Sérgio_Aparecido_do_Amaral_Jr

Сomentários

Transcrição

Sérgio_Aparecido_do_Amaral_Jr
V Congresso de Iniciação
Científica do IAMSPE
São Paulo
17/11/2011
Estudo genético da síndrome de BirtHogg-Dubé (variante HornsteinKnickenberg)
Bolsista: Sergio Aparecido do Amaral Junior
(Faculdade de Medicina do ABC)
Orientador: Jaques Waisberg
INTRODUÇÃO

A síndrome de Birt-Hogg-Dubé é uma doença
autossômica dominante que envolve pele e pulmões,
com risco aumentado para tumores de pele, rim e,
possivelmente, cólon, tireóide e parótida

Os indivíduos portadores possuem maior incidência de
cistos pulmonares e pneumotórax espontâneo

Os tumores renais são tipicamente bilaterais e
multifocais, com crescimento lento, geralmente
oncocitomas
INTRODUÇÃO

Síndrome de Birt-Hogg-Dubé x S. Hornstein-Knickenberg
SHBD
SHK
Lesões pele
Fibrofoliculoma
Tricodiscoma
Fibroma perifolicular
Acometimento
pulmonar
Cistos e
pneumotórax
espontâneo
Cistos e pneumotórax espontâneo
Acometimento
renal
Neoplasias
Neoplasias
Acometimento
colônico
Ausente
Neoplasias (pólipos hiperplásicos
e neoplasias malignas)
INTRODUÇÃO

Esta síndrome decorre de mutações (seis tipos de mutações identificadas)
no gene foliculina (FLCN) localizado no cromossomo 17p11

Mutações no gene FLCN podem interferir com a capacidade da foliculina
para conter o crescimento e divisão celular

Modificações no sistema de reparo do DNA, presente nesta síndrome
através da expressão na imuno-histoquímica do anti-hMSH2 contribuem
para a formação dos tumores

Pode ocorrer deleção (c.1285delC) ou duplicação (c.1285dupC) de um
nucleotídeo C no trato da policitosina no exon 11
RELATO DO CASO

Homem, 60 anos, com dor abdominal, alteração do hábito intestinal e lesões de
pele na face e na área cervical

Antecedentes: retirada de angioma de corda vocal, tireoidectomia total (sic),
parotidectomia esquerda (oncocitoma e sialodenite crônica)

Exames realizados

Biópsias das lesões da pele: proliferação fibrosa dérmica (tricodiscoma?);
fibroepitelioma; carcinoma basocelular

Colonoscopia: pólipos sésseis e pediculados ao longo de toda a mucosa
colônica; AP: pólipos hiperplásicos
RELATO DO CASO

Exames realizados
 Endoscopia digestiva alta: grande quantidade de
pólipos sésseis e pediculados no estômago e na1ª
porção do duodeno. AP: pólipos hiperplásicos
 Enteroscopia: pólipos sésseis, subpediculados e
pediculados nas porções distais do duodeno e no
jejuno proximal. AP: pólipos hiperplásicos
 Ultrassonografia abdominal: colecistolitíase, cisto
renal esquerdo, calcificação renal esquerda e
formação sólida retroperitoneal à direita
RELATO DO CASO

Ressonância magnética de abdome: múltiplas lesões expansivas sólidas,
localizadas em topografia de rins bilateralmente, a maior localizada no rim
direito e medindo cerca de 100mm
OBJETIVOS

Relatar o caso de paciente de 60 anos com quadro clínico
fortemente sugestivo da síndrome de Birt-Hogg-Dubé

Investigar a existência de mutações no éxon 11 do gene FLCN
(mutação mais frequente)

Analisar a expressão da proteína MSH2 do sistema de reparo do
DNA
MÉTODO

Pesquisa genética realizada no Laboratório de Biologia Molecular da
FMABC

DNA genômico extraído de sangue periférico, com o uso do kit Illustra
Blood GenomicPrep Mini Spin (GE Healthcare, Alemanha)

Quantificação do DNA: aparelho Qubit (Invitrogen®) com kit QuantiTTM dsDNA HS Assay (Invitrogen, Oregon, USA)

Amplificação do éxon 11 do gene da foliculina por PCR semiquantitativo

Amplificação do éxon 11 do gene da foliculina (FLCN):
Oligonucleotídeo iniciadores: sequência 5’  3’
FLCN éxon 11 sense
ACAAGCTGGTGTGTGACTGG
FLCN éxon 11 antisense TCCACAACCCATGACAGAGA
MÉTODO

Purificação e sequenciamento do produto de PCR com o kit QIAquick Gel
Extraction (Qiagen, Valencia, CA)

Imuno-histoquímica
Blocos de parafina: biópsias de estômago, intestino delgado e cólon
Anticorpo primário anti-hMSH2 N-20 (Santa Cruz Biotechnology, Santa Cruz,
CA, USA)
RESULTADOS

Amplificação do éxon
11 do gene FLCN
presente no DNA
genômico (Amostra P)
RESULTADOS

Sequenciamento do éxon 11 do gene FLCN no DNA e comparação
com a sequência não mutada obtida no GenBank
RESULTADOS
Imuno-histoquímica
CONCLUSÕES

Na investigação genética não foram encontradas mutações no éxon
11 do gene FLCN

Estudos serão realizados para avaliar a ocorrência de mutações
nos demais éxons do gene FLCN

A presença protéica da MSH2 nos tumores biopsiados pode sugerir
a relação entre o sistema de reparo do DNA e a síndrome de BirtHogg-Dubé

Documentos relacionados