%)
CC
N (%)
Total
N (%)
2 (25,0)
24 (55,9)
5 (62,5)
17 (39,5)
1 (12,5)
2 (4,6)
8 (100,0)
43 (100,0)
10 (55,5)
18 (50,0)
7 (38,9)
17 (47,2)
1 (5,5)
1 (2,8)
18 (100,0)
36 (100,0)
19 (47,5)
25 (42,4)
13 (32,5)
30 (50,8)
8 (20,0)
4 (6,8)
40 (100,0)
59 (100,0)
28 (51,9)
7 (38,9)
22 (40,7)
9 (50,0)
4 (7,4)
2 (11,1)
54 (100,0)
18 (100,0)
P valor*
0,067
0,196
0,100
0,105
0,081
3 (30,0)
23 (56,1)
6 (60,0)
16 (39,0)
1 (10,0)
2 (4,9)
41 (100,0)
10 (100,0)
2 (40,0)
26 (53,0)
3 (60,0)
21 (42,9)
0 (0,0)
2 (4,1)
5 (100,0)
49 (100,0)
1 (20,0)
43 (45,7)
1 (20,0)
42 (44,7)
3 (60,0)
9 (9,6)
5 (100,0)
94 (100,0)
0 (0,0)
35 (49,3)
0 (0,0)
30 (42,3)
0 (0,0)
6 (8,4)
0 (0,0)
71 (100,0)
11 (84,6)
15 (39,4)
1 (7,7)
21 (55,3)
1 (7,7)
2 (5,3)
13 (100,0)
38 (100,0)
3 (75,0)
25 (50,0)
1 (25,0)
23 (46,0)
0 (0,0)
2 (4,0)
4 (100,0)
50 (100,0)
4 (40,0)
40 (45,0)
4 (40,0)
39 (43,8)
2 (20,0)
10 (11,2)
10 (100,0)
89 (100,0)
0 (0,0)
35 (49,3)
0 (0,0)
30 (42,2)
0 (0,0)
6 (8,5)
0 (0,0)
71 (100,0)
6 (66,7)
9 (45,0)
10 (52,6)
1 (33,3)
2 (22,2)
10 (50,0)
8 (42,1)
2 (66,7)
1 (11,1)
1 (5,0)
1 (5,3)
0 (0,0)
9 (100,0)
20 (100,0)
19 (100,0)
3 (100,0)
4 (36,4)
12 (48,0)
12 (66,6)
0 (0,0)
6 (54,5)
13 (52,0)
5 (27,8)
0 (0,0)
1 (9,1)
0 (0,0)
1 (5,6)
0 (0,0)
11 (100,0)
25 (100,0)
18 (100,0)
0 (0,0)
0,292
0,017
**
0,018
0,249
0,156
**
0,103
0,042
92
Tabela 28 (Cont.): Correlação entre frequência do polimorfismo rs3817198 no gene LSP1 e a
história familiar de câncer (por grupo).
História familiar
Número de gerações com câncer
Grupo 3
1
2
3
4
Grupo 4
1
2
3
4
Número de casos cancer de mama
Grupo 1
<=3
>3
Grupo 2
<=3
>3
Grupo 3
<=3
>3
Grupo 4
<=3
>3
Idade ao diagnóstico
Grupo 1
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 2
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 3
<=30 anos
>30 e <=50 anos
>50 anos
Grupo 4
<=30 anos
>30 e <=50 anos
>50 anos
TT
N (%)
TC
N (%)
CC
N (%)
Total
N (%)
11 (68,8)
20 (40,0)
11 (37,9)
1 (33,3)
5 (31,2)
25 (50,0)
11 (37,9)
2 (66,7)
0 (0,0)
5 (10,0)
7 (24,2)
0 (0,0)
16 (100,0)
50 (100,0)
29 (100,0)
3 (100,0)
25 (55,5)
10 (41,7)
0 (0,0)
0 (0,0)
17 (37,8)
12 (50,0)
2 (66,7)
0 (0,0)
3 (6,7)
2 (8,3)
1 (33,3)
0 (0,0)
45 (100,0)
24 (100,0)
3 (100,0)
0 (0,0)
13 (56,5)
13 (46,4)
8 (34,8)
14 (50,0)
2 (8,7)
1 (3,6)
23 (100,0)
28 (100,0)
21 (47,7)
7 (70,0)
22 (50,0)
2 (20,0)
1 (2,3)
1 (10,0)
44 (100,0)
10 (100,0)
36 (47,3)
8 (36,4)
31 (40,8)
12 (54,5)
9 (11,9)
2 (9,1)
76 (100,0)
22 (100,0)
35 (48,6)
0 (0,0)
31 (43,0)
0 (0,0)
6 (8,4)
0 (0,0)
72 (100,0)
0 (0,0)
6 (75,0)
16 (47,0)
4 (44,4)
1 (12,5)
17 (50,0)
4 (44,4)
1 (12,5)
1 (3,0)
1 (11,2)
8 (100,0)
34 (100,0)
9 (100,0)
10 (41,7)
15 (60,0)
3 (60,0)
13 (54,1)
10 (40,0)
1 (20,0)
1 (4,2)
0 (0,0)
1 (20,0)
24 (100,0)
25 (100,0)
5 (100,0)
17 (56,7)
20 (35,7)
7 (58,3)
11 (36,7)
27 (48,2)
5 (41,7)
2 (6,6)
9 (16,1)
0 (0,0)
30 (100,0)
56 (100,0)
12 (100,0)
0 (0,0)
17 (42,5)
21 (50,0)
0 (0,0)
20 (50,0)
18 (42,9)
0 (0,0)
3 (7,5)
3 (7,1)
0 (0,0)
40 (100,0)
42 (100,0)
P valor*
0,007
0,020
0,175
0,195
0,124
**
0,100
0,109
0,085
0,120
* Qi-quadrado / exato de Fisher
**Não foi possível realizar a análise comparativa no grupo 4 para as variáveis presença de câncer de mama bilateral,
presença de câncer de ovário e número de casos de câncer de mama.
Nota: Valores em negrito indicam valores com significância estatística (p<0,05).
93
Quando a comparação entre os diferentes genótipos é realizada contra
características da história familiar de câncer, observamos pelo menos uma associação para
todos os SNPs avaliados no presente estudo. Para o SNP rs3803662 no gene TNRC9
associações foram encontradas com número de gerações afetadas com câncer e idade ao
diagnóstico. Notamos que 45,5% das mulheres do grupo 2 com apenas uma geração afetada
com câncer eram do genótipo AA, sendo que para todos os demais grupos e variáveis o
genótipo predominate foi o AG. No que se refere à idade ao diagnóstico, notamos que 50,0%
das mulheres do grupo 1 e grupo 3 apresentavam homozigose para o alelo G, e, a proporção
de homozigose para esse alelo vai diminuindo à medida em que a idade ao diagnóstico
aumenta (presente em 41,2% daquelas com diagnóstico entre 30 e 50 anos e em 11,1%
daquelas diagnosticadas após os 50 anos de idade).
Quando a comparação da história familiar é feita com o SNP rs2981582 (no gene
FGFR2) embora o dado não tenha apresentado significância estatística, observamos que
mulheres do grupo 1 com genótipo GG apresentavam um menor número de casos de câncer
(62,5% com menos de 3 casos de câncer na família) e menor número de casos de câncer de
mama (43,5% relataram a existência de menos de 3 casos de câncer de mama na família).
Em relação ao SNP rs13281615 uma associação foi encontrada com a presença de
câncer de mama bilateral, sendo que 60,0% dos casos do grupo 1 com câncer de mama
bilateral apresentavam genótipo GG (versus 17,1% ds casos sem história familiar de câncer
de mama bilateral). O mesmo se repetiu nos grupos 2 e 3 (80% de GG nas mulheres com
mama bilateral do grupo 2 vs 26,5% naquelas sem mama bilateral e, no grupo 3 a diferença
foi de 40% para 24,2%). Em relação ao número de casos de câncer observamos que o
genótipo homozigoto G estava presente em 41,7% das famílias do grupo 1 com mais de 3
casos de câncer, em 31,7% e em 38,8% das famílias dos grupos 2 e 3 respectivamente que
apresentavam mais de 3 casos de câncer nas suas famílias. Adicionalmente, embora trate-se
de um número amostral reduzido, cabe destacar que 66,7% das mulheres do grupo 1 com 4
gerações afetadas eram homozigotas GG, ocorrendo uma tendência a um aumento na
freqüência de homozigotas GG à medida em que aumenta o número de gerações afetadas
por câncer. No caso do polimorfismo rs889312 (gene MAP3K1), chamou a nossa atenção o
fato de que a medida em que a idade ao diagnóstico aumenta, diminui a freqüência de
homozigotos para o alelo A nos 4 grupos considerados.
94
No polimorfismo rs3817198 no gene LSP1 notamos a mesma tendência: uma
pequena associação com o número de gerações afetadas com câncer para os grupos 2, 3 e 4.
E a presença de câncer de mama bilateral foi observada no grupo 3 em 60,0% dos casos com
genótipo CC. Já o câncer de ovário esteve presente em 84,6% do grupo 1 com genótipo TT
normal.
Adicionalmente, a comparação da frequência dos diferentes genótipos versus a
história familiar foi realizada considerando separadamente as mulheres com mutação no
gene BRCA1 versus as mutadas no gene BRCA2. Dado o número amostral restrito de
pacientes com mutação deletéria identificada nesses genes, a estratificação em grupos por
gene mutado limitou as análises estatísticas a serem realizadas, no entanto algumas
tendências puderam ser observadas, onde destaca-se o fato de que todas as mulheres
mutadas no gene BRCA2 com câncer de mama bilateral eram homozigotas para o alelo G no
rs132281615 e, dentre as mutadas em BRCA1 e com câncer de mama bilateral, 86%
apresentavam pelo menos um alelo G. Adicionalmente, em relação ao rs3817198, todas as
mulheres com mutação no gene BRCA1 e com câncer de ovário apresentavam pelo menos
um alelo T, (sendo 88,9% homozigotas TT), o mesmo não foi observado para as mutadas em
BRCA2 e com história pessoal de câncer de ovário (p=0,006). No entanto para que
conclusões possam ser realizadas acerca da associação desses polimorfismos com o status
mutacional de BRCA1/2 e com a história familiar de câncer, um número maior de pacientes
com essas características precisa ser genotipado.
Embora esses achados possam ser ocasionais e devidos ao pequeno número amostral
analisado, vários achados merecem destaque e necessitam ser validados em um número
amostral maior, como por exemplo a associação identificada entre o SNP rs13281615 e
achados da história familiar, tais como presença de câncer de mama bilateral, idade ao
diagnóstico e número de casos de câncer presentes na família. Cabe ressaltar que, embora
interessantes e promissores, tratam-se de achados preliminares que necessitam de
confirmações e validações posteriores.
95
5.5 Identificação de indivíduos não-testados para mutações germinativas em BRCA1/2 que
poderiam se beneficiar do teste pela combinação de seus dados histopatológicos e dos
diferentes polimorfismos analisados
Para que os indivíduos não-testados, mas em risco para câncer hereditário, pudessem
ser identificados era necessário que as características que distinguem os grupos (mutados e
não mutados) fossem identificadas. Para tanto realizamos, inicialmente, uma comparação da
história familiar e das características histopatológicas e imunohistoquímicas do grupo 1
versus os grupos 2, 3 e 4. Os resultados dessas comparações encontram-se detalhados nas
tabelas 29 e 30.
96
Tabela 29: Características de história familiar do grupo 1 versus os grupos 2, 3 e 4.
Variável (Grupo 1)
Grupo 2
Presença de câncer de mama
P valor
Grupo 3
0,130
bilateral
P valor
Grupo 4
0,005
<0,001
Sim
9,3
5,0
0
Não
90,7
95,0
100,0
Presença de câncer de mama
*
masculino
*
*
Sim
0
0
0
Não
100
100
100
Presença de câncer de ovário
0,012
0,021
<0,001
Sim
7,4
11,0
0
Não
92,6
89,0
100
Número de gerações afetadas
0,331
com câncer
0,558
<0,001
1
20,4
16,2
62,5
2
46,3
50,5
33,3
3
33,3
30,3
4,2
4
0
3,0
0
Numero de casos de câncer de
<0,001
mama
<0,001
<0,001
<=3
81,5
77,8
100,0
>3
18,5
22,8
0,0
Total de casos de câncer
0,036
0,002
<0,001
<=3
33,3
40,0
75,0
>3
66,7
60,0
25,0
Número de óbitos por câncer de
0,480
mama
0,018
0,011
<=3
94,4
99,0
100
>3
5,6
1,0
0
Total de óbitos por câncer
0,83
<0,001
<0,001
<=3
70,6
90,9
97,2
>3
20,4
9,1
2,8
Idade ao diagnóstico
0,005
P valor
0,144
<0,001
<=30
44,4
30,3
0,0
>30 e <=50
46,3
56,6
48,8
>50
9,3
13,1
51,2
*Análise de comparação com correção de Bonferroni
Nota: Valores em negrito indicam valores com significância estatística (p<0,02).
97
Tabela 30: Características histopatológicas e imunohistoquímicas do grupo 1 versus os
grupos 2, 3 e 4.
Variável (Grupo 1)
Grupo 2 (%)
Local do tumor
P valor
Grupo 3 (%)
0,619
P valor
Grupo4 (%)
0,664
0,379
Unilateral
94,4
96,0
100,0
Bilateral
5,6
4,0
0,0
Anatomopatológico
0,317
1,0
1,0
Carcinoma ductal invasivo
85,1
94,4
92,1
Outros
14,9
5,6
7,9
Grau histológico
0,309
0,263
0,090
1
8,5
11,9
8,2
2
61,7
46,4
67,1
3
29,8
41,7
24,7
Receptor de estrógeno
0,024
0,008
<0,001
Negativo
35,8
34,8
23,2
Positivo
64,2
65,2
76,8
Receptor de progesterona
0,014
0,194
0,046
Negativo
34,0
46,8
40,2
Positivo
66,0
53,2
59,8
Her – 2
0,019
0,004
0,030
Negativo
72,5
64,8
76,8
Positivo
27,5
33,0
23,2
Duvidoso
2,2
Ki-67
1,000
<=14
7,7
>14
92,3
Citoqueratina 5/6
Negativo
92,3
Positivo
7,7
Citoqueratina 14
16,0
90,3
Positivo
9,7
Triplo negativo
13,2
Não
86,8
Subtipo Molecular
68,1
0,213
74,1
0,001
90,6
25,9
9,4
0,748
76,8
0,212
81,9
23,2
<0,001
Sim
0,006
31,9
84,0
0,054
Negativo
0,0
0,378
0,007
18,1
<0,001
19,6
<0,001
9,8
80,4
0,004
P valor
90,2
0,013
0,001
Luminal A
2,6
11,0
26,0
Luminal Her 2 negativo
57,9
34,2
42,5
Luminal Her2 positivo
23,7
26,0
16,4
Basal like
2,6
13,7
5,5
Her 2 superexpresso
13,2
15,1
9,6
*Análise de comparação com correção de Bonferroni
Nota: Valores em negrito indicam valores com significância estatística (p<0,02).
98
Na sequência uma analíse multivariada foi realizada, onde o grupo mutado foi
comparado com os três outros grupos (agrupados sob a classificação de “não-mutados”)
quanto a todas as variáveis presentes nas tabelas 29 e 30 acima. Com essa análise múltipla
pudemos identificar quais características diferiam entre os dois grupos e o “peso” que cada
uma dessas características conferia para a chance de “ser portador de mutação germinativa
nos genes BRCA1/BRCA2’’.
Dentre as variáveis analisadas, as que apresentaram resultados estatisticamente
significativos e que merecem destaque dada sua relação com a presença de mutação
germinativa deletéria nos genes BRCA1/BRCA2 são: triplo negatividade (risco aumentado
(odds ratio) em 5,883 vezes (IC 95%, 2,562 a 13,510, p<0,001); presença na família de câncer
de mama bilateral: aumento no risco de 5,797 vezes (IC 95%, 1,797 a 18,701, p=0,003),
número de casos de câncer de mama: risco aumentado de 5,033 vezes (IC 95%, 2,149 a
11,788, p<0,001), presença de câncer de ovário: risco de 4,412 vezes (IC 95%, 1,531 a
12,716, p=0,006), total de óbitos por câncer: risco de 2,906 vezes (IC 95%, 1,077 a 7,840,
p=0,035).
Considerando as variáveis que se destacaram como relacionadas a um aumento na
chance de possuir mutação germinativa deletéria nos genes BRCA1/BRCA2, analisamos de
forma criteriosa, dentre as mulheres do grupo 4 (não testadas para BRCA1/BRCA2) para
verificar se haveria alguma que, mesmo não tendo preenchido os critérios para teste
genético estabelecidos pelo Departamento de Oncogenética do HCB (probabilidade de
mutação pelas tabelas de prevalência de mutação Myriad superior a 30%, preenchimento de
um ou mais dos critérios clínicos preconizados pela ASCO, além de história pessoal de câncer
de mama em idade inferior a 40 anos e história pessoal ou familiar de câncer de ovário)
possuía um risco aumentado de câncer de mama e/ou ovário hereditários. Dessa forma,
através dessa análise dos heredogramas e laudos anátomo patológicos , identificamos 8
mulheres cujo tumor era triplo negativo. Ao analisar o heredograma dessas 8 famílias
notamos que uma delas apresentava um segundo fator de risco (além da triplo
negatividade), que é a presença de mais de 3 casos de câncer na família. Casos como esse
devem ser encaminhados para a Oncogenética para avaliação de risco genético, dada a
combinação de dados histopatológicos e de história familiar que apresentam.
99
Cabe dessa forma destacar a importância de considerar, para a identificação de
pacientes em risco, não apenas a idade ao diagnóstico, mas outros fatores, tais como
presença de triplo negatividade no tumor, presença de câncer de mama bilateral, associação
de história familiar de câncer de mama e de ovário, múltiplos casos e óbitos na família de
uma mesma patologia (no caso o câncer de mama), de forma a identificar e acompanhar
corretamente as famílias em risco para câncer hereditário.
100
6. Discussão
O presente estudo foi realizado com o objetivo de caracterizar a história familiar de
câncer, as características histopatológicas e imunohistoquímicas dos tumores mamários,
bem como a presença de polimorfismos modificadores do risco de câncer de mama e avaliar
a associação destas variáveis com a presença de mutação germinativa nos genes BRCA1 ou
BRCA2 em mulheres com câncer de mama hereditário.
6.1 Caracterização Geral:
6.1.1 Grupo amostral
Foram incluídas no estudo 287 mulheres com câncer de mama e divididas em 4
grupos como descrito previamente na metodologia. Todas as participantes do estudo foram
tratadas no Hospital de Câncer de Barretos, e em sua maioria eram provenientes do estado
de São Paulo (64,8%). Essa divisão em 4 grupos foi feita no intuito de identificar
características da história familiar, histopatológicas, imunohistoquímicas e relacionadas a
modificadores de risco como polimorfismos, que poderiam estar associadas com a presença
de mutação germinativa deletéria nos genes BRCA1/BRCA2, e que dessa forma poderiam
auxiliar na identificação de indivíduos/famílias em risco para câncer de mama hereditário.
Dentre as 287 mulheres incluídas, 83 foram recrutadas junto ao Departamento de
Mastologia e não foram selecionadas pela história familiar, tendo um papel de grupo
comparativo, cujas características refletiriam padrões frequentes nos tumores de mama
esporádicos. Na verdade, além de não terem sido selecionadas para história familiar, todas
aquelas famílias que, após a confecção do heredograma, preenchiam critérios para HBOC
(seja através de critérios clínicos ASCO, seja pelas tabelas de prevalência myriad, ou ainda
pela simples presença de casos de câncer de ovário, câncer de mama jovem, câncer de
mama masculino) foram excluídas do estudo ou inclusas em um dos outros três grupos caso
viessem a passar pelo Departamento de Oncogenética e fossem referenciadas para
101
realização do teste genético. Nesse caso o grupo para o qual seriam alocadas dependeria do
resultado da análise mutacional de BRCA1 e BRCA2.
No que se refere às demais 204 participantes do estudo, todas foram encaminhadas
pelo Departamento de Oncogenética da Instituição para realização de teste genético para
BRCA1/BRCA2, devido a uma história pessoal e/ou familiar sugestiva de câncer de mama
hereditário. Dados que os critérios utilizados pela clínica são variados (critérios ASCO, myriad
superior a 20%/30%, ou ainda a simples presença de um caso de câncer de ovário, ou um
caso de câncer de mama jovem), a frequência de mutações identificada não foi tão elevada
como seria esperado, já que esta está diretamente relacionada ao rigor dos critérios
utilizados para indicação do teste, e, quanto mais sugestiva for a história familiar, somada a
uma idade jovem e ainda aliada a uma histopatologia sugestiva de hereditariedade, maior a
chance de que a família seja portadora de uma mutação germinativa patogênica (conforme
pode ser observado nos resultados obtidos no presente trabalho).
6.1.2 Características dos tumores
Com relação aos dados anatomopatológicos e aos receptores hormonais, tivemos
uma perda considerável, já que vários pacientes haviam realizado a cirurgia em outras
Instituições e, em consequência não havia material biológico disponível para análise e, em
muitos casos, nem o laudo anátomo-patológico constava no prontuário médico da paciente.
Adicionalmente, vários blocos de parafina apresentavam má qualidade de material ou ainda
má conservação, e em vários espécimes não havia material tumoral remanescente no bloco
de parafina.
O tipo histológico mais frequente diagnosticado entre as mulheres foi o ductal
invasivo (84,4%). Diferentemente do esperado, mesmo para as mulheres com mutação
germinativa identificada, a presença de carcinoma medular foi baixa (1,6%). Em trabalho
realizado pelo grupo CIMBA, no qual foram analisados 4.325 portadores de mutações em
BRCA1 e 2.568 em BRCA2, encontrou-se uma frequência de 9,4% de tumores medulares
dentre os casos mutados em BRCA1 e, 2,2% dentre os mutados em BRCA2130.
102
No que se refere ao grau histológico, observamos em todos os grupos que a maioria
dos tumores apresentava grau II. No entanto, nos grupos 1 (mulheres mutadas) e 3
(mulheres testadas WT para os genes BRCA1/BRCA2) um número grande de casos
apresentava grau III (43,6% e 41,7% do total de cada grupo respectivamente). Conforme
resultados publicados pelo CIMBA no estudo supracitado, 77% das mulheres com mutações
em BRCA1 apresentavam grau III bem como 50% das mutadas em BRCA2130. No presente
estudo, quando estratificadas conforme o gene mutado, 56,5% das mulheres cujo gene
alterado era o BRCA1 apresentavam grau III e 25% das mutadas em BRCA2.
Em relação aos receptores hormonais ER, PR e HER2, observamos que a maioria dos
tumores do grupo 1 eram negativos para estrógeno e progesterona, diferentemente dos
demais grupos, onde a positividade de ambos os receptores prevaleceu. No caso de HER2 a
maior parte das pacientes (independentemente de grupo) apresentava resultados negativos
de expressão. Adicionalmente, conforme esperado, a maioria dos casos triplo negativos
estavam no grupo 1, ou seja, nos indivíduos com mutação germinativa nos genes
BRCA1/BRCA2 (51,1%). No grupo cujos pacientes apresentavam variantes de significado
clínico desconhecido o percentual de triplo negatividade foi levemente superior ao do grupo
supostamente esporádico (13,2% de TN no grupo das mulheres com VUS e 9,8% naquelas
não selecionadas para história familiar e não testadas para mutações nos genes
BRCA1/BRCA2). Nas mulheres testadas negativas o percentual de TN foi de 19,6% .
Quando estratificamos as mulheres mutadas conforme o gene alterado, observamos
que 75,9% das mulheres com tumores triplo negativos eram portadoras de mutação em
BRCA1, enquanto que apenas 11,1% eram mutadas em BRCA2, dados esses que corroboram
achados prévios da literatura, que apontam uma maior incidência de triplo negatividade
naquelas mulheres cuja mutação deletéria afeta o gene BRCA1.
Em estudo realizado por Young e colaboradores o câncer de mama triplo negativo
também foi associado à presença de mutações em BRCA1. Os pesquisadores analisaram 54
mulheres com pouca ou nenhuma história familiar de câncer de mama ou ovário e com
história pessoal de câncer de mama triplo negativo diagnosticado antes do 40 anos de idade.
Essas mulheres foram encaminhadas para teste genético, e, 5 delas apresentaram mutações
deletérias em BRCA1 e apenas uma em BRCA2. Os autores destacam que mulheres com
103
câncer de mama triplo negativo diagnosticados em idade jovem devem ser candidatas à
realização do teste genético em BRCA1, mesmo com ausência de história familiar de câncer
de mama e ovário 116.
Estudo realizado por Mavaddat130 e colaboradores (grupo CIMBA) encontrou uma
frequência de 69% de triplo negativas dentre 3.797 portadores de mutações em BRCA1 e de
16% dentre 2.392 mutados em BRCA2 analisados. Em estudo publicado por Carraro20 e
colaboradores a frequência de triplo negativas dentre as mutadas em BRCA1 foi de 50% (em
mulheres com câncer de mama em idade jovem não selecionadas para história familiar) e,
esse percentual aumentou para 83% naqueles casos com diagnóstico jovem e história
familiar positiva20. Achados semelhantes foram vistos em outro trabalho que avaliou os
casos de câncer de mama triplo negativo em idade jovem, realizado por Robertson 131 e
colaboradores. Foram selecionados para o estudo 308 indivíduos com câncer de mama triplo
negativo, desse total dois grupos foram criados, o primeiro composto por 159 indivíduos não
selecionados por idade ou história familiar e o segundo composto por 149 indivíduos
selecionados por idade jovem ao diagnóstico ou presença de alguma história familiar
positiva de câncer. Do total de indivíduos testados 45 mutações foram detectadas em
BRCA1. O estudo evidenciou que indivíduos com câncer de mama triplo negativo
diagnosticado antes dos 50 anos tem uma probabilidade superior a 10% de ser portador de
mutação em BRCA1, e, com base nesses dados, o estudo conclui que mulheres com câncer
de mama triplo negativo e idade jovem ao diagnóstico são candidatas à realização do teste
genético em BRCA1131.
Similarmente aos estudos acima destacados, em nosso estudo também observamos
uma associação entre triplo negatividade e história familiar de câncer. Ao compararmos a
variável triplo negatividade com a história familiar de câncer notamos que 95,8% das
mulheres com câncer de mama triplo negativo do grupo 1 tinham mais de 3 casos de câncer
na família. Quando a mesma comparação é realizada independentemente de grupo,
observamos que 67,3% das mulheres triplo negativas possuíam mais de 3 casos de câncer na
família e 34,5% apresentam 3 ou mais gerações afetadas por câncer. Quando apenas o
câncer de mama é considerado, verificamos que 34,5% das triplo negativas apresentam 3 ou
mais casos de câncer de mama na família, versus 16,7% das não triplo negativas.
104
Para os casos em que o resultado da imunohistoquímica pôde ser obtido, realizamos
uma classificação do subtipo molecular conforme classificação descrita por Goldhirsch
123
e
detalhada na seção de metodologia (item 4.5.2 - A) do presente trabalho. Os dados obtidos
dessa análise mostraram que 30% das mulheres com mutação germinativa nos genes BRCA1
ou BRCA2 foram classificadas como basal-like, o que é uma fração reduzida quando
comparado ao descrito na literatura. Em trabalho publicado por Andrés e colaboradores 92
pacientes foram testados e classificados quanto ao subtipo molecular. Dentre os pacientes
testados, 7 apresentavam mutações deletérias nos genes BRCA1/BRCA2 (7,6%). Do total de
pacientes com mutação 4 eram do tipo basal-like (57,1%)132.
No entanto, ao dividirmos as mulheres do grupo 1 conforme o gene mutado,
observamos que 88,8% das mulheres com o gene BRCA1 mutado possuíam tumor do tipo
basal-like versus 11,2% daquelas mutadas no gene BRCA2.
Quando comparamos o subtipo molecular com a história familiar de câncer
observamos uma associação do subtipo luminal B (subtipo molecular mais comum nas
mulheres com o gene BRCA2 alterado) com presença de mais de 3 casos de câncer na
família. A mesma tendência foi notada no subtipo her2-superexpresso e luminal A. Por outro
lado, o subtipo basal-like mostrou uma considerável associação com a presença de câncer de
mama bilateral (presente em 17,4% das pacientes com câncer de mama do tipo basal-like),
com presença de mais de 3 casos de câncer de mama na família e, um número expressivo de
indivíduos classificados como basal like tiveram idade ao diagnóstico inferior a 30 anos
(41,7% dos casos), em contraste com os casos classificados como Luminal A, onde uma
grande parcela dos casos foram diagnosticados em idade superior a 50 anos (37,9%).
Similarmente ao nosso estudo, em trabalho realizado por Turkoz
125
e colaboradores foram
avaliados alguns fatores de risco para câncer de mama e sua associação com os diferentes
subtipos moleculares. Esse trabalho envolveu 1.884 casos com câncer de mama e avaliou a
história familiar de câncer. De forma semelhante aos nossos achados, o estudo mostrou que
a idade ao diagnóstico >40 anos pareceu ser um fator de risco para o subtipo luminal A.
Além da idade ao diagnóstico o estudo de Turkoz avaliou outras variáveis relacionadas a
história familiar, porém nenhuma diferença significativa entre os subtipos e história familiar
foi identificada. O estudo destaca também uma limitação (a qual compartilhamos no
presente estudo), acerca da classificação do subtipo molecular basal-like, visto que não foi
105
possível obter resultado de citoqueratina para todos pacientes avaliados, dado que a mesma
não é realizada de maneira rotineira nos casos de câncer de mama na grande maioria dos
serviços de patologia.
6.1.3 História pessoal e familiar de câncer
Além de uma caracterização dos dados tumorais do nosso grupo amostral, revisamos
criteriosamente os heredogramas das famílias incluídas no estudo. Ao compararmos a
história familiar das mulheres alocadas para os grupos 2 e 3 versus aquelas do grupo 1,
observamos que nos dois grupos supramencionados (2 e 3) há uma parcela
significativamente elevada de casos de câncer de mama em idade jovem (inferior a 30 anos
de idade). Uma das possíveis explicações para a não detecção de mutações em um grupo
supostamente em risco está no fato de muitas dessas famílias terem sido referidas para
teste genético por apresentarem história pessoal de câncer de mama jovem, porém sem
história familiar “significativa” de câncer de mama e/ou ovário, o que, aparentemente, não é
um indicador “per si” da presença de mutações germinativas nos genes BRCA. Esse fato pode
ser constatado quando observamos a média de idade ao diagnóstico dos grupos analisados
no presente estudo: enquanto que no grupo 1 a média de idade ao diagnóstico foi de 41,88
anos, no grupo 2 foi de 34,91 e para o grupo 3 a média de idade foi de 38,37 anos. Em
contrapartida, quando a variável em questão é o número de casos de câncer de mama,
54,9% das mulheres do grupo 1 apresentam mais de 3 casos na sua família versus 18,5% e
22,3% nos grupos 2 e 3 respectivamente.
Adicionalmente, notamos que 86,6% das mulheres do grupo 4 não tinham presença
de outros tipos de câncer na família, enquanto que uma história familiar de outros tumores
(excetuando mama) estava presente em 40,8% das famílias do grupo 1. Cabe ainda destacar
que a presença de câncer de mama bilateral e câncer de ovário se constituíram em
características que diferenciaram o grupo 1 dos demais, estando presente em 19,6% e 25,5%
das mulheres do grupo 1 respectivamente, e em menos de 10% (no caso do câncer de mama
bilateral) ou de 15% (no caso do câncer de ovário) das mulheres pertencentes aos demais
grupos.
106
Os dados da história pessoal e familiar de câncer foram utilizados para o cálculo da
probabilidade de mutação nessas famílias. Para isso, conforme detalhado previamente,
diferentes modelos foram utilizados. No que se refere aos dados obtidos a partir das tabelas
de prevalência de mutação Myriad, quando comparamos as mulheres do grupo 1 com as
demais, observamos que a maioria daquelas com mutação identificada nos genes
BRCA1/BRCA2 (82,4%) tinham probabilidade de mutação entre 10% e 30%, o que era
esperado, já que tratam-se de famílias que comprovadamente possuem uma mutação
patogênica segregando nos genes considerados pelo modelo em questão. Pudemos observar
ainda a diversidade existente entre os modelos o que deve ser uma conseqüência das
variáveis que cada um deles considera para o cálculo da probabilidade de mutação bem
como os tipos de escore aplicados para o cálculo da probabilidade final (no caso dos
modelos de Manchester e Penn II), sendo que para ambos os modelos, em todos os grupos
(inclusive no grupo 1) a maioria das participantes foi classificada como risco baixo (inferior a
10% ou a 10 pontos, no caso do Manchester), o que indica uma tendência desses modelos
para subestimar a probabilidade real de mutação, reforçando mais uma vez a necessidade
da utilização concomitante de mais de um modelo quando esse for um critério para seleção
de famílias para realização do teste genético.
A possibilidade de que outros genes possam ser a causa da história familiar de câncer
nos grupos 2 e 3 deve ser cuidadosamente analisada. Sabe-se hoje que os genes BRCA1 e
BRCA2 respondem apenas por uma parcela do total de casos de câncer de mama e ovário
hereditários e diversos esforços vêm sendo realizados por pesquisadores do mundo inteiro
na tentativa de identificar outro(s) genes relacionados a esse tipo de neoplasia. Mutações no
gene BRIP1 (FANCJ) e PALB2 (FANCN) estão associadas a um risco cumulativo vital de câncer
de mama de 20% a 50%. Além disso, a presença de mutações germinativas nos genes TP53,
ATM, PTEN, STK11, CDH1, CHEK2, RAD51C estão associados a um risco moderado a alto de
desenvolvimento de câncer de mama69,87,133–139. Diversos estudos vêm publicando a
utilização de painéis gênicos para investigação da presença de mutações patogênicas em
outros genes que não BRCA em famílias com HBOC. Trabalho publicado por Walsh25 em 2011
selecionou para investigação 273 mulheres com carcinoma de ovário, 48 com carcinoma de
peritônio, 31 com câncer de tuba uterina e 8 com carcinoma de endométrio. Todos os casos
foram selecionados no momento do diagnóstico e não por idade ou histórico familiar. Os
107
carcinomas primários foram relacionados com a presença de mutação, sendo que mais de
30% dos casos com mutação não tinham presença de história familiar de câncer de mama e
ovário. O estudo mostra a importância da realização do teste genético em outros genes além
dos genes BRCA1 e BRCA2 25.
Estudo recentemente realizado por Silva e colaboradores com 120 pacientes com
critério para Síndrome de Predisposição ao câncer de Mama e Ovário Hereditários (HBOC),
investigou a presença de mutação nos genes BRCA1/2, TP53, CHEK2 1100delC, e,
adicionalmente, analisou a presença de variações no número de cópias em 14 genes de
suscetibilidade ao câncer de mama (PTEN, ATM, NBN, Rad50, Rad51, BRIP1, PALB2, MLH1,
MSH2, MSH6, TP53, CDKN2A, CDH1 e CTNNB1). Foram identificadas 31 mutações
patogênicas sendo 20 delas localizadas no gene BRCA1 (incluindo 2 casos com variação no
número de cópias e 18 mutações pontuais) e 7 no gene BRCA2. No estudo também foi
detectado um caso com mutação p.Arg337His em TP53 e um paciente com mutação em
CHEK2 1100delC. Os resultados do estudo mostraram uma alta frequência de mutação em
BRCA1/BRCA2 com alta prevalência de mutações em BRCA1 (64,5%). Além disso a mutação
em TP53 (p.Arg337His) sugere que todos os pacientes com câncer de mama com critérios
para HBOC caso negativos para BRCA1/BRCA2 devem ser testados para TP53 (p.Arg337His).
Apesar da alta frequência de mutação detectada, de maneira similar ao aqui reportado, há
um grande número de pacientes com presença de história familiar positiva de câncer, idade
jovem ao diagnóstico, além de outras características relacionadas ao câncer de mama,
porém, com ausência de mutação germinativa em BRCA1/BRCA221.
A busca contínua por uma melhor compreensão das características das famílias em
risco para câncer de mama hereditário, bem como pela determinação do risco de câncer da
forma mais acurada possível é fundamental. O conhecimento de qual gene está alterado e
qual o risco associado a essa alteração possibilita uma melhora significativa nas decisões
acerca do manejo do risco, bem como pode aumentar a gama de estratégias preventivas e
de redução de risco (exemplo cirurgias profiláticas) a serem oferecidas.
108
6.1.4 Polimorfismos
Polimorfismos genéticos atualmente estão sendo avaliados como modificadores do rsico
genético de doenças por diversos grupos de pesquisa. Estudo realizado pelo grupo CIMBA130
(Consortium of Investigators of Modifiers of BRCA1/2) avaliou a frequência de cinco
polimorfismos previamente publicados como relacionados a um aumento no risco de câncer
de mama hereditário, em pacientes portadoras de mutação em BRCA1/BRCA2, bem como
em pacientes em risco para câncer hereditário e naqueles com câncer de mama
supostamente esporádico. A análise dos diferentes polimorfismos foi realizada contra
características da história familiar de câncer e contra o status dos receptores hormonais
estrógeno, progesterona e HER2. Notou-se uma relação do receptor de estrógeno negativo
com a idade ao diagnóstico mais jovem ao diagnóstico nos casos com mutação em BRCA1
que nos BRCA2 e essa mesma tendência é notada nos tumores triplo negativos, o grau
histológico mais alto parece estar associado também com os casos estrógeno negativos,
mostrando a relevancia das carcterísticas patológicas, e destacando a impotância dos
modificadores do risco de câncer portadores de mutação em BRCA1/2130.
Ao compararmos a distribuição dos genótipos dos 5 polimorfismos analisados com o
status dos receptores hormonais de estrógeno, progesterona e HER2, notamos que, no caso
do SNP rs3803662 no gene TNRC9 há uma frequência aumentada de homozigotos GG dentre
os indivíduos cujo receptor de estrógeno era negativo (de forma similar ao relatado
previamente por Easton126 e colaboradores em 2007) e, embora não tenha alcançado uma
significância estatística, pudemos observar que essa diferença foi mais acentuada dentre as
mulheres dos grupos 1 e 3. Em relação ao SNP rs2981582 localizado no gene FGFR2,
observamos uma frequência aumentada do alelo A nas mulheres cujos receptores de
estrógeno e progesterona eram positivos (p=0,020 e p=0,014 respectivamente) e esse
aumento de frequência dentre os indivíduos cujo receptor hormonal (ER e PR) eram
positivos foi independente do grupo a que a mulher pertencia. No caso do polimorfismo
rs3817198 no gene LSP1 houve uma menor frequência do homozigoto C em todos os grupos
analisados. Em relação aos demais polimorfismos estudados não encontramos nenhuma
associação estatisticamente significativa quando comparados com o status de receptor
hormonal.
109
Existem, na literatura diversos estudos avaliando o impacto dos polimorfismos no
risco de câncer e sua associação com características tumorais. De acordo o trabalho
publicado por Tapper 140 e colaboradores em 2008, alguns polimorfismos que alteram o risco
de câncer de mama estão sendo descobertos. O trabalho realizado pelo autor supracitado
tinha como objetivo avaliar como essas variantes podem influenciar no prognóstico do
câncer de mama e no risco e, para isso foram analisadas 1.001 mulheres com câncer de
mama invasivo não familiar diagnosticadas em idade precoce, versus um grupo com câncer
de mama hereditário, quanto à presença e freqüência de 206 polimorfismos (SNPs) em 30
genes candidatos. Foi encontrada associação com o aumento do risco de desenvolvimento
de câncer de mama nos SNPs CASP8, TOX3 (anteriormente conhecido como TNRC9) e ESR1.
Os autores relataram ainda uma associação entre oito SNPs em seis genes (MAP3K1, DAPK1,
LSP1, MMP7, TOX3 e ESR1) e outro em uma região sem genes em 8q24, com sobrevida. Para
os SNPs nos genes MMP7, TOX3 e MAP3K1 os efeitos da sobrevida foram independentes dos
principais fatores prognósticos clínicos conhecidos. O efeito do SNP em ESR1 na sobrevida
mostrou-se mais significativo quando foram avaliados apenas os tumores ER-positivos.
Quando os casos foram estratificando de acordo com as características tumorais notou-se
que os SNPs em FGFR2 e TOX3 estão associados à doença. Por fim o estudo demonstrou
que vários SNPs estão associados com a sobrevida. Em alguns casos, pode ser devido a um
efeito sobre as características do tumor que tem impacto no prognóstico; em outros casos, o
efeito parece ser independente destes fatores de prognóstico140.
Resultados publicados por Fanale e colaboradores em 2012 demonstraram
associação de alguns polimorfismos (SNPs) s com câncer de mama. Os genes nos quais os
polimorfismos descritos estão são: TNRC9, FGFR2, MAP3K1, H19 e LSP1. O SNP mais
fortemente associado está localizado no gene FGFR2, o qual está super expresso em 5-10%
dos casos de câncer de mama. O SNP no gene TNRC9 mostra uma associação mais forte com
câncer de mama, e parece estar correlacionado com a presença de metástases ósseas e
receptor de estrógeno positivo. O SNP rs889312 no gene MAP3K1 mostrou uma
sensibilidade somente em portadores de mutação no gene BRCA2, não estando associado
com um risco aumentado em portadores de mutação em BRCA1. Diversos SNPs em LSP1 e
H19 provavelmente foram associados ao risco de desnvolvimento de câncer. O estudo então
conclui que a identificação de polimorfismos modificadores do risco pode levar à uma
110
melhor compreensão do mecanismo biológico do câncer de mama, podendo assim melhorar
a prevenção, a detecção e tratamento precoce da doença129.
Os resultados das análises da presença e frequência dos 5 polimorfismos aqui
considerados foram comparados com a história familiar de câncer. Nessa comparação
diversas associações foram identificadas, tanto com o número de casos de câncer na família
(associados com SNPs rs2981582 e rs13281615), com presença de câncer de mama bilateral
(SNP rs13281615), idade ao diagnóstico (SNP rs3803662, rs889312) e com número de
gerações afetadas por câncer (SNP rs13281615). Muitos dos achados aqui obtidos
corroboram dados da literatura, tal como a associação encontrada entre o SNP rs13281615 e
a história familiar positiva de câncer, correlação essa reportada previamente por Gorodnova
e colaboradores em 2010128.
Os dados obtidos com as análises de polimorfismos necessitam ser validados em um grupo
amostral maior. No entanto, caso essas associações se confirmem, teremos mais um dado
fundamental para a compreensão da epidemiologia do câncer hereditário e também do
câncer familial na nossa população.
6.1.5 Características que influenciam na presença de mutações germinativas em
BRCA1/BRCA2
A história familiar de câncer é o principal indicador para realização do teste genético.
No entanto diversos estudos têm apontado para o fato de que muitas mulheres são
candidatas à realização do teste genético pela combinação dos dados histopatológicos e
imunohistoquímicos do tumor, além de fatores relacionados à sua história pessoal e familiar
de câncer.No presente estudo, após uma ampla caracterização do grupo amostral em
questão, realizamos uma ”análise múltipla”, onde comparamos o grupo sabidamente com
câncer de mama hereditário (grupo 1, com mutação germinativa nos genes BRCA1/BRCA2)
quanto a diversas características da história familiar e do tumor (características
histopatológicas e imunohistoquímicas) na tentativa de identificar quais são as variáveis
mais importantes para distinguir esses grupos e consequentemente quais seriam as
111
características a serem observadas em um paciente para indicá-lo ou não para a realização
do teste genético.
Com base nos resultados da análise supracitada notamos uma diferença
estatisticamente significativa para quase todas as variáveis de história familiat analisadas
quando a comparação é feita entre o grupo 1 e o grupo 4, o que seria esperado, já que o
grupo 4 é constituído por mulheres com câncer de mama supostamente esporádico. Quando
a mesma análise é realizada com as características histopatológicas e imunohistoquímicas a
mesma tendência é vista, sendo as características marcantes, o receptor de estrógeno, Ki-67,
triplo negatividade e subtipo molecular com destaque para os casos basal-like presentes
quase que exclusivamente dentre as mulheres do grupo 1.
Quando comparamos o grupo 1 com os grupos 2 e 3, grupos esses em risco para
câncer de mama hereditário, mas sem mutação patogênica identificada nos genes testados,
destacamos quais características diferem entre esses grupos: presença de câncer de mama
bilateral e câncer de ovário, número de casos de câncer de mama e total de casos de câncer,
óbitos por câncer de mama e total de óbitos, idade ao diagnóstico, receptores de estrógeno,
progesterona, Her-2, citoqueratina 5/6, triplo negatividade e subtipo molecular.
Em trabalho realizado pelo grupo CIMBA o câncer de mama e ovário foram
investigados quanto às suas características histopatológicas e imunohistoquímicas em
portadores e não portadores de mutação em BRCA1/BRCA2. Foram avaliados 4,325
portadores de mutação em BRCA1 e 2,568 em BRCA2, e, como resultado, os autores
destacaram uma forte associação com o receptor de estrógeno negativo e idade mais jovem
ao diagnóstico para os casos mutados em BRCA1 quando comparados com os portadores de
mutação em BRCA2. Os autores relatam ainda que a idade ao diagnóstico era menor nos
casos mutados em BRCA1 que nas portadoras de BRCA2. Em ambos, os tumores estrógeno
negativos apresentaram maior grau histológico que os tumores estrógeno positivo. Tumores
lobulares foram mais relacionados com a presença de mutação em BRCA2, já os tumores do
tipo medular foram mais relacionados com a presença de mutação em BRCA1. Em relação ao
câncer de ovário não foi observado diferença significativa entre os portadores de mutação
em BRCA1 e BRCA2. As características patológicas dos tumores associados a BRCA1/2 podem
112
ser relevantes na previsão do risco, nas medidas profiláticas e nas estratégias de
rastreamento clínico.
No presente estudo, considerando todas as variáveis que aparentam estar associadas
ao câncer de mama hereditário, realizamos uma análise multivariada e, obtivemos o
seguinte resultado: triplo negatividade demonstrou estar fortemente associada à presença
de mutações deletérias nos genes BRCA1/BRCA2 e ocasiona um aumento de 5,883 vezes (IC
95%, p<0,001); presença de câncer de mama bilateral com um aumento de 5,797 vezes no
risco (IC 95, p=0,003), número de casos de câncer de mama (aumento de 5,033 vezes (IC
95%, p<0,001)), presença de câncer de ovário (aumento de 4,412 vezes no risco (IC 95%,
p=0,006)), e, por último, total de óbitos por câncer, ocasionando um aumento de 2,906
vezes no risco de ser portador de câncer de mama hereditário (IC 95%, p=0,035).
Em estudo desenvolvido por Robertson e colaboradores o câncer de mama triplo
negativo pode ser um possível indicador de para realização do teste genético em BRCA1 para
indivíduos menores que 50 anos. O estudo realizou o teste genetico em BRCA1 em 308
indivíduos com câncer de mama, 159 com câncer de mama triplo negativo e 149 com idade
jovem ao diagnóstico e história familiar. Dos 308 indivíduos testados 45 eram portadoras de
mutação. O presente estudo mostrou que as mulheres com câncer de mama triplo negativo
antes dos 50 anos de idade tem mais de 10% de probabilidade de mutação, e conclui que
esses indíviduos são candidatos a realização do teste genético.
Estudo realizado por Fostira e colaboradores avaliou em uma coorte de 403 mulheres
a prevalência de mutações em BRCA1 nos casos de câncer de mama triplo-negativo,
independente do fator idade e história familiar de câncer. A média de idade ao diagnóstico
em geral foi de 50 anos, a prevalência de casos de câncer de mama invasivo triplo negativo
foi de 8%, os resultados de mutação em BRCA1 foram obtidos através de sequenciamento
direto. Foram encontradas 65 mutações em BRCA1 dentre os 403 pacientes com câncer de
mama invasivo representando 16%. A média de idade das mulheres portadoras de mutação
foi de 39 anos. De um total de 106 mulheres diagnosticadas com câncer de mama triplo
negativo em idade jovem, 38 (36%) tinham mutação em BRCA1 . Das 65 mulheres
portadoras de mutação 15 (23%) não relataram história familiar de câncer. Dados como esse
indicam que mulheres com câncer de mama triplo negativo diagnosticado em idade jovem
113
são candidatas a realização do teste genético em BRCA1 independente da história familiar
de câncer de mama e ovário141.
Por fim, cabe destacar que apesar dos critérios relativamente restritos aplicados pelo
Departamento de Oncogenética para a seleção dos pacientes que deveriam ser testados e
da ampla metodologia utilizada para análise dos genes envolvidos, o risco alto/moderado de
câncer atribuído às famílias (no caso das famílias dos grupos 2 e 3 do presente estudo)
permanece inexplicado. Parte disso pode ser devido ao fato de que as alterações podem
estar em outros genes ainda não associados ao câncer de mama hereditário ou à presença
de alterações genéticas em genes de risco moderado a alto para as quais as pacientes não
foram testadas (tais como TP53 e PALB2). Adicionalmente cabe destacar a importância de
uma caracterização clínica, patológica e molecular das famílias (tal como a aqui realizada) de
forma a incluir outras variáveis, além da história familiar de câncer, como critério para a
seleção/identificação de mulheres/famílias em risco para câncer de mama hereditário.
Como limitações do presente estudo cabe destacar o número reduzido de tumores
para os quais a análise imunohistoquímica das citoqueratinas pôde ser realizada e, como
consequência, a classificação do subtipo molecular foi realizada para uma pequena parcela
do grupo amostral considerado. Adicionalmente, a análise dos polimorfismos e sua
associação com dados de história familiar bem como com dados do tumor deverá passar por
uma fase de validação em um número amostral maior para que conclusões/especulações
possam ser emitidas.
114
7 . Conclusão
1) Quando realizamos a caracterização das mulheres, em relação aos fatores de risco
(hormonais) para câncer de mama, notamos que 23,6% das mulheres estavam na
menopausa no momento do diagnóstico, mais da metade das mulheres (54%) faziam uso de
anticoncepcional, 79,4% delas tiveram pelo menos uma gestação antes do diagnóstico e
apenas 11,8% realizaram terapia de reposição hormonal. Quando analisamos a história
familiar notamos que as mulheres do grupo 4 tinham em sua grande maioria menos de três
casos de câncer presente na família (75%), já as mulheres dos grupos 1, 2 e 3 tinham 15,7%,
33,3%, 40% respectivamente. Por fim caracterizamos os grupos quanto a probabilidade de
apresentar mutação nos genes BRCA1 e BRCA2 e observamos que 82,4%, 44,4% e 49% das
mulheres dos grupos 1, 2 e 3 apresentavam probabilidade de mutação moderada entre 10 e
30%.
2) Observamos um predomínio de negatividade para os receptores hormonais ER, PR
e HER2 no grupo 1 quando comparado aos grupos 2, 3 e 4. Os grupos 2 e 3 apresentaram um
padrão intermediário entre os grupos 1 e 4. Quando o grupo 1 foi estratificado entre
mutadas em BRCA1 e mutadas em BRCA2, pudemos verificar que grande parte da
negatividade observada para os receptores devia-se aos casos com mutações germinativas
em BRCA1. Além da triplo-negatividade, um número considerável de mulheres do grupo 1
eram basal-like. As famílias das mulheres cujos tumores eram TN apresentavam um número
maior de casos de câncer de mama do que aquelas com pelo menos um dos receptores
positivos.
3) Em relação a análise da frequência dos cinco polimorfismos, observamos que para
o polimorfismo no gene TNRC9 o genótipo heterozigoto foi o mais frequente entre as
mulheres do grupo 1, já o polimorfismo no gene FGFR2 observamos uma maior prevalência
de heterozigotos em todos os grupos analisados, a mesma tendência foi observado para o
polimorfismo rs13281615. Já em relação ao polimorfismo no gene MAP3K1 notamos que
grande parte das mulheres dos grupos 1, 2 e 3 estavam em homozigose para o alelo A. E por
último o polimorfismo no gene LSP1 mostrou presença do alelo T em homozigose na maioria
115
das mulheres dos grupos 1, 2 e 3. Com base nesses resultados observamos correlação na
distribuição dos genótipos dos 5 SNPs analisados quando comparados aos 4 grupos aqui
considerados, então devemos destacar que esses resultados são fundamentais para a
compreensão da epidemiologia do câncer hereditário e também do câncer familial na nossa
população (pois a maioria das associações previamente relatadas na literatura foram entre
as mulheres com câncer aparentemente familial).
4) Quando comparamos os polimorfismos com os receptores imunohistoquímicos,
encontramos associação estatisticamente significativa para alguns dos polimorfismos
analisados, são eles: rs3803662 no gene TNRC9, rs2981582 localizado no gene FGFR2 e o
polimorfismo rs3817198 no gene LSP1. Já em relação aos demais polimorfismos estudados
não encontramos nenhuma associação estatisticamente significativa quando comparados
com o status de receptor hormonal.
Quando avaliamos a distribuição dos genótipos em relação a história familiar
observamos associações para todos os SNPs avaliados no presente estudo. Associação com
número de casos de câncer também foi verificada para os SNPs rs13281615 e rs3803662 (no
gene TNRC9), além de associação com idade ao diagnóstico. Já o polimorfismo rs889312
(gene MAP3K1) apresentou associação com o número de casos de câncer na família,
presença de câncer de mama bilateral, número de gereações afetadas com câncer, e idade
ao diagnóstico. O polimorfismo rs2981582 (gene FGFR2) apresentou associação apenas com
o número de gerações afetadas com câncer. Por fim o SNP rs3817198 (no gene LSP1)
apresentou uma associação com a presença de câncer de mama bilateral, presença de
câncer ovário e número de gerações afetadas com câncer. Esses SNPs se foram relevantes na
análise da história familiar e devem ser validados uma casuística maior.
5) Observamos, dentre os 83 casos do grupo 4 (não selecionados por sua história
familiar), 8 classificadas como triplo negativas, dentre essas apenas uma apresentou mais de
3 casos de câncer presente na família. A triplo negatividade apresentou uma forte relação
com a presença de mutação (risco aumentado (odds ratio) em 5,883 vezes (IC 95%, 2,562 a
13,510, p<0,001). Tendo em vista essas características pelo menos uma das mulheres do
grupo 4 deveria ter sido encaminhada para realização do teste genético.
116
Por fim, dentre as variáveis analisadas, cabe destacar a importância da triplo
negatividade, do número de casos de câncer e de câncer de mama presente na família, a
presença de câncer de ovário e de câncer de mama bilateral e a idade ao diagnóstico. Essas
variáveis devem ser consideradas conjuntamente no momento do aconselhamento
genético. Dessa forma concluímos que, não apenas a história familiar é fundamental para
indicação do teste genético, mas também as características do tumor são importantes e não
devem ser negligenciadas.
Perspectivas: Com base nos resutados obtidos, destacamos algumas características
relevantes, a presença de polimorfismos modificadores do risco parece estar relacionado
com a história familiar de câncer, dados como esse precisam ser validados em uma
casuística maior para validação. As citoqueratinas se mostraram muito importantes para
classificação dos diferentes subtipos, visto que grande parte das mulheres com mutação em
BRCA1 eram do subtipo basal-like, com base nesses achados sugerimos que a realização das
citoqueratinas sejam feitas de rotina proporcionando assim uma classificação molecular
completa.
117
8. Referências bibliográficas
1 De Moura Gallo CV, Azevedo E Silva Mendonça G, de Moraes E, Olivier M, Hainaut P. TP53
mutations as biomarkers for cancer epidemiology in Latin America: current knowledge and
perspectives. Mutat Res. 2005; 589: 192–207.
2 Parkin DM, Bray FI, Devesa SS. Cancer burden in the year 2000. The global picture. Eur J Cancer
Oxf Engl 1990. 2001; 37 Suppl 8: S4–66.
3 Kamangar F, Dores GM, Anderson WF. Patterns of cancer incidence, mortality, and prevalence
across five continents: defining priorities to reduce cancer disparities in different geographic
regions of the world. J Clin Oncol Off J Am Soc Clin Oncol. 2006; 24: 2137–2150.
4 Portal - Instituto Nacional de Câncer - INCA. http://www2.inca.gov.br (accessed 29 Jan2015).
5 Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S et al. A strong candidate
for the breast and ovarian cancer susceptibility gene BRCA1. Science. 1994; 266: 66–71.
6 Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N et al. Localization of a breast
cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science. 1994; 265: 2088–2090.
7 Crispo A, D’Aiuto G, De Marco M, Rinaldo M, Grimaldi M, Capasso I et al. Gail model risk factors:
impact of adding an extended family history for breast cancer. Breast J. 2008; 14: 221–227.
8 Garber JE, Offit K. Hereditary cancer predisposition syndromes. J Clin Oncol Off J Am Soc Clin
Oncol. 2005; 23: 276–292.
9 Rede Nacional de Câncer Familial Manual Operacional - INCA. 2009.
10 Passos-Bueno MR, Bertola D, Horovitz DDG, de Faria Ferraz VE, Brito LA. Genetics and genomics in
Brazil: a promising future. Mol Genet Genomic Med. 2014; 2: 280–291.
11 Acosta AX, Abé-Sandes K, Giugliani R, Bittles AH. Delivering genetic education and genetic
counseling for rare diseases in rural Brazil. J Genet Couns. 2013; 22: 830–834.
12 Horovitz DDG, de Faria Ferraz VE, Dain S, Marques-de-Faria AP. Genetic services and testing in
Brazil. J Community Genet. 2013; 4: 355–375.
13 Horovitz, D. D. G. Atenção aos defeitos congênitos no Brasil: propostas para estruturação e
integração da abordagem no sistemade saude. 2003.
14 Penchaszadeh VB. Community genetics in Latin America: challenges and perspectives. Community
Genet. 2000; 3: 124–127.
15 Legislações. Portal Saúde – Minist. Saúde – Wwwsaudegovbr. http://portalsaude.saude.gov.br
(accessed 5 Feb2015).
16 Dufloth RM, Carvalho S, Heinrich JK, Shinzato JY, dos Santos CC, Zeferino LC et al. Analysis of
BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history. São
Paulo Med J Rev Paul Med. 2005; 123: 192–197.
118
17 Gomes MCB, Costa MM, Borojevic R, Monteiro ANA, Vieira R, Koifman S et al. Prevalence of
BRCA1 and BRCA2 mutations in breast cancer patients from Brazil. Breast Cancer Res Treat. 2007;
103: 349–353.
18 Palmero EI, Caleffi M, Schüler-Faccini L, Roth FL, Kalakun L, Netto CBO et al. Population prevalence
of hereditary breast cancer phenotypes and implementation of a genetic cancer risk assessment
program in southern Brazil. Genet Mol Biol. 2009; 32: 447–455.
19 Ewald IP, Izetti P, Vargas FR, Moreira MA, Moreira AS, Moreira-Filho CA et al. Prevalence of the
BRCA1 founder mutation c.5266dupin Brazilian individuals at-risk for the hereditary breast and
ovarian cancer syndrome. Hered Cancer Clin Pract. 2011; 9: 12.
20 Carraro DM, Koike Folgueira MAA, Garcia Lisboa BC, Ribeiro Olivieri EH, Vitorino Krepischi AC, de
Carvalho AF et al. Comprehensive analysis of BRCA1, BRCA2 and TP53 germline mutation and
tumor characterization: a portrait of early-onset breast cancer in Brazil. PloS One. 2013; 8:
e57581.
21 Silva FC, Lisboa BC, Figueiredo MC, Torrezan GT, Santos EM, Krepischi AC et al. Hereditary breast
and ovarian cancer: assessment of point mutations and copy number variations in Brazilian
patients. BMC Med Genet. 2014; 15: 55.
22 Cury NM, Ferraz VE, Silva WA. TP53 p.R337H prevalence in a series of Brazilian hereditary breast
cancer families. Hered Cancer Clin Pract. 2014; 12: 8.
23 Ahmed M, Lalloo F, Evans DG. Update on genetic predisposition to breast cancer. Expert Rev
Anticancer Ther. 2009; 9: 1103–1113.
24 Turnbull C, Rahman N. Genetic predisposition to breast cancer: past, present, and future. Annu
Rev Genomics Hum Genet. 2008; 9: 321–345.
25 Walsh T, Casadei S, Lee MK, Pennil CC, Nord AS, Thornton AM et al. Mutations in 12 genes for
inherited ovarian, fallopian tube, and peritoneal carcinoma identified by massively parallel
sequencing. Proc Natl Acad Sci U S A. 2011; 108: 18032–18037.
26 Zhang S, Royer R, Li S, McLaughlin JR, Rosen B, Risch HA et al. Frequencies of BRCA1 and BRCA2
mutations among 1,342 unselected patients with invasive ovarian cancer. Gynecol Oncol. 2011;
121: 353–357.
27 Page DL, Schuyler PA, Dupont WD, Jensen RA, Plummer WD, Simpson JF. Atypical lobular
hyperplasia as a unilateral predictor of breast cancer risk: a retrospective cohort study. Lancet.
2003; 361: 125–129.
28 A Practical Guide to Human Cancer Genetics. http://www.springer.com (accessed 29 Jan2015).
29 Milne RL, Osorio A, Cajal TRY, Vega A, Llort G, de la Hoya M et al. The average cumulative risks of
breast and ovarian cancer for carriers of mutations in BRCA1 and BRCA2 attending genetic
counseling units in Spain. Clin Cancer Res Off J Am Assoc Cancer Res. 2008; 14: 2861–2869.
30 Struewing JP, Brody LC, Erdos MR, Kase RG, Giambarresi TR, Smith SA et al. Detection of eight
BRCA1 mutations in 10 breast/ovarian cancer families, including 1 family with male breast cancer.
Am J Hum Genet. 1995; 57: 1–7.
119
31 Liede A, Karlan BY, Narod SA. Cancer risks for male carriers of germline mutations in BRCA1 or
BRCA2: a review of the literature. J Clin Oncol Off J Am Soc Clin Oncol. 2004; 22: 735–742.
32 Cass I, Baldwin RL, Varkey T, Moslehi R, Narod SA, Karlan BY. Improved survival in women with
BRCA-associated ovarian carcinoma. Cancer. 2003; 97: 2187–2195.
33 Karhu R, Laurila E, Kallioniemi A, Syrjäkoski K. Large genomic BRCA2 rearrangements and male
breast cancer. Cancer Detect Prev. 2006; 30: 530–534.
34 Belogianni I, Apessos A, Mihalatos M, Razi E, Labropoulos S, Petounis A et al. Characterization of a
novel large deletion and single point mutations in the BRCA1 gene in a Greek cohort of families
with suspected hereditary breast cancer. BMC Cancer. 2004; 4: 61.
35 Risch HA, McLaughlin JR, Cole DEC, Rosen B, Bradley L, Fan I et al. Population BRCA1 and BRCA2
mutation frequencies and cancer penetrances: a kin-cohort study in Ontario, Canada. J Natl
Cancer Inst. 2006; 98: 1694–1706.
36 Breast Cancer Linkage Consortium. Cancer risks in BRCA2 mutation carriers. J Natl Cancer Inst.
1999; 91: 1310–1316.
37 Statement of the American Society of Clinical Oncology: genetic testing for cancer susceptibility,
Adopted on February 20, 1996. J Clin Oncol Off J Am Soc Clin Oncol. 1996; 14: 1730–1736;
discussion 1737–1740.
38 Bevers TB, Anderson BO, Bonaccio E, Buys S, Buys S, Daly MB et al. NCCN clinical practice
guidelines in oncology: breast cancer screening and diagnosis. J Natl Compr Cancer Netw JNCCN.
2009; 7: 1060–1096.
39 Gopie JP, Mureau MAM, Seynaeve C, Ter Kuile MM, Menke-Pluymers MBE, Timman R et al. Body
image issues after bilateral prophylactic mastectomy with breast reconstruction in healthy women
at risk for hereditary breast cancer. Fam Cancer. 2013; 12: 479–487.
40 Roukos DH, Briasoulis E. Individualized preventive and therapeutic management of hereditary
breast ovarian cancer syndrome. Nat Clin Pract Oncol. 2007; 4: 578–590.
41 Noguès C, Mouret-Fourme E. [Prophylactic surgery in common hereditary cancer syndromes]. Bull
Académie Natl Médecine. 2012; 196: 1237–1245.
42 Boddy MN, Freemont PS, Borden KL. The p53-associated protein MDM2 contains a newly
characterized zinc-binding domain called the RING finger. Trends Biochem Sci. 1994; 19: 198–199.
43 Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL et al. Identification of a RING protein that
can interact in vivo with the BRCA1 gene product. Nat Genet. 1996; 14: 430–440.
44 Koonin EV, Altschul SF, Bork P. BRCA1 protein products ... Functional motifs.. Nat Genet. 1996; 13:
266–268.
45 Deng CX, Brodie SG. Roles of BRCA1 and its interacting proteins. BioEssays News Rev Mol Cell Dev
Biol. 2000; 22: 728–737.
46 Wang Y, Cortez D, Yazdi P, Neff N, Elledge SJ, Qin J. BASC, a super complex of BRCA1-associated
proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev. 2000; 14:
927–939.
120
47 Venkitaraman AR. Functions of BRCA1 and BRCA2 in the biological response to DNA damage. J
Cell Sci. 2001; 114: 3591–3598.
48 Bertwistle D, Ashworth A. The pathology of familial breast cancer: How do the functions of BRCA1
and BRCA2 relate to breast tumour pathology? Breast Cancer Res BCR. 1999; 1: 41–47.
49 Arnold K, Kim M-K, Frerk K, Edler L, Savelyeva L, Schmezer P et al. Lower level of BRCA2 protein in
heterozygous mutation carriers is correlated with an increase in DNA double strand breaks and an
impaired DSB repair. Cancer Lett. 2006; 243: 90–100.
50 Palmero E.I. Identificação e Caracterização de Pacientes em Risco para Câncer de Mama
Hereditário no Sul do Brasil. 2007.
51 Cipollini G, Tommasi S, Paradiso A, Aretini P, Bonatti F, Brunetti I et al. Genetic alterations in
hereditary breast cancer. Ann Oncol Off J Eur Soc Med Oncol ESMO. 2004; 15 Suppl 1: I7–I13.
52 Abkevich V, Zharkikh A, Deffenbaugh AM, Frank D, Chen Y, Shattuck D et al. Analysis of missense
variation in human BRCA1 in the context of interspecific sequence variation. J Med Genet. 2004;
41: 492–507.
53 Lakhani SR, Jacquemier J, Sloane JP, Gusterson BA, Anderson TJ, van de Vijver MJ et al.
Multifactorial analysis of differences between sporadic breast cancers and cancers involving
BRCA1 and BRCA2 mutations. J Natl Cancer Inst. 1998; 90: 1138–1145.
54 Schweiger MR, Kerick M, Timmermann B, Isau M. The power of NGS technologies to delineate the
genome organization in cancer: from mutations to structural variations and epigenetic alterations.
Cancer Metastasis Rev. 2011; 30: 199–210.
55 Costa JL, Sousa S, Justino A, Kay T, Fernandes S, Cirnes L et al. Nonoptical massive parallel DNA
sequencing of BRCA1 and BRCA2 genes in a diagnostic setting. Hum Mutat. 2013; 34: 629–635.
56 Voelkerding KV, Dames SA, Durtschi JD. Next-generation sequencing: from basic research to
diagnostics. Clin Chem. 2009; 55: 641–658.
57 De Leeneer K, Hellemans J, De Schrijver J, Baetens M, Poppe B, Van Criekinge W et al. Massive
parallel amplicon sequencing of the breast cancer genes BRCA1 and BRCA2: opportunities,
challenges, and limitations. Hum Mutat. 2011; 32: 335–344.
58 Loman NJ, Misra RV, Dallman TJ, Constantinidou C, Gharbia SE, Wain J et al. Performance
comparison of benchtop high-throughput sequencing platforms. Nat Biotechnol. 2012; 30: 434–
439.
59 Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of
40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res.
2002; 30: e57.
60 MRC-Holland b.v. (http://www.mrc-holland.com).
61 Li FP, Fraumeni JF, Mulvihill JJ, Blattner WA, Dreyfus MG, Tucker MA et al. A cancer family
syndrome in twenty-four kindreds. Cancer Res. 1988; 48: 5358–5362.
121
62 Malkin D, Li FP, Strong LC, Fraumeni JF, Nelson CE, Kim DH et al. Germ line p53 mutations in a
familial syndrome of breast cancer, sarcomas, and other neoplasms. Science. 1990; 250: 1233–
1238.
63 Birch JM, Alston RD, McNally RJ, Evans DG, Kelsey AM, Harris M et al. Relative frequency and
morphology of cancers in carriers of germline TP53 mutations. Oncogene. 2001; 20: 4621–4628.
64 Li FP, Fraumeni JF. Soft-tissue sarcomas, breast cancer, and other neoplasms. A familial
syndrome? Ann Intern Med. 1969; 71: 747–752.
65 Seemann S, Maurici D, Olivier M, Caron de Fromentel C, Hainaut P. The tumor suppressor gene
TP53: implications for cancer management and therapy. Crit Rev Clin Lab Sci. 2004; 41: 551–583.
66 Birch JM, Hartley AL, Tricker KJ, Prosser J, Condie A, Kelsey AM et al. Prevalence and diversity of
constitutional mutations in the p53 gene among 21 Li-Fraumeni families. Cancer Res. 1994; 54:
1298–1304.
67 Eeles RA. Germline mutations in the TP53 gene. Cancer Surv. 1995; 25: 101–124.
68 Frebourg T, Abel A, Bonaiti-Pellie C, Brugières L, Berthet P, Bressac-de Paillerets B et al. [LiFraumeni syndrome: update, new data and guidelines for clinical management]. Bull Cancer
(Paris). 2001; 88: 581–587.
69 Bougeard G, Sesboüé R, Baert-Desurmont S, Vasseur S, Martin C, Tinat J et al. Molecular basis of
the Li-Fraumeni syndrome: an update from the French LFS families. J Med Genet. 2008; 45: 535–
538.
70 May P, May E. Twenty years of p53 research: structural and functional aspects of the p53 protein.
Oncogene. 1999; 18: 7621–7636.
71 Piovesan G. Prevalence of the P.R337H TP53 allele in the State of Parana. .
72 Ribeiro RC, Sandrini F, Figueiredo B, Zambetti GP, Michalkiewicz E, Lafferty AR et al. An inherited
p53 mutation that contributes in a tissue-specific manner to pediatric adrenal cortical carcinoma.
Proc Natl Acad Sci U S A. 2001; 98: 9330–9335.
73 Davison TS, Yin P, Nie E, Kay C, Arrowsmith CH. Characterization of the oligomerization defects of
two p53 mutants found in families with Li-Fraumeni and Li-Fraumeni-like syndrome. Oncogene.
1998; 17: 651–656.
74 Palmero EI, Schüler-Faccini L, Caleffi M, Achatz MIW, Olivier M, Martel-Planche G et al. Detection
of R337H, a germline TP53 mutation predisposing to multiple cancers, in asymptomatic women
participating in a breast cancer screening program in Southern Brazil. Cancer Lett. 2008; 261: 21–
25.
75 Achatz MIW, Olivier M, Le Calvez F, Martel-Planche G, Lopes A, Rossi BM et al. The TP53 mutation,
R337H, is associated with Li-Fraumeni and Li-Fraumeni-like syndromes in Brazilian families. Cancer
Lett. 2007; 245: 96–102.
76 Garritano S, Gemignani F, Palmero EI, Olivier M, Martel-Planche G, Le Calvez-Kelm F et al. Detailed
haplotype analysis at the TP53 locus in p.R337H mutation carriers in the population of Southern
Brazil: evidence for a founder effect. Hum Mutat. 2010; 31: 143–150.
122
77 Eng C. Will the real Cowden syndrome please stand up: revised diagnostic criteria. J Med Genet.
2000; 37: 828–830.
78 Nelen MR, Padberg GW, Peeters EA, Lin AY, van den Helm B, Frants RR et al. Localization of the
gene for Cowden disease to chromosome 10q22-23. Nat Genet. 1996; 13: 114–116.
79 Meijers-Heijboer H, Wijnen J, Vasen H, Wasielewski M, Wagner A, Hollestelle A et al. The CHEK2
1100delC mutation identifies families with a hereditary breast and colorectal cancer phenotype.
Am J Hum Genet. 2003; 72: 1308–1314.
80 Weischer M, Nordestgaard BG, Pharoah P, Bolla MK, Nevanlinna H, Van’t Veer LJ et al.
CHEK2*1100delC heterozygosity in women with breast cancer associated with early death, breast
cancer-specific death, and increased risk of a second breast cancer. J Clin Oncol Off J Am Soc Clin
Oncol. 2012; 30: 4308–4316.
81 Weischer M, Bojesen SE, Tybjaerg-Hansen A, Axelsson CK, Nordestgaard BG. Increased risk of
breast cancer associated with CHEK2*1100delC. J Clin Oncol Off J Am Soc Clin Oncol. 2007; 25:
57–63.
82 GeneTests.org. GeneTests.org. 2015.http://www.genetests.org (accessed 30 Jan2015).
83 Uhrhammer N, Bay JO, Bignon YJ. Seventh International Workshop on Ataxia-Telangiectasia.
Cancer Res. 1998; 58: 3480–3485.
84 Lim W, Olschwang S, Keller JJ, Westerman AM, Menko FH, Boardman LA et al. Relative frequency
and morphology of cancers in STK11 mutation carriers. Gastroenterology. 2004; 126: 1788–1794.
85 Karuman P, Gozani O, Odze RD, Zhou XC, Zhu H, Shaw R et al. The Peutz-Jegher gene product LKB1
is a mediator of p53-dependent cell death. Mol Cell. 2001; 7: 1307–1319.
86 Keller G, Vogelsang H, Becker I, Hutter J, Ott K, Candidus S et al. Diffuse type gastric and lobular
breast carcinoma in a familial gastric cancer patient with an E-cadherin germline mutation. Am J
Pathol. 1999; 155: 337–342.
87 Schrader KA, Masciari S, Boyd N, Wiyrick S, Kaurah P, Senz J et al. Hereditary diffuse gastric
cancer: association with lobular breast cancer. Fam Cancer. 2008; 7: 73–82.
88 CDH1 Gene - GeneCards | CADH1 Protein | CADH1 Antibody. http://www.genecards.org
(accessed 30 Jan2015).
89 Hartmann LC, Schaid DJ, Woods JE, Crotty TP, Myers JL, Arnold PG et al. Efficacy of bilateral
prophylactic mastectomy in women with a family history of breast cancer. N Engl J Med. 1999;
340: 77–84.
90 Kauff ND, Satagopan JM, Robson ME, Scheuer L, Hensley M, Hudis CA et al. Risk-reducing
salpingo-oophorectomy in women with a BRCA1 or BRCA2 mutation. N Engl J Med. 2002; 346:
1609–1615.
91 Rebbeck TR, Lynch HT, Neuhausen SL, Narod SA, Van’t Veer L, Garber JE et al. Prophylactic
oophorectomy in carriers of BRCA1 or BRCA2 mutations. N Engl J Med. 2002; 346: 1616–1622.
123
92 Eisen A, Lubinski J, Klijn J, Moller P, Lynch HT, Offit K et al. Breast cancer risk following bilateral
oophorectomy in BRCA1 and BRCA2 mutation carriers: an international case-control study. J Clin
Oncol Off J Am Soc Clin Oncol. 2005; 23: 7491–7496.
93 Grusenmeyer PA, Wong Y-N. Interpreting the economic literature in oncology. J Clin Oncol Off J
Am Soc Clin Oncol. 2007; 25: 196–202.
94 Gail MH, Brinton LA, Byar DP, Corle DK, Green SB, Schairer C et al. Projecting individualized
probabilities of developing breast cancer for white females who are being examined annually. J
Natl Cancer Inst. 1989; 81: 1879–1886.
95 Mastologia Oncologica de Umberto Veronesi. http://www.estantevirtual.com.br (accessed 30
Jan2015).
96 Claus EB, Risch N, Thompson WD. Autosomal dominant inheritance of early-onset breast cancer.
Implications for risk prediction. Cancer. 1994; 73: 643–651.
97 Calzone KA, Stopfer J, Blackwood A, Weber BL. Establishing a cancer risk evaluation program.
Cancer Pract. 1997; 5: 228–233.
98 Couch FJ, DeShano ML, Blackwood MA, Calzone K, Stopfer J, Campeau L et al. BRCA1 mutations in
women attending clinics that evaluate the risk of breast cancer. N Engl J Med. 1997; 336: 1409–
1415.
99 Shattuck-Eidens D, Oliphant A, McClure M, McBride C, Gupte J, Rubano T et al. BRCA1 sequence
analysis in women at high risk for susceptibility mutations. Risk factor analysis and implications for
genetic testing. JAMA. 1997; 278: 1242–1250.
100 Parmigiani G, Berry D, Aguilar O. Determining carrier probabilities for breast cancer-susceptibility
genes BRCA1 and BRCA2. Am J Hum Genet. 1998; 62: 145–158.
101 Frank TS, Deffenbaugh AM, Reid JE, Hulick M, Ward BE, Lingenfelter B et al. Clinical
characteristics of individuals with germline mutations in BRCA1 and BRCA2: analysis of 10,000
individuals. J Clin Oncol Off J Am Soc Clin Oncol. 2002; 20: 1480–1490.
102 Evans DGR, Eccles DM, Rahman N, Young K, Bulman M, Amir E et al. A new scoring system for the
chances of identifying a BRCA1/2 mutation outperforms existing models including BRCAPRO. J
Med Genet. 2004; 41: 474–480.
103 Evans DGR, Lalloo F, Wallace A, Rahman N. Update on the Manchester Scoring System for BRCA1
and BRCA2 testing. J Med Genet. 2005; 42: e39.
104 Evans DGR, Lalloo F, Cramer A, Jones EA, Knox F, Amir E et al. Addition of pathology and
biomarker information significantly improves the performance of the Manchester scoring system
for BRCA1 and BRCA2 testing. J Med Genet. 2009; 46: 811–817.
105 Antoniou AC, Pharoah PPD, Smith P, Easton DF. The BOADICEA model of genetic susceptibility to
breast and ovarian cancer. Br J Cancer. 2004; 91: 1580–1590.
106 Antoniou AC, Cunningham AP, Peto J, Evans DG, Lalloo F, Narod SA et al. The BOADICEA model of
genetic susceptibility to breast and ovarian cancers: updates and extensions. Br J Cancer. 2008;
98: 1457–1466.
124
107 Parmigiani G, Chen S, Iversen ES, Friebel TM, Finkelstein DM, Anton-Culver H et al. Validity of
models for predicting BRCA1 and BRCA2 mutations. Ann Intern Med. 2007; 147: 441–450.
108 Van Harssel JJT, van Roozendaal CEP, Detisch Y, Brandão RD, Paulussen ADC, Zeegers M et al.
Efficiency of BRCAPRO and Myriad II mutation probability thresholds versus cancer history criteria
alone for BRCA1/2 mutation detection. Fam Cancer. 2010; 9: 193–201.
109 Weitzel JN, Lagos VI, Cullinane CA, Gambol PJ, Culver JO, Blazer KR et al. Limited family structure
and BRCA gene mutation status in single cases of breast cancer. JAMA. 2007; 297: 2587–2595.
110 Hilbers FS, Meijers CM, Laros JFJ, van Galen M, Hoogerbrugge N, Vasen HFA et al. Exome
sequencing of germline DNA from non-BRCA1/2 familial breast cancer cases selected on the basis
of aCGH tumor profiling. PloS One. 2013; 8: e55734.
111 Sawyer S, Mitchell G, McKinley J, Chenevix-Trench G, Beesley J, Chen XQ et al. A role for common
genomic variants in the assessment of familial breast cancer. J Clin Oncol Off J Am Soc Clin Oncol.
2012; 30: 4330–4336.
112 Gracia-Aznarez FJ, Fernandez V, Pita G, Peterlongo P, Dominguez O, de la Hoya M et al. Whole
exome sequencing suggests much of non-BRCA1/BRCA2 familial breast cancer is due to moderate
and low penetrance susceptibility alleles. PloS One. 2013; 8: e55681.
113 Eberl MM, Sunga AY, Farrell CD, Mahoney MC. Patients with a family history of cancer:
identification and management. J Am Board Fam Pract Am Board Fam Pract. 2005; 18: 211–217.
114 Hoskins KF, Stopfer JE, Calzone KA, Merajver SD, Rebbeck TR, Garber JE et al. Assessment and
counseling for women with a family history of breast cancer. A guide for clinicians. JAMA. 1995;
273: 577–585.
115 Meyer JE, Amin E, Lindfors KK, Lipman JC, Stomper PC, Genest D. Medullary carcinoma of the
breast: mammographic and US appearance. Radiology. 1989; 170: 79–82.
116 Young SR, Pilarski RT, Donenberg T, Shapiro C, Hammond LS, Miller J et al. The prevalence of
BRCA1 mutations among young women with triple-negative breast cancer. BMC Cancer. 2009; 9:
86.
117 Oldenburg RA, Kroeze-Jansema K, Meijers-Heijboer H, van Asperen CJ, Hoogerbrugge N, van
Leeuwen I et al. Characterization of familial non-BRCA1/2 breast tumors by loss of heterozygosity
and immunophenotyping. Clin Cancer Res Off J Am Assoc Cancer Res. 2006; 12: 1693–1700.
118 Lakhani SR, Van De Vijver MJ, Jacquemier J, Anderson TJ, Osin PP, McGuffog L et al. The
pathology of familial breast cancer: predictive value of immunohistochemical markers estrogen
receptor, progesterone receptor, HER-2, and p53 in patients with mutations in BRCA1 and BRCA2.
J Clin Oncol Off J Am Soc Clin Oncol. 2002; 20: 2310–2318.
119 Gadzicki D, Schubert A, Fischer C, Milde S, Lehmann U, Steinemann D et al. Histopathological
criteria and selection algorithms for BRCA1 genetic testing. Cancer Genet Cytogenet. 2009; 189:
105–111.
120 Lidereau R, Eisinger F, Champème MH, Noguès C, Bièche I, Birnbaum D et al. Major improvement
in the efficacy of BRCA1 mutation screening using morphoclinical features of breast cancer.
Cancer Res. 2000; 60: 1206–1210.
125
121 Chang J, Hilsenbeck SG, Sng JH, Wong J, Ragu GC. Pathological features and BRCA1 mutation
screening in premenopausal breast cancer patients. Clin Cancer Res Off J Am Assoc Cancer Res.
2001; 7: 1739–1742.
122 Farshid G, Balleine RL, Cummings M, Waring P, Kathleen Cuningham Consortium for Research
into Familial Breast Cancer (kConFab). Morphology of breast cancer as a means of triage of
patients for BRCA1 genetic testing. Am J Surg Pathol. 2006; 30: 1357–1366.
123 Goldhirsch A, Wood WC, Coates AS, Gelber RD, Thürlimann B, Senn H-J et al. Strategies for
subtypes--dealing with the diversity of breast cancer: highlights of the St. Gallen International
Expert Consensus on the Primary Therapy of Early Breast Cancer 2011. Ann Oncol Off J Eur Soc
Med Oncol ESMO. 2011; 22: 1736–1747.
124 Carey LA, Perou CM, Livasy CA, Dressler LG, Cowan D, Conway K et al. Race, breast cancer
subtypes, and survival in the Carolina Breast Cancer Study. JAMA. 2006; 295: 2492–2502.
125 Turkoz FP, Solak M, Petekkaya I, Keskin O, Kertmen N, Sarici F et al. Association between
common risk factors and molecular subtypes in breast cancer patients. Breast Edinb Scotl. 2013;
22: 344–350.
126 Easton DF, Pooley KA, Dunning AM, Pharoah PDP, Thompson D, Ballinger DG et al. Genome-wide
association study identifies novel breast cancer susceptibility loci. Nature. 2007; 447: 1087–1093.
127 Garcia-Closas M, Hall P, Nevanlinna H, Pooley K, Morrison J, Richesson DA et al. Heterogeneity of
breast cancer associations with five susceptibility loci by clinical and pathological characteristics.
PLoS Genet. 2008; 4: e1000054.
128 Gorodnova TV, Kuligina ES, Yanus GA, Katanugina AS, Abysheva SN, Togo AV et al. Distribution of
FGFR2, TNRC9, MAP3K1, LSP1, and 8q24 alleles in genetically enriched breast cancer patients
versus elderly tumor-free women. Cancer Genet Cytogenet. 2010; 199: 69–72.
129 Fanale D, Amodeo V, Corsini LR, Rizzo S, Bazan V, Russo A. Breast cancer genome-wide
association studies: there is strength in numbers. Oncogene. 2012; 31: 2121–2128.
130 Mavaddat N, Barrowdale D, Andrulis IL, Domchek SM, Eccles D, Nevanlinna H et al. Pathology of
breast and ovarian cancers among BRCA1 and BRCA2 mutation carriers: results from the
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Cancer Epidemiol Biomark Prev
Publ Am Assoc Cancer Res Cosponsored Am Soc Prev Oncol. 2012; 21: 134–147.
131 Robertson L, Hanson H, Seal S, Warren-Perry M, Hughes D, Howell I et al. BRCA1 testing should
be offered to individuals with triple-negative breast cancer diagnosed below 50 years. Br J Cancer.
2012; 106: 1234–1238.
132 Andrés R, Pajares I, Balmaña J, Llort G, Ramón Y Cajal T, Chirivella I et al. Association of BRCA1
germline mutations in young onset triple-negative breast cancer (TNBC). Clin Transl Oncol Off
Publ Fed Span Oncol Soc Natl Cancer Inst Mex. 2014; 16: 280–284.
133 Blanco A, de la Hoya M, Balmaña J, Ramón y Cajal T, Teulé A, Miramar M-D et al. Detection of a
large rearrangement in PALB2 in Spanish breast cancer families with male breast cancer. Breast
Cancer Res Treat. 2012; 132: 307–315.
126
134 Meindl A, Hellebrand H, Wiek C, Erven V, Wappenschmidt B, Niederacher D et al. Germline
mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer
susceptibility gene. Nat Genet. 2010; 42: 410–414.
135 Hearle N, Schumacher V, Menko FH, Olschwang S, Boardman LA, Gille JJP et al. Frequency and
spectrum of cancers in the Peutz-Jeghers syndrome. Clin Cancer Res Off J Am Assoc Cancer Res.
2006; 12: 3209–3215.
136 FitzGerald MG, Marsh DJ, Wahrer D, Bell D, Caron S, Shannon KE et al. Germline mutations in
PTEN are an infrequent cause of genetic predisposition to breast cancer. Oncogene. 1998; 17:
727–731.
137 Vuorela M, Pylkäs K, Hartikainen JM, Sundfeldt K, Lindblom A, von Wachenfeldt Wäppling A et al.
Further evidence for the contribution of the RAD51C gene in hereditary breast and ovarian cancer
susceptibility. Breast Cancer Res Treat. 2011; 130: 1003–1010.
138 Rahman N, Seal S, Thompson D, Kelly P, Renwick A, Elliott A et al. PALB2, which encodes a
BRCA2-interacting protein, is a breast cancer susceptibility gene. Nat Genet. 2007; 39: 165–167.
139 Seal S, Thompson D, Renwick A, Elliott A, Kelly P, Barfoot R et al. Truncating mutations in the
Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. Nat Genet.
2006; 38: 1239–1241.
140 Tapper W, Hammond V, Gerty S, Ennis S, Simmonds P, Collins A et al. The influence of genetic
variation in 30 selected genes on the clinical characteristics of early onset breast cancer. Breast
Cancer Res BCR. 2008; 10: R108.
141 Fostira F, Tsitlaidou M, Papadimitriou C, Pertesi M, Timotheadou E, Stavropoulou AV et al.
Prevalence of BRCA1 mutations among 403 women with triple-negative breast cancer:
implications for genetic screening selection criteria: a Hellenic Cooperative Oncology Group Study.
Breast Cancer Res Treat. 2012; 134: 353–362.
127
9.Anexos
Anexo 1
TERMO DE INFORMAÇÃO E CONSENTIMENTO PARA GUARDA E UTILIZAÇÃO
DE MATERIAL BIOLÓGICO
Você está sendo admitido (a) neste Hospital para estabelecimento de diagnóstico, fator
prognóstico e/ou tratamento de alguma forma de tumor. Para estes fins pode haver a
necessidade de remoção do tumor e/ou material biológico relacionado à enfermidade. É
prática rotineira, deste hospital, usar parte do tumor e/ou material biológico (saliva, sangue e
outros) retirado para exames clínicos laboratoriais e diagnóstico definitivo. O restante do
tumor ou do material biológico que é retirado e não é utilizado é congelado e armazenado
para novos exames, se necessário, caso contrário, são descartados conforme legislação
sanitária regulamentar sobre o assunto.
Para obter um maior conhecimento sobre o câncer, médicos e pesquisadores deste
Hospital desenvolvem pesquisa clínica e científica. Através dessa pesquisa é possível
conhecer melhor os mecanismos da doença e, portanto, tentar oferecer novas possibilidades
de diagnóstico, prognóstico e tratamento. Estes estudos somente serão possíveis se realizados
em fragmentos de tumores removidos ou em material biológico colhido (saliva, sangue dentre
outros).
Estamos solicitando a sua permissão para guardar e utilizar um fragmento do tumor
e/ou material biológico retirados de você e que não são mais necessários para o seu
diagnóstico. Esclarecemos que a obtenção e o estudo dos referidos fragmentos de tumor e
material biológico não implicarão em riscos adicionais ao seu tratamento, diagnóstico ou
prognóstico, nem tampouco, em aumento no tempo e período para a execução dos
procedimentos necessários.
O depositário destes tecidos será o Banco de Tumores do Hospital de Câncer de
Barretos. Este material poderá ser usado em pesquisas futuras. A eventual inclusão de seu
material em projetos de pesquisa só ocorrerá após apreciação e aprovação da Comissão de
Ética em Pesquisa do Hospital. A utilização para qualquer outro fim deverá ter apreciação e
aprovação do Comitê de Armazenamento e Utilização de Materiais Biológicos desta
Instituição. Sua privacidade e identidade serão sempre preservadas.
A eventual inclusão dos resultados em publicação científica ou outros meios será feita
sempre de modo a manter o seu anonimato, já que todo material do Banco de Tumores é
128
codificado. No entanto, como o Diretor do Banco tem acesso a sua identidade, em casos de
pesquisas genéticas que caracterizam alterações que envolvam riscos para seus familiares
podem lhe ser informados, se esse for seu desejo.
Ressalta-se ainda que não existirá quaisquer benefícios ou direitos financeiros a
receber sobre os eventuais resultados decorrentes da utilização do seu fragmento de tumor
e/ou material biológico. Ressalta-se ainda que, se você não concordar em doar o material para
o Banco de Tumores, sua decisão não influenciará, de nenhum modo, no seu tratamento.
A autorização para armazenamento e utilização destas amostras é por prazo
indeterminado, podendo ser cancelada por aviso escrito ao Diretor do Banco de Tumores
desta Instituição.
Caso você tenha questões a fazer sobre este Termo de Consentimento, ou alguma
dúvida que não tenha sido esclarecida pelo seu médico, por gentileza, entre em contato com a
Comissão de Ética Medica, pelo telefone (17) 3321-6600, ramal 6875.
Você receberá uma cópia deste documento e o original será arquivado em seu
prontuário. Somente assine este se consentir.
Declaração
Eu, ..............................................................declaro estar ciente das informações ora
prestadas, tendo lido atentamente e concordado com todo o teor, DOANDO meu material
biológico (tumor, tecido, sangue, saliva e outros) integralmente para a Fundação Pio XII.
(escrever Sim ou Não) ......................... consinto (concordo) que meu material
biológico, quando não necessário para o meu diagnóstico, possa ser coletado, guardado e
utilizado pelo Banco de Tumores desta Instituição, perante aprovação prévia do Comitê
competente. Autorizo também acesso a meus dados de idade, sexo, fatores epidemiológicos
relacionados, e outras informações do meu prontuário médico, diagnóstico, tratamento e
história familiar e sua utilização, desde que minha identidade seja mantida em
confidencialidade.
Se a resposta anterior for SIM, minha informação e amostra poderão ser usadas em
teste genéticos, que podem identificar risco de doenças genéticas para meus familiares. Nesse
caso (escrever Sim ou Não), ...................... quero ser informado da descoberta.
129
Por expressão de verdade firmo o presente Termo.
Barretos/SP, _________ de _________________________ de ___________
Nome do(a) paciente
Assinatura do(a) paciente
Nome do responsável
Assinatura do responsável
130
Anexo 2
Termo de Consentimento Livre e Esclarecido
IDENTIFICAÇÃO E ANÁLISE DE MUTAÇÕES EM GENES DE PREDISPOSIÇÃO
HEREDITÁRIA AO CÂNCER
PROCEDIMENTO DA INVESTIGAÇÃO:
Esse é um teste que está sendo oferecido pelo Hospital de Câncer de Barretos e sua
participação não vai influenciar ou modificar seu acesso a qualquer tratamento médico. A sua
participação é voluntária, e dessa forma você tem o direito a se recusar a participar do teste genético, e
você pode desistir de fazê-lo a qualquer momento. Você também tem a opção de realizar o teste
anonimamente, situação em que seu DNA será estudado para identificar alterações em genes de
predisposição ao câncer, mas, nesse caso, não lhe será dito o resultado.
O teste genético pode lhe proporcionar uma estimativa mais precisa do risco de desenvolver
câncer ao longo de sua vida, além de permitir determinar se você tem uma alteração genética que pode
ser transmitida para seus filhos. Este teste não tem uma precisão de 100% e há limitações sobre o ele
pode lhe revelar.
É importante destacar que este teste não vai lhe trazer informações sobre o seu estado de
saúde atual.
Inicialmente você participará de pelo menos duas consultas de aconselhamento genético, onde
terá a oportunidade de discutir os possíveis benefícios, limitações e riscos da análise dos genes de
predisposição hereditária ao câncer em seu caso. Você precisará fornecer informações detalhadas
sobre sua história familiar, inclusive informações sobre parentes que tiveram câncer ao longo de suas
vidas. A princípio, esse aconselhamento é realizado individualmente, mas você poderá trazer um
familiar ou outra pessoa para acompanhar a consulta. Será sugerido que você forneça informações
sobre esta avaliação que está sendo realizada a outros familiares.
O teste genético normalmente requer a retirada de 10 ml de sangue periférico. Em raras
situações será necessário coletar sangue novamente para realizar o teste.
A avaliação psicológica estará disponível antes e após a realização do teste genético.
O teste genético não é pago pelo SUS ou por planos de saúde privados, sendo possibilitado
para você gratuitamente pelo Hospital do Câncer de Barretos (HCB). Não é um teste de rastreamento
de câncer a ser oferecido para a população em geral, somente para pacientes e famílias que preencham
os critérios clínicos pré-estabelecidos pela equipe da Oncogenética.
131
RESULTADOS:
Quando a análise estiver concluída, você será contactado (a) e convidado (a) a marcar uma
consulta para receber o resultado do exame pessoalmente. Nenhuma informação será fornecida por
telefone ou carta, independente do resultado. Quando o resultado do teste laboratorial estiver
disponível, você poderá adiar ou recusar o recebimento destes resultados. Excepcionalmente, o
resultado poderá ser fornecido a um de seus familiares, se autorizado previamente por você e se esta
pessoa estiver acompanhando a investigação.
Quando você receber o resultado de seu teste, terá a opção de transmitir ou não esse resultado
a outros familiares. Se outros familiares tiveram indicação do teste e decidirem participar, eles serão
atendidos pela equipe da Oncogenética para receber explicações e orientações, e então assinar
formulário de consentimento e coleta de sangue para a realização do teste.
Nenhuma informação médica a seu respeito será fornecida a outros familiares durante o
processo de entrevistas sem o seu consentimento expresso e por escrito.
DURANTE O ACONSELHAMENTO, SERÁ EXPLICADO QUE HÁ TRÊS POSSÍVEIS
RESULTADOS:
1) Ter herdado um gene de predisposição ao câncer alterado (mutação genética).
Saiba que, a presença de uma mutação gênica não indica a certeza de desenvolvimento do câncer,
mas sim, uma chance aumentada para o desenvolvimento de diferentes tipos de câncer, que irá variar
dependendo da região do material genético em que estiver a mutação. O risco pode ser diferente para
homens e mulheres, dependendo do tipo de câncer em questão.
2) Não ter herdado um gene de predisposição ao câncer alterado (mutação genética).
Com isso, podemos chegar à conclusão que uma alteração nos genes para as quais você foi
testado não explica sua história pessoal e familiar de câncer. Ainda assim, é possível que você tenha
herdado um outro gene de predisposição ao câncer para o qual ainda não há testes disponíveis.
3) Ser impossível de determinar se você herdou ou não um gene de predisposição ao câncer
alterado (teste inconclusivo).
Se o teste laboratorial for inconclusivo, você terá a opção de repetir o teste em outra data. Neste
caso, o laboratório continuará estudando sua amostra de sangue (DNA) à procura de outros genes
alterados que possam estar contribuindo para a ocorrência de câncer. Porém, se esse for o caso, não há
prazo ou promessa de um resultado conclusivo para essa segunda investigação.
RISCOS E DESCONFORTO:
Normalmente há riscos mínimos e infreqüentes envolvidos na coleta de uma amostra de
sangue. Estes riscos incluem: dor no local da coleta, sangramento, hematoma (uma marca roxa na
pele) e infecção.
Os riscos do teste genético são primariamente de origem psicológica. Saber que você tem um
gene de predisposição ao câncer alterado poderia causar depressão, ansiedade, raiva e medo do futuro.
Este resultado poderia afetar as suas relações com familiares e entes queridos. Se você descobrir que
132
tem um gene de predisposição alterado, e tornar pública essa informação, isso poderia gerar algum tipo
de discriminação especialmente por companhias de seguro, planos de saúde, empregadores e até
mesmo familiares.
BENEFÍCIOS DA INFORMAÇÃO:
Este teste pode fornecer uma informação que torna possível calcular com maior precisão se
você ou seus parentes, inclusive seus filhos, têm maior risco de desenvolver certos tipos de câncer. Se
este for o caso, vocês serão aconselhados quanto às opções de prevenção do câncer e seguimento a
longo prazo.
Se você descobrir que não herdou um gene alterado, você poderá evitar exames de detecção
precoce ou cirurgias preventivas desnecessárias e, além disso, você não vai transmitir essa alteração
para os seus filhos. O fato de descobrir que você não tem uma predisposição maior ao câncer para o
qual você foi testado poderá lhe trazer uma grande sensação de alívio ao descobrir o resultado do teste.
USO DA AMOSTRA DE SANGUE:
Qualquer amostra de sangue obtida com a finalidade de realizar este teste ficará armazenada no
Hospital de Câncer de Barretos. Estamos solicitando também a sua permissão para armazená-lo junto
ao Laboratório de Patologia Molecular e utilizá-lo em pesquisas futuras, que tenham como objetivo
conhecer melhor os mecanismos do surgimento e progressão do câncer. A eventual inclusão de seu
material biológico em projetos de pesquisa só ocorrerá após apreciação e aprovação pela Comissão
de Ética em Pesquisa do Hospital de Câncer de Barretos.
CONFIDENCIALIDADE:
O resultado final do teste genético será mantido unicamente em arquivos do Departamento da
Oncogenética. Somente será registrada no prontuário médico a sua participação no teste genético, mas
não o resultado. O resultado somente poderá ser fornecido a qualquer outra pessoa, instituição,
empresa ou seguros de saúde mediante sua autorização por escrito. Os dados usados para pesquisa ou
publicações científicas não terão a identificação dos participantes.
PEDIDO DE MAIS INFORMAÇÕES:
Você pode fazer mais perguntas sobre o teste genético a qualquer momento para qualquer
pessoa da equipe da Oncogenética. Nosso telefone de contato é (17)3321 6600, no Hospital de Câncer
de Barretos, ramal 7059.
ACOMPANHAMENTO MÉDICO
Você e seus familiares em risco para câncer poderão ser acompanhados periodicamente pela
equipe da Oncogenética se assim o desejarem, inclusive realizando os exames necessários conforme os
protocolos pré-estabelecidos para cada caso..
133
DOCUMENTAÇÃO DE CONSENTIMENTO:
Recebi uma cópia deste termo de consentimento livre e esclarecido para manter comigo. Uma outra
cópia deste consentimento será mantida pelo Departamento de Oncogenética e uma terceira cópia será
mantida no laboratório de Patologia Molecular do Hospital de Câncer de Barretos.
1. Eu gostaria de saber os resultados de meu teste genético, os quais poderão me dar informações
sobre o risco de ter um gene alterado que aumenta o risco de desenvolvimento de câncer.
Marque com um X:
Sim (
)
Não (
)
2. Eu dou permissão para que minha amostra seja estocada para futuras pesquisas na área de genética
e câncer no Hospital de Câncer de Barretos.
Marque com um X:
Sim (
)
Não (
)
3. No caso de novas informações sobre o risco de câncer, mais especificamente sobre os tipos de
câncer que ocorrem na minha família, ou de novas pesquisas nessa área das quais eu poderia
participar, gostaria que a equipe da Oncogenética entrasse em contato comigo.
Marque com um X:
Sim (
)
Não (
)
4. Em caso de impossibilidade de receber o resultado do teste genético, autorizo a seguinte pessoa a
recebê-lo por mim (pessoalmente):
Nome:__________________________________________________________________
RG:_______________________________CPF:__________________________________
Endereço:________________________________________________________________
Eu concordo em realizar a análise genética e aceito os riscos. Eu entendo as informações fornecida
por este documento e eu tive a oportunidade de fazer perguntas e esclarecer dúvidas que eu tinha sobre
o teste, o procedimento, os riscos associados e as alternativas.
______________________________ _________________
Participante
Data
_________________
Data de Nascimento
______________________________ _________________
Testemunha
Data
_______________________________ __________________
Equipe Oncogenética
Data
134
Anexo 3
ETIQUETA
IDENTIFICAÇÃO
1
Nome
2
RGH
Data de Nascimento
DD-MM-AAAA
4
Data de Admissão Hospitalar
DD-MM-AAAA
5
Sexo
3
6
1- Feminino; 2- Masculino
Cor - Padrão IBGE ou exterior
1- Branco; 2- Pardo; 3- Negro; 4- Amarelo; 99- Ignorado
Estado Civil
7
0- Solteiro; 1-Casado / União estável; 2- Separado / Divorciado; 3-Viúvo; 99- Ignorado
Escolaridade
8
9
10
11
12
13
14
15
1- Analfabeto; 2- 1 Grau Incompleto; 3- 1º Grau Completo;
4- 2º Grau Incompleto; 5- 2º Grau Completo; 6- Superior; 99-ignorado
Profissão
Procedencia
Tem diagnóstico de câncer
0- Não; 1- Sim; 99- Ignorado
1- Múltiplos tumores primários
2- Tumor em idade jovem
3- Tumor bilateral
4- Multifocalidade/sincronicidade
5- Sítio tumoral não usual
6- Histologia rara
7- Tumor de mama masculino
8- Tumor em associação com doença genética/anomalia congênita
9- História familial
10- Outros
99- Ignorado
Qual o sítio do tumor primário? (se tiver mais que um descrever o mais recente primeiro)
Ano do diagnóstico
Idade ao diagnóstico
16
Descrever o anatomopatológico (Tipo, Grau)
17
Receptor de estrógeno
18
Receptor de progesterona
19
20
21
22
23
24
Her-2
Estadiamento (TNM)
Já teve outro tipo de câncer, em outra parte do corpo
0- Não; 1- Sim; 99- Ignorado
Quantos outros primários?
Já teve algum tipo de Tumor Benigno?
0- Não; 1- Sim; 99- Ignorado
Qual o sítio do tumor benigno
1- Rim
7- Meningeoma
135
23456-
Suprarrenal
Pâncreas
Hipófise
Osso
Tireóide
8- Mioma
9- Lipoma
10-Cerebelo
11- Outros____________________
99- Ignorado
Lesões benignas da mama
0- Não; 1- Sim; 99- Ignorado
25
26
Biópsia de mama por lesão suspeita
0- Não; 1- Sim; 99- Ignorado
Cirurgias
27
28
29
30
31
32
33
Mamografia regularmente
Menarca
Menopausa
Idade primeira gestação
Parto normal
Cesária
34
Aborto
35
Anticoncepcional
36
37
38
0- Não; 1- Sim; 99- Ignorado
Reposição hormonal
Fumante
0- Não; 1- Sim
Etilista
0- Não; 1- Sim
136
Anexo 4
137
Anexo 5
Manuscrito submetido para Hereditary Cancer in Clinical Practice.
Association of polymorphisms with a family history of cancer and the presence of germline
mutations in the BRCA1/BRCA2 genes
Gabriela Carvalho Fernandes1,2, Rodrigo AD Michelli, MD3, Cristovam ScapulatempoNeto1,2,4, Edenir I Palmero, PhD1,2,3,5.
Authors Primary Affiliations:
1. Molecular Oncology Research Center, Barretos Cancer Hospital, Brazil.
2. Post-Graduate Program in Oncology, Barretos Cancer Hospital, Brazil.
3. Oncogenetics Department, Barretos Cancer Hospital, Brazil.
4. Pathology Department, Barretos Cancer Hospital, Brazil.
5. Barretos School of Health Sciences, Dr. Paulo Prata – FACISB, Brazil.
Acknowledgements
This project was financially supported by CNPq and Barretos Cancer Hospital internal
research funds (PAIP).
Correspondence to:
Edenir Inêz Palmero, PhD
Centro de Pesquisa em Oncologia Molecular, Hospital de Câncer de Barretos
Av Antenor Duarte Vilela, 1331 – Barretos, SP, Brazil, CEP 14784-400
Telephone number: + 55 17 3321 6600 ext 7057
Fax number: + 55 17 3321 6600
Email: [email protected]
Running head: Polymorphisms in Hereditary Breast Cancer.
138
Disclaimer: This study does not have any conflicts of interest.
Abstract:
Introduction: Breast cancer (BC) is an important public health problem worldwide. In Brazil,
breast cancer is the most frequently diagnosed tumor and the leading cause of cancer death
in women. Hereditary cancer represents approximately 5 to 10% of BC cases. Even outside
the hereditary cancer context, the presence of polymorphisms acting as genetic modifiers
may contribute to a better or worse prognosis. Not much is known about the hereditary BC
epidemiology in Brazil or about the influence of polymorphisms on hereditary
predisposition. Objective: This study examined the role of five different polymorphisms in
four groups of women with BC: Group 1: women with a germline mutation in the BRCA1/2
genes; Group 2: women with variants of uncertain significance in BRCA1/2; Group 3: women
with no mutations in BRCA1/2; and Group 4: "sporadic BC“. Patients and methods: The
women included in groups 1, 2 and 3 were patients from the Department of Oncogenetics of
the Barretos Cancer Hospital who had undergone genetic testing because of a clinical
suspicion of hereditary predisposition syndrome. Group 4 included women from the
Department of Mastology at the same institution. The constitutive DNA was analyzed for the
presence of polymorphisms at rs2981582 (FGFR2 gene); rs3803662 (TNRC9); rs889312
(MAP3K1); rs3817198 (LSP1 gene); and rs13281615 (8Q24). The analyses were performed
using PCR amplification and bi-directional sequencing.
Results: No differences were identified in the frequency of the polymorphisms that were
analyzed among the four groups. However, some associations were identified, such as the
occurrence of bilateral breast cancer and homozygosity for the G allele in rs13281615 as well
as the correlation between the SNPs rs2981582 and rs13281615 and the number of cancer
cases in the family. Regarding the G allele of rs13281615, we observed that the proportion
of individuals who were homozygous for this allele increased with the number of
generations affected by cancer. Regarding the hormone receptors, we observed an
increased frequency in G homozygotes (rs3803662) among estrogen receptor-negative
individuals. For rs2981582 (FGFR2), we observed an increased frequency of the T allele in
139
women who were positive for the estrogen and progesterone receptors (p=0.020 and
p=0.014, respectively).
Conclusion: The results presented here provide interesting data on the modifying effect of
polymorphisms on a family history of cancer; this may be a variable to consider in the
analysis of tumor diversity, and of the family history observed in families with hereditary
breast cancer (even in those harboring the same type of genetic alteration).
140
Introduction
In Brazil, breast neoplasms are the main cause of death by cancer among women (1).
It is currently estimated that 5-10% of the total number of breast cancer (BC) cases are
hereditary. BRCA1 and BRCA2 are among the genes associated with hereditary breast cancer
(2, 3). Women harboring a germline mutation in the BRCA1 gene show a lifetime cumulative
risk (LCR) between 44 and 68% of developing breast cancer until 70 years of age. Moreover,
the LCR for ovarian cancer in these patients is also significantly higher and may reach 60% by
70 years of age (4, 5). The BRCA2 gene, when altered, is responsible for approximately 30 to
40% of all cases of hereditary breast cancer. The LCR for breast cancer in women harboring
germline mutations in this gene is similar to the risk of carriers of germline mutations in
BRCA1 (44 to 68% until 70 years of age) (6, 7), whereas the risk of ovarian cancer ranges
from 15 to 30% (8, 9). Families with mutations in BRCA1/2 differ in terms of age at diagnosis,
the number of family members affected, and tumor prognosis. Currently, several reports in
the literature point to the role of polymorphisms as genetic modifiers of the risk of cancer in
families and as responsible factors for part of this diversity identified in the families with
known mutations.
In 2007, a large study was conducted by Easton and collaborators (10) involving
genome-wide association studies (GWAS) of 4,398 cases (women with breast cancer) and
4,316 controls, followed by a validation step involving 21,860 cases and 22,578 controls. This
study identified single nucleotide polymorphisms (SNPs) in five loci that were associated
with the risk of developing breast cancer: 1) rs2981582 (C>T) in gene FGFR2, which encodes
a tyrosine kinase receptor that acts in the development of the mammary glands; 2)
rs3803662 (C>T), localized in a region that includes TNRC9; 3) rs889312 (A>C), localized in a
region that includes MAP3K1 in addition to two putative genes, MGC33648 and MIER3; 4)
rs3817198 (T>C) in gene LSP1; and 5) rs13281615 (A>G), which resides in a region that does
not include any known gene (8q24) but where variants associated with an increased risk of
prostate and colorectal cancer have been identified. The authors correlated the presence of
the above mentioned polymorphisms with histopathological characteristics such as positivity
or negativity for the estrogen and progesterone hormone receptors, stage of tumor
development, nodes, size, histology and stage at diagnosis. Among the five SNPs mentioned
above, three (rs2981582, rs3803662 and rs889312) were significantly associated with an
141
increased risk of breast cancer in estrogen receptor-positive individuals. Women who were
TT homozygous in SNP rs3803662 and who had estrogen-negative tumors exhibited a risk of
developing breast cancer that was 1.28-fold (95% CI = 1.13–1.45) higher than women who
were homozygous for the wild-type allele (present in 53% of the controls). Additionally, a
study involving 1,267 patients with breast cancer identified that individuals who were CT
heterozygous or TT homozygous for rs3803662 exhibited a higher probability of having
breast cancer diagnosed before the age of 60 years (p=0.025) (11).
Studies involving rs3817198 have found that the least frequent allele (C) leads to an
increase of approximately 10% in the risk of breast cancer in Caucasian women; however,
the same allele has a protective effect among women of African ascent (12, 13).
Considering the factors described above and the possible modifying effect conferred
by polymorphisms, the objective of this study was to evaluate the frequency of the
polymorphisms rs2981582, rs3803662, rs889312, rs3817198, and rs13281615 in women with
breast cancer, with or without mutations in the BRCA1 and BRCA2 genes, and to correlate the
frequency of the different polymorphisms with the family history of cancer and with the
histopathological features of the tumors.
Materials and Methods
Cases
This project was approved by the Research Ethics Committee of the Barretos Cancer
Hospital. All the participants in the study were treated at this institution and signed an
informed consent form. The women from the oncogenetics department underwent genetic
testing for mutations in the BRCA1 and BRCA2 genes and, based on the results, were
allocated to three different groups: a) Group 1: 51 women with a personal and family history
of breast cancer with a pathogenic germline mutation in the BRCA1 and/or BRCA2 genes; b)
Group 2: 53 women with a personal and family history of breast cancer with the presence of
a variant of unknown clinical significance (VUS) identified in the BRCA1 and/or BRCA2 genes;
c) Group 3: 100 women with a personal and family history of breast cancer without a
pathogenic mutation and/or mutation of unknown clinical significance identified in the
BRCA1 and/or BRCA2 genes. Additionally, there were 83 women included with a personal
history of breast cancer who were not selected according to their cancer family history and
142
who did not undergo genetic testing for the analysis of mutations in the BRCA1 and/or
BRCA2 genes (“sporadic” group).
Molecular Analysis
For the polymorphism analysis, DNA was extracted using the QIAamp Blood DNA
Mini-Kit (Qiagen) according to the manufacturer's instructions. Genotyping was performed
through PCR amplification using the Hot Start Taq enzyme (Qiagen). Following amplification,
the products were purified with the ExoSap enzyme (USB products) and sequenced
bidirectionally using the BigDye Terminator v3.1 Kit (Applied Biosystems, USA).
Electrophoresis was run in the automated sequencer model 3500 (Applied Biosystems, USA).
For the analysis of mutations in the BRCA1 and BRCA2 genes and the subsequent
separation of the participants into the three study groups, a multiplex PCR amplification of
all coding exons of the BRCA1 (NCBI; NM_007294.3) and BRCA2 (NCBI; NM_000059.3) genes
and their respective flanking intronic regions was performed, followed by bidirectional
sequencing using two platforms (ABI 3500 XL sequencer) and a new generation sequencer
(Ion Torrent PGM, Applied Biosystems). In addition, large rearrangements were investigated
using the multiplex ligation-dependent probe amplification (MLPA) technique.
Statistical Analysis
The program SPSS v.21.0 for Windows (Chicago, IL) was used for the statistical analysis.
The categorical variables were described using absolute frequencies and relative percentage
frequencies. The correlations were obtained using the Chi-square and Fisher’s exact tests.
The level of significance adopted in all the tests was 5%.
Results
The following polymorphisms were considered in this study: rs2981582 in gene FGFR2,
rs3803662 in gene TNRC9, rs13281615 and rs889312 in gene MAP3K1 and rs3817198 in
gene LSP1.
143
Table 1 presents the genotype frequency of the five polymorphisms that were
evaluated and their distribution in the different study groups.
Table 1: Frequency of polymorphisms rs3803662 (TNRC9), rs2981582 (FGFR2), rs13281615,
rs889312 (MAP3K1) and rs3817198 (LSP1) per group.
Variable
Group 1
N (%)
Group 2
N (%)
Group 3
N (%)
Group 4
N (%)
rs3803662 (TNRC9)
P value*
0.027
TT
5 (9.8)
12 (22.6)
17 (17.3)
16 (19.5)
CT
27 (52.9)
24 (45.3)
47 (48.0)
37 (45.1)
CC
19 (37.3)
17 (32.1)
34 (34.7)
29 (35.4)
rs2981582 (FGFR2)
0.031
TT
14 (27.5)
9 (16.7)
26 (26.3)
19 (23.2)
CT
22 (43.1)
33 (61.1)
49 (49.5)
43 (52.4)
CC
15 (29.4)
12 (22.2)
24 (24.2)
20 (24.4)
rs13281615 (8q24)
0.029
AA
14 (27.5)
11 (20.4)
27 (27.0)
23 (28.0)
AG
24 (47.1)
26 (48.1)
48 (48.0)
37 (45.1)
GG
13 (25.5)
17 (31.5)
25 (25.0)
22 (26.8)
rs889312 (MAP3K1)
0.029
CC
8 (15.7)
8 (14.8)
11 (11.0)
8 (9.8)
CA
21 (41.2)
20 (37.0)
55 (55.0)
36 (43.9)
AA
22 (43.1)
26 (48.1)
34 (34.0)
38 (46.3)
rs3817198 (LSP1)
0.023
TT
26 (51.0)
28 (51.9)
44 (44.4)
38 (46.3)
TC
22 (43.1)
24 (44.4)
43 (43.4)
38 (46.3)
CC
3 (5.9)
2 (3.7)
12 (12.1)
6 (7.3)
*Chi-square
Group 1: women with germline mutations in the BRCA1/BRCA2 genes; Group 2: women with VUS in the BRCA1/BRCA2
genes; Group 3: women WT for the BRCA1/BRCA2 genes; Group 4: control, sporadic group.
Note: Values in bold indicate statistical significance (p<0.05).
Although there were no marked differences in the frequency of the polymorphisms
studied among the four groups, some findings are noteworthy: i) there was a higher
frequency of TT homozygotes for rs3803662 in the groups comprising women without
mutations in the BRCA1/BRCA2 genes; ii) regarding rs889312, an increase was observed in
144
the frequency of heterozygous individuals among those without mutations or VUS in
BRCA1/2; and iii) the groups with mutations and VUS had higher frequencies of
homozygosity for the “normal” allele and of heterozygosity for the SNP rs3817198 compared
to the WT and sporadic groups, which had a relatively increased frequency of CC
homozygotes compared to groups 1 and 2.
The analysis of the family history of cancer according to the different polymorphisms
studied is detailed in Table 2.
145
Table 2: Correlations between the genotype frequencies of the polymorphisms and the
family history of cancer (overall).
Number of cancer
cases
Presence of
bilateral breast
cancer
Presence of
ovarian cancer
Number of generations with
cancer
Number of
breast cancer
cases
Polymorphism
≤3
>3
Yes
No
Yes
No
1
2
3
4
≤3
>3
rs3803662 - TT
N (%)
24
(20.2)
24
(15.5)
4
(20.0)
43
(17.0)
4
(14.3)
43
(17.5)
18
(22.2)
20
(16.8)
9
(13.4)
1
(16.7)
39
(18.2)
9
(15.2)
rs3803662 - TC
N (%)
49
(41.2)
83
(53.6)
9
(45.0)
123
(48.6)
15
(53.6)
117
(47.6)
33
(40.7)
59
(49.6)
36
(53.7)
4
(66.6)
97
(45.3)
34
(57.6)
rs3803662 - CC
N (%)
46
(38.6)
48
(30.9)
7
(35.0)
87
(34.4)
9
(32.1)
85
(34.7)
30
(37.1)
40
(33.6)
22
(32.9)
1
(16.7)
78
(36.5)
16
(27.2)
Total N (%)
119
(100.0)
155
(100.0
20
(100.0)
253
(100)
28
(100)
245
(100.0)
81
(100)
119
(100)
67
(100)
6
(100)
214
(100)
59
(100)
P value*
(p=0.729)
(p=0.883)
(p=0.959)
(p=0.885)
(p=0.538)
rs2981582 - TT
N (%)
32
(26.6)
34
(21.8)
4
(20.0)
62
(24.3)
2
(7.5)
64
(25.8)
20
(24,7)
31
(26,0)
12
(17,4)
3
(50,0)
50
(23,3)
15
(25,0)
rs2981582 - TC
N (%)
53
(44.2)
89
(57.1)
13
(65.0)
129
(50.6)
18
(66.6)
124
(50.0)
38
(46.9)
58
(48.7)
44
(63.7)
1
(16.6)
108
(50.2)
34
(56.6)
rs2981582 - CC
N (%)
35
(29.2)
33
(21.1)
3
(15.0)
64
(25.1)
7
(25.9)
60
(24.2)
23
(28.4)
30
(25.3)
13
(18.9)
2
(33.4)
57
(26.5)
11
(18.4)
Total N (%)
120
(100.0)
156
(100)
20
(100.0)
255
(100)
27
(100)
248
(100.0)
81
(100)
119
(100)
69
(100)
6
(100)
215
(100)
60
(100)
P value*
(p=0.729)
(p=0.721)
(p=0.154)
(p=0.665)
(p=0.329)
rs13281615 - AA
N (%)
36
(30.0)
34
(21.7)
3
(15.0)
67
(26.1)
11
(39.3)
59
(23.8)
27
(33.3)
26
(21.8)
17
(24.3)
0
(0.0)
55
(25.5)
15
(25.0)
rs13281615 - AG
N (%)
64
(53.3)
69
(43.9)
5
(25.0)
127
(49.6)
12
(42.8)
120
(48.4)
40
(49.4)
61
(51.3)
28
(40.0)
3
(50.0)
105
(48.6)
27
(45.0)
rs13281615 -GG
N (%)
20
(16.7)
54
(34.4)
12
(60.0)
62
(24.3)
5
(17.9)
69
(27.8)
14
(17.3)
32
(26.9)
25
(35.7)
3
(50.0)
56
(25.9)
18
(30.0)
Total N (%)
120
(100)
157
(100)
20
(100.0)
256
(100)
28
(100)
248
(100)
81
(100)
119
(100)
70
(100)
6
(100)
216
(100)
60
(100)
P value*
0.003
0.005
0.078
0.005
0.667
rs889312 - CC
N (%)
14
(11.6)
19
(12.1)
5
(25.0)
28
(10.9)
2
(7.1)
31
(12.5)
7
(8.7)
16
(13.4)
10
(14.4)
0
(0.0)
27
(12.5)
6
(10.0)
rs889312 - CA
N (%)
52
(43.4)
77
(49.0)
12
(60.0)
117
(45.7)
12
(42.9)
117
(47.2)
36
(44.4)
50
(42.0)
37
(52.8)
5
(83.3)
99
(45.8)
30
(50.0)
rs889312 - AA
N (%)
54
(45.0)
61
(38.9)
3
(15.0)
111
(43.4)
14
(50.0)
100
(40.3)
38
(46.9)
53
(44.6)
23
(32.8)
1
(16.7)
90
(41.6)
24
(40.0)
Total N (%)
120
(100)
157
(100)
20
(100)
256
(100)
28
(100)
248
(100)
81
(100)
119
(100)
70
(100)
6
(100)
216
(100)
60
(100)
P value*
0.469
0.006
0.260
0.066
0.932
rs3817198 - TT
N (%)
59
(49.1)
74
(47.4)
6
(30.0)
127
(49.8)
18
(66.7)
115
(46.3)
46
(56.8)
51
(42.9)
33
(47.8)
2
(33.3)
105
(48.8)
28
(46.7)
rs3817198 - TC
N (%)
47
(39.2)
73
(49.8)
10
(50.0)
109
(42.7)
6
(22.2)
113
(45.6)
30
(37.1)
60
(50.4)
26
(37.7)
4
(66.7)
92
(42.8)
28
(46.7)
rs3817198 - CC
N (%)
14
(11.7)
9
(5.8)
4
(20.0)
19
(7.5)
3
(11.1)
20
(8.1)
5
(6.1)
8
(6.7)
10
(14.5)
0
(0.0)
18
(8.4)
4
(6.6)
Total N (%)
120
(100)
156
(100)
20
(100)
255
(100)
27
(100)
248
(100)
81
(100)
119
(100)
69
(100)
6
(100)
215
(100)
60
(100)
P value*
0.635
0.029
0.183
0.097
0.960
*Chi-square
Note: Values in bold indicate statistical significance (p<0.05).
146
When comparing the genotypes with the family history of cancer, some potential
associations were identified, including the occurrence of bilateral breast cancer and
homozygosity for the G allele in rs13281615 and rs889312 in which 85% of women with
bilateral breast cancer had at least one C allele versus 57% of those with unilateral breast
cancer. Likewise, 85% of the women with bilateral breast cancer had at least one T allele in
rs2981582. Furthermore, regarding allele G in rs13281615, we observed that the proportion of
individuals who were homozygous for this allele increased with the number of generations
affected by cancer. Moreover, we observed that in the case of rs3803662 and rs2981582,
heterozygous TC individuals presented a higher number of cancer cases (in general) and a
higher number of breast cancer cases.
Detailed data on the frequency of the different genotypes versus the family history of
cancer with the women subgrouped according to their BRCA1 and BRCA2 gene mutation status
are found in supplemental Tables 1 to 5.
In addition, the frequency of the different genotypes was compared to the family
history by separately considering the women with a mutation in BRCA1 to those with mutations
in BRCA2. Given the limited sample size of patients with a deleterious mutation identified in
these genes, the group stratification per mutated gene limited the statistical analyses that were
conducted. However, some trends could be observed, for example, all of the women with
mutations in the BRCA2 gene with bilateral breast cancer were homozygous for the G allele in
rs132281615, and among those with mutations in BRCA1 and with bilateral breast cancer, 86%
had at least one G allele. Moreover, in regard to rs3817198, all of the women with mutations in
BRCA1 and with ovarian cancer had at least one T allele (with 88.9% being TT homozygotes);
however, the same pattern was not observed for the women with mutations in BRCA2 and a
personal history of ovarian cancer (p=0.006). To reach a conclusion on the association of these
polymorphisms with the BRCA1/2 mutational status and with a family history of cancer, more
patients with these characteristics must be genotyped.
The data correlating the genotypes of the five polymorphisms that were analyzed
with the status of the hormone receptors (estrogen, progesterone and HER2) are shown in
Table 3.
147
Table 3: Correlation between the genotype frequencies of the polymorphisms and the
hormone receptors (overall).
Estrogen
Progesterone
Her-2
Polymorphisms
Negative
Positive
Negative
Positive
Negative
Positive
rs3803662 - TT
N (%)
16 (16.3)
33 (18.9)
25 (20.5)
24 (15.8)
32 (16.0)
14 (21.2)
3 (100.0)
rs3803662 - TC
N (%)
42 (42.9)
84 (48.3)
51 (41.8)
78 (51.3)
98 (49.3)
26 (39.4)
0 (0.0)
rs3803662 - CC
N (%)
40 (40.8)
57 (32.8)
46 (37.7)
50 (32.9)
69 (34.7)
26 (39.4)
0 (0.0)
Total
98 (100.0)
174 (100.0)
122 (100.0)
152 (100.0)
199 (100.0)
66 (100.0)
3 (100.0)
P value*
0.035
0.068
Inconclusive
0.037
rs2981582 - TT
N (%)
20 (20.7)
45 (25.4)
22 (18.0)
43 (28.0)
46 (22.9)
18 (27.3)
1 (33.4)
rs2981582 – CT
N (%)
47 (48.4)
94 (53.2)
66 (54.0)
76 (49.3)
100 (49.7)
36 (54.5)
2 (66.6)
rs2981582 – CC
N (%)
30 (30.9)
38 (21.4)
34 (28.0)
35 (22.7)
55 (27.4)
12 (18.2)
0 (0.0)
Total
97 (100.0)
177 (100.0)
122 (100.0)
154 (100.0)
201 (100.0)
66 (100.0)
3 (100.0)
P value*
0.020
0.014
0.025
rs13281615 - AA
N (%)
26 (26.5)
47 (26.5)
36 (29.3)
38 (24.7)
52 (25.9)
17 (25.4)
2 (66.6)
rs13281615 - AG
N (%)
42 (42.8)
86 (48.7)
54 (43.9)
74 (48.0)
93 (46.2)
32 (47.7)
1 (33.4)
rs13281615 - GG
N (%)
30 (30.7)
44 (24.8)
33 (26.8)
42 (27.3)
56 (27.9)
18 (26.9)
0 (0.0)
Total
98 (100.0)
177 (100.0)
123 (100.0)
154 (100.0)
201 (100.0)
67 (100.0)
3 (100.0)
P value*
0.056
0.056
0.056
rs889312 - CC
N (%)
13 (13.3)
22 (12.4)
12 (9.7)
23 (14.9)
27 (13.4)
7 (10.5)
0 (0.0)
rs889312 - CA
N (%)
44 (44.9)
81 (45.8)
61 (49.5)
65 (42.2)
90 (44.7)
32 (47.7)
1 (33.3)
rs889312 - AA
N (%)
41 (41.8)
74 (40.6)
50 (43.1)
66 (42.9)
84 (41.9)
28 (41.8)
2 (66.7)
Total
98 (100.0)
177 (100.0)
123 (100.0)
154 (100.0)
201 (100.0)
67 (100.0)
3 (100.0)
P value*
0.073
0.066
0.062
rs3817198 - TT
N (%)
51 (52.6)
80 (45.2)
61 (50.0)
71 (46.1)
98 (48.8)
39 (51.4)
0 (0.0)
rs3817198 - TC
N (%)
40 (41.2)
83 (46.9)
50 (41.0)
74 (48.1)
89 (44.3)
31 (40.7)
3 (100)
rs3817198 - CC
N (%)
6 (6.2)
14 (7.9)
11 (9.0)
9 (5.8)
14 (6.9)
6 (7.9)
0 (0.0)
Total
97 (100.0)
177 (100.0)
122 (100.0)
154 (100.0)
201 (100.0)
76 (100.0)
3 (100.0)
P value*
0.042
0.077
0.042
*Chi-square
Note: Values in bold indicate statistical significance (p<0.05).
148
When the different polymorphisms were analyzed with the hormone receptors, we
observed an increased frequency of heterozygotes for rs3803662 in individuals with
estrogen receptor (ER)-positive tumors, in individuals with progesterone receptor (PR)positive tumors and in individuals who were negative for the HER2 receptor. Regarding
rs2981582, individuals with at least one T allele more frequently exhibited positivity for the
three receptors (ER, PR and HER2). We also observed an increased frequency of the WT
allele among ER-negative individuals. For the SNPs rs13281615 and rs889312, no association
was found between their frequencies and the hormone receptors considered.
When the analysis of the polymorphisms with the hormone receptors was conducted
separately for the groups studied (supplementary Tables 6 to 10), we noted some
associations. Regarding the SNP rs2981582 in gene FGFR2, we observed an association
between group 2 (with VUS in the BRCA1/2 genes) with the ER in which the presence of TT
homozygotes was not observed, and TC heterozygosity was present in 73.7% of the ERnegative cases. Additionally, when this analysis was performed for the SNP rs13281615, we
observed an association with HER-2 negativity in group 3 (WT for BRCA1/2), with 49.1% of
individuals being AG heterozygotes. For the SNP rs889312 in gene MAP3K1, an association
with HER-2-negative tumors was observed in group 2, and 46.0% of the negative cases were
homozygous for the A allele. The SNP rs3817198 in gene LSP1 showed an association with
the ER in group 3 (WT), in which 50.0% of the ER-positive cases were heterozygous (TC).
Finally, in the case of the SNP rs3803662 in gene TNRC9, the increased frequency of allele C
homozygosity was more evident in groups 1 and 3, in which most cases of ER-negative
tumors have the CC genotype.
An analysis of genotypes versus hormone receptors was conducted by separately
considering the individuals with BRCA1 mutations and those with identified mutations in
BRCA2, but no association was observed in this analysis (data not shown).
The association between the genotypes in the five SNPs considered and the age at
diagnosis was evaluated. Although no significant association was identified, these data are
shown in Table 4.
149
Table 4: Mean age of the polymorphism genotypes.
Polymorphism
Mean Age
Standard Deviation
CC
42.11
14.937
CA
43.67
11.628
AA
40.48
11.726
rs13281615 (8q24)
AA
41.09
13.669
AG
41.92
11.003
GG
rs2981582 (FGFR2)
43.61
12.573
AA
41.12
12.189
AG
42.42
12.184
GG
42.33
12.113
AA
43.06
10.707
AG
43.00
13.239
GG
40.73
11.374
TT
41.68
12.642
TC
42.27
11.672
CC
43.55
11.995
rs889312 (MAP3K1)
rs3803662 (TNRC9)
rs3817198 (LSP1)
Discussion
Genetic polymorphisms are being widely evaluated as modifiers of the genetic risk of
disease by several research groups. A study conducted by Garcia-Closas and collaborators
(14) evaluated the frequency of five polymorphisms that were previously reported to be
associated with an increased risk of breast cancer (10) and investigated whether the
association between these polymorphisms and the risk of breast cancer was somehow
influenced by clinically relevant tumoral features in 23,039 cases of invasive breast cancer
and in 26,273 controls from 20 different studies. The authors found that common genetic
variants (polymorphisms) influenced the pathological tumor subtype, which provided
additional evidence of the biologically distinct behavior of ER-positive versus ER-negative
tumors.
In this study, we compared the genotype distribution of the five polymorphisms that
were previously reported in the literature to be associated with the risk of breast cancer (10,
150
14, 15) in three groups of women: women with putative hereditary breast cancer, with or
without germline mutations in the BRCA1 and BRCA2 genes, women with VUS identified in
one of those genes, and women with putative sporadic breast cancer. The genotype data
from the five polymorphisms were then correlated with the family history of cancer and the
histopathological features of the tumors, always considering a possible influence of the
mutational status of BRCA1/2.
When we compared the genotypes of the polymorphisms analyzed with the
pathological characteristics of the tumors, we noted that, in the case of the SNP rs3803662
in gene TNRC9, there was an increased frequency of GG homozygotes among ER-negative
individuals (as previously reported by Easton and collaborators (10) in 2007), and although
the difference was not statistically significant, it was possible to observe that this difference
was stronger among women in groups 1 (with mutations) and 3 (WT). Regarding the SNP
rs2981582, which was localized in gene FGFR2, we observed an increased frequency of the T
allele in women who were positive for the estrogen and progesterone receptors (p=0.020
and p=0.014, respectively); this increase in frequency among individuals positive for the
hormone receptors (ER and PR) did not depend on the group to which the women belonged.
There are several studies evaluating the effects of polymorphisms on the risk of
cancer and their association with tumoral features. According to the study published by
Tapper and collaborators (16) in 2008, some polymorphisms capable of altering the risk of
breast cancer are being discovered. The study conducted by the above mentioned authors
had the objective of evaluating how those variants may influence the prognosis and risk of
developing breast cancer. For this purpose, 1,001 women with non-familial, invasive breast
cancer that was diagnosed at early age were analyzed compared to a group of women with
hereditary breast cancer; the presence and frequency of 206 SNPs in 30 candidate genes
were evaluated in the two groups. An association with an increased risk of developing breast
cancer was found in the SNPs localized in the CASP8, TNRC9 and ESR1 genes. The authors
also reported an association between survival and eight SNPs in six genes (MAP3K1, DAPK1,
LSP1, MMP7, TOX3 and ESR1) and another SNP in a gene-free region in 8q24. For the SNPs in
genes MMP7, TOX3 and MAP3K1, the survival effects did not depend on the known main
clinical prognosis factors. The effect of the SNP in ESR1 on survival was more significant
when only ER-positive tumors were evaluated. When the cases were stratified according to
151
tumor features, it was observed that the SNPs in FGFR2 and TOX3 were associated with the
disease. Finally, the study showed that several SNPs were associated with survival. In some
cases, this association may occur because of an effect on the tumor characteristics that has
an impact on prognosis; in other cases, the effect appears to be independent of these
prognostic factors (16).
Results published by Fanale and collaborators (17) in 2012 demonstrated the
association of some SNPs with breast cancer. The genes in which the polymorphisms
described reside in are TNRC9, FGFR2, MAP3K1, H19 and LSP1. The most strongly associated
SNP is localized in gene FGFR2, which was overexpressed in 5-10% of the cases of breast
cancer. The SNP in gene TNRC9 showed a stronger association with breast cancer and
appeared to be correlated with the presence of bone metastases and positivity for the
estrogen receptor. The SNP rs889312 in gene MAP3K1 showed sensitivity only in individuals
harboring mutations in BRCA2, and it was not associated with an increased risk in carriers of
BRCA1 mutations. Several SNPs in LSP1 and H19 were most likely associated with the risk of
developing cancer. Therefore, the study concluded that the identification of risk-modifying
polymorphisms may lead to a better understanding of the biological mechanism of breast
cancer, thus improving the prevention, detection and early treatment of the disease.
The results of the analyses of the presence and frequency of the five polymorphisms
considered here were compared to the family history of cancer. Several associations were
identified in that comparison, either with the number of cancer cases in the family
(associated with the SNPs rs2981582 and rs13281615), with the presence of bilateral breast
cancer (SNP rs13281615) or with the number of generations affected by cancer (SNP
rs13281615). Moreover, regarding allele G of rs13281615, we observed that the proportion
of individuals who were homozygous for this allele increased as the number of generations
affected by cancer increased. Many of the findings described here corroborate data in the
literature, such as the association found between SNP rs13281615 and a positive family
history of cancer, which was a correlation previously reported by Gorodnova and
collaborators in 2010 (18).
The effect of polymorphisms on the family history of cancer was also reported by
Huijts and collaborators (19), who showed an association between rs2981582 in gene FGFR2
152
and the average number of first- and second-degree relatives with breast and/or ovarian
cancers (P = 0.05). The authors also found an association with the age at diagnosis, in which
individuals who were heterozygous or homozygous for the least frequent allele for
rs3803662 had a higher probability of having the cancer diagnosed at an age younger than
60 years.
An association with age at diagnosis was not observed in this study for any of the five
polymorphisms considered. However, the data obtained and the possible associations
identified with the tumor pathological features and with the family history of cancer must be
validated using a larger sample size. Nonetheless, if these associations are confirmed, we will
have additional data to understand the epidemiology of hereditary and familial cancer in our
population.
Conclusion
Some potential associations were found between the five polymorphisms analyzed in
this study previously reported in the literature as being associated and an increase in the risk
of breast cancer, with an emphasis placed on the effect of these polymorphisms on the
family history of cancer and on hormone receptor positivity/negativity. These findings must
be interpreted with caution because of the limited sample size in this study. The data must
be validated with a larger number of cases and, if confirmed, the clinical relevance of the
associations identified and their applicability in medical practice must be considered
carefully. However, the results presented here provide interesting information on the
modifying effect of polymorphisms on the family history of cancer and may be a variable to
consider in the analysis of tumor diversity, and of the family history observed in families with
hereditary breast cancer (even in those harboring the same type of genetic alteration).
Acknowledgments
This study was supported by a grant from Conselho Nacional de Desenvolvimento Científico
e Tecnológico (CNPq), Edital MCT/CNPq 14/2010, processo 480760/2010-1.
153
References
1.
INCA. (2015) Portal - Instituto Nacional de Câncer.
http://www2incagovbr/wps/wcm/connect/inca/portal/home. Accessed 29 Jan 2015.
2.
Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, et al. A strong
candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 1994 Oct
7;266(5182):66-71.
3.
Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D, Collins N, et al. Localization of a
breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science. 1994 Sep
30;265(5181):2088-90.
4.
Zhang S, Royer R, Li S, McLaughlin JR, Rosen B, Risch HA, et al. Frequencies of BRCA1 and
BRCA2 mutations among 1,342 unselected patients with invasive ovarian cancer. Gynecol Oncol.
2011 May 1;121(2):353-7.
5.
Page DL, Schuyler PA, Dupont WD, Jensen RA, Plummer WD, Jr., Simpson JF. Atypical
lobular hyperplasia as a unilateral predictor of breast cancer risk: a retrospective cohort study.
Lancet. 2003 Jan 11;361(9352):125-9.
6.
(2015) A Practical Guide to Human Cancer Genetics.
7.
Liede A, Karlan BY, Narod SA. Cancer risks for male carriers of germline mutations in BRCA1
or BRCA2: a review of the literature. J Clin Oncol. 2004 Feb 15;22(4):735-42.
8.
Cass I, Baldwin RL, Varkey T, Moslehi R, Narod SA, Karlan BY. Improved survival in women
with BRCA-associated ovarian carcinoma. Cancer. 2003 May 1;97(9):2187-95.
9.
Karhu R, Laurila E, Kallioniemi A, Syrjakoski K. Large genomic BRCA2 rearrangements and
male breast cancer. Cancer Detect Prev. 2006;30(6):530-4.
10.
Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, et al. Genomewide association study identifies novel breast cancer susceptibility loci. Nature. 2007 Jun
28;447(7148):1087-93.
11.
Gudmundsson J, Sulem P, Manolescu A, Amundadottir LT, Gudbjartsson D, Helgason A, et
al. Genome-wide association study identifies a second prostate cancer susceptibility variant at
8q24. Nat Genet. 2007 May;39(5):631-7.
12.
Antoniou AC, Sinilnikova OM, McGuffog L, Healey S, Nevanlinna H, Heikkinen T, et al.
Common variants in LSP1, 2q35 and 8q24 and breast cancer risk for BRCA1 and BRCA2 mutation
carriers. Hum Mol Genet. 2009 Nov 15;18(22):4442-56.
13.
Huo D, Zheng Y, Ogundiran TO, Adebamowo C, Nathanson KL, Domchek SM, et al.
Evaluation of 19 susceptibility loci of breast cancer in women of African ancestry. Carcinogenesis.
2012 Apr;33(4):835-40.
14.
Garcia-Closas M, Hall P, Nevanlinna H, Pooley K, Morrison J, Richesson DA, et al.
Heterogeneity of breast cancer associations with five susceptibility loci by clinical and pathological
characteristics. PLoS Genet. 2008 Apr;4(4):e1000054.
15.
Mavaddat N, Barrowdale D, Andrulis IL, Domchek SM, Eccles D, Nevanlinna H, et al.
Pathology of breast and ovarian cancers among BRCA1 and BRCA2 mutation carriers: results from
the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). Cancer Epidemiol Biomarkers
Prev. 2012 Jan;21(1):134-47.
16.
Tapper W, Hammond V, Gerty S, Ennis S, Simmonds P, Collins A, et al. The influence of
genetic variation in 30 selected genes on the clinical characteristics of early onset breast cancer.
Breast Cancer Res. 2008;10(6):R108.
17.
Fanale D, Amodeo V, Corsini LR, Rizzo S, Bazan V, Russo A. Breast cancer genome-wide
association studies: there is strength in numbers. Oncogene. 2012 Apr 26;31(17):2121-8.
18.
Gorodnova TV, Kuligina E, Yanus GA, Katanugina AS, Abysheva SN, Togo AV, et al.
Distribution of FGFR2, TNRC9, MAP3K1, LSP1, and 8q24 alleles in genetically enriched breast cancer
patients versus elderly tumor-free women. Cancer Genet Cytogenet. 2010 May;199(1):69-72.
154
19.
Huijts PE, Vreeswijk MP, Kroeze-Jansema KH, Jacobi CE, Seynaeve C, Krol-Warmerdam EM,
et al. Clinical correlates of low-risk variants in FGFR2, TNRC9, MAP3K1, LSP1 and 8q24 in a Dutch
cohort of incident breast cancer cases. Breast Cancer Res. 2007;9(6):R78.
155
Supplemental material tables
Table 1 Correlation between the frequency of polymorphism rs3803662 in gene TNRC9 and the
family history of cancer (per group).
Family history
Number of cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Presence of bilateral breast cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Presence of ovarian cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Number of generations with cancer
Group 1
1
2
3
4
Group 2
1
2
3
4
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (25.0)
3 (7.0)
2 (25.0)
25 (58.1)
4 (50.0)
15 (34.9)
8 (100.0)
43 (100.0)
6 (33.3)
6 (17.1)
5 (27.7)
19 (54.3)
7 (38.9)
10 (28.6)
18 (100.0)
35 (100.0)
5 (12.8)
12 (20.3)
18 (46.2)
29 (49.2)
16 (41.0)
18 (30.5)
39 (100.0)
59 (100.0)
11 (20.4)
3 (16.6)
24 (44.4)
10 (55.6)
19 (35.2)
5 (27.8)
54 (100.0)
18 (100.0)
1 (10.0)
4 (9.8)
6 (60.0)
21 (51.2)
3 (30.0)
16 (39.0)
10 (100.0)
41 (100.0)
2 (40.0)
10 (20.8)
1 (20.0)
23 (48.0)
2 (40.0)
15 (31.2)
5 (100.0)
48 (100.0)
1 (20.0)
16 (17.2)
2 (40.0)
45 (48.4)
2 (40.0)
32 (34.4)
5 (100.0)
93 (100.0)
P value*
0.235
0.149
0.055
0.147
0.198
0.234
0.253
**
0 (0.0)
13 (18.3)
0 (0.0)
34 (47.9)
0 (0.0)
24 (33.8)
0 (0.0)
71 (100.0)
0 (0.0)
5 (13.2)
7 (53.8)
20 (52.6)
6 (46.2)
13 (34.2)
13 (100.0)
38 (100.0)
1 (25.0)
11 (22.5)
3 (75.5)
21 (42.9)
0 (0.0)
17 (34.6)
4 (100.0)
49 (100.0)
0.098
0.175
0.122
3 (27.3)
14 (16.1)
5 (45.4)
42 (48.3)
3 (27.3)
31 (35.6)
11 (100.0)
87 (100.0)
0 (0.0)
13 (18.3)
0 (0.0)
34 (47.9)
0 (0.0)
24 (33.8)
0 (0.0)
71 (100.0)
1 (11.1)
4 (20.0)
0 (0.0)
0 (0.0)
3 (33.3)
8 (40.0)
13 (68.4)
3 (100.0)
5 (55.6)
8 (40.0)
6 (31.6)
0 (0.0)
9 (100.0)
20 (100.0)
19 (100.0)
3 (100.0)
5 (45.5)
4 (16.0)
3 (17.7)
0 (0.0)
4 (36.4)
12 (48.0)
8 (47.0)
0 (0.0)
2 (18.1)
9 (36.0)
6 (35.3)
0 (0.0)
11 (100.0)
25 (100.0)
17 (100.0)
0 (0.0)
**
0.086
0.039
156
Table 1 (Cont.): Correlation between the frequency of polymorphism rs3803662 in gene
TNRC9 and the family history of cancer (per group).
Family history
Number of generations with cancer
Group 3
1
2
3
4
Group 4
1
2
3
4
Number of breast cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Age at diagnosis
Group 1
<=30 years
>30 and <=50 years
>50 years
Group 2
<=30 years
>30 and <=50 years
>50 years
Group 3
<=30 years
>30 and <=50 years
>50 years
Group 4
<=30 years
>30 and <=50 years
>50 years
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (12.5)
9 (18.0)
5 (17.9)
1 (33.3)
8 (50.0)
24 (48.0)
14 (50.0)
1 (33.3)
6 (37.5)
17 (34.0)
9 (32.1)
1 (33.4)
16 (100.0)
50 (100.0)
28 (100.0)
3 (100.0)
10 (22.2)
3 (12.5)
1 (33.3)
0 (0.0)
18 (40.0)
15 (62.5)
1 (33.3)
0 (0.0)
17 (37.8)
6 (25.0)
1 (33.4)
0 (0.0)
45 (100.0)
24 (100.0)
3 (100.0)
0 (0.0)
3 (13.0)
2 (7.1)
8 (34.8)
19 (67.9)
12 (52.2)
7 (25.0)
23 (100.0)
28 (100.0)
11 (25.6)
1 (10.0)
18 (41.9)
6 (60.0)
14 (32.5)
3 (30.0)
43 (100.0)
10 (100.0)
11 (14.5)
6 (28.6)
37 (48.7)
9 (42.8)
28 (36.8)
6 (28.6)
76 (100.0)
21 (100.0)
14 (19.4)
0 (0.0)
34 (47.2)
0 (0.0)
24 (33.4)
0 (0.0)
72 (100.0)
0 (0.0)
0 (0.0)
4 (11.8)
1 (11.1)
4 (50.0)
16 (47.0)
7 (77.8)
4 (50.0)
14 (41.2)
1 (11.1)
8 (100.0)
34 (100.0)
9 (100.0)
4 (16.7)
7 (29.2)
1 (20.0)
14 (58.3)
10 (41.6)
0 (0.0)
6 (25.0)
7 (29.2)
4 (80.0)
24 (100.0)
24 (100.0)
5 (100.0)
3 (10.0)
9 (16.6)
4 (30.8)
12 (40.0)
28 (51.9)
7 (53.9)
15 (50.0)
17 (31.5)
2 (15.3)
30 (100.0)
54 (100.0)
13 (100.0)
0 (0.0)
10 (25.0)
6 (14.3)
0 (0.0)
12 (30.0)
25 (59.5)
0 (0.0)
18 (45.0)
11 (26.2)
0 (0.0)
40 (100.0)
42 (100.0)
P value*
0.066
0.107
0.089
0.167
0.061
**
0.041
0.083
0.004
0.106
*Chi-square/ Fisher’s exact
**It was not possible to conduct a comparative analysis in group 4 for the following variables: presence of bilateral breast
cancer, presence of ovarian cancer and age at diagnosis.
Note: Values in bold indicate statistical significance (p<0.05).
157
Table 2: Correlation between the frequency of polymorphism rs2981582 in gene FGFR2 and
the family history of cancer (per group).
Family history
Number of cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Presence of bilateral breast cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Presence of ovarian cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Number of generations with cancer
Group 1
1
2
3
4
Group 2
1
2
3
4
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (25.0)
12 (27.9)
1 (12.5)
21 (48.8)
5 (62.5)
10 (23.3)
8 (100.0)
43 (100.0)
4 (22.2)
5 (13.9)
10 (55.6)
23 (63.9)
4 (22.2)
8 (22.2)
18 (100.0)
36 (100.0)
11 (27.5)
15 (25.4)
17 (42.5)
32 (54.2)
12 (30.0)
12 (20.4)
40 (100.0)
59 (100.0)
15 (27.7)
2 (11.1)
25 (46.3)
13 (72.2)
14 (26.0)
3 (16.7)
54 (100.0)
18 (100.0)
P value*
0.074
0.164
0.100
0.144
0.111
3 (30.0)
11 (26.8)
6 (60.0)
16 (39.0)
1 (10.0)
14 (34.2)
10 (100.0)
41 (100.0)
0 (0.0)
9 (18.3)
4 (80.0)
29 (59.2)
1 (20.0)
11 (22.5)
5 (100.0)
49 (100.0)
1 (20.0)
25 (26.6)
3 (60.0)
46 (48.9)
1 (20.0)
23 (24.5)
5 (100.0)
94 (100.0)
0 (0.0)
17 (24.0)
0 (0.0)
38 (53.5)
0 (0.0)
16 (22.5)
0 (0.0)
71 (100.0)
2 (15.4)
12 (31.6)
7 (53.9)
15 (39.5)
4 (30.7)
11 (28.9)
13 (100.0)
38 (100.0)
0 (0.0)
9 (18.0)
3 (75.0)
30 (60.0)
1 (25.0)
11 (22.0)
4 (100.0)
50 (100.0)
0 (0.0)
26 (29.2)
8 (80.0)
41 (46.1)
2 (20.0)
22 (24.7)
10 (100.0)
89 (100.0)
0 (0.0)
17 (24.0)
0 (0.0)
38 (53.5)
0 (0.0)
16 (22.5)
0 (0.0)
71 (100.0)
2 (22.2)
8 (40.0)
2 (10.5)
2 (66.7)
3 (33.3)
6 (30.0)
13 (68.4)
0 (0.0)
4 (44.5)
6 (30.0)
4 (21.1)
1 (33.3)
9 (100.0)
20 (100.0)
19 (100.0)
3 (100.0)
1 (9.1)
6 (24.0)
2 (11.1)
0 (0.0)
6 (54.5)
15 (60.0)
12 (66.6)
0 (0.0)
4 (36.4)
4 (16.0)
4 (22.3)
0 (0.0)
11 (100.0)
25 (100.0)
18 (100.0)
0 (0.0)
0.257
0.249
**
0.129
0.269
0.111
**
0.077
0.109
158
Table 2 (Cont.): Correlation between the frequency of polymorphism rs2981582 in gene
FGFR2 and the family history of cancer (per group).
Family history
Number of generations with cancer
Group 3
1
2
3
4
Group 4
1
2
3
4
Number of breast cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Age at diagnosis
Group 1
<=30 years
>30 and <=50 years
>50 years
Group 2
<=30 years
>30 and <=50 years
>50 years
Group 3
<=30 years
>30 and <=50 years
>50 years
Group 4
<=30 years
>30 and <=50 years
>50 years
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
3 (18.7)
14 (8.4)
8 (27.6)
1 (33.3)
7 (43.8)
23 (13.7)
17 (58.6)
1 (33.3)
6 (37.5)
13 (77.9)
4 (13.8)
1 (33.4)
16 (100.0)
50 (100.0)
29 (100.0)
3 (100.0)
14 (31.1)
3 (12.5)
0 (0.0)
0 (0.0)
22 (48.9)
14 (58.3)
2 (66.3)
0 (0.0)
9 (20.0)
7 (29.2)
1 (33.4)
0 (0.0)
45 (100.0)
24 (100.0)
3 (100.0)
0 (0.0)
6 (26.1)
8 (28.6)
7 (30.4)
15 (53.6)
10 (43.5)
5 (17.8)
23 (100.0)
28 (100.0)
9 (20.5)
0 (0.0)
25 (56.8)
8 (66.6)
10 (22.7)
4 (33.4)
44 (100.0)
10 (100.0)
18 (23.7)
7 (31.8)
38 (50.0)
11 (50.0)
20 (26.3)
4 (18.2)
76 (100.0)
22 (100.0)
17 (23.6)
0 (0.0)
38 (52.8)
0 (0.0)
17 (23.6)
0 (0.0)
72 (100.0)
0 (0.0)
2 (25.0)
10 (29.4)
2 (22.2)
4 (50.0)
13 (38.2)
5 (55.6)
2 (25.0)
11 (32.4)
2 (22.2)
8 (100.0)
34 (100.0)
9 (100.0)
6 (25.0)
3 (12.0)
0 (0.0)
12 (50.0)
18 (72.0)
3 (60.0)
6 (25.0)
4 (16.0)
2 (40.0)
24 (100.0)
25 (100.0)
5 (100.0)
10 (33.3)
13 (23.2)
3 (25.0)
12 (40.0)
31 (55.4)
6 (50.0)
8 (26.7)
12 (21.4)
3 (25.0)
30 (100.0)
56 (100.0)
12 (100.0)
0 (0.0)
10 (25.0)
9 (21.4)
0 (0.0)
19 (47.5)
24 (57.1)
0 (0.0)
11 (27.5)
9 (21.5)
0 (0.0)
40 (100.0)
42 (100.0)
P value*
0.035
0.025
0.063
0.162
0.087
**
0.125
0.080
0.085
0.125
*Chi-square/ Fisher’s exact
**It was not possible to conduct a comparative analysis in Group 4 for the following variables: presence of bilateral breast
cancer, presence of ovarian cancer and number of breast cancer cases.
Note: Values in bold indicate statistical significance (p<0.05).
159
Table 3: Correlation between the frequency of polymorphism rs13281615 and the family
history of cancer (per group).
Family history
Number of cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Presence of bilateral breast cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Presence of ovarian cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Number of generations with cancer
Group 1
1
2
3
4
Group 2
1
2
3
4
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
2 (25.0)
12 (27.9)
6 (75.0)
18 (41.8)
0 (0.0)
13 (33.3)
8 (100.0)
43 (100.0)
7 (41.2)
4 (11.1)
8 (47.0)
17 (47.2)
2 (11.8)
15 (41.7)
18 (100.0)
36 (100.0)
12 (30.0)
15 (25.0)
22 (55.0)
26 (43.3)
6 (15.0)
19 (31.7)
40 (100.0)
60 (100.0)
15 (27.8)
3 (16.6)
27 (50.0)
8 (44.4)
12 (22.2)
7 (38.8)
54 (100.0)
18 (100.0)
P value*
0.133
0.003
0.039
0.056
0.008
1 (10.0)
13 (31.7)
3 (30.0)
21 (51.2)
6 (60.0)
7 (17.1)
41 (100.0)
10 (100.0)
0 (0.0)
11 (22.5)
1 (20.0)
25 (51.0)
4 (80.0)
13 (26.5)
5 (100.0)
49 (100.0)
2 (40.0)
25 (26.3)
1 (20.0)
47 (49.5)
2 (40.0)
23 (24.2)
95 (100.0)
5 (100.0)
0 (0.0)
18 (25.3)
0 (0.0)
34 (47.9)
0 (0.0)
19 (26.8)
0 (0.0)
71 (100.0)
5 (38.5)
9 (23.7)
6 (46.1)
18 (47.3)
2 (15.4)
11 (29.0)
13 (100.0)
38 (100.0)
1 (25.0)
10 (20.0)
3 (75.0)
23 (46.0)
0 (0.0)
17 (34.0)
4 (100.0)
50 (100.0)
5 (45.4)
22 (24.7)
3 (27.3)
45 (50.6)
3 (27.3)
22 (24.7)
11 (100.0)
89 (100.0)
0 (0.0)
18 (25.3)
0 (0.0)
34 (47.9)
0 (0.0)
19 (26.8)
0 (0.0)
71 (100.0)
2 (22.2)
3 (15.0)
9 (47.4)
0 (0.0)
4 (44.5)
14 (70.0)
5 (26.3)
1 (33.3)
3 (33.3)
3 (15.0)
5 (26.3)
2 (66.7)
9 (100.0)
20 (100.0))
19 (100.0)
3 (100.0)
6 (54.6)
3 (12.0)
2 (1.2)
0 (0.0)
4 (36.3)
14 (56.0)
8 (44.4)
0 (0.0)
1 (9.1)
8 (32.0)
8 (44.4)
0 (0.0)
11 (100.0)
25 (100.0)
18 (100.0)
0 (0.0)
0.020
0.245
**
0.086
0.167
0.130
**
0.090
0.003
160
Table 3 (Cont.): Correlation between the frequency of polymorphism rs13281615 and the
family history of cancer (per group).
Family history
Number of generations with cancer
Group 3
1
2
3
4
Group 4
1
2
3
4
Number of breast cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Age at diagnosis
Group 1
<=30 years
>30 and <=50 years
>50 years
Group 2
<=30 years
>30 and <=50 years
>50 years
Group 3
<=30 years
>30 and <=50 years
>50 years
Group 4
<=30 years
>30 and <=50 years
>50 years
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
6 (37.5)
16 (32.0)
5 (16.6)
0 (0.0)
8 (50.0)
23 (46.0)
14 (46.7)
2 (66.7)
2 (12.5)
11 (22.0)
11 (36.7)
1 (33.3)
16 (100.0)
50 (100.0)
30 (100.0)
3 (100.0)
13 (28.9)
4 (16.6)
1 (33.3)
0 (0.0)
24 (53.3)
10 (41.7)
1 (33.3)
0 (0.0)
8 (17.8)
10 (41.7)
1 (33.4)
0 (0.0)
45 (100.0)
24 (100.0)
3 (100.0)
0 (0.0)
5 (21.7)
9 (32.1)
14 (60.9)
10 (35.8)
4 (17.4)
9 (32.1)
23 (100.0)
28 (100.0)
10 (22.7)
1 (10.0)
21 (47.7)
5 (50.0)
13 (29.6)
4 (40.0)
44 (100.0)
10 (100.0)
22 (28.6)
5 (22.7)
35 (45.4)
12 (54.6)
20 (26.0)
5 (22.7)
77 (100.0)
22 (100.0)
18 (25.0)
0 (0.0)
35 (48.6)
0 (0.0)
19 (26.4)
0 (0.0)
72 (100.0)
0 (0.0)
4 (50.0)
7 (20.5)
3 (33.3)
4 (50.0)
18 (53.0)
2 (22.2)
0 (0.0)
9 (26.5)
4 (44.5)
8 (100.0)
34 (100.0)
9 (100.0)
8 (33.3)
2 (8.0)
1 (20.0)
8 (33.3)
15 (60.0)
3 (60.0)
8 (33.4)
8 (32.0)
1 (20.0)
24 (100.0)
25 (100.0)
5 (100.0)
11 (36.6)
13 (23.2)
3 (23.1)
13 (43.4)
27 (48.2)
8 (61.5)
6 (20.0)
16 (28.6)
2 (15.4)
30 (100.0)
56 (100.0)
13 (100.0)
0 (0.0)
13 (32.5)
10 (23.8)
0 (0.0)
19 (47.5)
18 (42.9)
0 (0.0)
8 (20.0)
14 (33.3)
0 (0.0)
40 (100.0)
42 (100.0)
P value*
0.005
0.033
0.148
0.130
0.130
**
0.034
0.097
0.065
0.049
*Chi-square/ Fisher’s exact
**It was not possible to conduct a comparative analysis in group 4 for the following variables: presence of bilateral breast
cancer, presence of ovarian cancer and number of breast cancer cases.
Note: Values in bold indicate statistical significance (p<0.05).
161
Table 4: Correlation between the frequency of polymorphism rs889312 in gene MAP3K1 and
the family history of cancer (per group).
Family history
Number of cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Presence of bilateral breast cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Presence of ovarian cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Number of generations with cancer
Group 1
1
2
3
4
Group 2
1
2
3
4
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
2 (25.0)
6 (14.0)
2 (25.0)
19 (44.1)
4 (50.0)
18 (41.9)
8 (100.0)
43 (100.0)
4 (22.2)
4 (11.1)
7 (38.9)
13 (36.1)
7 (38.9)
19 (52.8)
18 (100.0)
36 (100.0)
5 (12.5)
6 (10.0)
19 (47.5)
36 (60.0)
16 (40.0)
18 (30.0)
40 (100.0)
60 (100.0)
3 (5.6)
3 (16.6)
24 (44.4)
9 (50.0)
27 (50.0)
6 (33.4)
54 (100.0)
18 (100.0)
P value*
0.205
0.077
0.109
0.048
0.079
2 (20.0)
6 (14.6)
6 (60.0)
15 (36.6)
2 (20.0)
20 (48.8)
10 (100.0)
41 (100.0)
2 (40.0)
6 (12.2)
3 (60.0)
17 (34.7)
0 (0.0)
26 (53.1)
5 (100.0)
49 (100.0)
1 (20.0)
10 (10.5)
3 (60.0)
52 (54.7)
1 (20.0)
33 (34.8)
5 (100.0)
95 (100.0)
0 (0.0)
6 (8.2)
0 (0.0)
33 (45.2)
0 (0.0)
34 (46.6)
0 (0.0)
71 (100.0)
1 (7.6)
7 (18.4)
6 (46.2)
15 (39.5)
6 (46.2)
16 (42.1)
13 (100.0)
38 (100.0)
0 (0.0)
8 (16.0)
1 (25.0)
19 (38.0)
3 (75.0)
23 (46.0)
4 (100.0)
50 (100.0)
1 (9.0)
10 (11.2)
5 (45.5)
50 (56.2)
5 (45.5)
29 (32.6)
11 (100.0)
89 (100.0)
0 (0.0)
6 (8.4)
0 (0.0)
33 (46.5)
0 (0.0)
32 (45.1)
0 (0.0)
71 (100.0)
0 (0.0)
5 (25.0)
3 (15.8)
0 (0.0)
6 (66.7)
4 (20.0)
9 (47.3)
2 (66.4)
3 (33.3)
11 (55.0)
7 (36.9)
1 (33.3)
9 (100.0)
20 (100.0)
19 (100.0)
3 (100.0)
0.019
0.199
**
0.147
0.164
0.156
**
0.088
0.081
3 (27.3)
3 (12.0)
2 (11.1)
0 (0.0)
3 (27.3)
10 (40.0)
7 (38.9)
0 (0.0)
5 (45.4)
12 (48.0)
9 (50.0)
0 (0.0)
11 (100.0)
25 (100.0)
18 (100.0)
0 (0.0)
162
Table 4 (Cont.): Correlation between the frequency of polymorphism rs889312 in gene
MAP3K1 and the family history of cancer (per group).
Family history
Number of generations with cancer
Group 3
1
2
3
4
Group 4
1
2
3
4
Number of breast cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Age at diagnosis
Group 1
<=30 years
>30 and <=50 years
>50 years
Group 2
<=30 years
>30 and <=50 years
>50 years
Group 3
<=30 years
>30 and <=50 years
>50 years
Group 4
<=30 years
>30 and <=50 years
>50 years
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
1 (6.3)
6 (12.0)
4 (13.3)
0 (0.0)
9 (56.2)
22 (44.0)
20 (66.7)
3 (100.0)
6 (37.5)
22 (44.0)
6 (20.0)
0 (0.0)
16 (100.0)
50 (100.0)
30 (100.0)
3 (100.0)
3 (6.7)
2 (8.3)
1 (33.3)
0 (0.0)
18 (40.0)
14 (58.4)
1 (33.3)
0 (0.0)
24 (53.3)
8 (33.3)
1 (33.4)
0 (0.0)
45 (100.0)
24 (100.0)
3 (100.0)
5 (21.8)
3 (10.7)
9 (39.1)
12 (42.8)
9 (39.1)
13 (46.5)
23 (100.0)
28 (100.0)
7 (15.9)
1 (10.0)
17 (38.6)
3 (30.0)
20 (45.5)
6 (60.0)
44 (100.0)
10 (100.0)
9 (11.7)
2 (9.1)
40 (51.9)
15 (68.2)
28 (36.4)
5 (22.7)
77 (100.0)
22 (100.0)
6 (8.4)
0 (0.0)
33 (45.8)
0 (0.0)
33 (45.8)
0 (0.0)
72 (100.0)
0 (0.0)
1 (12.5)
6 (17.6)
1 (11.1)
3 (37.5)
13 (38.2)
5 (55.5)
4 (50.0)
15 (44.2)
3 (33.4)
8 (100.0)
34 (100.0)
9 (100.0)
3 (12.5)
3 (12.0)
2 (40.0)
7 (29.1)
11 (44.0)
2 (40.0)
14 (58.4)
11 (44.0)
1 (20.0)
24 (100.0)
25 (100.0)
5 (100.0)
5 (16.7)
4 (7.1)
2 (15.4)
13 (43.3)
34 (60.8)
8 (61.5)
12 (40.0)
18 (32.1)
3 (23.1)
30 (100.0)
56 (100.0)
13 (100.0)
0 (0.0)
1 (2.5)
7 (16.7)
0 (0.0)
15 (37.5)
21 (50.0)
0 (0.0)
24 (60.0)
14 (33.3)
0 (0.0)
40 (100.0)
42 (100.0)
P value*
0.023
0.031
0.103
0.146
0.116
**
0.121
0.030
0.085
0.002
*Chi-square/ Fisher’s exact
**It was not possible to conduct a comparative analysis in group 4 for the following variables: presence of bilateral breast
cancer, presence of ovarian cancer and number of breast cancer cases.
Note: Values in bold indicate statistical significance (p<0.05).
163
Table 5: Correlation between the frequency of polymorphism rs3817198 in gene LSP1 and
the family history of cancer (per group).
Family history
Number of cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Presence of bilateral breast cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Presence of ovarian cancer
Group 1
Yes
No
Group 2
Yes
No
Group 3
Yes
No
Group 4
Yes
No
Number of generations with cancer
Group 1
1
2
3
4
Group 2
1
2
3
4
TT
N (%)
TC
N (%)
CC
N (%)
Total
N (%)
2 (25.0)
24 (55.9)
5 (62.5)
17 (39.5)
1 (12.5)
2 (4.6)
8 (100.0)
43 (100.0)
10 (55.5)
18 (50.0)
7 (38.9)
17 (47.2)
1 (5.5)
1 (2.8)
18 (100.0)
36 (100.0)
19 (47.5)
25 (42.4)
13 (32.5)
30 (50.8)
8 (20.0)
4 (6.8)
40 (100.0)
59 (100.0)
28 (51.9)
7 (38.9)
22 (40.7)
9 (50.0)
4 (7.4)
2 (11.1)
54 (100.0)
18 (100.0)
P value*
0.067
0.196
0.100
0.105
0.081
3 (30.0)
23 (56.1)
6 (60.0)
16 (39.0)
1 (10.0)
2 (4.9)
41 (100.0)
10 (100.0)
2 (40.0)
26 (53.0)
3 (60.0)
21 (42.9)
0 (0.0)
2 (4.1)
5 (100.0)
49 (100.0)
1 (20.0)
43 (45.7)
1 (20.0)
42 (44.7)
3 (60.0)
9 (9.6)
5 (100.0)
94 (100.0)
0 (0.0)
35 (49.3)
0 (0.0)
30 (42.3)
0 (0.0)
6 (8.4)
0 (0.0)
71 (100.0)
11 (84.6)
15 (39.4)
1 (7.7)
21 (55.3)
1 (7.7)
2 (5.3)
13 (100.0)
38 (100.0)
3 (75.0)
25 (50.0)
1 (25.0)
23 (46.0)
0 (0.0)
2 (4.0)
4 (100.0)
50 (100.0)
4 (40.0)
40 (45.0)
4 (40.0)
39 (43.8)
2 (20.0)
10 (11.2)
10 (100.0)
89 (100.0)
0 (0.0)
35 (49.3)
0 (0.0)
30 (42.2)
0 (0.0)
6 (8.5)
0 (0.0)
71 (100.0)
6 (66.7)
9 (45.0)
10 (52.6)
1 (33.3)
2 (22.2)
10 (50.0)
8 (42.1)
2 (66.7)
1 (11.1)
1 (5.0)
1 (5.3)
0 (0.0)
9 (100.0)
20 (100.0)
19 (100.0)
3 (100.0)
4 (36.4)
12 (48.0)
12 (66.6)
0 (0.0)
6 (54.5)
13 (52.0)
5 (27.8)
0 (0.0)
1 (9.1)
0 (0.0)
1 (5.6)
0 (0.0)
11 (100.0)
25 (100.0)
18 (100.0)
0 (0.0)
0.292
0.017
**
0.018
0.249
0.156
**
0.103
0.042
164
Table 5 (Cont.): Correlation between the frequency of polymorphism rs3817198 in gene
LSP1 and the family history of cancer (per group).
Family history
Number of generations with cancer
Group 3
1
2
3
4
Group 4
1
2
3
4
Number of breast cancer cases
Group 1
<=3
>3
Group 2
<=3
>3
Group 3
<=3
>3
Group 4
<=3
>3
Age at diagnosis
Group 1
<=30 years
>30 and <=50 years
>50 years
Group 2
<=30 years
>30 and <=50 years
>50 years
Group 3
<=30 years
>30 and <=50 years
>50 years
Group 4
<=30 years
>30 and <=50 years
>50 years
TT
N (%)
TC
N (%)
CC
N (%)
Total
N (%)
11 (68.8)
20 (40.0)
11 (37.9)
1 (33.3)
5 (31.2)
25 (50.0)
11 (37.9)
2 (66.7)
0 (0.0)
5 (10.0)
7 (24.2)
0 (0.0)
16 (100.0)
50 (100.0)
29 (100.0)
3 (100.0)
25 (55.5)
10 (41.7)
0 (0.0)
0 (0.0)
17 (37.8)
12 (50.0)
2 (66.7)
0 (0.0)
3 (6.7)
2 (8.3)
1 (33.3)
0 (0.0)
45 (100.0)
24 (100.0)
3 (100.0)
0 (0.0)
13 (56.5)
13 (46.4)
8 (34.8)
14 (50.0)
2 (8.7)
1 (3.6)
23 (100.0)
28 (100.0)
21 (47.7)
7 (70.0)
22 (50.0)
2 (20.0)
1 (2.3)
1 (10.0)
44 (100.0)
10 (100.0)
36 (47.3)
8 (36.4)
31 (40.8)
12 (54.5)
9 (11.9)
2 (9.1)
76 (100.0)
22 (100.0)
35 (48.6)
0 (0.0)
31 (43.0)
0 (0.0)
6 (8.4)
0 (0.0)
72 (100.0)
0 (0.0)
6 (75.0)
16 (47.0)
4 (44.4)
1 (12.5)
17 (50.0)
4 (44.4)
1 (12.5)
1 (3.0)
1 (11.2)
8 (100.0)
34 (100.0)
9 (100.0)
10 (41.7)
15 (60.0)
3 (60.0)
13 (54.1)
10 (40.0)
1 (20.0)
1 (4.2)
0 (0.0)
1 (20.0)
24 (100.0)
25 (100.0)
5 (100.0)
17 (56.7)
20 (35.7)
7 (58.3)
11 (36.7)
27 (48.2)
5 (41.7)
2 (6.6)
9 (16.1)
0 (0.0)
30 (100.0)
56 (100.0)
12 (100.0)
0 (0.0)
17 (42.5)
21 (50.0)
0 (0.0)
20 (50.0)
18 (42.9)
0 (0.0)
3 (7.5)
3 (7.1)
0 (0.0)
40 (100.0)
42 (100.0)
P value*
0.007
0.020
0.175
0.195
0.124
**
0.100
0.109
0.085
0.120
165
Table 6: Correlation between the genotype frequency of polymorphism rs3803662 in gene
TNRC9 and the hormone receptors (per group).
Hormone Receptors
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
P value*
Estrogen
Group 1
0.127
Negative
3 (10.7)
12 (42.9)
13 (46.4)
28 (100.0)
Positive
2 (10.0)
12 (60.0)
6 (30.0)
20 (100.0)
Group 2
0.138
Negative
3 (15.8)
10 (52.6)
6 (31.6)
19 (100.0)
Positive
9 (27.3)
13 (39.4)
11 (33.3)
33 (100.0)
Group 3
0.114
Negative
7 (21.8)
11 (34.3)
14 (43.9)
32 (100.0)
Positive
9 (15.5)
31 (53.4)
18 (31.1)
58 (100.0)
Group 4
0.131
Negative
3 (15.8)
9 (47.3)
7 (36.9)
19 (100.0)
Positive
13 (20.6)
28 (44.4)
22 (35.0)
63 (100.0)
Negative
3 (10.8)
13 (46.4)
12 (42.8)
28 (100.0)
Positive
2 (10.0)
11 (55.0)
7 (35.0)
20 (100.0)
Negative
3 (16.6)
8 (44.5)
7 (38.9)
18 (100.0)
Positive
9 (26.5)
15 (44.1)
10 (29.4)
34 (100.0)
Negative
10 (23.3)
17 (39.5)
16 (37.2)
43 (100.0)
Positive
6 (12.2)
28 (57.1)
15 (30.7)
49 (100.0)
Negative
9 (27.3)
13 (39.4)
11 (33.3)
33 (100.0)
Positive
7 (14.3)
24 (49.0)
18 (36.7)
49 (100.0)
Progesterone
Group 1
0.165
Group 2
0.106
Group 3
0.113
Group 4
0.075
Her-2
Group 1
0.191
Negative
4 (9.6)
22 (52.4)
16 (38.0)
42 (100.0)
Positive
0 (0.0)
1 (25.0)
3 (75.0)
4 (100.0)
Inconclusive
1 (0.0)
0 (0.0)
(0.0)
1 (100.0)
Negative
8 (21.7)
17 (45.9)
12 (32.4)
37 (100.0)
Positive
4 (30.7)
5 (38.6)
4 (30.7)
13 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
11 (19.4)
27 (47.3)
19 (33.3)
57 (100.0)
Positive
3 (10.0)
15 (50.0)
12 (40.0)
30 (100.0)
Inconclusive
2 (100.0)
0 (0.0)
0 (0.0)
2 (100.0)
Group 2
0.153
Group 3
Negative
0.109
Group 4
0.079
Negative
9 (14.3)
32 (50.8)
22 (34.9)
63 (100.0)
Positive
7 (36.9)
5 (26.2)
7 (36.9)
19 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
*Chi-square/ Fisher’s exact
Note: Values in bold indicate statistical significance (p<0.05).
166
Table 7: Correlation between the genotype frequency of polymorphism rs2981582 in gene
FGFR2 and the hormone receptors (per group).
Hormone Receptors
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
P value*
Estrogen
Group 1
0.114
Negative
7 (25.0)
12 (42.9)
9 (32.1)
28 (100.0)
Positive
7 (35.0)
8 (40.0)
5 (25.0)
20 (100.0)
Group 2
0.038
Negative
0 (0.0)
14 (73.7)
5 (26.3)
19 (100.0)
Positive
9 (26.5)
18 (52.9)
7 (20.6)
34 (100.0)
Group 3
0.073
Negative
8 (25.8)
12 (38.7)
11 (35.5)
31 (100.0)
Positive
15 (25.0)
34 (56.6)
11 (18.3)
60 (100.0)
Group 4
0.149
Negative
5 (26.3)
9 (20.9)
5 (25.0)
19 (100.0)
Positive
14 (73.7)
34 (79.2)
15 (75.0)
63 (100.0)
Negative
6 (21.4)
13 (46.4)
9 (32.2)
28 (100.0)
Positive
8 (40.0)
7 (35.0)
5 (25.0)
20 (100.0)
Negative
1 (5.6)
15 (83.3)
2 (11.1)
18 (100.0)
Positive
8 (22.9)
17 (48.5)
10 (28.6)
35 (100.0)
Negative
9 (20.9)
19 (44.2)
15 (34.9)
43 (100.0)
Positive
14 (28.0)
28 (56.0)
8 (16.0)
50 (100.0)
Negative
6 (18.2)
19 (57.6)
8 (24.2)
33 (100.0)
Positive
13 (26.5)
24 (48.9)
12 (24.6)
49 (100.0)
Progesterone
Group 1
0.080
Group 2
0.180
Group 3
0.025
Group 4
0.113
Her-2
Group 1
0.082
Negative
11 (26.2)
19 (45.2)
12 (28.6)
42 (100.0)
Positive
2 (50.0)
1 (25.0)
1 (25.0)
4 (100.0)
Inconclusive
1 (100.0)
0 (0.0)
0 (0.0)
1 (100.0)
Negative
6 (16.2)
21 (56.7)
10 (27.1)
37 (100.0)
Positive
3 (21.4)
9 (64.3)
2 (14.3)
14 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
Negative
16 (27.2)
25 (42.3)
18 (30.5)
59 (100.0)
Positive
7 (24.1)
18 (62.0)
4 (13.9)
29 (100.0)
Inconclusive
0 (0.0)
2 (100.0)
0 (0.0)
2 (100.0)
Group 2
0.131
Group 3
0.085
Group 4
0.134
Negative
13 (20.7)
35 (55.5)
15 (23.8)
63 (100.0)
Positive
6 (31.6)
8 (42.1)
5 (26.3)
19 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
*Chi-square/ Fisher’s exact
Note: Values in bold indicate statistical significance (p<0.05).
167
Table 8: Correlation between the genotype frequency of polymorphism rs13281615 and the
hormone receptors (per group).
Hormone Receptors
AA
N (%)
AG
N (%)
GG
N (%)
Total
N (%)
P value*
Estrogen
Group 1
0.151
Negative
7 (25.0)
15 (53.6)
6 (21.4)
28 (100.0)
Positive
7 (35.0)
6 (30.0)
7 (35.0)
20 (100.0)
Group 2
0.121
Negative
4 (21.0)
7 (36.8)
8 (42.2)
19 (100.0)
Positive
7 (20.6)
18 (52.9)
9 (26.5)
34 (100.0)
Group 3
0.100
Negative
9 (28.1)
13 (40.6)
10 (31.3)
32 (100.0)
Positive
16 (26.7)
32 (53.3)
12 (20)
60 (100.0)
Group 4
0.138
Negative
6 (31.6)
7 (36.8)
6 (31.6)
19 (100.0)
Positive
17 (27.0)
30 (47.6)
16 (25.4)
63 (100.0)
Negative
7 (25.0)
16 (57.1)
5 (17.9)
28 (100.0)
Positive
7 (35.0)
5 (25.0)
8 (40.0)
20 (100.0)
Negative
4 (22.2)
7 (38.9)
7 (38.9)
18 (100.0)
Positive
7 (20.0)
18 (51.4)
10 (28.6)
35 (100.0)
Negative
15 (34.1)
17 (38.6)
12 (27.3)
44 (100.0)
Positive
11 (22.0)
28 (56.0)
11 (22.0)
50 (100.0)
Negative
10 (30.3)
14 (42.4)
9 (27.3)
33 (100.0)
Positive
13 (26.5)
23 (47.0)
13 (26.5)
49 (100.0)
Progesterone
Group 1
0.132
Group 2
0.148
Group 3
0.102
Group 4
0.118
Her-2
Group 1
0.169
Negative
11 (26.2)
19 (45.2)
12 (28.6)
42 (100.0)
Positive
2 (50.0)
1 (25.0)
1 (25.0)
4 (100.0)
Inconclusive
0 (0.0)
1 (100.0)
0 (0.0)
1 (100.0)
Negative
7 (19.0)
20 (54.0)
10 (27.0)
37 (100.0)
Positive
3 (21.4)
4 (28.6)
7 (50.0)
14 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
14 (23.7)
29 (49.1)
16 (27.2)
59 (100.0)
Positive
9 (30.0)
15 (50.0)
6 (20.0)
30 (100.0)
Inconclusive
2 (100.0)
0 (0.0)
0 (0.0)
2 (100.0)
Group 2
0.117
Group 3
Negative
0.030
Group 4
0.127
Negative
20 (31.7)
25 (39.7)
18 (28.6)
63 (100.0)
Positive
3 (15.8)
12 (63.1)
4 (21.1)
19 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
*Chi-square/ Fisher’s exact
Note: Values in bold indicate statistical significance (p<0.05).
168
Table 9: Correlation between the genotype frequency of polymorphism rs889312 in gene
MAP3K1 and the hormone receptors (per group).
Hormone Receptors
CC
N (%)
CA
N (%)
AA
N (%)
Total
N (%)
P value*
Estrogen
Group 1
0.141
Negative
5 (17.8)
11 (39.2)
12 (43.0)
28 (100.0)
Positive
3 (15.0)
7 (35.0)
10 (50.0)
20 (100.0)
Group 2
0.152
Negative
3 (15.8)
6 (31.6)
10 (52.6)
19 (100.0)
Positive
5 (14.7)
13 (38.2)
16 (47.1)
34 (100.0)
Group 3
0.136
Negative
4 (12.5)
18 (56.2)
10 (31.3)
32 (100.0)
Positive
7 (11.7)
34 (56.7)
19 (31.6)
60 (100.0)
Group 4
Negative
1 (5.2)
9 (47.4)
9 (47.4)
19 (100.0)
Positive
7 (11.1)
27 (42.9)
29 (46.0)
63 (100.0)
Negative
4 (14.3)
11 (39.3)
13 (46.4)
28 (100.0)
Positive
4 (20.0)
7 (35.0)
9 (45.0)
20 (100.0)
Negative
2 (11.1)
6 (33.3)
10 (55.6)
18 (100.0)
Positive
6 (17.1)
13 (37.1)
16 (45.8)
35 (100.0)
Negative
4 (9.1)
28 (63.6)
12 (27.3)
44 (100.0)
Positive
7 (14.0)
25 (50.0)
18 (36.0)
50 (100.0)
Negative
2 (6.0)
16 (48.5)
15 (45.5)
33 (100.0)
Positive
6 (12.2)
20 (40.9)
23 (46.9)
49 (100.0)
0.147
Progesterone
Group 1
0.147
Group 2
0.122
Group 3
0.124
Group 4
0.130
Her-2
Group 1
0.173
Negative
8 (19.0)
15 (35.7)
19 (45.3)
42 (100.0)
Positive
0 (0.0)
3 (75.0)
1 (25.0)
4 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
1 (100.0)
1 (100.0)
Negative
7 (18.9)
13 (35.1)
17 (46.0)
37 (100.0)
Positive
0 (0.0)
5 (35.7)
9 (64.3)
14 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
Negative
6 (10.1)
33 (55.9)
20 (34.0)
59 (100.0)
Positive
5 (16.6)
17 (56.7)
8 (26.7)
30 (100.0)
Inconclusive
0 (0.0)
1 (50.0)
1 (50.0)
2 (100.0)
Group 2
0.046
Group 3
0.107
Group 4
0.147
Negative
6 (9.5)
29 (46.0)
28 (44.5)
63 (100.0)
Positive
2 (10.5)
7 (36.9)
10 (52.6)
19 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
*Chi-square/ Fisher’s exact
Note: Values in bold indicate statistical significance (p<0.05).
169
Table 10: Correlation between the genotype frequency of polymorphism rs3817198 in gene
LSP1 and the hormone receptors (per group).
Hormone Receptors
TT
N (%)
TC
N (%)
CC
N (%)
P value*
Estrogen
Group 1
0.109
Negative
13 (46.4)
12 (42.9)
3 (10.7)
28 (100.0)
Positive
11 (55.0)
9 (45.0)
0 (0.0)
20 (100.0)
Negative
10 (52.6)
8 (42.1)
1 (5.3)
19 (100.0)
Positive
18 (53.0)
15 (44.1)
1 (2.9)
34 (100.0)
Negative
19 (61.3)
11 (35.5)
1 (3.2)
31 (100.0)
Positive
22 (36.6)
30 (50.0)
8 (13.4)
60 (100.0)
Group 2
0.193
Group 3
0.007
Group 4
0.162
Negative
9 (47.3)
9 (47.3)
1 (5.4)
19 (100.0)
Positive
29 (46.0)
29 (46.0)
5 (8.0)
63 (100.0)
Negative
14 (50.0)
12 (42.8)
2 (7.2)
28 (100.0)
Positive
10 (50.0)
9 (45.0)
1 (5.0)
20 (100.0)
Progesterone
Group 1
0.186
Group 2
0.171
Negative
10 (55.5)
8 (44.5)
0 (0.0)
18 (100.0)
Positive
18 (51.4)
15 (42.8)
2 (5.8)
35 (100.0)
Negative
25 (58.1)
14 (32.6)
4 (9.3)
43 (100.0)
Positive
13 (28.2)
28 (60.9)
5 (10.9)
46 (100.0)
Negative
12 (36.3)
16 (48.5)
5 (15.2)
33 (100.0)
Positive
26 (53.1)
22 (44.9)
1 (2.0)
49 (100.0)
Negative
22 (52.4)
18 (42.9)
2 (4.7)
42 (100.0)
Positive
1 (25.0)
2 (50.0)
1 (25.0)
4 (100.0)
Inconclusive
0 (0.0)
1 (100)
0 (0.0)
1 (100.0)
Negative
20 (54.0)
15 (40.6)
2 (5.4)
37 (100.0)
Positive
6 (42.9)
8 (57.1)
0 (0.0)
14 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
Group 3
0.024
Group 4
0.015
Her-2
Group 1
0.075
Group 2
0.201
Group 3
0.119
Negative
26 (44.1)
26 (44.1)
7 (11.8)
59 (100.0)
Positive
14 (48.3)
13 (44.8)
2 (6.9)
29 (100.0)
0 (0.0)
2 (100.0)
0 (0.0)
2 (100.0)
Negative
30 (47.6)
30 (47.6)
3 (4.8)
63 (100.0)
Positive
8 (42.1)
8 (42.1)
3 (15.8)
19 (100.0)
Inconclusive
0 (0.0)
0 (0.0)
0 (0.0)
0 (0.0)
Inconclusive
Group 4
0.098
170
Anexo 6
171

Documentos relacionados

boadiceas pessoas

boadiceas pessoas em genes conhecidos de moderada penetrância como, por exemplo: PTEN, ATM, PALB2 (cerca de 1%) e alterações em genes descritas em Estudos Associação

Leia mais